USE OF PHOSPHORYLATION PATHWAY-RELATED FACTOR IN REGULATING FUNCTION OF REGULATORY T CELL

Abstract

A method for the treatment and/or the prevention of a disease or a symptom related to dysfunction of regulatory T cell immunomodulation includes administering to a subject in need thereof compositions that regulate regulatory T cell immunomodulatory function, in which the compositions may be prepared by contacting starting materials with phosphorylation pathway-related factors, the agonists or the antagonists thereof. The phosphorylation pathway-related factors are selected from: proto-oncogene protein PIM1 and the coding sequence thereof. The regulation is achieved by regulating the activity of regulators of regulatory T cells selected from the group: FOXP3, IL-2, GITR, CTLA4, and a combination thereof.

Claims

1. A method for the treatment and/or the prevention of a disease or a symptom related to dysfunction of regulatory T cells immunomodulation comprises: administering to a subject in need thereof a phosphorylation pathway-related factor, an agonist or an antagonist thereof or a composition comprising regulatory T cell prepared by contacting a starting material comprising a CD4+ T cell with the phosphorylation pathway-related factor, an agonist or an antagonist thereof, and wherein the phosphorylation pathway-related factor is selected from: proto-oncogene protein PIM1 and the coding sequence thereof.

2. The method of claim 1, wherein the phosphorylation pathway-related factor, the agonist or the antagonist thereof regulates activity of a regulator of the regulatory T cell, wherein the regulator is selected from the group: FOXP3 (forkhead box P3), IL-2 (interleukin 2), GITR (glucocorticoid-induced TNFR-related protein), CTLA4 (cytotoxic T-lymphocyte-associated protein 4), and a combination thereof.

3. The method of claim 2, wherein the phosphorylation pathway-related factor or the agonist thereof negatively regulates the activity of FOXP3, GITR or CTLA4 and positively regulates IL-2 activity, and the antagonist of the phosphorylation pathway-related factor positively regulates the activity FOXP3, GITR, or CTLA4 activity and negatively regulates IL-2 activity.

4. The method of claim 1, wherein the agonist is selected from: a signal factor and the coding sequence thereof that induces PIM1 expression; and the antagonist is selected from: an anti-PIM1 antibody, shPIM1, an antisense oligonucleotide targeting PIM1, and a chemical inhibitor of PIM1.

5. The method of claim 4, wherein the agonist is selected from: IL-4 (interleukin 4), IL-6 (interleukin 6), TCR (T-cell receptor), and the coding sequence thereof.

6. The method of claim 1, wherein the disease or the symptom related to dysfunction of regulatory T cell immunomodulation is a disease or a symptom related to the regulatory T cell having an abnormal immunosuppressive function.

7. A method for the preparation of a composition comprising a regulatory T cell, wherein the method comprises: (a) providing a starting material comprising CD4+ T cells; (b) contacting the starting material with a phosphorylation pathway-related factor, an agonist or an antagonist thereof to obtain the resulting regulatory T cell, or with a composition comprising a regulatory T cell prepared by contacting CD4+ T cells with a phosphorylation pathway-related factor, an agonist or an antagonist thereof, wherein the phosphorylation pathway-related factor is selected from: proto-oncogene protein PIM1 and the coding sequence thereof.

8. The method of claim 7, wherein the method further comprises one or more steps selected from the group consisting of: step (a) before step (b), purifying or isolating the CD4+ T cells; and step (c) after step (b), purifying or isolating the resulting regulatory T cells.

9. A method of regulating regulatory T cells activity, wherein the method comprises: contacting a sample or an object comprising a CD4+ T cell with a phosphorylation pathway-related factor, an agonist or an antagonist thereof, or with a regulatory T cell formed by contacting a CD4+ T cell with the phosphorylation pathway-related factor, the agonist or the antagonist thereof; wherein the phosphorylation pathway-related factor is selected from: proto-oncogene protein PIM1 and the coding sequence thereof.

10. A method of selecting a substance that regulates regulatory T cell activity, wherein the method comprises: detecting FOXP3 protein stability or PIM1 activity, wherein the substance that regulates the regulatory T cell activity is selected by detecting FOXP3 phosphorylation induced by PIM1 or the FOXP3 protein stability.

11. A method of regulating regulatory T cells activity, wherein the method comprising: contacting a sample or an object comprising a CD4+ T cell with a phosphorylation pathway-related factor, an agonist or an antagonist thereof, or with a regulatory T cell formed by: (a) providing a starting material comprising CD4+ T cells; (b) purifying or isolating the CD4+ T cells; (c) contacting the CD4+ T cells with the phosphorylation pathway-related factor, the agonist or the antagonist thereof to obtain the resulting regulatory T cells; and (d) purifying or isolating the resulting regulatory T cells; wherein the phosphorylation pathway-related factor is selected from: proto-oncogene protein PIM1 and the coding sequence thereof.

12. The method of claim 1, wherein the chemical inhibitor of PIM1 is selected from 4-[3-(4-chlorophenyl)-2,1-benzisoxazol-5-yl]-2-pyrimidinamine, 3-cyano-4-phenyl-6-(3-bromo-6-hydroxy)phenyl-2(1H)-pyridinone, 2-hydroxy-3-cyano-4-phenyl-6-(3-bromo-6-hydroxyphenyl)pyridine, and a racemic mixture of a pyridocarbazole-cyclopentadienyl Ruthenium complex.

13. The method of claim 1, wherein the CD4+ T cell is a CD4+ CD45RA+ natural T cell.

14. A reagent or a kit for the preparation of a composition comprising regulatory T cell or a composition for the regulation of regulatory T cell activity, comprising: (a) one or more phosphorylation pathway-related factors selected from the group: proto-oncogene protein PIM1 and the coding sequence thereof; an agonist and an antagonist of the phosphorylation pathway-related factors; and (b) a pharmaceutically, immunologically, or healthcare science acceptable carrier.

15. The reagent or the kit of claim 14, wherein the regulation is achieved by regulating the activity of a regulatory factor of the regulatory T cell, wherein the regulator is selected from the group: FOXP3, IL-2, GITR, CTLA4, and a combination thereof.

16. The reagent or the kit of claim 14, wherein the antagonist is a chemical inhibitor of PIM1 is selected from 4-[3-(4-chlorophenyl)-2,1-benzisoxazol-5-yl]-2-pyrimidinamine, 3-cyano-4-phenyl-6-(3-bromo-6-hydroxy)phenyl-2(1H)-pyridinone, 2-hydroxy-3-cyano-4-phenyl-6-(3-bromo-6-hydroxyphenyl)pyridine, and a racemic mixture of a pyridocarbazole-cyclopentadienyl Ruthenium complex.

17. The method of claim 7, wherein the antagonist is a chemical inhibitor of PIM1 is selected from 4-[3-(4-chlorophenyl)-2,1-benzisoxazol-5-yl]-2-pyrimidinamine, 3-cyano-4-phenyl-6-(3-bromo-6-hydroxy)phenyl-2(1H)-pyridinone, 2-hydroxy-3-cyano-4-phenyl-6-(3-bromo-6-hydroxyphenyl)pyridine, and a racemic mixture of a pyridocarbazole-cyclopentadienyl Ruthenium complex.

18. The method of claim 9, wherein the antagonist is a chemical inhibitor of PIM1 is selected from 4-[3-(4-chlorophenyl)-2,1-benzisoxazol-5-yl]-2-pyrimidinamine, 3-cyano-4-phenyl-6-(3-bromo-6-hydroxy)phenyl-2(1H)-pyridinone, 2-hydroxy-3-cyano-4-phenyl-6-(3-bromo-6-hydroxyphenyl)pyridine, and a racemic mixture of a pyridocarbazole-cyclopentadienyl Ruthenium complex.

19. The method of claim 10, wherein the antagonist is a chemical inhibitor of PIM1 is selected from 4-[3-(4-chlorophenyl)-2,1-benzisoxazol-5-yl]-2-pyrimidinamine, 3-cyano-4-phenyl-6-(3-bromo-6-hydroxy)phenyl-2(1H)-pyridinone, 2-hydroxy-3-cyano-4-phenyl-6-(3-bromo-6-hydroxyphenyl)pyridine, and a racemic mixture of a pyridocarbazole-cyclopentadienyl Ruthenium complex.

20. The method of claim 11, wherein the antagonist is a chemical inhibitor of PIM1 is selected from 4-[3-(4-chlorophenyl)-2,1-benzisoxazol-5-yl]-2-pyrimidinamine, 3-cyano-4-phenyl-6-(3-bromo-6-hydroxy)phenyl-2(1H)-pyridinone, 2-hydroxy-3-cyano-4-phenyl-6-(3-bromo-6-hydroxyphenyl)pyridine, and a racemic mixture of a pyridocarbazole-cyclopentadienyl Ruthenium complex.

Description

BRIEF DESCRIPTION OF DRAWINGS

[0089] FIGS. 1A-1C show that FOXP3 binds to PIM1 and is phosphorylated by PIM1.

[0090] FIG. 1A shows immunoblot detection using corresponding antibodies following co-immunoprecipitation by FLAG antibody in HEK 293T cells co-transfected with HA-FOXP3 and FLAG-PIM1, collected after 48 h, and lysed in RIPA lysis buffer.

[0091] FIG. 1B shows immunoblot analysis using Ser422 phosphorylation-specific antibodies and other corresponding antibodies following immunoprecipitation by HA antibody in HEK 293T cells co-transfected with HA-FOXP3 or its Ser422A mutant and FLAG-PIM1 or its enzymatic activity-deficient mutant K67M (respectively: HA-S422A FOXP3; FLAG-K67M PIM1+HA-S422A FOXP3; HA-S422A FOXP3+FLAG-PIM1; HA-FOXP3; HA-FOXP3+FLAG-K67M PIM1; HA-FOXP3+FLAG-PIM1), collected and lysed after 48 h.

[0092] FIG. 1C shows FPLC-purified MBP-FOXP3 and His-PIM1 and its K67M mutant, which were expressed by prokaryotic cells, after in vitro reaction in the presence of ATP, were analyzed by immunoblot. Total proteins in the reaction system were subjected to SDS-PAGE, and then shown under ultraviolet light after Lumitein protein gel staining.

[0093] FIG. 2 shows inflammatory cytokines IL-6 and IL-4 can induce PIM1 expression in SZ4.03 lymphocyte line that highly expresses FOXP3.

[0094] SZ4.03 cells were treated with IL-6 (20 ng/ml) or IL-4 (30 ng/ml), respectively. After 0 h, 1 h, 2 h, and 4 h, cells were collected and lysed by boiling directly in SDS-Loading Buffer. Samples were then analyzed by immunoblot.

[0095] FIG. 3 shows PIM1 inhibits FOXP3 binding to chromatin.

[0096] HA-FOXP3 and FLAG-PIM1 were co-transfected into HEK 293T cells. After 48 h, cells were collected and cytoplasm (Cy), nucleus (Nu), and chromatin (Chr) were isolated. The isolated samples were analyzed by immunoblot. The data represent two independent test results.

[0097] FIGS. 4A-4E show PIM1 negatively regulates the transcription regulatory activity of FOXP3 transcription factor.

[0098] FIG. 4A shows SZ4.03 cell line that highly expresses FOXP3 was infected with lentivirus packaged with a negative control shRNA (shCK) and PIM1 shRNA (shPIM1), selected by puromycin (50 ng/ml), and treated by DMSO or PMA/Inomycin to activate T cell activity. After 4 h, total RNA was extracted and converted to cDNA. PIM1 mRNA expression levels were then analyzed by quantitative PCR.

[0099] FIGS. 4B-C show FOXP3 positively regulates the mRNA expression levels of target genes (GITR and CTLA4).

[0100] FIG. 4D shows FOXP3 negatively regulates the mRNA expression levels of target gene (IL-2).

[0101] FIG. 4E shows the mRNA expression levels of non-FOXP3 target gene (STUB1).

[0102] FIGS. 5A-5B show PIM1 inhibitors significantly increase cell levels of CLTA4+ FOXP3+ Treg and CD25+ FOXP3+ Treg.

[0103] FIG. 5A shows human CD4+ CD25+ CD127.sup.low natural Treg (nTreg) after sorted by BD FACS Aria II flow sorter and expanded through Bead-CD3/CD28 and IL-2 (500 U/ml). After removal of Beads, DMSO or PIM1 inhibitor (100 nM) was added and treated for 24 h, followed by APC-FOXP3 and PE-CD25 antibody staining for flow cytometry analysis.

[0104] FIG. 5B shows the expanded nTreg after Beads removal and rested for 24 h, DMSO or PIM1 inhibitor (100 nM) was then added and treated for 48 h, followed by APC-FOXP3 and PE-CD25 antibody staining for flow cytometry analysis.

[0105] FIG. 6 shows PIM1 inhibitors can enhance immunosuppressive activity of nTreg.

[0106] The expanded nTreg were mixed with human CFSE-labeled PBMC (210.sup.5 cells/well) in U-shaped wells of 96-well plate at corresponding proportion. 5000 T cell dynabeads conjugated with CD3/CD28 antibody were added. Cell proliferation levels were detected after two groups of cells treated with DMSO and PIM1 inhibitors, respectively, were incubated for five days.

[0107] FIG. 7 shows PIM1 inhibitors promote FOXP3+ and CTLA4+ nTreg cell expansion.

[0108] 500 U/ml of IL-2 was added to 210.sup.5 nTreg cells. nTreg cells were expanded using CD3/CD28 T cell dynabeads and cells at 3:1 ratio. After two weeks, part of expanded nTreg cells were collected for FACS detection. Dynabeads were removed from the remaining cells. After 48 h of rest, FOXP3 and CTLA4 cells were collected again by flow cytometry. The working concentrations of Rapamycin and PIM1 inhibitors are both 100 nM.

[0109] FIG. 8 shows PIM1 protein expression knockout can enhance FOXP3 transcription regulatory activity.

[0110] Primary nTreg cells were activated with 500 U/ml of IL-2 and CD3/CD28 T cell dynabeads and cells at 3:1 ratio for 4 h, and, respectively, infected with lentivirus encoding PIM1, PIM2, and PIM3 shRNA overnight. Continued incubation for one week, the mRNA levels of FOXP3 and its target gene CTLA4 were detected by quantitative PCR.

[0111] FIGS. 9A-9B show kaempferol inhibits FOXP3 S422 phosphorylation in a dose-dependent manner.

[0112] FIG. 9A shows the protein levels of pS422-FOXP3, FOXP3, and a-tubulin in cell lysates detected directly by immunoblot. Myc-FOXP3 and FLAG-PIM1 were co-transfected into HEK293T cells. After 36 h, cells were treated, respectively, with 50 nM, 10 nM, 2 nM, 0.4 nM of PIM1 inhibitor and 50 M, 10 M, 2 M, 0.4 M, 0.08 M of kaempferol for 12 h. Cells were collected at 48 h after cell transfection.

[0113] FIG. 9B shows the effect of small molecule inhibitor on FOXP3 S422 phosphorylation using ImageJ software analyzing FIG. 9A.

[0114] FIGS. 10A-10B show kaempferol can specifically inhibit FOXP3 S422 phosphorylation induced by PIM1.

[0115] FIG. 10A shows the protein levels of pS422-FOXP3, FOXP3, and -tubulin in cell lysates detected directly by immunoblot. Myc-FOXP3, FLAG-PIM1, FLAG-PIM2, and FLAG-PIM3 were co-transfected into HEK293T cells. 36 h later, cells were treated with 50 M of kaempferol for 12 h. Cells were collected 48 h after cell transfection.

[0116] FIG. 10B shows small molecule inhibitor can specifically inhibit FOXP3 S422 phosphorylation induced by PIM1 using ImageJ software analyzing FIG. 10A.

[0117] FIG. 11 shows kaempferol can inhibit histone H3 S10 phosphorylation induced by PIM1.

[0118] FLAG-PIM1 was transfected into HEK293T cells. 36 h later, cells were treated with 50 M of kaempferol for 12 h. 48 h after cell transfection, cells were treated in whole cell lysis solution. The levels of phosphorylated (Phospho)-histone H3S10, histone H3, and PIM1 were detected directly by immunoblot.

[0119] FIG. 12 shows kaempferol only inhibits FOXP3 S422 phosphorylation and histone H3 S10 phosphorylation induced by PIM1.

[0120] FLAG-PIM1 was transfected and MYC-FOXP3 and FLAG-PIM1 co-transfected into HEK293T cells. After 36 h, HEK293 was used as blank control group and each group was treated with 50 M of kaempferol for 12 h. After 48 h, cells collected and lysed by cell lysis buffer. The levels of pS422-FOXP3, FOXP3, phosphorylated-histone H3 (Ser10), histone H3, and GAPDH were detected directly by immunoblot.

[0121] FIG. 13 shows kaempferol can inhibit FOXP3 protein degradation induced by PMA/LPS.

[0122] HA-FOXP3-Jurkat stable expression cells were treated with PMA (25 ng/ml) and LPS (1 ng/ml). 50 M kaempferol, 100 nM PIM1 inhibitors (specifically of 4-[3-(4-chlorophenyl)-2,1-benzisoxazol-5-yl]-2-pyrimidinamine), and 10 g/ml PI3K inhibitor (LY294002) were added, and DMSO as a control. Cells were collected 24 h later. The levels of FOXP3 and GAPDH were detected directly by immunoblot.

[0123] FIG. 14A shows kaempferol enhances the expression of CTLA4, and FIG. 14B shows kaemptferol enhances the expression of FOXP3 in the induced Treg.

[0124] Human CD4+ CD45RA+ natural T cells (i.e., natural T cells rather than Treg cells) were sorted by BD FACS Aria II flow sorter and expanded by Bead-CD3/CD28 (2:1), IL-2 (100 U/ml), and TGF- (1 ng/ml, 3 ng/ml, and 5 ng/ml) for 5 days. DMSO or kaempferol (50 uM) was added and treated for 48 h. Flow cytometry analysis was performed after PE-FOXP3 (FIG. 14B) and APC-CTLA4 (FIG. 14A) antibody staining.

DETAILED DESCRIPTION

[0125] The inventors believe that FOXP3 can be regulated in a series of time and space, including post-transcriptional modification, translation or modification, and protein-protein interactions, etc. Among them, a class of factors (including enzymes, small molecule compounds, etc.) serve as FOXP3 negative regulators capable of down-regulating FOXP3 activity under different signaling stimuli, thereby regulating the entire immune system. Through long-term and in-depth studies, the inventors found that phosphorylation pathway-related factors can affect FOXP3 binding to chromatin, thereby regulating FOXP3 transcription regulatory activity on its target genes. These phosphorylation pathway-related factors are FOXP3 negative regulatorsincluding PIM1 protein and its inflammation inducing signals. Thus, also in the present application, the inventors further provide use of proto-oncogene protein PIM1 and/or the coding sequence thereof, the agonists or the antagonists thereof in the preparation of compositions containing regulatory T cells or compositions that regulate regulatory T cell activity, methods of preparing compositions containing regulatory T cells; methods of regulating regulatory T cell activity; and a reagent or a kit used in the preparation of compositions containing regulatory T cells or compositions that regulate regulatory T cell activity.

[0126] Specifically, the inventors, in study prior to the present invention, have constructed cell lines stably expressing FOXP3 and have purified FOXP3 protein under different signaling stimuli. The purified proteins were analyzed by mass spectrometry, thereby identifying multiple Ser/Thr/Tyr phosphorylation sites in FOXP3 protein sequences. In the present study, the inventors performed a large number of screening tests and found FOXP3-S422 is a potential phosphorylation site for PIM1. Further experiments proved that PIM1 protein can interact with FOXP3 and specifically phosphorylates FOXP3 Ser422 In vivo and in vitro. Moreover, further studies found, under inflammatory cytokine stimulation, such as the stimulation of IL-6, IL-4, etc., the in vitro expanded natural regulatory T cells (nTreg) can rapidly up-regulate PIM1 protein expression levels. Thus, it is possible that PIM1 plays an important regulatory role in nTreg activity.

[0127] Recently, studies found that PIM1 plays an important role in the transformation of normal cells to become cancerous cells promoted by collaborative proto-oncogene encoded MYC protein. PIM1 interacts with MYC protein and is recruited to the target genes of MYC transcription factor and phosphorylates Ser10 of histone H3, thereby activating the transcription of target genes. We found the phosphorylation site in FOXP3 sequence by PIM1 is located within Forkhead domain, which is an important domain that determines its interaction with DNA or chromatin. Thus, we believe it is possible that PIM1 affects FOXP3 binding to genomic DNA, thereby regulating nTreg physiological activity. Experimental results are consistent with such predications. PIM1 overexpression significantly inhibits FOXP3 binding to chromatin. PIM1 knockout in FOXP3+ Treg significantly enhances transcriptional regulatory activity of FOXP3 on its target genes: including promoting the transcription of FOXP3-positively regulated genes (CTLA4, GITR, CD25, etc.) and inhibiting the transcription of FOXP3-negatively regulated gene (IL-2). Using PIM1 kinase-specific inhibitors to treat the expanded nTreg cells in vitro can significantly increase the levels of CD25+ FOXP3+ Treg and CTLA4+FOXP3+ Treg. Also, in vitro inhibition tests showed PIM1 inhibitors can significantly enhance the immunosuppressive activity of nTreg. Thus, we are confident that PIM1 regulates FOXP3 transcription regulatory activity and inhibits immunosuppressive activity of nTreg by modifying FOXP3 phosphorylation.

[0128] Previous studies found that increasing FOXP3 expression levels alone cannot enhance immunosuppressive activity of nTreg, suggesting that the exertion of FOXP3 transcription regulatory activity requires the regulation of other signals. Our research findings provide a possible pathway for this. It is possible to significantly increase immunosuppressive activity of FOXP3+ Treg by up-regulating FOXP3 expression levels and, simultaneously, inhibiting PIM1 expression levels or its activity.

[0129] Based on the above, the inventors in the present invention, revealed, for the first time, the effects of FOXP3 phosphorylation pathway-related factorPIM1 kinase and inflammatory cytokines, its expression inducers, on the regulatory mechanisms of FOXP3+ Treg immune activity and the regulation of regulatory T cell activity. Identification and application of these regulators provide new ways for the treatment and/or the prevention of diseases or symptoms (e.g., cancer, autoimmune diseases, etc.) related to dysregulation of FOXP3+ Treg activity by regulating immunosuppressive activity of FOXP3+ Treg cells; and for the preparation of regulatory T cells or regulating its activity, and drug selection. Meanwhile, it also provides use of these regulators as vaccine adjuvant and new methods for improving immunogenicity of viral infection.

[0130] On this basis, the inventors have completed the present invention.

[0131] Phosphorylation Pathway-Related Factors, the Agonists or the Antagonists Thereof

[0132] As used herein, the term regulators or activity regulators refers to phosphorylation pathway-related factors or the agonists or the antagonists thereof. They can affect FOXP3 binding to chromatin through FOXP3 phosphorylation, thereby regulating FOXP3 transcription regulatory activity on its target genes, regulating immunosuppressive activity of Treg. Thus, they can be used for the treatment and/or the prevention of diseases or symptoms related to dysregulation of FOXP3+ Treg cell activity (e.g., cancer, autoimmune disease), or used as vaccine adjuvant to increase immunogenicity of viral infection.

[0133] As used herein, the term phosphorylation pathway-related factors refers to activity factors that affect the activity of its downstream factors or processes (such as FOXP3 transcription regulatory activity on its target genes, regulatory activity of regulatory T cells on immune function) through affecting phosphorylation pathways. In the present invention, phosphorylation pathway-related factors include: PIM1 protein and/or coding sequence thereof.

[0134] As used herein, PIM1 protein refers to PIM1 proto-oncogene protein, which is a constitutively active Ser/Thr kinase. It was first discovered in lymphoma as a cooperative oncogene with MYC proto-oncogene. PIM1 sequences known in the art include, but not limited to: Entrez Gene: 5292.

[0135] As used herein, agonists of phosphorylation pathway-related factors refer to substances that can promote the expression of phosphorylation pathway-related factors or enhance the activity of phosphorylation pathway-related factors. In the present invention, they may also refer to as agonists, e.g. PIM1 agonists. PIM1 agonists used in the present invention include, but are not limited to: inflammatory cytokines IL-6, IL-4; TCR and/or the coding sequences thereof. Broadly speaking, PIM1 agonists also include substances transferred to body, tissues or cells to enhance PIM1 levels or activity, such as PIM1 transgene and/or its carriers.

[0136] As used herein, antagonists of phosphorylation pathway-related factors refer to substances that can inhibit the expression of phosphorylation pathway-related factors or reduce the activity of phosphorylation pathway-related factors. In the present invention, they may also refer to as inhibitors. Antagonists useful in the present invention include, but are not limited to. the following PIM1 antagonists: anti-PIM1 antibodies. shPIM1, antisense oligonucleotides targeting PIM1, chemical inhibitors of PIM1, for example, see References 8-14, such as: PIM1 inhibitors: 4-[3-(4-Chlorophenyl)-2,1-benzisoxazol-5-yl]-2-pyrimidinamine; 3-Cyano-4-phenyl-6-(3-bromo-6-hydroxy)phenyl-2(H)-pyridinone, 2-Hydroxy-3-cyano-4-phenyl-6-(3-bromo-6-hydroxyphenyl) pyridine; a racemic mixture of a pyridocarbazolo-cyclopentadienyl Ruthenium complex; or other PIM1 inhibitors, e.g., kaempferol, selected according to the methods of the present invention or selected by using methods known in the art. One skilled in the art can employ methods known in the art to prepare anti-PIM1 antibodies, shPIM1, antisense oligonucleotides targeting PIM1, or to identify chemical inhibitors of PIM1.

[0137] The proteins or polypeptides of the present invention can be purified natural products, or chemically synthesized products, or produced from prokaryotic or eukaryotic hosts (e.g., bacterial, yeast, higher plant, insect, and mammalian cells) using recombination techniques.

[0138] It should be understood that the above definitions of the terms in the present invention also include conservative polypeptide variants or their homologous polypeptides of the proteins and polypeptides. In one embodiment of the present invention, the proteins or polypeptides are derived from human or other eukaryotes, such as mouse, rat, cow, or monkey, and they are highly conserved among them.

[0139] Protein or polypeptide variants of the present invention include (but are not limited to): one or more (usually 1-50, preferably 1-30, more preferably 1-20, most preferably 1-10, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) amino acid deletions, insertions, and/or substitutions, and one or several (usually 20 or less, preferably 10 or less, more preferably 5 or less) amino acid additions at the C-terminus and/or the N-terminus. For example, in the art, when substituting with functionally close or similar amino acids, the functions of proteins or polypeptides usually do not change. As another example, one or several amino acid additions at the C-terminus and/or the N-terminus usually also do not change the functions of proteins or polypeptides. One skilled in the art can easily determine these variations, which do not affect the activity of proteins or polypeptides, based on common knowledge in the art and/or routine experimentation.

[0140] As used herein, the term coding sequences refers to sequences encoded by PIM1 proto-oncogene of the present invention, or highly homologous sequences thereof, or molecules that hybridize with the sequences under stringent conditions, or gene family molecules having high homology.

[0141] As used herein, the term stringent conditions refers to: (1) hybridization and washing at relatively low ionic strength and relatively high temperatures, such as 0.2SSC, 0.1% SDS, 60 C.; or (2) hybridization with denaturants, such as 50% (v/v) formamide, 0.1% calf serum/0.1% Ficoll, 42 C., etc.; or (3) hybridization occurs only when the identity between two sequences is at least 50%, preferably 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, or 90% or more, more preferably 95% or more.

[0142] Full-length coding sequences or fragments thereof of the present invention can be obtained generally by PCR amplification, recombination, or synthesis methods. For PCR amplification, primers can be designed based on the related nucleotide sequences disclosed in the present invention, especially open reading frame sequences. Commercially available cDNA libraries or cDNA libraries prepared according to conventional methods known by one skilled in the art can be used as template to amplify and obtain relevant sequences. If sequences are relatively long, two or more PCR amplifications are often necessary, and then splice together the amplified fragments in correct order.

[0143] Compositions and Treatment or Prevention of Diseases

[0144] Regulators of the present invention can be used in the preparation of therapeutic or prophylactic pharmaceutical compositions, healthcare compositions or vaccine compositions, or adjuvant compositions.

[0145] Accordingly, in another aspect, the present invention also provides a composition, which includes (a) safe and effective amount of regulators of the present invention; and (b) pharmaceutically acceptable carriers or excipients. Amount of regulators of the present invention is usually 10 g-100 mg/dose, preferably 100-1000 g/dose.

[0146] As used herein, the term effective amount refers to amount of therapeutic agent for treating, ameliorating, or preventing target diseases or conditions, or amount showing detectable therapeutic or prophylactic effect. Precise effective amount for a subject depends on the object's size and health, nature and extent of disease, and therapeutic agents and/or therapeutic agent combination selected for administering. Therefore, it is not useful to pre-specify an accurate effective amount. However, for a given condition, routine experimentation can be used to determine an effective amount. Clinicians can determine that.

[0147] Pharmaceutical compositions may also contain pharmaceutically acceptable carriers. The term pharmaceutically acceptable carriers refers to carriers used in the administration of therapeutic agent. This term refers to some pharmaceutical carriers: they themselves do not induce antibody production harmful to individuals, who received the compositions, and do not have undue toxicity after the administration of compositions. These carriers are known to one skilled in the art. Full discussion of pharmaceutically acceptable excipients can be found in Remington's Pharmaceutical Sciences (Mack Pub. Co., NJ 1991). This type of carriers include (but are not limited to): saline, buffer, dextrose, water, glycerol, ethanol, adjuvant, and a combination thereof.

[0148] Pharmaceutically acceptable carriers in therapeutic compositions may contain liquids, such as water, saline, glycerol, and ethanol. In addition, auxiliary substances may also be present in these carriers, such as wetting agents or emulsifying agents, pH buffering substances, etc. Moreover, immunological compositions may further contain immune adjuvant.

[0149] Typically, therapeutic compositions may be prepared as injectable agents, e.g., liquid solutions or suspensions; and may also be prepared as solid form suitable for dissolving into solutions or suspensions prior to injection.

[0150] Once compositions of the present invention are prepared, they can be directly administered to subjects. Subjects for prevention or treatment can be animals; especially human.

[0151] Therapeutic or prophylactic pharmaceutical compositions (including vaccines) of the present invention containing regulators of the present invention may be administered orally, subcutaneously, intradermally, intravenously, etc. applications. Therapeutic agent dosage regimen may be single dose regimen or multiple dose regimens.

[0152] Compositions of the present invention may be used for regulating regulatory T cells, thereby treating or preventing diseases caused by immune dysregulation. When down-regulation of patient's immune response is required, compositions containing antagonists of phosphorylation pathway-related factors may be used. When up-regulation of patient's immune response is required, compositions containing phosphorylation pathway-related factors of the present invention or agonists thereof may be used. Diseases requiring down-regulation of patient's immune response in treatment include, but are not limited to: autoimmune diseases, organ transplantation. Diseases requiring up-regulation of patient's immune response in treatment include but are not limited to: cancer, viral infection. The up-regulation may be achieved by inhibiting regulatory Treg cell function. The down-regulation may be achieved by enhancing regulatory Treg cell function.

[0153] Main Advantages of the Present Invention

[0154] (1) The present invention reveals, for the first time, phosphorylation pathway-related factorPIM1 affects FOXP3 binding to chromatin by phosphorylating FOXP3, and, in turn, regulates FOXP3 transcriptional regulatory activity on its target genes.

[0155] (2) Determination and application of regulators of the present invention provide a new way to regulate FOXP3 transcriptional regulatory activity on its target genes by phosphorylating FOXP3, thereby treating and/or preventing diseases or conditions (e.g., cancer, autoimmune diseases, etc.) related to dysregulation of FOXP3, IL-2, and/or IFN- activity.

[0156] (3) The present invention further provides use of PIM1 and/or its coding sequences, the agonists or the antagonists thereof in the preparation of compositions containing regulatory T cells or compositions regulating regulatory T cell activity; methods of preparing compositions containing regulatory T cells: methods of regulating regulatory T cell activity; and reagents or kits used in the preparation of compositions containing regulatory T cells or compositions regulating regulatory T cell activity.

EXAMPLES

[0157] The following specific embodiments further illustrate the present invention. It should be understood that these embodiments are merely used to illustrate the present invention and are not intended to limit the scope of the present invention. One skilled in the art may make suitable modifications and changes to the present invention. These modifications and changes, however, are within the scope of the present invention.

[0158] Conventional methods in the art may be used for experimental methods not specified in the following examples, such as those referenced in Molecular Cloning, A Laboratory Manual (third edition, New York, Cold Spring Harbor Laboratory Press, 1989), or in accordance with conditions recommended by the suppliers. DNA sequencing methods are conventional methods in the art, and tests can also be provided by commercial companies.

[0159] Unless otherwise indicated, percentages and parts are calculated by weight. Unless otherwise defined, all professional and scientific terms have identical meanings well known to one skilled in the art. In addition, any methods and materials similar or equivalent to the disclosures can be applied to the methods of the present invention. Preferred embodiments of methods and materials in the disclosure are used for demonstration purposes only.

Example I

Materials and Methods

[0160] 1. Plasmids and Vectors:

Referring to Reference 4, cloning and constructing N-terminal FLAG-tagged FOXP3, PIM1, and other plasmids (plPFLAG2 and plPFHA2 are eukaryotic expression vectors; pET28a and pET21-MBP prokaryotic expression vectors) and lentiviral packaging vector plasmids (FUGW, dR8.9, and VSV-G).

[0161] PIM1 gene was obtained from amplifying human peripheral blood mononuclear cell cDNA library. Primers were designed according to the sequences downloaded from Genbank as follows:

TABLE-US-00001 SEQ Primer IDNO: Sequence PIM1-upstream 1 5-GAGGAATTCGATGCTCTTGTC primer CAAAATCAACTC-3 PIM1-downstream 2 5-GAGGGGAGGACCTGCCAGAAA primer G-3

[0162] 2. Antibodies:

Flag antibodies (M2) were purchased from Sigma. FOXP3 antibodies (hFOXY) were purchased from eBioscience. PIM1 antibodies were purchased from Santa Cruz. pS422-FOXP3 antibodies were custom made by Abmart Inc. HRP-conjugated anti-mouse secondary antibodies were purchased from Promega.

[0163] 3. Cells and Treatments:

Human HEK293T cells (purchased from Chinese Academy of Sciences Cell Bank (Catalog Number: GNHu17)) were cultured in DMEM (Dulbecco's modified Eagle's medium) containing 10% FBS, 100 units/ml penicillin-streptomycin, at 37 C. under 5% CO.sub.2.

[0164] SZ4.03 cells (lymphocyte cell line that highly expresses FOXP3, kept in the present laboratory; also can be routinely obtained by one skilled in the art according to methods described in Reference 7) were cultured in 1640 culture medium containing 10% FBS, 100 units/ml penicillin-streptomycin, 100 units ml non-essential amino acids, and 100 units/ml sodium pyruvate, at 37 C. under 5% CO.sub.2.

[0165] Cell transfection: Lipofection was performed using Lipofectamin 2000 (Invitrogen) (performed according to operating instructions). Samples were collected 48 h after transfection for analysis.

[0166] Human embryonic kidney cell line HEK293 were co-transfected with FUGW-TAP-FOXP3, dR8.9, and VSV-G. Culture supernatants were collected 48 h and 72 h after transfection.

shPIM1 primer sequences were designed as follows:

TABLE-US-00002 SEQ Primer IDNO: Sequence ShPIM1 3 CCGGGATACTCTCTTCTTCTCATAGCTCGAGCT primer1 ATGAGAAGAAGAGATATCTTTTT ShPIM1 4 AATTAAAAAGATACTCTCTTCTTCTCATAGCTC primer2 GAGCTATGAGAAGAAGAGAGTATC
shCK primer sequences were designed as follows:

TABLE-US-00003 SEQ Primer IDNO: Sequence ShCK 5 CCGGTCAACAAGATGAAGAGCACCAACTCGAGT primer1 TGGTGCTCTTCATCTTGTTGTTTTTG ShCK 6 AATTCAAAAACAACAAGATGAAGAGCACCAACT primer2 CGAGTTGGTGCTCTTCATCTTGTTGA

[0167] After annealing, the synthesized shRNA primer sequences were ligated into lentiviral shRNA expression vector pLKO.1 (purchased from Addgene). After mixed at a ratio of pLKO.1:dR8.9:VSVG=5:4:3, HEK 293T cells were transfected with the mixture using calcium phosphate method. Viruses were collected 48 h after transfection. After low-speed centrifugation and filtration, virus suspension was used directly to infect target cells.

[0168] 4. Reagents and Isolation of Nucleus and Chromatin Subfractions:

PIM1 inhibitor (4-[3-(4-chlorophenyl)-2,1-benzisoxazol-5-yl]-2-pyrimidine amine) was purchased from Tocris.
IL-4 and IL-6 were purchased from Apotech.
MG132 was purchased from Merck.
Protein AG-beads were purchased from Shanghai Yuekebio.

[0169] Isolation of cellular components: cells were lysed using cytoplasm extraction solution (10 mM Hepes, pH 7.9, 10 mM KCl, 0.1 mM EDTA, 1 mM DTT, 0.5 mM PMSF, 1% complete protease inhibitor cocktail (Cat No 1-697-498; Roche Biochem), 1 mM Na.sub.3VO.sub.4), placed on ice for 15 minutes, then added to a final concentration of 0.6% NP-40. After lysis by vortex for 30 seconds, centrifuged at 12000 g for 30 seconds. The obtained supernatant is cytoplasmic fraction and precipitate is nucleus component. After nucleus component was dissolved using nuclear suspension (20 mM Hepes pH 7.9, 400 mM NaCl, 1 mM EDTA, 1 mM DTT, 1 mM PMSF, 1% protease inhibitor cocktail reagent, 1 mM Na.sub.3VO.sub.4), rotated slowly and uniformly at 4 C. for 30 minutes, followed by centrifugation at 16,060 g at 4 C. for 15 min. The obtained insoluble precipitate is chromatin subfraction.

[0170] 5. Immunoprecipitation:

Cells were lysed using RIPA buffer (20 mM Tris/HCL pH 7.5, 150 mM NaCl, 1% NP-40, 0.5% Na-DOC, 1 mM EDTA and 1 mM PMSF protease inhibitor, 1% Cocktail, 1 mM Na3VO4 phosphatase inhibitor, 1 mM NaF). Primary antibody was first added to cell lysate and incubated for 1 h, and then agarose beads coupled with Protein A/G were added for 1 h. After lysis and washing three times with RIPA buffer, bound proteins were detected using SDS-PAGE.

[0171] 6. Immunoblot:

After protein samples were subjected to SDS-PAGE, transferred to nitrocellulose membrane, sealed in TBST with 5% skim milk for 1 h, primary antibody was added and incubated for 1 h, then HRP-conjugated secondary antibody was added and incubated for 1 h, and results shown by exposure with ECL substrates.

[0172] 7. Gene Site-Directed Mutagenesis:

FOXP3 S422A mutant and PIM1 K67M mutant were obtained by PCR mutation (see Reference Document 5)

TABLE-US-00004 SEQ Primer IDNO: Sequence FOXP3S422A 7 GAGCCAGAGGCCCGCCAGGTGTTCCAAC mutantprimer1 FOXP3S442A 8 GTTGGAACACCTGGCGGGCCTCTGGCTC mutantprimer2 PIM1K67M 9 GCCGGTGGCCATCATGCACGTGGAGAAG mutantprimer1 GAC PIM1K67M 10 GTCCTTCTCCACGTGCATGATGGCCACC mutantprimer2 GGC

[0173] 8. Protein Expression and Purification:

PIM1 gene and PIM1K67M gene were inserted into PET28a prokaryotic expression vector to obtain PET28a-PIM1 and PET28a-PIM1 K67M. Then, BL21 competent cells were transformed to induce expression with IPTG, cells collected, lysed, and purified using nickel column (Qiagen), and finally purified proteins were obtained by fast protein liquid chromatography (GE). MBP-S422FOXP3 and MBP-FOXP3 proteins expression was expressed as described above, cells collected, lysed, and purified using amylose resin (NEB), proteins were eluted and dialyzed using standard buffer (25 mM Tris-HCl (pH 7.5), 150 mM NaCl, 10 mM -mercaptocthanol, and 10% glycerol). Finally, all protein concentrations were measured using Brandford methods (Beyotime Institute of Technology).

[0174] 9. In Vitro Phosphorylation Experiments:

1 g 6His-PIM1 or 6His-PIM1K67M and 1 g MBP-FOXP3 (total four groups, respectively: 6His-PIM1; MBP-FOXP3; MBP-FOXP3+6His-PIM1; MBP-FOXP3+6His-PIM1 K67M) was added to 100 l reaction solution containing 20 mM MOPS buffer (pH 7.4), 150 mM NaCl, 12.5 mM magnesium chloride, 1 mM manganese chloride, 1 mM DTT, 10 M ATP. Evenly mixed, after incubation at 30 C. for 2 h, SDS sample buffer was added to terminate the reaction. Immnuoblot was performed on the above reaction systems. FOXP3 S422 phosphorylation in each system was analyzed using anti-pS422-FOXP3 antibody.

[0175] 10. Cell Proliferation Detection Experiments:

Regulatory T cells were obtained from human peripheral blood mononuclear cells (purchased from Shanghai Blood Center) by antibody labeling and magnetic bead sorting. As mentioned above, after labeling effector T cells with 1 M CFSE (Invitrogen), regulatory T cells and effector T cells were cultured for 80 h. Flow cytometry was used to detect fluorescence intensity changes in effector T cells, their proliferation status was analyzed.

Example I-1. Effect of Proto-Oncogene Encoded Protein PIM1 on FOXP3

[0176] HEK293T cells were co-transfected with HA-FOXP3 and FLAG-PIM1. After 48 h, cells were collected. After lysed with RIPA buffer, immunoprecipitated using FLAG antibody, and then immunoblot was performed using corresponding antibodies (results shown in FIG. 1A). The results show: FLAG-PIM1 can be co-precipitated with HA-FOXP3.

[0177] HEK 293T cells were co-transfected with HA-FOXP3 or its Ser422 mutant and FLAG-PIM1 or its enzymatic activity-deficient mutant K67M. After 48 h, cells were collected. After lysis, immunoprecipitated using HA antibody and then immunoblot analysis was performed using pS422-FOXP3 antibody and other suitable antibodies (results shown in FIG. 1B). The results show: FLAG-PIM1 can phosphorylate Ser422 of HA-FOXP3.

[0178] Immunoblot analysis was performed after MBP-FOXP3 and His-PIM1 and its K67M mutants were expressed by prokaryotic cells and FPLC purified, and reacted in vitro, in the presence of ATP. SDS-PAGE was performed on the total proteins in the reaction system. After protein gel was stained by Lumitein, and visualized under UV light (results shown in FIG. 1C). The results show: FOXP3 Scr422 phosphorylation can only be detected in MBP-FOXP3 and His-PIM1 in vitro phosphorylation experimental system.

[0179] The above results show: the proto-oncogene encoded protein PIM1 can bind FOXP3 and specifically catalyzes FOXP3 Ser422 phosphorylation. In other words, FOXP3 binds PIM1, and is phosphorylated at Ser422 by PIM1.

Example I-2. Inflammatory Cytokines IL-6 and IL-4 can Induce PIM1 Expression

[0180] SZ4.03 cells were treated with IL-6 (20 ng/ml) or IL-4 (30 ng/ml), respectively, for 0 h, 1 h, 2 h, and 4 h. Cells were collected and lysed by boiling directly in SDS sample buffer, and then samples were analyzed by immunoblot (primary antibodies are PIM1 antibody and FOXP3 antibody) (results shown in FIG. 2).

[0181] The results show: after IL-6 or IL-4 treatment, in SZ4.03 lymphocyte cell line that highly expresses FOXP3, PIM1 expression gradually increases as treatment time increases; whereas there is no significant difference in FOXP3 expression levels.

[0182] The results show: two kinds of inflammatory cytokines, IL-4 and IL-6, can stimulate endogenous PIM1 expression.

Example I-3. PIM1 Inhibits FOXP3 Binding to Chromatin

[0183] HA-FOXP3 and FLAG-PIM1 were co-transfected into HEK 293T cells. After 48 h, cells were collected and chromatin (Chr), cytoplasmic (Cy) and nucleus (Nu) were isolated. Immunoblot analysis was performed on the isolated samples (results shown in FIG. 3).

[0184] The results show: when FOXP3 and PIM1 are present together, as compared with that when only one of them is present, the amount of FOXP3 binding to chromatin is significantly reduced; whereas the amount of FOXP3 in nucleus and cytoplasm remains unchanged.

[0185] The results show: phosphorylation modification exists as one of FOXP3 post-translational modifications. PIM1 can inhibit FOXP3 binding to chromatin, thereby inhibiting the transcription of FOXP3 target genes.

Example I-4. PIM1 Negatively Regulates FOXP3 Transcription Regulatory Activity

[0186] SZ4.03 cells that highly expresses FOXP3 were infected with viral vectors carrying the negative control shRNA (shCK) and PIM1 shRNA (shPIM1) packaged using lentiviral packaging system, followed by puromycin (50 ng/ml) selection and DMSO or PMA/inomycin (P/I) for 4 h. Total RNA was extracted and reverse transcribed to cDNA. Then, the mRNA expression levels of PIM1 (results shown in FIG. 4A), the mRNA expression levels of FOXP3-positively regulated target genes (GITR and CTLA4) (results shown in FIGS. 4B and 4C), the mRNA expression levels of FOXP3-negatively regulated target gene (IL-2) (results shown in FIG. 4D), the mRNA expression levels of non-FOXP3 target gene (STUB1) (results shown in FIG. 4E) were analyzed by quantitative PCR.

[0187] The results show: as compared with the control shCK, shPIM1 can significantly reduce the mRNA expression levels of PIM1. shPIM1 enhances the mRNA expression levels of FOXP3-positively regulated target genes (GITR and CTLA4), reduces the mRNA expression levels of FOXP3-negatively regulated target gene (IL-2), and does not affect the mRNA expression levels of non-FOXP3 target gene (STUB1).

[0188] The results show: PIM1 can negatively regulate FOXP3 transcription regulatory activity; shPIM1 can positively regulate FOXP3 transcription regulatory activity, thereby affect the mRNA expression levels of FOXP3 target genes.

Example I-5. PIM1 Inhibitors can Increase CLTA4+ FOXP3+ Treg and CD25+ FOXP3+ Treg Cell Levels

[0189] After human CD4+ CD25+ CD127.sup.low natural Treg (nTreg) were sorted by BD FACS Aria II flow sorter, and expanded through Bead-CD3/CD28 and IL-2 (500 U/ml). DMSO or PIM1 inhibitor (4-[3-(4-chlorophenyl)-2,1-benzisoxazol-5-yl]-2-pyrimidinamine, 100 nM) was added and treated for 24 h. and the cells were stained with APC-FOXP3 and PE-CD25 antibody for flow cytometry analysis (results shown in FIG. 5A). The expanded nTreg were rested for 24 h. DMSO or PIM1 inhibitor (100 nM) was then added and treated for 48 h, followed by staining with APC-FOXP3 and PE-CD25 antibody for flow cytometry analysis (results shown in FIG. 5B).

[0190] The results show: as compared with DMSO control group, PIM1 inhibitor can significantly increase CLTA4+ FOXP3+ Treg and CD25+ FOXP3+ Treg cell levels.

[0191] The results show: PIM1 inhibitor can positively regulate FOXP3 expression levels and increase CLTA4+ FOXP3+ Treg and CD25+ FOXP3+ Treg cell levels.

Example I-6. PIM1 Inhibitors can Enhance Immunosuppressive Activity of nTreg

[0192] The expanded nTreg were mixed with CFSE-labeled human PBMC (210.sup.5 cells/well) at the corresponding ratio (i.e., PBMC only, Treg:PBMC=1:2 or 1:4, or Treg only) in 96-well U-shaped well. 5000 Bead-CD3/CD28 were added to each well. Two groups of cells were treated, respectively, with DMSO and PIM1 inhibitors, cultured for 5 days, followed by detection of cell proliferation levels (results shown in FIG. 6).

[0193] The results show: as compared with DMSO-treated group, PBMC proliferation was inhibited more in PIM1 inhibitor-treated group.

[0194] The results show: PIM1 inhibitors can enhance immunosuppressive activity of nTreg.

Example I-7. PIM1 Inhibitors Promote FOXP3+ and CTLA4+ nTre & Cell Expansion

[0195] 500 U/ml of IL-2 was added to 210.sup.5 nTreg cells. nTreg cells were expanded at a 3:1 ratio of CD3/CD28 T cell dynabeads and cells. After two weeks, part of the expanded nTreg cells were collected for FACS detection. Dynabeads were removed from the remaining cells and rested for 48 h. Cells were collected again for FACS detection of FOXP3 and CTLA4. Working concentrations of Rapamycin and PIM1 inhibitors are both 100 nM (results shown in FIG. 11).

[0196] The results show: comparing the PIM1 inhibitor-treated experimental group with the control group, PIM1 inhibitors can promote FOXP3+ and CTLA4+nTreg cell expansion.

Example I-8. PIM1 Gene Knockout can Enhance FOXP3 Transcription Regulatory Activity

[0197] 500 U/ml of IL-2 was added to 210.sup.5 nTreg cells. Primary nTreg cells were activated at a 3:1 ratio of CD3/CD28 T cell dynabeads and cells for 4 h, followed by infection of lentiviruses encoding PIM1, PIM2, and PIM3 shRNA overnight. Cells were cultured for 1 week without removing dynabeads, and then the mRNAs level of FOXP3 and its target gene CTLA4 were detected (results shown in FIG. 12).

[0198] The results show: the mRNA levels of CTLA4 increase in shPIM1 knockout nTreg cells, indicating that PIM1 gene can regulate FOXP3 transcription activity.

Example II

[0199] The objective of this part of embodiments is to select small molecules capable of specifically affecting FOXP3+ Treg cell function and to develop agonists capable of affecting FOXP3 protein function; to detect the effect of these inhibitors on Treg cell function; and to provide new therapeutic approaches for the treatment of autoimmune diseases, organ transplantation, etc.

[0200] Shanghai Institute of Quality and Standardization provided Chinese herb medicine small molecule standard library. According to the retrieved information, there are 95 small molecules related to inflammation. Using molecular immunology-related technologies, we found, for the first time, that kaempferol affects FOXP3 post-translational modification and FOXP3 stability.

[0201] Relevant Information about Kaempferol:

Experiment Code: IPS-001

[0202] Molecular Formula: C.sub.15H.sub.10O.sub.6

Molecular Weight: 286.24

Structure:

[0203] ##STR00001##

[0204] Materials and Methods

1. Plasmids and Vectors:

[0205] N-terminal Myc-FOXP3, Flag-PIM1, Flag-PIM2, and Flag-PIM3 were constructed and cloned according to Reference 4.

[0206] PIM1, PIM2, and PIM3 genes were obtained by amplification from human peripheral blood mononuclear cell cDNA library.

[0207] Primers were designed according to the sequences downloaded from Genbank as follows:

TABLE-US-00005 SEQ Primer IDNO: Sequence PIM1-upstream 1 5-GAGGAATTCGATGCTCTTGTC primer CAAAATCAACTC-3 PIM1-downstream 2 5-GAGGGGAGGACCTGCCAGAAA primer G-3 PIM2-upstream 11 5-CACGAATTCTCCATGTTGACC primer AAGCCTCTACAG-3 PIM2-downstream 12 5-GAGGAAGGCTCCTTTGTAGGA primer TTG-3 PIM3-upstream 13 5-GTAGAATTCATGCTGCTCTCC primer AAGTTCGGCTC-3 PIM3-downstream 14 5-CTAGCTCCCAGTCAGGTGCAG primer CTC-3

[0208] Cell transfection: Lipofection was performed using Lipofectamin 2000 (Invitrogen) (performed according to operating instructions). Samples were collected at 48 h after transfection for analysis.

[0209] Human embryonic kidney cell line HEK293 was co-transfected with FUGW-TAP-FOXP3, dR8.9, and VSV-G. Cell culture supernatants were collected at 48 and 72 h after transfection.

[0210] shPIM1 primer sequences were designed as follows:

TABLE-US-00006 SEQ Primer IDNO: Sequence ShPIM1 3 CCGGGATACTCTCTTCTTCTCATAGCTCGAGCT primer1 ATGAGAAGAAGAGAGTATCTTTTT ShPIM1 4 AATTAAAAAGATACTCTCTTCTTCTCATAGCTC primer2 GAGCTATGAGAAGAAGAGAGTATC ShPIM2 15 CCGGGCCCAGGATCTCTTTGACTATCTCGAGAT primer1 AGTCAAAGAGATCCTGGGCTTTTT ShPIM2 16 AATTAAAAAGCCCAGGATCTCTTTGACTATCTC primer2 GAGATAGTCAAAGAGATCCTGGGC ShPIM3 17 CCGGCGCCTGTCAGAAGATGAACATCTCGAGAT primer1 GTTCATCTTCTGACAGGCGTTTTT ShPIM3 18 AATTAAAAACGCCTGTCAGAAGATGAACATCTC primer2 GAGATGTTCATCTTCTGACAGGCG

[0211] shCK primer sequences are as follows:

TABLE-US-00007 SEQ Primer IDNO: Sequence ShCK 5 CCGGTCAACAAGATGAAGAGCACCAACTCGAGT primer1 TGGTGCTCTTCATCTTGTTGTTTTTG ShCK 6 AATTCAAAAACAACAAGATGAAGAGCACCAACT primer2 CGAGTTGGTGCTCTTCATCTTGTTGA

[0212] After annealing, the synthesized shRNA primer sequences were ligated into shRNA lentiviral expression vector pLKO.1 (purchased from Addgene). After mixed at a ratio of pLKO.1:dR8.9:VSVG=5:4:3, they were transfected into HEK 293T cells by calcium phosphate method. Viruses were collected 48 h after transfection. Virus suspensions, after low-speed centrifugation and filtration, were used directly to infect target cells.

[0213] 2. Antibodies:

Flag antibody (M2) was purchased from Sigma. FOXP3 antibody (hFOXY) was purchased from eBioscience. H3S10 (Phospho-Histone) and histone H3 antibodies were purchased from Cell signaling. pS422-FOXP3 antibody was custom made by Abmart Inc. GAPDH antibody was purchased from Abmart Inc. -tubulin was purchased from Tianjin Sungene Biotech Co., Ltd. HRP-conjugated anti-mouse secondary antibody was purchased from Promega.

[0214] 3. Cells and Treatments:

Human HEK293T (purchased from the Chinese Academy of Sciences Cell Bank (catalog number: GNHu17)) was cultured in DMEM (Dulbecco's modified Eagle's medium) containing 10% FBS, 100 units/ml penicillin-streptomycin, at 37 C. under 5% CO.sub.2.

[0215] Jurkat E6.1 T cells (purchased from the Chinese Academy of Sciences Cell Bank (catalog number: TCHU123)) were cultured in 1640 medium containing 10% FBS, 100 units/ml penicillin-streptomycin, 100 units/ml non-essential amino acids, and 100 units/ml sodium pyruvate, at 37 C. under 5% CO.sub.2.

[0216] Cell transfection: Lipofection was performed using Lipofectamin 2000 (Invitrogen). Samples were collected 48 h after transfection for analysis.

[0217] Human embryonic kidney cell line HEK293 was co-transfected with FUGW-HA-FOXP3, del 8.9 and VSV-G. Cell culture supernatants were collected 48 h and 72 h after transfection. Viruses were purified by ultracentrifugation and used to infect Jurkat E6.1 to ultimately obtain Jurkat cell lines stably expressing HA-FOXP3.

[0218] 4. Reagents and Isolation of Cellular Components:

PIM1 inhibitor (4-[3-(4-chlorophenyl)-2,1-benzisoxazol-5-yl]-2-pyrimidinamine) was purchased from Tocris. PI3K-inhibitor (LY294002) was purchased from Beyotime Institute of Biotechnology. PMA was purchased from Beyotime. LPS was purchased from Invivogen. Kaempferol was purchased from Shanghai Institute of Quality and Standardization.

[0219] Cells were lysed with cytoplasm extraction solution (10 mM Hepes, pH 7.9, 10 mM KCl, 0.1 mM EDTA, 1 mM DTT, 0.5 mM PMSF, 1% complete protease inhibitor cocktails (Cat No 1-697-498; Roche Biochem), 1 mM Na.sub.3VO.sub.4), placed on ice 30 minutes, centrifuged at 12000 g for 30 seconds.

[0220] 5. Immunoblot:

Protein samples were subjected to SDS-PAGE, and then transferred to nitrocellulose membrane, which was then sealed in TBST containing 5% nonfat dry milk or 3% bovine serum albumin for 1 h. Primary antibody was added and incubated for 1 h and then HRP-conjugated secondary antibody was added and incubated for 1 h, and results shown by exposure with ECL substrates.

[0221] 6. Primary Cell Sorting and Cell Proliferation Assay Experiments:

Human peripheral blood mononuclear cells (purchased from Shanghai Blood Center) were simultaneously stained with CD4, CD25, and CD127 antibodies, and then the CD4+ CD25.sup.hi CD127.sup.low cell populations were selected by FACSAriaII cell sorter. The selected NTreg cells were cultured in vitro in X-VIVO (Lonza) medium containing 1% GlutaMax (GIBCO), 1% NaPyr (GIBCO), and 500 U IL2.

[0222] Expansion process requires the presence of CD3/CD28 T cell Dynabeads (Invitrogen, Catalog No.: 111-41D). The ratio of Dynabeads and cells is 3:1. The phenotype of expanded nTreg cells was identified by detecting the expression levels of FOXP3. As mentioned above, after effector T cells were labeled with 1 M CFSE (Invitrogen), regulatory T cells were cultured with effector T cells for 80 h. Fluorescence intensity changes in effector T cells were detected by flow cytometry, and analyzed for their proliferation status.

Example II-1. Kaempferol Inhibits FOXP3 S422 Phosphorylation in a Dose-Dependent Manner

[0223] HEK293T cells were co-transfected with MYC-FOXP3 and FLAG-PIM1. 36 h later, cells were treated with 50 nM, 10 nM, 2 nM, and 0.4 nM of PIM1 inhibitor and 50 M, 10 M, 2 M, 0.4 M, and 0.08 M of kaempferol for 12 h. After 48 h, cells were collected and lysed with cell lysis buffer. The levels of pS422-FOXP3, FOXP3, and 3-tubulin were directly detected by immunoblot (results shown in FIG. 9A). FIG. 9A was analyzed using ImageJ software (results shown in FIG. 9B).

[0224] The results show: Kaempferol inhibits FOXP3 S422 phosphorylation in a dose-dependent manner.

Example II-2. Kaempferol can Specifically Inhibit FOXP3 S422 Phosphorylation Induced by PIM1

[0225] HEK293T cells were co-transfected, respectively, with Myc-FOXP3+FLAG-PIM1, Myc-FOXP3+FLAG-PIM2, and Myc-FOXP3+FLAG-PIM3. 36 h later, cells were treated with 50 M kaempferol for 12 h. After 48 h. cells were collected and lysed with cell lysis buffer. The levels of pS422-FOXP3, FOXP3, and -tubulin were directly detected by immunoblot (results shown in FIG. 10A). FIG. 10A was analyzed using ImageJ software (results shown in FIG. 10B).

[0226] The results show: kaempferol does not affect FOXP3 phosphorylation levels induced by PIM2 and PIM3, but specifically inhibits FOXP3 S422 phosphorylation induced by PIM1.

Example II-3. Kaempferol can Inhibit Histone H3 S10 Phosphorylation Induced by PIM1

[0227] HEK293T cells were co-transfected with MYC-FOXP3 and FLAG-PIM1. 36 h later, cells were treated with 50 M of kaempferol for 12 h. Cells were collected at 48h after transfection and directly sonicated in SDS-loading buffer, and lysed by boiling. The levels of (Phospho-Histone) H3S10, histone H3, and PIM1 were directly detected using immunoblot (results shown in FIG. 11).

[0228] This results show: PIM1 can be recruited by MYC proto-oncogene to its target genes and phosphorylates histone H3 at Ser10 to initiate target gene transcription. Namely, histone H3 S10 is one of PIM1 phosphorylation substrates. The experimental results show kaempferol does not affect PIM1 expression levels, but inhibits histone H3 S10 phosphorylation induced by PIM1.

Example II-4. Kaempferol Only Inhibits FOXP3 S422 Phosphorylation and Histone H3 S10 Phosphorylation Induced by PIM1

[0229] HEK293T cells were transfected with FLAG-PIM1, and co-transfected with MYC-FOXP3 and FLAG-PIM1. 36 h later, HEK293 was used as blank control group and each group was treated with 50 M of kaempferol for 12 h, respectively. Cells were collected alter 48 h and lysed with cell lysis buffer. The levels of pS422-FOXP3, FOXP3, histone H3 Ser10 phosphorylation, histone H3, and GAPDH were directly detected by immunoblot (results shown in FIG. 12).

[0230] The results show: kaempferol treatment can inhibit FOXP3 S422 phosphorylation and histone H3 S10 phosphorylation; while it does not affect histone H3 S10 phosphorylation in the control group.

[0231] The results show: kaempferol specifically inhibits histone H3 S10 phosphorylation levels induced by PIM1.

Example II-5. Kaempferol can Inhibit FOXP3 Protein Degradation Induced by PMA/LPS Stimulation

[0232] Jurkat cells stably expressing HA-FOXP3 were treated with PMA (25 ng/ml) and LPS (1 ng/ml). Each sample was added 50 M kaempferol, 100 nM PIM1 inhibitor (i.e., 4-[3-(4-chlorophenyl)-2,1-benzisoxazol-5-yl]-2-pyrimidinamine), and 10 g/ml PI3K inhibitor (LY294002). DMSO serves as a control. Cells were collected after 24 h. The levels of FOXP3 and GAPDH were directly detected by immunoblot (results shown in FIG. 13).

[0233] The results show that: PMA and LPS co-stimulation can cause FOXP3 protein degradation in Jurkat cells stably expressing HA-FOXP3. Kaempferol, PIM1 inhibitor, and PI3K inhibitor can inhibit FOXP3 protein degradation.

Example II-6. Kaempferol Enhances FOXP3 and CTLA4 Expression in the Induced Treg

[0234] Human CD4+ CD45RA+ natural T cells (i.e., natural T cells rather than Treg cells) were sorted by BD FACS Aria II flow sorter and expanded using Bead-CD3/CD28 (2:1). IL-2 (100 U/ml), and TGF- (1 ng/ml, 3 ng/ml, and 5 ng/ml) for 5 days to obtain the induced Treg cells. DMSO or kaempferol (50 uM) was added and treated for 48 h. After PE-FOXP3 and APC-CTLA4 antibody staining, flow cytometry analysis was performed (results as shown in FIGS. 14a and 14b).

[0235] The results show: as compared with the DMSO control group, kaempferol can significantly increase FOXP3 expression levels and CLTA4+ FOXP3+ Treg cell levels.

[0236] The results show: kaempferol can positively regulate FOXP3 expression levels and increase CLTA4+ FOXP3+ Treg cell levels.

[0237] All documents mentioned in the present invention are incorporated by reference in the present application, as if each reference was individually incorporated by reference. It should also be understood that, after reading the foregoing teachings of the present invention, those skilled in the art may make various modifications or changes of the present invention. These equivalents would similarly fall within the scope of the appended claims in the present application.

REFERENCES

[0238] 1. Belkaid, Y., Piccirillo, C. A., Mendez, S., Shevach, E. M., and Sacks, D. L. (2002). CD4+CD25+ regulatory T cells control Leishmania major persistence and immunity. Nature 420, 502-507; [0239] 2. Belkaid, Y. and Rouse, B. T. (2005). Natural regulatory T cells in infectious disease. Nat Immunol 6, 353-360; [0240] 3. Li, B. and Greene, M. I. (2008). Special regulatory T-cell review: FOXP3 biochemistry in regulatory T cells-how diverse signals regulate suppression. Immunology 123, 17-19; [0241] 4. Li, B., Samanta, A., Song, X., Iacono, K. T., Bembas, K., Tao, R., Basu, S., Riley, J. L., Hancock, W. W., Shen, Y., et al.(2007). FOXP3 interactions with histone acetyltransferase and class II histone deacetylases are required for repression. Proc Natl Acad Sci USA 104, 4571-4576; [0242] 5. Qian, S., McDonough, H., Boellman, F., Cyr. D. M., Patterson, C., et al. (2006). CHIP-mediated stress recovery by sequential ubiquitination of substrates and Hsp70. Nature 440, 551-555; [0243] 6. WO 2007:084775, Composition and method for modulation of suppressor T cell activation; [0244] 7. J. Todd Abrams, Stuart R. Lessin, Subrata K. Ghosh, Peter C. Nowell, William Ju., Eric C. Vonderheid, Alain H. Rook, Elaine Defreitas; Malignant and Nonmalignant T Cell Lines From Human T Cell Lymphotropic Virus Type I-negative Patients with Sezary Syndrome: The Journal of Immunology, Vol 146(5): 1455-1462 (Mar. 1, 1991); [0245] 8. Miduturu C V, Deng X, Kwiatkowski N, Yang W, Brault L, Filippakopoulos P, Chung E, Yang Q, Schwaller J, Knapp S, King R W, Lee J D, Herrgard S, Zarrinkar P, Gray N S; High-throughput kinase profiling: a more efficient approach toward the discovery of new kinase inhibitors. Chem Biol. 2011 Jul. 29; 18(7):868-79. doi: 10.16/j.chembiol.2011.05.010; [0246] 9. Isaac M, Siu A, Jongstra J; The oncogenic PIM kinase family regulates drug resistance through multiple mechanisms. Drug Resist Updat. August-October, 2011; 14(4-5):203-11. doi: 10.1016j.drup.2011.04.002. available on line May 20, 2011; [0247] 10. Blanco-Aparicio C, Carnero A; Pim kinases in cancer: Diagnostic, prognostic and treatment opportunities. Biochem Pharmacol. Oct. 5, 2012. pii: S0006-2952(12)00649-1. doi: 10.1016j.bcp.2012.09.018. [Early electronic publication] [0248] 11. Fathi A T, Arowojolu O, Swinnen I, Sato T, Rajkhowa T, Small D, Marmsater F, Robinson J E, Gross S D, Martinson M, Allen S, Kallan N C, Levis M; A potential therapeutic target for FLT3-ITD AML: PIM1 kinase. Leuk Res. 2012 February; 36(2):224-31. doi: 10.1016/j.leukres.2011.07.011. available on line Jul. 29, 2011; [0249] 12. Oleg Fedorov, Michael Sundstrm, Brian Marsden, Stefan Knapp; Insights for the development of specific kinase inhibitors by targeted structural genomics. Drug Discovery Today, Vol. 12 (9-10), May, 2007, pages 365-372; [0250] 13. Ogawa N, Yuki H, Tanaka A; Insights from Pim1 structure for anti-cancer drug design. Expert Opin Drug Discov. December 2012; 7(12): 1177-92. doi: 10.1517/17460441.2012.727394. available on line Sep. 25, 2012; [0251] 14. Merkel A L, Meggers E, Ocker M; PIM1 kinase as a target for cancer therapy. Expert Opin Investig Drugs. April 2012; 21(4):425-36. doi: 10.1517/13543784.2012.668527. available on line Mar. 4, 2012.