E1-MINUS ADENOVIRUSES AND USE THEREOF
20170190752 ยท 2017-07-06
Inventors
Cpc classification
C12N2710/10343
CHEMISTRY; METALLURGY
C12N7/00
CHEMISTRY; METALLURGY
A61K45/06
HUMAN NECESSITIES
A61K48/00
HUMAN NECESSITIES
C12N2710/10032
CHEMISTRY; METALLURGY
A61P43/00
HUMAN NECESSITIES
C12N2830/00
CHEMISTRY; METALLURGY
A61K48/0008
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A61K48/0066
HUMAN NECESSITIES
C12N15/86
CHEMISTRY; METALLURGY
C12N2710/10043
CHEMISTRY; METALLURGY
A61P35/00
HUMAN NECESSITIES
International classification
C12N7/00
CHEMISTRY; METALLURGY
A61K48/00
HUMAN NECESSITIES
C12N15/86
CHEMISTRY; METALLURGY
Abstract
The present invention is related to a virus, preferably an adenovirus, characterised in that the virus comprises: a lacking functional wildtype E1 region, and a transporter for the transport of YB-1 into the nucleus of a cell which is infected with the virus.
Claims
1. A virus, preferably an adenovirus, characterised in that the virus comprises: a lacking functional wildtype E1 region, and a transporter for the transport of YB-1 into the nucleus of a cell which is infected with the virus.
2. The virus according to claim 1, characterised in that the virus comprises a nucleic acid coding for protein IX and expresses protein IX.
3. The virus according to claim 1 or 2, characterised in that the lacking functional wildtype E1A region is E1A-minus.
4. The virus according to any of claims 1 to 3, characterised in that the lacking functional wildtype E1 region is E1B-minus.
5. The virus according to claim 4, characterised in that the lacking wildtype E1 region is E1B55K-minus and/or E1B19K-minus and/or protein IX-minus.
6. The virus according to any of claims 1 to 5, characterised in that the transporter is a transporter provided by the virus.
7. The virus according to claim 6, characterised in that the transporter is a viral transporter.
8. The virus according to any of claims 1 to 7, characterised in that the transporter comprises protein E4orf6.
9. The virus according to any of claims 1 to 8, characterised in that the transporter comprises protein E1B55K.
10. The virus according to any of claims 6 to 8, characterised in that the transporter comprises a complex of E4orf4 and E1B55K.
11. The virus according to any of claims 1 to 10, characterised in that the transporter is coded by a nucleic acid, whereby the nucleic acid is under the control of a promoter.
12. The virus according to claim 11, characterised in that the transporter is a complex of at least two factors and whereby each factor is coded by a nucleic acid, whereby both nucleic acids are controlled by a shared promoter.
13. The virus according to claim 12, characterised in that both nucleic acid are connected through an element which controls the expression strength, whereby the element is preferably selected from the group comprising IRES.
14. The virus according to claim 11, characterised in that the transporter is a complex of at least two factors and whereby each factor is coated by a nucleic acid, whereby both nucleic acids are controlled by a proprietary promoter.
15. The virus according to any of claims 11 to 14, characterised in that the promoter is different from the E4 promoter, in particular the adenoviral E4 promoter and is different from the E1B promoter, in particular the adenoviral E1B promoter.
16. The virus according to any of claims 11 to 15, characterised in that the promoter is selected from the group comprising tissue-specific promoters, tumor-specific promoters, the CMV-promoter, viral promoters and particularly adenoviral promoters under the proviso that these are different from the E4 promoter, the E1B promoter and preferably also different from the E2-late promoter.
17. The virus according to any of claims 1 to 16, characterised in that the nucleic acid coding for the transporter has a 3-UTR at the 3 end of E1B55K.
18. The virus according to any of claims 1 to 17, characterised in that if the lacking wildtype E1 region is E1B55K-positive, the nucleic acid coding for the transporter does not comprise an E1B55K coding nucleic acid.
19. The virus according to any of claims 1 to 18, characterised in that the nucleic acid coding for the transporter codes for E1B55K and E1B19K.
20. The virus according to any of claims 1 to 19, preferably claim 18, characterised in that the nucleic acid coding for the transporter codes for protein IX.
21. The virus according to claim 19 or 20, characterised in that the nucleic acid coding for the E1B55K and E1B19K is under the control of a promoter.
22. The virus according to claim 19 or 20, characterised in that the nucleic acid coding for the E1B55K and/or E1B19K and/or protein IX is under the control of a promoter, whereby the promoter is different from an E1A-dependent promoter.
23. The virus according to any of claims 1 to 22, characterised in that the lacking functional wildtype E1 region is E1A13S-minus and/or E1A12S-minus.
24. The virus according to any of claims 1 to 23, characterised in that the lacking functional wildtype E1 region is E1A13S-minus.
25. The virus according to any of claims 1 to 24, characterised in that preferably the lacking wildtype E1 region is E1A13S-minus and E1A12-minus, whereby the virus comprises a nucleic acid coding for the E1A12S protein, whereby the nucleic acid is preferably a heterologous nucleic acid.
26. The virus according to claim 25, characterised in that the nucleic acid coding for the E1A12S protein is under the control of a promoter, whereby the promoter is preferably a YB-1 dependent promoter and more preferably selected from the group comprising the adenoviral E2-late promoter, the MDR-promoter and the DNA polymerase alpha promoter.
27. The virus according to any of claims 1 to 26, in particular claim 26, characterised in that the nucleic acid(s) coding for the transporter code for E4orf6 and E1B55K.
28. The virus according to claim 26 or 27, characterised in that the virus comprises a nucleic acid coding for protein IX, whereby preferably the nucleic acid coding for E1A12S and the nucleic acid coding for protein IX are under the control of a shared promoter, whereby more preferably both nucleic acids are linked to each other through an expression regulating element, whereby the element is more preferably selected from the group comprising IRES.
29. The virus according to any of claims 25 to 28, characterised in that the nucleic acid coding for the E1A12S protein and the nucleic acid coding for the protein IX are each under the control of a promoter, whereby the promoter is preferably the same promoter.
30. The virus according to any of claim 28 or 29, characterised in that the promoter is a YB-1 dependent promoter, which is preferably selected from the group comprising the adenoviral E2-late promoter, the MDR promoter and the DNA polymerase-alpha promoter.
31. The virus according to any of claims 1 to 30, preferably any of claims 24 to 30, more preferably claim 24, characterised in that the virus comprises a YB-1 coding nucleic acid.
32. The virus according to claim 31, characterised in that the nucleic acid coding for the E1A12S protein and the nucleic acid coding for the YB-1 are under the control of a shared promoter, whereby preferably both nucleic acids are linked to each other by an expression regulating element, whereby the element is preferably selected from the group comprising IRES.
33. The virus according to claim 31, characterised in that the nucleic acid coding for YB-1 and the nucleic acid coding for E1A12S protein are each under the control of a promoter, whereby the promoter is preferably the same promoter.
34. The virus according to any of claims 31 to 33, characterised in that the promoter is a YB-1 dependent promoter which is preferably selected from the group comprising the adenoviral E2-late promoter, the MDR promoter and the DNA polymerase-alpha promoter.
35. The virus according to any of claims 24 to 34, characterised in that the nucleic acid coding for E1A12S is cloned into the E3 region or E4 region.
36. The virus according to any of claims 24 to 35, characterised in that the nucleic acid coding for E1A12S and the nucleic acid coding for the protein IX or the nucleic acid coding for the YB-1 are cloned into the E3 region or the E4 region.
37. The virus according to any of claims 1 to 36, characterised in that the expression of the nucleic acid coding for protein IX is controlled by a promoter different from E1B via E1B19K or via E12AS.
38. The virus according to any of claims 1 to 37, characterised in that the virus comprises at least one transgene which is preferably cloned into the E3 region.
39. The virus according to claim 38, characterised in that the virus comprises at least one transgen which is preferably cloned into the E4 region.
40. The virus according to any of claims 1 to 39 comprising a nucleic acid coding for the RGD motif, whereby the RGD motif is preferably cloned into the HI-loop domain of the fibre knob.
41. The virus according to any of claims 1 to 40, further comprising MLP genes and/or E2A genes and E2B genes and/or E3 genes and/or E4 genes.
42. The virus according to any of claims 1 to 41, characterised in that the virus is replication deficient in cells which do not contain YB-1 in the nucleus.
43. The virus according to any of claims 1 to 42, characterised in that the virus can replicate in cells which have YB-1 in the nucleus, in particular have YB-1 in the nucleus independent of the cell cycle.
44. The virus according to any of claims 1 to 42, characterised in that the virus is replication deficient in cells where or in which YB-1 is deregulated.
45. The virus according to any of claims 1 to 42, characterised in that the virus is capable of replicating in tumor cells, preferably tumor cells which are resistant against cytostatics and/or radiation.
46. The virus according to claim 45, characterised in that the cells are multiple-drug resistant.
47. A nucleic acid coding for a virus according to any of claims 1 to 46 or a part thereof.
48. Use of a virus according to any of claims 1 to 46 or a nucleic acid according to claim 47 or a vector comprising the same or a replication system comprising such nucleic acid or a part thereof, for the manufacture of a medicament.
49. Use of a virus according to any of claims 1 to 46 or a nucleic acid according to claim 47 for replication in cells, whereby the cells contain YB-1 in the nucleus, preferably contain YB-1 in the nucleus independent of the cell cycle, or the cells contain deregulated YB-1 or that the cells are tumor cells, preferably tumor cells which are resistant against cytostatics and/or radiation.
50. Use according to claim 49, characterised in that the cells contain YB-1 in the nucleus after or due to a measure which is applied to the cell or has been applied to the cell and is selected from the group comprising radiation, application of cytostatics and hyperthermia.
51. Use according to claim 48, characterised in that the medicament is for the treatment of tumors and/or cancer(s) and/or for the restoration of sensitivity of cells to cytostatics and/or radiation, whereby preferably the cells are tumor cells which are resistant against cytostatics and/or radiation.
52. Use according to claim 51, characterised in that at least one part of the cells forming the tumor are cells which have YB-1 in the nucleus, preferably contain YB-1 in the nucleus independent of the cell cycle, or that at least a part of the cells forming the tumor have deregulated YB-1 or at least a part of the cells forming the tumor are tumor cells, more preferably tumor cells which are resistant against cytostatics and/or radiation.
53. Use according to claim 52, characterised in that the cells, particularly the cells forming the tumor or parts thereof, are resistant, in particular multi-resistant against drugs, preferably antitumor agents and more preferably cytostatics.
54. Use according to any of claims 51 to 53, preferably 53, characterised in that the cells show an expression, more preferably an overexpression of the membrane bound transport protein P-glycoprotein.
55. Use according to any of claims 49 to 54, characterised in that the cells have YB-1 in the nucleus, and particularly that the cells forming the tumor or part thereof have YB-1 in the nucleus.
56. Use according to any of claims 49 to 55, characterised in that the tumor contains YB-1 in the nucleus after induction of the transport of YB-1 into the nucleus.
57. Use according to claim 56, characterised in that the transport of YB-1 into the nucleus is triggered by at least one measure which is selected from the group comprising radiation, application of cytostatics and hyperthermia.
58. Use according to claim 57, characterised in that the measure is applied to a cell, an organ or an organism.
59. Use of a virus replication system, particularly an adenoviral replication system, comprising a nucleic acid which codes for a virus, particularly an adenovirus, according to any of claims 1 to 46 or a part thereof, and comprising a nucleic acid of a helper virus, whereby the nucleic acid of the helper virus comprises a nucleic acid sequence which codes for YB-1, and optionally complements the virus, preferably for the manufacture of a medicament, more preferably for the treatment of tumors and/or cancer(s) and/or for restoration of the sensitivity of cells to cytostatics and/or radiation, whereby the cells are preferably tumor cells which are resistant against cytostatics and/or radiation.
60. Use of a viral replication system, preferably an adenoviral replication system according to claim 59, characterised in that the viral nucleic acid, preferably the adenoviral nucleic acid and/or the nucleic acid of the helper virus are present as replicable vector.
61. Use of a nucleic acid coding for a virus, preferably an adenovirus according to any of claims 1 to 46 for the manufacture of a medicament, preferably for the manufacture of a medicament for the treatment of tumors and/or for restoration of sensitivity of cells to cytostatics and/or radiation, whereby the cells are preferably tumor cells which are resistant against cytostatics and/or radiation.
62. Use according to claim 61, characterised in the cells, and particularly the cells forming the tumor or parts thereof, are resistant, in particular multiple-resistant against drugs, preferably antitumor agents and more preferably cytostatics.
63. A vector comprising a nucleic acid according to claim 47, preferably for the use according to any of claims 48 to 58.
64. Use of an agent interacting with YB-1 for the characterisation of cells, cells of a tumor tissue or patients, in order to determine whether such cells, cells of a tumor tissue or patients can/should be contacted and/or treated with a virus, particularly an adenovirus, according to any of claims 1 to 46 or a nucleic acid according to claim 47.
65. Use according to claim 64, characterised in that the agent is selected from the group comprising antibodies, high affinity binding peptides, antikalines, aptamers, aptazymes and spiegelmers.
66. A pharmaceutical composition comprising a virus according to any of claims 1 to 46, or a nucleic acid according to claim 47 or a viral replication system as described in claim 59 or 60.
67. The pharmaceutical composition according to claim 66, whereby the composition comprises at least one further pharmaceutically active agent.
68. The pharmaceutical composition according to claim 67, whereby the pharmaceutically active agent is selected from the group comprising cytokines, metalloproteinase inhibitors, angiogenesis inhibitors, cytostatics, cell cycle inhibitors, proteosome inhibitors, recombinant antibodies, inhibitors of the signal transduction cascade and protein kinases.
69. The pharmaceutical composition according to any of the preceding claims, characterised in that the composition comprises a combination of at least two compounds, whereby preferably any compound is each and independently selected from the group comprising cytostatics.
70. The pharmaceutical composition according to claim 69, characterised in that at least two of the compounds target different target molecules.
71. The pharmaceutical composition according to any of claims 68 to 70, preferably 70, characterised in that at least two of the compounds are active through different modes of action.
72. The pharmaceutical composition according to any of claims 69 to 71, characterised in that at least one compound increases the infectibility of a cell in which the virus is replicating.
73. The pharmaceutical composition according to any of claims 69 to 72, characterised in that at least one compound influences the availability of a compound in the cell, preferably increases the availability of the compound, whereby the compound mediates the uptake of the virus in one or the cell, preferably the one in which the virus replicates.
74. The pharmaceutical composition according to any of claims 69 to 73, characterised in that at least one of the compound mediates the transport of YB-1 into the nucleus, preferably increases the same.
75. The pharmaceutical composition according to any of claims 69 to 74, characterised in that at least one compound is a histone deacylase inhibitor.
76. The pharmaceutical composition according to claim 75, characterised in that the histone deacylase inhibitor is selected from the group comprising trichostatine A, FR 901228, MS-27-275, NVP-LAQ824, PXD101, apicidine and scriptaid.
77. The pharmaceutical composition according to any of claims 69 to 75, characterised in that at least one compound is selected from the group comprising trichostatine A, FR 901228, MS-27-275, NVP-LAQ824, PXD101, apicidine and scriptaid.
78. The pharmaceutical composition according to any of claims 69 to 77, characterised in that at least one compound is a topoisomerase inhibitor.
79. The pharmaceutical composition according to claim 78, characterised in that the topoisomerase inhibitor is selected from the group comprising camptothecin, irinotecan, toptecan, DX-8951f, SN-38, 9-aminocamptothecin, 9-nitrocamptothecin, daunorubicin and etoposid.
80. The pharmaceutical composition according to any of claims 67 to 79, and particularly 79, characterised in that the composition comprises trichostatine A and irinotecan.
81. The pharmaceutical composition according to any of claims 66 to 80, characterised in that the virus, in particular the virus according to any of claims 1 to 46 is separated from one or both or all of the at least two compounds.
82. The pharmaceutical composition according to claim 81, characterised in that at least one unit dose of the virus is separated from at least one unit dose of the or all further pharmaceutically active compound(s) or from one or the at least two compounds.
83. A kit comprising a virus, particularly a virus according to any of the preceding claims, and at least two pharmaceutically active agents, whereby each pharmaceutically active agent is individually and independently selected from the group comprising cytostatics.
Description
[0269] In the following the present invention shall be further illustrated by reference to the figures and examples from which new features, embodiments and advantages may be taken.
[0270]
[0271]
[0272]
[0273]
[0274]
[0275]
[0276]
[0277]
[0278]
[0279]
[0280]
[0281]
[0282]
[0283] The binding mechanism of E2F/RB and the E1A mediated release of E2F is substantially different from the mechanism underlying the present invention. The release of E2F from the Rb protein is not, as assumed in the prior art, an important, not to say the decisive step of adenoviral replication, but the nuclear localisation of the human transcription factor YB-1. This transcription factor is present in normal cells over the major part of the cell cycle only in the cytoplasm. After infection with an adenovirus it is induced in the nucleus under certain conditions or is already present in the nucleus in distinct cellular systems such as distinct tumor diseases, i. e. including, but not limited to, breast cancer, ovarian carcinoma, prostate cancer, osteosarcoma, glioblastoma, melanoma, small-cell carcinoma of the lung and colorectal cancer.
Example 1: Design of Various Protein IX Expressing Adenoviruses
[0284] Starting from the design depicted in
[0285] The adenovirus Xvir 05/promoter as depicted in
[0286] The adenovirus of the adenovirus Xvir05/E1A12S as depicted in
[0287] The adenovirus of adenovirus Xvir 05/E1B19K as depicted in
[0288] The adenovirus of adenovirus Xvir05/E3-IX as depicted in
[0289]
[0290] The virus depicted in
[0291] The adenovirus depicted in
[0292] Finally, the adenovirus of the invention as depicted in
[0293] The adenovirus of the invention depicted in
Example 2: Detection of Protein IX Expression
[0294] This experiment was carried out in order to confirm the relevance of the expression of protein IX for effective particle formation in YB-1 mediated replication. For such purpose the oncolytic, YB-1 dependent replicating adenovirus Xvir 03-03UTR was used which is described in the prior art and which is depicted in
[0295] When carrying out the experiment it was proceeded as follows: Per 10 cm dish 10.sup.6 293 and 257RDB cells were plated. At the next day the cells were, as depicted in
[0296] The result of this experiment is depicted in
[0297] As may be taken from
Example 3: Structure of Recombinant Adenoviruses Xvir05, Xvor05/Protein IX, Xvir05/01 and Xvir05/02
[0298] In vector Xvir05 the expression of, among others, the viral proteins E4orf6 and E1B55k is provided by the expression cassettes CMV-E4orf6 and RSV-E1B-region. This results in translocation of YB-1 into the nucleus. The E1A12S gene product, as well as the YB-1 gene product, under the control of the E2-late promoter, additionally promote viral replication. Additionally, the virus is capable of inhibiting the expression of the ABC transporters MRP and MDR1. Additionally, the proteins E1B19K and protein IX are expressed as part of the cassette RSV-E1B region.
[0299] The vector Xvir05-protein IX is a further vector development. There, the expression of the adenoviral protein IX which is present in the expression cassette E2late-E1A12S-IRES-protein IX is ensured. The vector does not contain the whole E1B region, but only the open reading frame of E1B55k.
[0300] The complete E1B region, i. e. E1B19k, E1B55k and protein IX are controlled by a viral, non-adenoviral promoter in case of vector Xvir05/01, such as the RSV promoter. The expression cassette E2-late-E1A12S-IRES-YB-1 is present in the E4 region. Thus specific therapeutic transgenes can be cloned into the E3 region. The E3 deletion is such that the adenoviral ADP protein adenoviral death protein can still be expressed. Additionally, the expression of E1A12S and E1B19k results in the expression of protein IX.
[0301] The vector Xvir05/02 additionally comprises an RGD motif in the H loop of the fibre knob in order to provide for better infection rates.
[0302] The preparation of the virus was as follows:
Modification of the Rescue Plasmid pAdEASY (Qbiogene)
Use of the Shuttle Vector pShuttle-AdEASY for the Preparation of a E3E4 Shuttle Vector
[0303] First a CMV promoter was introduced into the available vector pShuttle-AdEASY and a bovine growth hormone polyadenylation signal cloned into it. For such purpose the plasmid was digested with EcoRI, the ends made blunt-ended by filling with T4 polymerase and dNTPs, the backbone dephosphorylated and the two resulting cleavage products religated. By this procedure the restriction recognition sequences for EcoRI were destroyed. The plasmid thus obtained was referred to as pShuttle(-EcoRI)-AdEASY.
[0304] Subsequently, the cassette CMV-MCS-polyA was excised from the pShuttle of Clontech by using MfeI and EcoRI, the ends made blunt-ended and cloned into the vector pShuttle(-EcoRI)-AdEASY which was linearised with XbaI, made blunt-ended and dephosphorylated for such purpose. The plasmid CMV-MCS-PolyA-pShuttle-AdEASY was thus generated.
[0305] For the manipulation of the E3and E4 region the E3E4 region of the plasmid pAdEASY was cloned with SpeI and PacI into plasmid CMV-MCS-PolyA-pShuttle-AdEASY and thus the plasmid E3E4 pShuttle-AdEASY prepared. By restriction with NdeI and religation one of the two NdeI cleavage sites was deleted and thus also the multiple cloning site from the plasmid. By this procedure plasmid E3E4-pShuttle(-NdeI)-AdEASY was obtained.
E4 Manipulation
[0306] In order to provide space for potential therapeutic transgenes and in order to avoid an undesired homologous recombination, the E4 region in plasmid E3E4-pShuttle(-NdeI)-AdEASY was specifically deleted. For such purpose the E4orf6 region was truncated by about 634 bp by means of cleavage with PstI and religation=E3E4ORF6-pShuttle(-NdeI)-AdEASY. The respective deletions can be made in other systems for the generation of recombinant adenoviruses by a person skilled in the art.
Cloning of the RGD Motif in E3E4ORF6-pShuttle(-NdeI)-AdEASY
[0307] For an improved infectivity and referring to Dmitriev et al. 1998 (An Adenovirus Vector with Genetically Modified Fibers Demonstrates Expanded Tropism via Utilization of a Coxsackievirus and Adenovirus Receptor-Independent Cell Entry Mechanism) the HI loop of the fibre knob domain was modified: The respective region was amplified using the primers RGD-Hpa fw (5-GAGgttaacCTAAGCACTGCCAAG-3), RGD-EcoRV rev (5 CATAGAGTATGCAGATATCGTTAGTGTTACAGGTTTAGTTTTG-3) as well as RGD-EcoRV fw (5-GTAACACTAACGATATCTGCATACTCTATGTCATTTTCATGG-3) and RGD-BfrI rev (5-CAGCGACATGAActtaagTGAGCTGC-3) and thus an EcoRV cleavage site generated. Into this cleavage site paired oligonucleotides were cloned which coded for Arg-Gly-Asp (RGD) peptide: RGD-Oligo 1 (5-CACACTAAACGGTACACAGGAAACAGGAGACACAACTTGTGACTGCCGCGGAGA CTGTTTCTGCCC-3) and RGD-Oligo 2 (5-GGGCAGAAACAG TCTCCGCGGCAGTCA CAAGTTGTGTCTCCTGTTTCCTGTGTACCGTTTAGTGTG-3). By cloning into the HpaI and BfrI cleavage site in the E3E4ORF6-pShuttle (-NdeI)-AdEASY E3-RGD-E4ORF6-pShuttle (-NdeI)-AdEASY was generated. The RGD motif is present in the HI loop of the fibre knob domain.
Cloning of the E3a Region into the E3 Region of E3RGD-E4ORF6-pShuttle (-NdeI)-AdEASY.
[0308] For such purpose the vector pcDNA3.1(+) of Invitrogen was digested with BglII and BamHI, whereby the CMV promoter was removed and the vector religated (pcDNA3.1(+) without CMV=oCMV). To the SpeI and XhoI restriction sites of the pcDNA3.1(+) oCMV vector the 2709 bp fragment which was dissected with SpeI (27083 bp) and XhoI (29792 bp) from the wildtype virus DNA, was cloned into (pcDNA3.1(+) oCMV/E3aXhoI). Alternatively, one may cut at the 3 end with HpaI (30570 bp) rather than with XhoI. For such purpose the vector pcDNA31 (+) oCMV is then digested with SpeI and EcoRV and the adenoviral SpeI-HpaI-fragment cloned therein (pcDNA3.1(+) oCMV/E3aHpaI). A further option is provided by the 2718 bp EcoRI fragment from the adenovirus wildtype DNA (positions 27332 bp and 30050 bp) which is cloned into pcDNA3.1(+) oCMV which has been opened using EcoRI (pcDNA3.1(+) oCMV/E3aEcoRI).
[0309] Using pcDNA3.1(+) oCMV/E3a the E3a region could be cloned into the vector E3RGD-E4ORF6-pShuttle (-NdeI)-AdEASY: The shuttle vector E3RGD-E4ORF6-pShuttle (-NdeI)-AdEASY was digested with NheI for such purpose, the ends made blunt-ended and further digested with SpaI. The insert from pcDNA3.1(+) oCMV/E3aXhoI was cloned into this site: The plasmid was digested with XhoI for such purpose, the ends made blunt-ended and further digested with SpeI. The fragment thus excised was cloned into the previously cut open plasmid E3RGD-E4ORF6-pShuttle (-NdeI)-AdEASY.
[0310] The fragments SpeI-HpaI (position 27083 bp to 30570 bp) and EcoRI (position 27332 bp to 30050 bp) may be prepared in a similar manner from the respective pcDNA3.1(+) oCMV/E3a constructs and cloned.
[0311] Alternatively, the E3a region may be amplified by PCR using the primers E3a forward (SpeI) 5-CTTAAGGACTAGTTTCGCGC-3 and E3a reverse (XhoI, NheI) 5 CAAGCTAGCTCGAGGAATCATG-3 using the adenovirus type 5 wildtype DNA as template. With the E3a reverse primer a NheI cleavage site is generated. The amplificate is restricted with SpeI and NheI and cloned into the vector E3RGD-E4ORF6-pShuttle (-NdeI)-AdEASY also digested with SpeI and NheI.
For the SpeI-HpaI Fragment
[0312] Alternatively, the E3a region can be amplified by PCR using the primers E3a forward (SpeI) 5-CTTAAGGACTAGTTTCGCGC-3 and E3a reverse (HpaI, NheI) 5 CACGCTAGCAAGTTAACCATGTCTTGG-3 using the adenovirus type 5 wildtype DNA as template. Using the E3a reverse primer an NheI cleavage site is thus generated. The amplificate is restricted with SpeI and NheI and cloned into the vector E3RGD-E4ORF6-pShuttle (-NdeI)-AdEASY which is also opened by SpeI and NheI.
For the EcoRI Fragment
[0313] Alternatively, the E3a region can be amplified by PCR using the primers E3a forward (EcoRI) 5-GAAACCGAATTCTCTTGGAAC-3 and E3a reverse (NheI, EcoRI) 5 GAATTCTAGCTAGCTCAGCTATAG-3 using the adenovirus type 5 wildtype DNA as template. Using the E3a reverse primer an NheI cleavage site is thus generated. The amplificate is restricted with EcoRI and NheI and cloned into the vector E3RGD-E4ORF6-pShuttle (-NdeI)-AdEASY also cut open with EcoRI and NheI.
[0314] The cloning of the E3a region from pcDNA3.4+) oCMV/E3a in E3RGD-E4ORF6-pShuttle (-NdeI)-AdEASY E3aE3RGD-E4ORF6-pShuttle (-NdeI)-AdEASY was generated.
[0315] The thus cloned region comprises the E3 region until after the open reading frame for the E3 ADP (position 29772 bp) and thus the E3 promoter, the complete E3A region with the polyadenylation signal, the transcription start and the open reading frame for 12.5 K, E3 6.7 K, E3 gp19 K and E3 ADP.
[0316] The E3 region is, compared to the adenovirus type 5 DNA sequence, in case of SpeI-XhoI cloning deleted from position 29796 to 31509 bp (=1713 bp).
[0317] Further deletions between the E3 promoter and the open reading frame for the ADP are possible with plasmid pcDNA3.1(+) oCMV/E3a: By further restrictions between position 27596 bp and 29355 bp, for example with EcoRII, BsiWI, DraI, MunI, the open reading frames for 6.7 K and gp19 K which are present in between, may be removed and thus provided up to 1.8 kb of additional space for the incorporation of further transgenes. By a respective restriction the above noted E3A amplificates can also be truncated and be cloned as previously described.
Cloning of the Second Expression Cassette E1a 12S Under the Control of the E2 Late Promoter.
[0318] First, the E2 late promoter was cloned as paired oligonucleotide (upper primer 5-TCGAGCTCCGCATTTGGCGGGCGGGATTGGTCTTCGTAGAACCTAATCTCGTGGG CGTGGTAGTCCTCAGGTACAAAT-3 and lower primer 5-AGCTTATTTGTACCTGAGGACTACCACGCCCACGAGATTAGGTTCTACGAAGACC AATCCCGCCCGCCAAATGCGGAGC-3 in the HindIII and BglII cleavage site of the pGL3-enhancer plasmid of Promega (pGL3-E2Late).
[0319] Subsequently, the luciferase gene was excised with NcoI and XbaI, the ends made blunt-ended and T ends added. At the thus opened site the transgene E1A 12S which was amplified by RT-PCR using the primers E1a 12S forward 5-ATGGCCGCCAGTCTTTTG-3 and E1a 12S reverse 5-TTATGGCCTGGGGCGTTTAC-3, was introduced by TA cloning.
[0320] By doing so, the cassette contains the E2-late promoter, the open reading frame E1a-12S and the SV-40 late polyadenylation signal of the vector pGL3.
[0321] This cassette was excised with PvuI and ClaI, the ends made blunt-ended and can now alternatively be cloned into the E3a region which was deleted by EcoRII, BsiWI, DraI, MunI (after removal of the open reading frames for E3 6,7 K and gp19 K as above) or into the deletion of the E4ORF6, for example into the blunt-ended and phosphorylated BfrI cleavage site.
[0322] The thus generated construct is E3a/E2Late-E1a-12S/E3RGD-E4ORF6-pShuttle (-NdeI)-AdEASY or E3aE3RGD-E4ORF6/E2Late-E1a-12S-pShuttle (-NdeI)-AdEASY.
Cloning of the Second Expression Cassette E1a 12S with YB-1 Under the Control of the E2Late Promoter
[0323] The amplificates E1a 12S (as above) and the IRES element (pCITE-4a(+) of Novagen as template, IRES forward=5-TCCGGTTATTTTCCACCATATTGC-3 and IRES reverse=5-TTATCATCGTGTTTTTCAAAGG-3) were one after the other cloned into the multiple cloning site of the pcDNA3.1(+) vector (Invitrogen). For such purpose the E1a-12S amplificate was introduced into the blunt-ended BamHI cleavage site by TA cloning. Subsequently, the plasmid E1a-12S was linearised in pcDNA3.1(+) with EcoRV, T ends added and the amplificate for the IRES element introduced by cloning. The thus obtained construct E1a-12S-IRES-pcDNA3.1(+) was linearised with NotI and the ends made blunt-ended; also the YB-1-EcoRI cleavage product from the plasmid pHVad2c CMV/S40+Yb-1 s (Stephan Bergmann) was made blunt-ended and introduced into the dephosphorylated vector E1A-12S-IRES-pcDNA3.1(+). Alternatively, the PCR amplificate for the open reading frame of protein IX may be introduced into the blunt-ended NotI cleavage site of the vector E1a-12S-1RES-pcDNA3.1(+) after addition of T ends, more specifically using the primers IX forward 5-ATGAGCACCAACTCGTTTG-3 and IX reverse 5 GTTTTAAACCGCATTGGGAGG-3.
[0324] The cassette E1A-12S-IRES-YB-1 or E1A-12S-IRES protein IX was excised with PmeI and cloned into the above-described plasmid pGL3-E2Late after removal of the luciferase gene with NcoI and XbaI and blunt-ending and dephosphorylation.
[0325] This cassette E2late-E1A-12S-IRES-YB-1 was excised with PvuI and ClaI, the ends made blunt-ended and can now alternatively be cloned into the EcoRII, BsiWI, DraI, MunI deleted E3a region (after removal of the open reading frames for E3 6,7 K and gp19 K, see above), or into the deletion of the E4ORF6, for example into the blunt-ended and dephosphorylated BfrI cleavage site.
[0326] The thus obtained construct is E3a/E2Late-E1a-12S-IRES-YB-1/E3RGD-E4ORF6-pShuttle (-NdeI)-AdEASY or E3aE3RGD-E4ORF6/E2Late-E1a-12S-IRES-YB-1-pShuttle (-NdeI)-AdEASY.
Generation of the Rescue Plasmid E3a/E2Late-E1a-12S/E3RGD-E4ORF6-pAdEASY or E3aE3RGD-E4ORF6/E2Late-E1a-12S-pAdEASY or E3a/E2Late-E1a-12S-IRES-YB-1/E3RGD-E4ORF6-pAdEASY or E3aE3RGD-E4ORF6/E2Late-E1a-12S-IRES-YB-1-pAdEASY, Respectively
[0327] The E3aE3RGD-E4ORF6 region with the second expression cassette E2Late-E1a-12S or E2Late-E1a-12S-IRES-YB-1 in E3a or E4ORF6 was excised with SpeI and PacI from the corresponding pShuttle plasmid E3aE3RGD-E4ORF6-pShuttle (-NdeI)-AdEASY and cloned into the corresponding opened vector pAdEASY, which created the new rescue vector E3a/E2Late-E1a-12S/E3RGD-E4ORF6-pAdEASY or E3aE3RGD-E4ORF6/E2Late-E1a-12S-pAdEASY or E3a/E2Late-E1a-12S-IRES-YB-1/E3RGD-E4ORF6-pAdEASY or E3aE3RGD-E4ORF6/E2Late-E1a-12S-IRES-YB-1-pAdEASY, respectively.
[0328] E3aE3RGD-E4ORF6-pAdEASY contains the E3a region, an RGD motif and a deleted E4ORF6, as a second expression cassette either E2Late-E1a-12S or E2Late-E1a-12S-IRES-YB-1 are present in E3a or E4ORF6. This construct is the rescue plasmid for the introducing of further transgenes into the E1 region by a shuttle plasmid.
Preparing the Transgene Cassette for the E1 Region
Cloning of the E1B Region
[0329] For the E1B region the adenoviral genome was restricted with XbaI (position 1340 bp) and MunI (position 3925 bp) and the 2585 bp fragment was cloned into the pShuttle of AdEASY into the XbaI and MunI cloning sites which thus contains the complete E1B area (pShuttle/E1B).
[0330] Alternatively, the E1B region can be amplified by PCR with the primers E1B forward 5-GTGTCTAGAGAATGCAATAGTAG-3 and E1B reverse 5-GTCAAAGAATCCAATTGTGC-3 using the adenovirus type 5 wildtype DNA as template, be restricted with XbaI and MunI and cloned into the XbaI and MunI cleavage sites of the pShuttle of AdEASY.
[0331] Thus the pShuttle/E1B comprises the E1B promoter, the open reading frames for E1B19K, E1B55K and protein IX and the natural Poly-A part. The E1B promoter was removed by means of XbaI and HpaI, the ends of the vector made blunt-ended and replaced by the CMV promoter from pcDNA3.1(+) of Invitrogen which was cleaved with MluI and XhoI and the ends of which were also made blunt-ended. Alternatively, rather than the CMV promoter, an RSV promoter or a tumor-specific and viral promoters, respectively, for example the promoters mentioned in the patent, can control the expression of the E1B region.
Preparing the RSV Plasmid for the Preparation of the Cassette RSV-E4ORF6-polyA.
[0332] Plasmid pRc/RSV of Invitrogen was cleaved with XhoI, SpeI and XbaI. The thus resulting 2810 bp and 278 bp fragments were religated such that by doing so the F1 origin and the neomycine resistance gene (oNeo) were removed.
[0333] The thus obtained vector pRc/RSV (oNeo) comprises only one BamHI cleavage site into which the open reading frame for E4ORF6 from plasmid CGN from Dobbelstein was cloned. Alternatively, the amplificate of a PCR using the primers E4ORF6-forward 5-ATGACTACGTCCGGCGTTCC-3 and E4ORF6-reverse 5-CTACATGGGGGTAGAGTC-3 can be introduced into the EcoRV cleavage site of the vector pRc/RSV (oNeo) after adding the T ends (TA cloning). Alternatively, rather than the RSV promoter (by excision using MliI and HindIII), a CMV promoter (obtained from the pcDNA3.1(+) by excision with MluI and HindIII) or a tumor-specific and viral promoter, respectively, for example the promoters described in the patent, can control the expression of E4orf6.
[0334] The cassette RSV-E4ORF6-polyA (the bovine growth hormone polyadenylation signal is derived from plasmid pRC/RSV) was cleaved with MunI, the ends made blunt-ended and further excised with XhoI from the plasmid. The expression cassette was subsequently cloned into the vector pShuttle/E1B which had been cleaved by NotI, made blunt-ended and subsequently cleaved with XhoI. From this vector RSV-E4ORF6-polyA/E1B-pShuttle-AdEASY was obtained.
Introducing the Transgenic Cassette into the Rescue Vector
[0335] The vector RSV-E4ORF6-polyA/E1B-pShuttle-AdEASY for the E1-Bereich was linearised using Bst1 107I and MroI and introduced together with the rescue plasmid (see above) into BJ5183 (EC) bacteria by means of electroporation. The adenoviral plasmid RSV-E4ORF6-polyA/E1B-E3a/E2Late-E1a-12S/E3RGD-E4ORF6-pAdEASY was generated (or in a corresponding manner with the other above mentioned rescue vector variants) by homologous recombination which resulted in virus production after transfection in HEK293 cells.
[0336] It is within the present invention and obvious for a person skilled in the art in the light of the present disclosure that other systems, such as, for example, pAdenoX-System of Clontech/BD Biosciences or the system of Microbix may be used for the manufacture of the adenoviruses, preferably recombinant adenoviruses, according to the invention, in particular those which contain the above expression cassettes individually and/or in any combination.
[0337] The features disclosed in the preceding description, the claims as well as the figures may be individually or in any combination essential for the practising of the invention in its various embodiments.