Method for improved protein production in filamentous fungi

09695430 ยท 2017-07-04

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to a method for genetically modifying a filamentous fungus host for improved protein production. The method comprises that a filamentous fungus host is genetically modified to overexpress or to be deficient of specific genes. The invention relates also to the modified hosts. Furthermore, the invention relates to a method for improved production or for producing an improved composition of proteins, such as cellulases, hemicellulases, other proteins involved in the degradation of lignocellulosic material, or other proteins, in a filamentous fungus host.

Claims

1. A method to genetically modify a filamentous fungus host for improved protein production, said method comprising genetically modifying a filamentous fungus host to overexpress with increased amount or activity, or to be deficient with reduced or lacking amount or activity of one or more genes selected from the group consisting of genes tre66966 having a nucleotide sequence according to SEQ ID NO:1, tre112524 having a nucleotide sequence according to SEQ ID NO:2, tre123668 having a nucleotide sequence according to SEQ ID NO:3, and tre120120 having a nucleotide sequence according to SEQ ID NO:5; or coding region of any of genes tre66966 (SEQ ID NO:1), tre112524 (SEQ ID NO2), tre123668(SEQ ID NO:3) or tre120120 (SEQ ID NO:5), said host being capable of increased or decreased production of cellulase, hemicellulase, other proteins involved in degradation of lignocellulosic material and/or other proteins as compared to parental strain.

2. The method according to claim 1, wherein the filamentous fungus host is genetically modified to overexpress one or more of the genes selected from the group consisting of genes tre66966 having a nucleotide sequence according to SEQ ID NO:1, tre112524 having a nucleotide sequence according to SEQ ID NO:2, tre123668 having a nucleotide sequence according to SEQ ID NO:3, and tre120120 having a nucleotide sequence according to SEQ ID NO:5; or a coding region of any of genes tre66966 (SEQ ID NO:1), tre112524 (SEQ ID NO2), tre123668 (SEQ ID NO:3) or tre120120 (SEQ ID NO:5), said host being capable of increased production of cellulase, hemicellulase, other proteins involved in degradation of lignocellulosic material and/or other proteins as compared to the parental strain.

3. The method according to claim 1, wherein the filamentous fungus host is genetically modified to be deficient of one or more of the genes selected from the group comprising genes tre66966 having a nucleotide sequence according to SEQ ID NO:1, tre112524 having a nucleotide sequence according to SEQ ID NO:2, tre123668 having a nucleotide sequence according to SEQ ID NO:3, and tre120120 having a nucleotide sequence according to SEQ ID NO:5; or a coding region of any of genes tre66966 (SEQ ID NO:1), tre112524 (SEQ ID NO:2), tre123668 (SEQ ID NO:3) or tre120120 (SEQ ID NO:5), said host being capable of decreased production of cellulase, hemicellulase, other proteins involved in degradation of lignocellulosic material and/or other proteins as compared to the parental strain.

4. The method according to claim 1, wherein the host is selected from the group consisting of Trichoderma, Aspergillus, Fusarium, Neurospora, Talaromyces, Phanerochaete, Chrysosporium and Penicillium.

5. A filamentous fungus host genetically modified to overexpress or to be deficient of one or more genes selected from the group consisting of genes tre66966 having a nucleotide sequence according to SEQ ID NO:1, tre112524 having a nucleotide sequence according to SEQ ID NO:2, tre123668 having a nucleotide sequence according to SEQ ID NO:3, and tre120120 having a nucleotide sequence according to SEQ ID NO:5; or a coding region of any of genes tre66966 (SEQ ID NO:1), tre112524 (SEQ ID NO:2), tre123668 (SEQ ID NO:3) or tre120120 (SEQ ID NO:5), said host being capable of increased or decreased production of cellulase, hemicellulase, other proteins involved in degradation of lignocellulosic material and/or other proteins as compared to the parental strain.

6. The host according to claim 5, wherein the filamentous fungus host is genetically modified to overexpress one or more genes selected from the group consisting of genes tre66966 having a nucleotide sequence according to SEQ ID NO:1, tre112524 having a nucleotide sequence according to SEQ ID NO:2, tre123668 having a nucleotide sequence according to SEQ ID NO:3, and tre120120 having a nucleotide sequence according to SEQ ID NO:5; or a coding region of any of genes tre66966 (SEQ ID NO:1), tre112524 (SEQ ID NO2), tre123668 (SEQ ID NO:3) or tre120120 (SEQ ID NO:5), said host being capable of increased production of cellulase, hemicellulase, other proteins involved in degradation of lignocellulosic material and/or other proteins as compared to the parental strain.

7. The host according to claim 5, wherein the filamentous fungus host is genetically modified to be deficient of one or more genes selected from the group consisting of genes tre66966 having a nucleotide sequence according to SEQ ID NO:1, tre112524 having a nucleotide sequence according to SEQ ID NO:2, tre123668 having a nucleotide sequence according to SEQ ID NO:3, and tre120120 having a nucleotide sequence according to SEQ ID NO:5; a coding region of any of genes tre66966 (SEQ ID NO:1), tre112524 (SEQ ID NO2), tre123668 (SEQ ID NO:3) or tre120120 (SEQ ID NO:5), said host being capable of decreased production of cellulase, hemicellulase, other proteins involved in degradation of lignocellulosic material and/or other proteins as compared to the parental strain.

8. The host according to claim 5, wherein the host is selected from the group consisting of Trichoderma, Aspergillus, Fusarium, Neurospora, Talaromyces, Phanerochaete, Chrysosporium and Penicillium.

9. A method for improved production or for producing an improved composition of proteins in a filamentous fungus host, said method comprising a step of cultivating the modified filamentous fungus host of claim 5 under suitable culture conditions for protein production.

10. The method according to claim 9, wherein the protein is selected from the group consisting of cellulases, hemicellulases, side chain cleaving enzymes, lignocellulose.

11. The method according to claim 9, wherein the protein is a heterologous or recombinant protein and expressed under a promoter of a gene encoding any one of the proteins whose production is effected by genetical modification of the host.

12. The method according to claim 11, wherein the the promoter is a promoter of a gene encoding a cellulase, a hemicellulase, other protein involved in the degradation of lignocellulosic material or other secreted protein.

13. The method according to claim 11, wherein the promoter is a promoter of a gene encoding a protein selected from the group consisting of cellulases, hemicellulases, side chain cleaving enzymes, lignocellulose degrading enzymes, pectinases, ligninases; amylolytic enzymes; proteases; invertases; phytases, phosphatases and hydrophobins.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1-5 present the results of protein production by strains genetically modified to overexpress a specific gene.

(2) FIG. 6A Biomass (g/l) in T. reesei precultures before induction of hydrolytic enzyme production and in the uninduced control cultures at the sampling time points of the induction experiment.

(3) FIG. 6B pH of the T. reesei cultures induced either with Avicel, spruce, wheat straw or sophorose, as well as the precultures before induction and the uninduced control cultures.

(4) FIG. 7A. Transcript levels of a set of known genes encoding hydrolytic enzymes during an induction experiment: abf1 (arabinofuranosidase 1), bga1 (beta-galactosidase 1), bgl1 (beta-glucosidae 1), bxl1 (beta-xylosidase 1), cip1 (cellulose-binding), cip2 ( ) egl1 (endoglucanase 1), glr1 (glucuronidase 1), man1, xyn2 and xyn4.

(5) FIG. 7B Transcript levels of a set of known genes encoding hydrolytic enzymes during an induction experiment: abf1 (arabinofuranosidase 1), bga1 (beta-galactosidase 1), bxl1 (beta-xylosidase 1), cip2 ( ), glr1 (glucuronidase 1), and xyn2.

(6) FIG. 8 Schematic view of the plasmid constructs made for transforming the strain T. reesei QM9414 and generating the strains overexpressing the genes encoding putative regulatory factors. The gene is inserted in the plasmid vector by replacing the region between attR1 attR2 sites containing the genes ccdB and CmR with the gene specific sequences. The names of the plasmids and the corresponding T. reesei strains obtained by transformation and the corresponding gene inserted in the plasmid are listed.

DETAILED DESCRIPTION OF THE INVENTION

(7) The present invention relates to improved production of various proteins in filamentous fungi. The invention is based on the finding of regulatory factors which affect the production of various proteins, in particular hydrolytic enzymes. Within the scope of the present invention are cellulases, such as cellobiohydrolases, endoglucanases and -glucosidases; and hemicellulases, such as xylanases, mannases, -xylosidases; and side chain cleaving enzymes, such as arabinosidases, glucuronidases, acetyl xylan esterases; and other lignocellulose degrading enzymes, in particular pectinases, such as endo- and exopolygalacturonases, pectin esterases, pectin and pectin acid lyase; and ligninases, such as lignin peroxidases, Mn peroxidases, laccases; amylolytic enzymes, such as -amylases, glucoamylases, pullulanases, cyclodextrinases; hydrophobins; proteases (serine, aspartic, glutamic, metallo proteases, acidic, alkaline); invertases; phytases; phosphatases, and hydrophobins.

(8) By overexpressing specific genes and/or by making deficient specific genes which encode the regulatory factors in the fungal host, it is possible to increase or alter the production of endogenous proteins, in particular hydrolytic enzymes, such as cellulases, hemicellulases, lignocellulose degrading enzymes, other proteins involved in the degradation of lignocellulosic material or other proteins, typically secreted proteins. It is also possible to produce heterologous or recombinant proteins under the regulation of the promoters of the affected genes, such as cellulase or hemicellulase gene promoters, or promoters of other genes encoding proteins involved in the degradation of lignocellulosic material or other secreted protein promoters, by good yield in the modified host.

(9) Described herein are methods used in modifying filamentous fungi hosts, such as Trichoderma, Aspergillus, Fusarium, Neurospora, Talaromyces, Phanerochaete, Chrysosporium and Penicillium. In these methods are used genes selected based on expression of the genes in cultures grown on different substrates and by sequence data of the genes. The sequence preferably comprises a sequence domain characteristic for genes encoding regulatory proteins, such as transcription factors, other transcriptional regulators, protein kinases, proteins involved in histone modification or chromatin remodelling, or the genes are preferably co-regulated with cellulase or hemicellulase genes in the genome of a filamentous fungus host.

(10) Overexpression of a gene (here in particular a regulating gene) can be carried out for example by introducing into a fungus host an additional copy or copies of a specific gene, or expressing the gene under another promoter resulting in increased expression of the gene, or otherwise genetifically modifying the fungus host so that either the gene is more abundantly expressed or the activity of the gene product is increased. The effect of overexpression of a gene on protein production can be studied by culturing the modified host under conditions suitable for protein production. The effect on the production of an endogenous protein or proteins can be studied by determining for example a specific enzyme activity, determining the amount of total protein, or determining the amount of specific endogenous or heterologous protein produced.

(11) Making deficient of a gene means either a genetic modification of the fungus host to delete or truncate a specific gene (here in particular a regulating gene) or a genetic modification of the fungus host resulting in reduced or lacking expression of the gene or reduced or lacking activity of the gene product by any suitable method. By inactivation is meant a genetic modification (usually deletion) resulting in complete loss of activity of a gene product. In this invention, the effect of the genetic modification of a specific gene on protein production can be studied by determining for example a specific enzyme activity, determining the amount of total protein, or determining the amount of specific endogenous or heterologous protein produced.

(12) By a regulatory gene is meant here a gene whose function has an effect on production of proteins by the fungal host. Overexpression of the gene (as described above) or making deficient of a gene (as described above) has an effect on protein production by the fungus. The gene can encode for example a transcription factor, other transcriptional regulator, a protein kinase, a protein involved in histone modification or chromatin remodelling, or other regulatory protein.

(13) By inducing substrates are meant here substrates capable of inducing the production of hydrolytic enzymes or lignocelluloses degrading enzymes, such as cellulase or hemicellulase, other protein involved in the degradation of lignocellulosic material, or other proteins, typically secreted proteins, or proteins produced using promoters of genes encoding secreted proteins. For the purpose of studying the genes encoding the mentioned enzymes, for example substrates, such as Avicel, pretreated wheat straw, pretreated spruce, lactose, spent grain extract or sophorose, or other plant derived carbon sources, can be used. Pretreatment of spruce and wheat can be carried out by using steam explosion and washing the treated material. The fibrous fraction of the material can be used for the induction.

(14) In one aspect improved production may mean improved production of a desired enzyme or other protein. As disclosed herein a filamentous fungus host may be constructed to overexpress a specific regulatory gene or genes, or may be constructed to be deficient in a specific other regulatory gene or genes, in order to improve the protein production.

(15) By suitable culture conditions for protein production is meant here any culture conditions suitable for producing a desired protein or a combination of desired proteins. Conditions for producing hydrolytic enzymes or lignocelluloses degrading enzymes, such as cellulase or hemicellulase, other protein involved in the degradation of lignocellulosic material or for many secreted or other proteins, are well known for a person skilled in the art.

(16) By improved production is here meant in one aspect increased amount of protein produced. The protein may be produced into the culture medium or into the host cell, preferably into the culture medium. Increased production may be detected for example as higher maximal level of protein or enzymatic acitivity, such as cellulase or hemicellulase activity, or total extracellular protein produced as compared to the parent host. In addition, or alternatively, improved protein production may be detected as a higher level of produced enzymatic activity or protein produced at any time point of cultivation which results in higher production level at earlier stages in cultivation and thus in faster production process as compared to parent host strain. Improved production may mean also increased production of secreted protein or enzymatic activity per biomass amount in the culture. Protein production by a lower amount of biomass is beneficial due to easier down stream-processing of the protein product and reduced consumption of nutrients during the production process. Also, a desired effect of the genetic manipulation of the production strain is lowered viscosity of the production culture due to e.g. lowered biomass amount in the production process or due to other properties of the strain. Cellulase and hemicellulase activities can be measured using a variety of methods using different substrates (for examples of the methods, see: Zhang Y. H., Hong J., Ye X., Cellulase assays, Methods Mol. Biol., (2009), 581:213-231; Sharrock K. R., Cellulase assay methods: a review, J. Biochem. Biophys. Methods. (1988), 17:81-105; T. K. Ghose, Measurement of cellulase activities, (1987), Pure & Appl. Chem., 59, 257-268; T. K. Ghose and V. S. Bisaria, Measurement of hemicellulase activities. Pure & Appl. Chem., (1987), 59, 1739-1752). Cellulase acitivity can be measured e.g. as enzymatic activity against the substrate, 4-methylumbelliferyl--D-lactoside (MULac). Methods for measuring the combined activity of CBHI, EGI and -glucosidase (referred here as total MULac activity), as well as the separate activities of the enzymes, using MULac as substrate have been described (Bailey and Thtiharju, 2003; Collen et al., 2005; van Tilbeurgh et al., 1982, 1985, 1988). Other substrates often used for cellulase activity measurements include e.g. CMC cellulose, hydroxyethylcellulose and filter paper. The hemicellulase activity can be measured e.g. as activity against the birch xylan substrate (Bailey et al., 1992, Bailey M. J., Biely, P. and Poutanen, K. (1992) Interlaboratory testing of methods for assay of xylanase activity. J. Biotechnol. 23: 257-270), and production of total extracellular protein by using any of the methods for measurement of protein concentration known in the art, for example using Bio-Rad Protein Assay (Bio.Rad) Growth and progress of the cultivation of filamentous fungi can be determined by measuring the production of biomass and by measuring the pH of the culture medium. Induction of protein production, and differences in gene expression level can be analysed by isolation of RNA and subjecting the samples to micro array hybridisation analysis or Northern hybridisation or TRAC analysis (Rautio, J. J., Smit, B. A., Wiebe, M., Penttil, M. & Saloheimo, M. 2006. Transcriptional monitoring of steady state and effects of anaerobic phases in chemostat cultures of the filamentous fungus Trichoderma reesei. BMC Genomics 7, article number 247. 15 p. 10.1186/1471-2164-7-247).

(17) Improved CBHI activity may be detected by higher production level of enzyme activity against MULac substrate using a method modified for analysis of CBHI activity.

(18) Improved EGI activity may be detected by higher production level of enzyme activity against MULac substrate and especially by higher activity against MULac substrate under conditions measuring specifically the activity of EGI.

(19) The increased hemicellulase production may be detected by higher production level of enzyme activity against birch xylan substrate.

(20) In one embodiment the protein can be an endogenous protein, in particular a hydrolytic enzyme, such as cellulase, hemicellulase or lignocellulose degrading enzyme, or other secreted protein. More specifically the protein can be a cellulase or hemicellulase.

(21) In another embodiment the protein may be any protein which is produced under the promoter of the affected endogenous genes. The protein may be produced for example under various cellulase or hemicellulase gene promoters, such as promoters of genes encoding CBHI, EGI or XYNI.

(22) Improved protein production may mean altered content of the proteins produced by the fungus host, and production of a desired protein or a protein mixture. As disclosed herein a filamentous fungus host may be constructed to overexpress a specific regulatory gene or genes, or may be constructed to be deficient in a specific other regulatory gene or genes, in order to alter the protein production compared to the parental host.

(23) By the term endogenous proteins are meant here proteins which are natural products of a filamentous fungus host.

(24) By a heterologous protein is meant a protein that is not a natural product of the fungal species.

(25) By recombinant proteins are meant here proteins that are not natural products of a filamentous fungus or that are produced by a non-natural construction in a filamentous fungus. DNA sequences encoding desired homologous or heterologous proteins may be transferred by a suitable method to a host.

(26) By secretable protein or secreted protein is meant here a protein that is secretable or secreted outside of the host cell to the culture medium.

(27) By increased protein production is meant protein production which is a least 3%, preferably at least 5%, more preferably at least 10%, still more preferably at least 20%, still more preferably at least 30% or most preferably at least 50% better than protein production by using the parent fungal host strain which has not been genetically modified.

(28) By reduced protein production is meant protein production which is at least 3%, preferably at least 5%, more preferably at least 10%, still more preferably at least 20%, still more preferably at least 30% or most preferably at least 50% lower than protein production by using the parent fungal host strain which has not been genetically modified.

(29) One embodiment of the invention comprises the expression of gene sequences responsible of regulating the production of hydrolytic enzymes. The genes may increase or decrease the enzyme production, or they may increase the production of some enzyme activities and decrease other enzyme activities.

(30) Genetical modification of a filamentous fungus host means here any genetic modification method by which a filamentous fungus host is modified to overexpress a specific regulatory gene or to gain modified properties of the gene or genes and/or to be deficient of the gene or genes.

(31) Genetical modification methods for the strains of Trichoderma, Aspergillus, Fusarium, Neurospora, Phanerochaete, Talaromyces, Chrysosporium and Penicillium are available and well known for a person skilled in the art (Sambrook et al., 1989, Penttil et al., 1987; Jain et al., 1992; Austin et al., 1990; Bull et al., 1988; Maier et al., 2005; Akileswaran et al., 1993).

(32) Penttil M, Nevalainen H, Rtt M, Salminen E, Knowles J. (1987) A versatile transformation system for the cellulolytic filamentous fungus Trichoderma reesei. Gene. 1987; 61:155-64.

(33) Jain S, Durand H, Tiraby G. (1992) Development of a transformation system for the thermophilic fungus Talaromyces sp. CL240 based on the use of phleomycin resistance as a dominant selectable marker. Mol Gen Genet. 1992 September; 234(3):489-93.

(34) Austin B, Hall R M, Tyler B M. (1990) Optimized vectors and selection for transformation of Neurospora crassa and Aspergillus nidulans to bleomycin and phleomycin resistance. Gene. 1990 93:157-62.

(35) Bull J H, Smith D J, Turner G. (1988) Transformation of Penicillium chrysogenum with a dominant selectable marker. Curr Genet. 1988 May; 13(5):377-82.

(36) Maier F J, Malz S, Lsch A P, Lacour T, Schfer W. (2005) Development of a highly efficient gene targeting system for Fusarium graminearum using the disruption of a polyketide synthase gene as a visible marker. FEMS Yeast Res. 2005 April; 5(6-7):653-62.

(37) Akileswaran L, Alic M, Clark E K, Hornick J L, Gold M H. (1993) Isolation and transformation of uracil auxotrophs of the lignin-degrading basidiomycete Phanerochaete chrysosporium. Curr Genet. 1993; 23(4):351-6.

(38) By gene is meant here in particular a gene or genes encoding regulatory proteins, such as transcription factors, other transcriptional regulators, protein kinases, proteins involved in histone modification or chromatin remodelling, or genes located near cellulase or hemicellulase genes (co-expressed) in the genome of a filamentous fungus host. The genes have been selected by using the method as described herein. The function of the genes has been exemplified in Trichoderma, in particular in T. reesei which show the effect of these genes in protein production. Modification of the genes in other filamentous fungi, in particular Aspergillus will be useful for improved protein production. The gene in the present invention is preferably a Trichoderma gene. Within the scope of the present invention are also the closest homologues of the genes in other species of filamentous fungi and nucleotide sequences hybridizing under stringent conditions to said genes or said homologues. Within the scope of the present invention are also fragments, derivatives or other nucleotide sequences of said genes hybridizing under stringent conditions to said genes or said homologue. The gene may be isolated, which means that it is isolated from its natural components. The gene may be partly or completely synthetic. Within the scope of the present invention are also derivatives of said gene, which refer to nucleic acid sequences comprising deletions, substitutions, insertions or other modifications compared to said gene, but having the same or equivalent function as said gene.

(39) A fungal host denotes here any fungal host strains selected or genetically modified to produce (or not produce) efficiently a desired product and is useful for protein production for e.g. analytical, medical or industrial use. A fungal host is in particular a fungal production host that is suitable for industrial production of certain protein products. The host strain is preferably a recombinant strain modified by gene technological means to efficiently produce a product of interest. The fungal host may belong for example to Trichoderma, Aspergillus, Fusarium, Neurospora, Talaromyces, Phanerochaete, Chrysosporium or Penicillium genera. Typically the host is Trichoderma or Aspergillus host.

(40) The closest homologue of a Trichoderma gene in other species of filamentous fungi means here a gene that has the highest percentage of identical nucleotides with the Trichoderma gene of all the genes of the organism; or a gene whose protein product has the highest percentage of identical amino acids with the protein product encoded by the Trichoderma gene of all the gene products of the organism. The sequence identity of homologous regulatory genes in different organisms is typically very low. Typically, the sites binding either to DNA or other protein factors involved in the regulation event share homology, but the intervening sequences between these sites may not be conserved.

(41) Therefore the total % of sequence identity of homologous regulatory genes in different organisms remains relatively low. However, the percentage of sequence identity in the aligned nucleotide sequence can be used as a measure to identify the closest homologue of the gene in the other organism, thus a likely functional counterpart of the gene in the other organism. Software and algorithms for homology searches as well as public databases with whole geneome sequence information for a variety of species exist, such as the BLAST program (Stephen F. Altschul, Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), Gapped BLAST and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Reference for compositional score matrix adjustment: Stephen F. Altschul, John C. Wootton, E. Michael Gertz, Richa Agarwala, Aleksandr Morgulis, Alejandro A. Schaffer, and Yi-Kuo Yu (2005) Protein database searches using compositionally adjusted substitution matrices, FEBS J. 272:5101-5109) and the NCBI database.

(42) A specific gene is here represented by a specific sequence (SEQ ID NO). The effect of the gene has been shown by using the sequence of a specific SEQ ID NO (which is here a Trichoderma sequence). The sequence may comprise additional sequence in front of and/or after the coding region of the gene. As described here, instead of the Trichoderma sequence, the closest homologue from another filamentous fungus could be used. As is known to a person skilled in the art, also sequences hybridizing under stringent conditions to the Trichoderma sequence or to its closest homologue, could be used. wherein stringent conditions refer here to an overnight incubation at 42 degree C. in a solution comprising 50% formamide, 5SSC (750 mM NaCl, 75 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5Denhardt's solution, 10% dextran sulfate, and 20 g/ml denatured, sheared salmon sperm DNA, followed by washing the filters in 0.1SSC at about 65 degree C.

(43) The detection methods of cellulase activity, CBHI activity or EGI activity are well known for a person skilled in the art. The methods are described for example in Bailey and Thtiharju, 2003; Collen et al., 2005; van Tilbeurgh et al., 1982, 1985, 1988. Colln, A., Saloheimo, M., Bailey, M., Penttil, M. & Pakula, T. M. (2005) Protein production and induction of the unfolded protein response in Trichoderma reesei strain Rut-C30 and its transformant expressing endoglucanase I with a hydrophobic tag. Biotech. Bioeng. 89, 335-344. Bailey M J, Thtiharju J. 2003. Efficient cellulase production by Trichoderma reesei in continuous cultivation on lactose medium with a computer-controlled feeding strategy. Appl Microbiol Biotechnol 62:156-62.van Tilbeurgh H, Claeyssens M, de Bruyne C. 1982. The use of 4-methylumbelliferyl and other chromophoric glycosidases in the study of cellulolytic enzymes. FEBS Lett 149:152-156.van Tilbeurgh H, Loontiens F G, de Bruyne C K, Claeyssens M. 1988. Fluorogenic and chromogenic glycosides as substrates and ligands of carbohydrates. Methods Enzymol 160:45-59.van Tilbeurgh H, Pettersson G, Bhikabhai R, De Boeck H, Claeyssens M. 1985. Studies of the cellulolytic system of Trichoderma reesei QM 9414. Reaction specificity and thermodynamics of interactions of small substrates and ligands with the 1,4-beta-glucan cellobiohydrolase II. Eur J Biochem 148:329-34.

(44) The cultures of the strains modified for the regulatory genes can be analysed for the produced protein pattern more in detail using a broader set of enzyme activity measurements specific for different enzymes. In addition, the produced protein pattern can be analysed using 2D gel electrophoresis followed by identification of the proteins by mass spectrometry. The 2D gel analysis can reveal also quantitative differences in the produced protein patterns between the cultures of the different strains. This information can reveal specific sets of produced proteins that are affected by the specific genetic modification. Furthermore, additional genetically modified strains can be constructed to be able to analyse the effects of both the overexpression and the deficiency (typically deletion) of the gene, and by these means to reveal the target genes and proteins whose function is affected by the modification of the gene, and to demonstrate the effect of the specific gene modification on the produced protein pattern. These genetically modified strains can also be subjected to transcriptional profiling in order to elucidate the effect of the genetic modification on the gene expression levels and to reveal target genes affected by the modification. The information of the effects of the genetic modification on the produced protein pattern (from the enzyme assays and 2D gel analysis of the culture supernatants) as well as information on the transcriptional responses caused by the genetic modification, and the target genes for the regulatory events it is possible to modify the protein production properties and efficiency, as well as the composition of the protein mixture produced into the culture medium in a defined way.

(45) The improvement in protein production process can mean either increased production of all the secreted proteins, or improved production of a specific set of proteins, or reduced production of unwanted products, or a faster or shorter production process for the protein, or a production process with less consumption of nutrients for other products than proteins (e.g. for biomass, or unwanted side-products), or better physico-chemical properties protein producing unit (e.g. less viscose cultivation, better morphology of the production host), or better down-stream processing properties of cultivation and the protein product, or better physico-chemical quality of the product.

(46) According to specific embodiments of the invention one or more of the gene sequences tre66966 (SEQ ID NO:1), tre112524 SEQ ID NO:2), tre123668 (SEQ ID NO:3) and tre120120 (SEQ ID NO:5) (Table 2); or the closest homologue of at least one of said sequences in Trichoderma, Aspergillus, Fusarium, Neurospora, Chrysosporium, or Penicillium; or a fragment or derivative of any of said genes, or other sequence hybridizing under stringent conditions to at least one of said sequences or said homologues, are overexpressed in a fungus host. The overexpression of these genes in the genetically modified host causes increased production of cellulase, hemicellulase, other proteins involved in degradation of lignocellulosic material and/or other proteins, typically secreted proteins and/or production of total extracellular protein as compared to the parental host, or proteins produced using promoters of genes encoding secreted proteins. This can be detected either as higher maximal level of enzymatic acitivity or protein produced during the cultivation or as a higher level of produced enzymatic activity or protein produced at any time point of cultivation resulting in higher production level at earlier stages of cultivation and thus in faster production process as compared to parent host.

(47) Cellulase acitivity can be measured e.g. as enzymatic activity against the substrate, 4-methylumbelliferyl--D-lactoside (MULac). Methods for measuring the combined activity of CBHI, EGI and -glucosidase (referred here as total MULac activity), as well as the separate activities of the enzymes, using MULac as substrate have been described by Bailey and Thtiharju, 2003; Collen et al., 2005; van Tilbeurgh et al., 1982, 1985, 1988. The hemicellulase activity can be measured e.g. as activity against the birch xylan substrate (Bailey et al., 1992, Bailey M. J., Biely, P. and Poutanen, K. (1992) Interlaboratory testing of methods for assay of xylanase activity. J. Biotechnol. 23: 257-270), and production of total extracellular protein by using any of the methods for measurement of protein concentration known in the art, for example using Bio-Rad Protein Assay (Bio.Rad).

(48) It is advantageous, if one or more of genes tre66966 (SEQ ID NO:1), tre112524 SEQ ID NO:2), tre123668 (SEQ ID NO:3), still more preferably either one or both of genes tre66966 (SEQ ID NO:1) and/or tre112524 SEQ ID NO:2), are overexpressed in a fungus host. The term gene encompasses here also the closest homologue of at least one of said sequences in Trichoderma, Aspergillus, Fusarium, Neurospora, Talaromyces, Phanerochaete, Chrysosporium or Penicillium; or a fragment or derivative of said genes or other nucleotide sequence hybridizing under stringent conditions to at least one of said sequences or said homologues.

(49) TABLE-US-00001 TABLE 1 Plasmid T. reesei gene strain pMH35 tre66966 35-10 pMH17 tre112524 17-6 pMH18 tre123668 18-11 pMH22 tre120120 22-1

(50) According to other specific embodiments of the invention gene tre112524 (SEQ ID NO:2); or the closest homologue of said sequence in Trichoderma, Aspergillus, Fusarium, Neurospora, Chrysosporium or Penicillium; or a fragment or derivative of said genes or other nucleotide sequence hybridizing under stringent conditions to said sequence or said homologues, is overexpressed in the fungus host. The overexpression of this gene causes increased cellulase activity, in particular enzyme activity against MULac substrate under conditions measuring specifically EGI activity. The overexpression of this gene causes also increased hemicellulase activity. This can be detected as increased production. Furthermore, the overexpression this gene causes increased production of extracellular protein in the culture medium.

(51) Also other combinations of the mentioned genes can be overexpresed and/or made deficient in a fungus host to get a combined effect of the genes on protein production properties of the fungus host. Inactivation or reduced activity of one or more of mentioned genes may be beneficial to reduce production of unwanted side-products. Within the scope of protection are thus genetical modification of a fungus host by overexpression or by making deficient at least one of said genes. Overexpression of the above mentioned genes in filamentous fungus hosts was exemplified here by constructing Trichoderma strains expressing these genes. The expression of the same or corresponding genes i.e. closest homologues of said genes, in other filamentous fungi hosts, is within the scope of protection of the present invention.

(52) The corresponding genes may also be either overexpressed or made deficient, as described above, also in other filamentous fungi hosts.

(53) In some other applications it is desirable to tailor a protein product, in which for example higher levels of EGI and xylanase activity are desired. For that application, the gene tre112524 (SEQ ID NO:2); or the closest homologue of said gene in Trichoderma, Aspergillus, Fusarium, Neurospora, Chrysosporium or Penicillium; or a fragment or derivative of said gene or other nucleotide sequence hybridizing under stringent conditions to said gene or to at least one of said homologues, should be overexpressed in the fungus host.

(54) Also sequences hybridizing under stringent conditions to the Trichoderma genes or their closest homologues in other filamentous fungus hosts are within the scope of protection of the present invention. In the following text, by gene is meant also the closest homologue of the gene or sequences hybridizing into said gene or said homologue as herein described. By gene is in the following text meant also any fragment or derivative or modified form comprising deletions, substitutions, insertions or other genetic modifications, but having the same or equivalent function as the said gene.

(55) To exemplify the effect of the genes on protein production, the genes were overexpressed in T. reesei QM9414 host as described in the Examples 4-6.

(56) The structure of the genes is similar in that they all comprise a sequence domain typical to genes encoding regulatory proteins, such as transcription factors as shown in Table 2.

(57) TABLE-US-00002 TABLE 2 IPR001183, Fungal transcriptional IPR007219, regulatory Fungal IPR000182, protein, N- transcriptional IPR001680, GCN5-related N- Gene ID terminal factor W D40 repeat acetyltraansferase tre123668 pMH 18 x tre66966 pMH 35 x tre120120 pMH 22 x tre112524 pMH 17 x x

(58) The effect of gene tre66966 (FIG. 1), represented by SEQ ID NO:1, was exemplified by constructing strain T. reesei 35-10 overexpressing the gene. The overexpression of this gene caused increased cellulase production measured as total Mulac activity, CBHI activity and EGI activity. In particular CBHI activity was increased compared to the parent host. Also hemicellulase production, measured as production of xylanase activity, and total extracellular protein production were increased as compared to the production by the parent host strain. The overexpression of gene tre66966 can be used in particular to increase cellulase or hemicellulase production, or the production of other secreted proteins. In addition, production of various heterologous proteins under the promoters of cellulase or hemicellulase genes (or similarly regulated promoters) can be produced at higher level by the strains overexpressing the gene as compared to the parent host strain.

(59) The effect of gene tre112524 (FIG. 2), represented by SEQ ID NO:2, was exemplified by constructing strain T. reesei 17-6 overexpressing the gene. In the cultures of the strain 17-6, the maximal level of total extracellular protein produced was reached earlier than in the cultures of the parent host strain. By overexpression of the gene a faster production process for secreted proteins can be obtained. Specifically, the strains 17-6 produced higher amount of hemicellulase activity, measured against xylan substrate, as well as a slightly higher amount of cellulase activity, measured as total MULac activity or EGI activity. However, production of CBHI activity was not affected by the overproduction.

(60) Improved production of hemicellulase activity or selected cellulase activities can be obtained by overexpressing the gene 112524. In the overexpressing strain also improved production of heterologous proteins under the promoters of these hemicellulase and cellulase gene promoters can be obtained.

(61) The effect of gene tre123668 (FIG. 3), represented by SEQ ID NO:3, was exemplified by constructing strain T. reesei 18-11 overexpressing the gene. The overexpression of this gene caused increased cellulase production, measured especially as total Mulac activity or CBHI activity, as compared to the parent host. The overexpression of the gene had also slightly positive effect on the production of hemicellulase activity, measured as xylanase activity. In the cultures of the strain 18-11, the maximal level of the produced activities were higher and reached earlier than in the cultures of the parent host. The overexpression of the gene had also slightly positive effect on the production of the total extracellular protein, especially when the amount of produced protein per fungal biomass was inspected. The overexpression of gene tre123668 can be used in particular to increase cellulase or hemicellulase production, or the production of other secreted proteins. In addition, production of various heterologous proteins under the promoters of cellulase or hemicellulase genes (or similarly regulated promoters) can be produced at higher level by the strains overexpressing the gene as compared to the parent host strain.

(62) The effect of gene tre120120 (FIG. 5), represented by SEQ ID NO:5, was exemplified by constructing strain T. reesei 22-1 overexpressing the gene. The overexpression of the gene had a positive effect on the production of cellulase activity, measured as total MULac activity, or especially as CBHI activity. In the cultures of the strain 22-1, the maximal level of the produced activities were reached earlier than in the cultures of the parent host. Also the production of the hemicellulase activity, measured against xylan substrate, reached the maximum level faster than in the cultures of the parent host strain. The cultures of 22-1 produced less biomass than the cultures of the parent host strain. The improved faster production of proteins in the culture medium during cultivation as compared to the parent host was especially pronounced when the amount of produced amount of protein or enzyme activity per fungal biomass was inspected. The overexpression of the gene had also a positive effect on the production of the total extracellular protein when the amount of produced protein per fungal biomass was inspected, especially at the earlier stages of the cultivation. By overexpressing gene tre120120, it is possible to improve the production of cellulases and hemicellulases, or other secreted proteins. Also production of heterologous proteins produced under the promoters of cellulase or hemicellulase genes can be improved by overexpression of the gene. Especially, by overexpression of the gene it is possible to make the production process faster. Also less nutrients is consumed for biomass formation in the strain overproducing the gene. As the improvement in production was more pronounced in the case of CBHI activity production as compared to EGI activity production, overexpression of the gene can be also used to preferentially overproduce CBHI activity or heterologous proteins under cbh1 promoter.

(63) The effect of the genes as described herein has been exemplified by overexpressing them in Trichoderma. The strain was T. reesei QM9414 (ATCC 26921), which is generally available to the public.

(64) Total Mulac is measured as enzyme activity against Mulac substrate measuring activities of CBHI, EGI, and BGL.

(65) EGI has been measured as enzyme activity against Mulac in the presence of glucose, to inhibit BGLI, and cellobiose, to inhibit the activity of CBHI

(66) CBHI has been measured as enzyme activity against Mulac obtained by subtracting the activity measured in the presence of glucose and cellobiose from the activity measured in the presence of glucose and in the absence of cellobiose.

(67) The methods for determining cellulase activities has been described in Bailey and Thtiharju, 2003; Collen et al., 2005; van Tilbeurgh et al., 1982, 1985, 1988.

EXAMPLES

Example 1

(68) Cultivation of Trichoderma reesei for Transcriptome Analysis to Study the Cellular Responses During Induction of Hydrolytic Enzyme Production

(69) Cultivation Procedure

(70) Trichoderma reesei Rut-C30 (ATCC56765) was cultivated in shake flasks in medium containing 7.6 g/l (NH.sub.4).sub.2SO.sub.4, 15.0 g/l KH.sub.2PO.sub.4, 2.4 mM MgSO.sub.4.7H.sub.2O, 4.1 mM CaCl.sub.2.H.sub.2O, 3.7 mg/l CoCl.sub.2, 5 mg/l FeSO.sub.4.7H.sub.2O, 1.4 mg/l ZnSO.sub.4.7H.sub.2O, 1.6 mg/l MnSO.sub.4.7H.sub.2O, and 10 g/l sorbitol. pH of the medium was adjusted to 4.8 by addition of KOH. The cultures were inoculated with 810.sup.7 spores/200 ml medium and grown for 4 days in conical flasks at 28 C. with shaking at 250 rpm. For induction of the hydrolytic enzyme production, the cultures were combined and aliquots of the combined culture transferred to flasks containing inducing medium (200 ml of the culture per 90 ml of the inducing medium). The composition of the inducing medium was as described above except for containing 2 g/l sorbitol and supplemented either with Avicel cellulose, pretreated wheat straw, pretreated spruce or sophorose. Uninduced control cultures were treated similarly except that no supplement was used in the inducing medium. The concentrations of the inducing substances were 1% (w/v) of Avicel, wheat or spruce or 0.7 mM sophorose. Pretreatment of spruce and wheat straw was done using steam explosion, followed by washing steps. The fibrous fraction of the material was used for the induction.

(71) Collection of Samples and Sample Treatment

(72) Samples for analysis of biomass production, pH of the culture supernatant, and for RNA isolation were collected at different time points during the pre-cultivation step as well as from the combined culture before induction. After addition of the inducing substances the cultures were sampled for pH measurement and RNA isolation; biomass formation was measured only from separate uninduced control flasks reserved for the purpose. The sampling time points of the induced cultures were 0 h, 6 h, 17 h, and 41 h after the onset of induction. Biomass dry weight was measured by filtering and drying mycelium samples at 105 C. to constant weight (24 h). For RNA isolation mycelium samples of 50 ml were filtered, washed with equal volume of 0.7% (w/v) NaCl, frozen immediately in liquid nitrogen, and stored at 80 C. Total RNA was isolated using the Trizoff Reagent (Gibco BRL) essentially according to manufacturer's instructions, and purified further by column purification (Qiagen, manufacturer's instructions). cDNA was synthesised from the purified RNA, followed by fluorescent labelling and expression microarray analysis using custom oligonucleotide microarrays by Roche NimbleGen, Inc. The design for the microarray probes and slides was done according to T. reesei genome version v2.0.

(73) Monitoring of the Cultures

(74) During the precultivation stage the progress of the cultivations was monitored by analysis of biomass formation and change of pH in the culture supernatant. After the onset of the induction biomass formation was only measured from uninduced control cultures specifically dedicated for the purpose, since the insoluble material in the inducing media could not be separated from fungal biomass. pH was measured from all the cultures throughout the cultivation procedure. Biomass dry weight (g/l) in the precultures before induction and in the uninduced control cultures are shown in FIG. 7A and pH of the cultures in FIG. 7B. The biomass and pH data show that, at the induction time point 100 h, the cultivations were actively growing and growth continued during the induction time period in the control cultures. The extent of pH decrease in the cultures during time suggest equal growth characteristics of the replicate cultures. No significant difference was detected between the uninduced and sophorose induced cultures either. In cultures with Avicel, the pH decreased slightly faster as compared to the uninduced culture, and the cultures with spruce and wheat showed fastest decrease in the pH, the difference being, however, relatively small.

Example 2. TRAC Analysis of a Selected Set of Genes Encoding Hydrolytic Enzymes

(75) In order to select the optimal time points of the induction experiment for the expression microarray analysis, transcription levels of a set of known genes encoding hydrolytic enzymes were analysed using TRAC method. The relative expression levels are shown for abf1 (arabinofuranosidase 1), bga1 (beta-galactosidase 1), bgl1 (beta-glucosidae 1), bxl1 (beta-xylosidase 1), cip1 (cellulose-binding), cip2 ( ) egl1 (endoglucanase 1), glr1 (glucuronidase 1), man1, xyn2 and xyn4. Clear induction was detected for majority of the genes at the time points 6 h and 17 h, and also at 41 h of the sophorose cultures, and these time points were selected for the microarray analysis. The transcript levels detected by the TRAC analysis are shown in FIG. 8A and FIG. 8B.

Example 3. Expression Microarray Analysis of the Induced Cultures

(76) The cultures induced either with Avicel, sophorose, pretreated wheat straw or pretreated spruce were subjected to microarray expression analysis. The time points 0 h, 6 h, 17, and 41 h of the uninduced and sophorose induced cultures were used for the analysis, and the time points 0 h, 6 h and 17 h were selected for the Avicel, wheat and spruce induced cultures. The microarray analysis was done using custom oligonucleotide microarrays by Roche NimbleGen, Inc. The design for the microarray probes and slides was done according to T. reesei genome version v2.0. Raw microarray data was analysed using R and the Bioconductor packages Oligo, Limma and Mfuzz.

(77) The analysis showed co-expression of a group of genes together with cellulase or hemicellulase genes. These genes included novel previously not described genes with sequence domains typical to genes for different types of regulatory proteins, including genes for transcription factors, kinases, and proteins involved in histone modification and chromatin remodelling, phosphatidylinositol/phosphatidylcholine transfer protein. In order to evaluate the effect of these genes on protein production, and specifically production of hydrolytic enzymes, like cellulases and hemicellulases, a set of these genes were cloned and overexpressed in T. reesei QM9414 (ATCC 26921). The selected genes had a significantly higher expression at least in three of the inducing conditions studied as compared to the unincuced cultures at the same time point, or that the expression profile of the genes was similar to the expression profiles of known hemicellulase or cellulase genes (according to M fuzz clustering of the expression data). The selected genes with their corresponding protein identity number, predicted functional prediction based on the sequence domains, and information on their induction in the presence of different inducing substances at different time points of the induction experiment are listed in Table 3.

(78) The information provided on the genes include the ID number according to JGI genome version 2.0, predicted function of the gene based on the sequence data, and data on induction of the gene in the presence of different inducers (Avicel, pretreated wheat straw, pretreated spruce or sophorose) at different induction time points. Statistically significant induction (higher expression level as compared to the uniniduced control cultures at the same time point) in the Avicel, Spruce, Wheat or Sophorose induced cultures at the time points 0 h, 6 h, 17 h, or 41 h is indicated by 1, and statistically significant reduction in the expression level by 1.

(79) TABLE-US-00003 TABLE 3 The induced genes encoding putative regulatory factors and selected for overexpression in T. reesei. Avicel Avicel Avicel Wheat Wheat Wheat Gene ID Class Extension 0 h 6 h 17 h 0 h 6 h 17 h TRIRE0066966 Regulation G-protein. 0 0 0 0 0 0 beta. WD-40 repeat TRIRE0112524 Regulation Transkcription 0 0 0 0 0 0 factor TRIRE0123668 Regulation GCN5-related 0 1 0 0 1 1 N- acetyltransferase TRIRE0120120 Regulation GCN5-related 0 1 1 0 1 1 N- acetyltransferase Spruce Spruce Spruce Sophorose Sophorose Sophorose Sophorose Inducer Gene ID 0 h 6 h 17 h 0 h 6 h 17 h 41 h Time (h) TRIRE0066966 0 0 0 0 0 0 0 TRIRE0112524 0 0 0 0 0 0 0 TRIRE0123668 0 1 1 0 1 1 1 TRIRE0120120 0 0 1 0 0 1 1

Example 4

(80) The primers used for amplification of the genes from T. reesei QM6a (CBS383.78) genome were as follows:

(81) The 5 end primer contained a general part consisting of four 5 terminal G's, 25nt attB1 site (ACAAGTTTGTACAAAAAAGCAGGCT) (SEQ ID NO: 6) and a 8 nt region upsam from start codon of cbh1 gene (TGCGCATC), altogether forming the sequence GGGGACAAGTTTGTACAAAAAAGCAGGCTTGCGCATC (SEQ ID NO:7)

(82) The general component of the oligo was followed by gene specific sequence corresponding to the 5 end of the gene.

(83) The 3 end primer contained four 5 terminal G's, 25nt attB2 site

(84) TABLE-US-00004 (SEQIDNO:8) (ACCACTTTGTACAAGAAAGCTGGGT)
and the nucleotides CTTA followed by the gene specific sequence corresponding to the 3 end of the gene.

(85) The primers used for amplification of the genes using genomic T. reesei DNA as a template were the following:

(86) TABLE-US-00005 pMH17112524 (SEQIDNO:9) 5GGGGACAAGTTTGTACAAAAAAGCAGGCTTGCGCATCATGGCTGGATC GCCTGCTGCTG pMH17112524 (SEQIDNO:10) 3GGGGACCACTTTGTACAAGAAAGCTGGGTACACATTCATCCCTGCGCC CAG pMH18123668 (SEQIDNO:11) 5GGGGACAAGTTTGTACAAAAAAGCAGGCTTGCGCATCATGCCTCTCGT TGTCGTCCCAG pMH18123668 (SEQIDNO:12) 3GGGGACCACTTTGTACAAGAAAGCTGGGTCTTAATTGAGCAGCGGCTC GCG pMH22120120 (SEQIDNO:13) 5GGGGACAAGTTTGTACAAAAAAGCAGGCTTGCGCATCATGTCCCGCCA AATCTCCCACC pMH22120120 (SEQIDNO:14) 3GGGGACCACTTTGTACAAGAAAGCTGGGTCTTACTCGGTGCTGATACT TCT pMH3566966 (SEQIDNO:17) 5GGGGACAAGTTTGTACAAAAAAGCAGGCTTGCGCATCATGGCCAAGAA GGCGCGTC pMH3566966 (SEQIDNO:18) 3GGGGACCACTTTGTACAAGAAAGCTGGGTGCTAGGCGCCGTTGACGAC TC

(87) PCR amplification reaction using the primers mentioned above resulted in DNA fragments containing the gene specific sequences described below inserted between the 5 and 3 terminal sequences originating from the general parts of the primers.

Example 5. Construction of T. reesei Strains Overexpressing the Regulatory Genes Selected Based on the Transcriptome Data from the Induction Experiment on Avicel, Wheat, Spruce or Sophorose Containing Media

(88) The genes encoding putative regulatory factors co-expressed with known cellulase or hemicellulase genes were amplified by PCR from the Trichoderma genome (T. reesei QM6a; CBS383.78) and cloned into an expression vector which was then transformed into T. reesei QM9414. The transformants were selected based on function of the AmdS selection marker gene present in the expression cassette, transformants were purified from colonies originating from single spores, and the integration of the expression cassette into the genome was confirmed by PCR amplification of the cassette. Schematic view of the plasmids used for transformation is shown in FIG. 8.

Example 6. Cultivation of the T. reesei Strains Overexpressing the Putative Regulatory Factors, and Analysis of the Cultures for Growth and Protein Production

(89) The modified strains overexpressing genes encoding the putative regulatory factors were cultivated in shake flasks on medium containing 7.6 g/l (NH.sub.4).sub.2SO.sub.4, 15.0 g/l KH.sub.2PO.sub.4, 2.4 mM MgSO.sub.4.7H.sub.2O, 4.1 mM CaCl.sub.2.H.sub.2O, 3.7 mg/l CoCl.sub.2, 5 mg/l FeSO.sub.4.7H.sub.2O, 1.4 mg/l ZnSO.sub.4.7H.sub.2O, 1.6 mg/l MnSO.sub.4.7H.sub.2O and supplemented with 4% lactose and 2% spent grain extract. The cultures were analysed for growth and protein production, including assays for cellulase and hemicellulase activity. Cellulase activity was measured using 4-methylumbelliferyl--custom character-lactoside (MULac) as a substrate. The MULac can be used for measurement of combined activities of CBHI, EGI and BGL in T. reesei cultures (Bailey and Thtiharju, 2003; Collen et al., 2005; van Tilbeurgh et al., 1982, 1985, 1988. Using a modified method MULac substrate can used also to measure the activities of CBHI and EGI specifically (Bailey and Thtiharju, 2003; Collen et al., 2005; van Tilbeurgh et al., 1982, 1985, 1988). Xylanase activity was measured using birch xylan as a substrate (Bailey M. J., Biely P., and Poutanen, K., (1992) Interlaboratory testing of methods for assay of xylanase activity. J. Biotechnol. 23: 257-270). For the results on protein production in the cultures of the modified strains and the parental strain T. reesei QM9414, see the FIGS. 1-5.

Example 7

(90) The closest homologue of a gene in another fungal species can be identified e.g. based on homology searches against genome databases using programs such as Blast. The homology searches can be done using either the nucleotide sequence of the gene or the amino acid sequence of the translated gene as a query. Information on the closest homologue of the gene can be obtained in any organism with a sequenced genome. Complete genome sequences are available for homology searches for a multitude of fungal species, and the number of fully sequenced fungal organisms is still increasing.

(91) In this example, the translated sequences of the ORFs of the T. reesei genes tre77513, tre80291, tre41573, tre74765 and tre64608 were subjected to BLASTP homology search against protein sequence databases of a set of fungal species. The translated sequences of the T. reesei ORFs were according to JGI (Joint Genome Institute; genome version 2.0).

(92) The search was carried out using the fungal genome BLAST databases at NCBI containing completed genome sequence and whole genome shotgun sequence data with the corresponding protein sequences of a large number of fungal species. The databases used in the search in this example were: Completed Aspergillus fumigatus proteins; Completed Aspergillus nidulans FGSC A4 proteins; Completed Aspergillus terreus proteins; Completed Chaetomium globosum CBS 148.51 proteins; Completed Gibberella zeae PH-1 proteins;
(The reference for the BLASTP 2.2.23+ program used: S. F. Altschul, T. L. Madden, A. A. Schaffer, J. Zhang, Z. Zhang, W. Miller, and D. J. Lipman (1997), Gapped BLAST and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Reference for compositional score matrix adjustment: S. F. Altschul, J. C. Wootton, E. M. Gertz, R. Agarwala, A. Morgulis, A. A. Schaffer, and Y.-K. Yu (2005) Protein database searches using compositionally adjusted substitution matrices, FEBS J. 272:5101-5109.).

(93) The parameters used in the searches were as follows: General parameters: Max target sequences: 100 (Maximum number of aligned sequences to display (the actual number of alignments may be greater than this)). Short queries: Automatically adjust word size and other parameters to improve results for short queries. Expect threshold: 10 (Expected number of chance matches in a random model) Word size: 3 (The length of the seed that initiates an alignment) Scoring Parameters: Matrix: BLOSUM62 (Assigns a score for aligning pairs of residues, and determines overall alignment score) Gap Costs: Existence:11, Extension:1 (Cost to create and extend a gap in an alignment) Compositional adjustments: Conditional compositional score matrix adjustment (Matrix adjustment method to compensate for amino acid composition of sequences) Filters and Masking: Filter: Low complexity regions filter (Mask regions of low compositional complexity that may cause spurious or misleading results).

(94) Table 4 shows examples of the closest homologues of the T. reesei genes in other fungal species obtained by the BLAST search: the closest homologue of tre66966 in G. zeae, tre112524 in A. nidulans, tre123668 in C. globosum and tre120120 in P. marneffei. fumigatus.

(95) TABLE-US-00006 TABLE 4 Examples of the closest homologies of the T. reesei genes in selected fungal species based on the BLAST search *)Identical The best alignment Query amino Identical sequence acids per amino Identities length query acids/length in the Alignment Query (amino Blast Blast E length of the alignment length/query sequence acids) Hit sequence Species Score value (%) alignment (%) length (%) translated 994 ref|XP_384527.1|, Gibberella 979 0.00E+00 67 492/686 71 69 tre66966 FG04351.1 zeae translated 949 ref|XP_664000.1|, Aspergillus 142 5.00E33 15 111/392 28 41 tre112524 AN6396.2 nidulans translated 212 ref|XP_001220518.1|, Chaetomium 88 2.00E17 31 66/208 31 98 tre123668 CHGG_01297 globosum translated 222 gb|EEA27105.1| Penicillium 48.1 0.00002 20 45/158 28 71 tre120120 marneffei