Process for transformation in withania somnifera plants to increase secondary metabolite content
09695431 ยท 2017-07-04
Assignee
Inventors
- Bashir Mohammad Khan (Pune, IN)
- Neha Gupta (Pune, IN)
- Parth Sanjaykumar Patel (Pune, IN)
- Poonam Sharma (Pune, IN)
- Shuchishweta Vinay Kendurkar (Pune, IN)
Cpc classification
C12N15/8243
CHEMISTRY; METALLURGY
International classification
C12N15/82
CHEMISTRY; METALLURGY
Abstract
Described herein is a process of genetic transformation in W. somnifera by Agrobacterium tumefaciens mediated transformation to overexpress squalene synthase gene (WsSQS) encoding WsSQS enzyme that catalyzes the synthesis of squalene from farnesyl pyrophosphate. Increased withanolide level including withaferin-A, withanolide A and B and withanone is attained in transformed plant tissues.
Claims
1. A process for genetic transformation in Withania somnifera plants to increase secondary metabolite content in green house acclimatized plants, comprising: a) immersing a pre-cultured Withania somnifera explant in a bacterial suspension comprising an Agrobacterium tumefaciens harboring a plasmid carrying a cDNA sequence of squalene synthase (WsSQS) comprising SEQ ID NO: 1 for 10-20 mins and co-cultivating the pre-cultured explant and the Agrobacterium for 24-48 h in dark; b) transferring the co-cultivated explant to a proliferation medium containing cefotaxime for 8-10 days so as to provide a tissue; c) determining Gus expression in the tissue by Gus assay followed by transferring Gus positive tissue to hygromycin B selection medium, thereby providing shoots; d) maintaining the shoots on hygromycin B while reducing the concentration of cefotaxime; and e) transferring the shoots to rooting medium to provide transformed plantlets and subjecting the transformed plantlets to greenhouse conditions; wherein the explant is an apical or nodal segment from a seedling shoot.
2. The process for genetic transformation according to claim 1, wherein the plasmid carrying the cDNA sequence comprising SEQ ID NO:1 is pCAMBIA1301.
3. The process for genetic transformation according to claim 2, wherein the cDNA sequence of WsSQS comprising SEQ ID NO:1 is positioned in the plasmid between a promoter and a terminator in pCAMBIA1301.
4. The process for genetic transformation according to claim 3, wherein the promoter is CaMV 35S rRNA (Cauliflower Mosaic virus) and the terminator is Nopaline synthase (Nos).
5. The process for genetic transformation according to claim 1, wherein the tissue exhibits overexpression of WsSQS mRNA transcript levels up to 2-5 fold compared to a respective wild-type tissue.
6. The process for genetic transformation according to claim 1, wherein WsSQS protein activity in transformed root, leaf and stem tissues is 3.3, 2.7 and 2.1 fold higher, respectively, compared to respective wild type tissues.
7. The process for genetic transformation in Withania somnifera plants according to claim 1, wherein WsSQS protein activity in the transformed plant is in the range of 50-150 pKat/mg protein.
8. The process for genetic transformation according to claim 1, wherein the secondary metabolites are withanolides selected from the group consisting of withaferin-A, withanolide A and B and withanone.
Description
BRIEF DESCRIPTION OF ACCOMPANYING FIGURES
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
DETAILED DESCRIPTION OF INVENTION
(9) Withania somnifera is traditionally known as ashwagandha, and commonly known as Indian ginseng, poison gooseberry, or winter cherry. Withania somnifera is cultivated in many of the drier regions of India, such as Mandsaur district of Madhya Pradesh, Punjab, Sindh, Gujarat, and Rajasthan. It is also found in Nepal.
(10) In the present disclosure, the seeds of W. somnifera were procured from Vindhya herbals, Bhopal, MP, India. Agrobacterium tumefaciens GV2260 is used as the transformation vehicle in the instant disclosure.
(11) The disclosure will now be described in detail in connection with certain preferred and optional embodiments, so that various aspects thereof may be more entirely comprehended and appreciated.
(12) In a preferred embodiment, the present disclosure provides a process for genetic transformation in Withania somnifera plants employing an expression vector system carrying WsSQS gene having SEQ ID NO. 1 to cultivate hardened Withania somnifera plants, with increased secondary metabolite content comprising: a) immersing pre-cultured explants in a bacterial suspension for 10-20 mins and co-cultivating with transformant cells for 24-48 h in dark; b) transferring cells to proliferation medium containing cefotaxime for 8-10 days; c) confirming expression of the inserted gene in transformed tissues by Gus assay followed by transferring Gus positive explants to hygromycin B selection medium; d) maintaining hygromycin B-resistant Gus-positive shoots on selection medium with reduced cefotaxime concentration; and e) sub-culturing shoots of transformed explants on rooting medium and subjecting transformed plantlets to greenhouse conditions.
(13) Agrobacterium tumefaciens mediated transformation in Withania somnifera plants results in the overexpression of squalene synthase gene (WsSQS) encoding the WsSQS enzyme, and thereby causing enhanced catalysis of squalene from farnesyl pyrophosphate.
(14) Accordingly, 80-100 pre-cultured explants are immersed with freshly prepared A. tumefaciens suspension for 15 mins followed by co-cultivating with A. tumefaciens for 48 h in dark and transferred to proliferation medium containing 220-300 mg l.sup.1 cefotaxime for 8-10 days to obtain A. tumefaciens mediated transformed cell lines of W. somnifera.
(15) In order to establish the expression of the inserted WsSQS gene in the explants, the cells are determined for their glucuronidase (Gus) activity and hygromycin resistant property. Cells exhibiting Gus+ and hygromycin resistance are maintained on selection medium with cefotaxime concentration reduced to 100 mg l.sup.1 to eliminate growth of Agrobacterium.
(16) Independent transformed lines obtained by detaching shoots from transformed explant are transferred to a rooting medium. Efficient rooting is obtained in appropriate plant growth medium at favourable growth conditions and is transferred to green house for acclimatization
(17) In an embodiment, the present disclosure provides a bacterial suspension comprising cells of A. tumefaciens harboring plasmid carrying SEQ ID NO. 1, wherein pre-cultured explants are co-cultivated with the said bacterial suspension.
(18) In an embodiment, the present disclosure provides a transgenic plant or parts thereof, including seeds comprising a nuclear genome encoded nucleotide sequence as set forth in SEQ ID NO. 1.
(19) In an embodiment, the present disclosure provides a cDNA having nucleotide sequence as set forth in SEQ ID NO. 1.
(20) In another preferred embodiment, the present disclosure provides an expression vector system A. tumefaciens harbouring pCAMBIA 1301 containing the T-DNA construct comprising (described in
(21) Accordingly, cloned cDNA WsSQS fragments of SEQ ID NO: 1 (Accession No: GU732820) with opening reading frame of 1242 bp, were obtained by amplification using primers consisting of restriction enzymes sites KpnI and SacI. The WsSQS open reading frame is adjusted between CaMV 35S promoter and Nos terminator using site specific restriction enzymes to ensure high levels of gene expression.
(22) Accordingly A. tumefaciens characterized by WsSQS gene is grown in yeast extract minimal medium containing rifampicin and kanamycin in 1:1 ratio. Cells harvested by centrifugation are resuspended in MS medium to obtain suitable bacterial cell density for infection. 90 explants which are two days pre-cultured apical and nodal segments from in vitro grown shoots as explants are initially immersed with freshly prepared A. tumefaciens suspension for 15 mins followed by co-cultivating with A. tumefaciens for 48 h in dark and transferred to cefotaxime containing proliferation medium for ten days to obtain A. tumefaciens mediated transformed cell lines of W. somnifera.
(23) Further, expression of WsSQS gene in transformed tissues is confirmed by Gus assay to detect -Glucuronidase activity according to Jefferson et al., 1987 and by growing Gus+ transformants on hygromycin B selective medium. Hygromycin B-resistant, Gus-positive shoots are continuously maintained on selection medium with cefotaxime concentration reduced to 100 mg l.sup.1.
(24) Independent transformed lines obtained by detaching shoots from transformed explant are transferred to rooting medium. Efficient rooting is obtained in appropriate plant growth medium at favourable growth conditions and is transferred to green house for acclimatization.
(25) Accordingly expression of introduced gene is determined by -glucuronidase activity in explants. Gus reporter gene with catalase intron does not express detectable Gus activity in A. tumefaciens; however transformed Gus-positive shoots stained blue indicate stable expression of the introduced gene.
(26) Gus+ transformants grown in proliferation medium containing 10 mgl.sup.1 hygromycin B as the selective antibiotic exhibit shoot elongation and multiplication while untransformed tissues are indicated by necrotic shoots are eliminated. Growth of Gus+, hygromycin B resistant transformed cell lines are sustained in selection medium with decreased concentration of cefotaxime.
(27) Consequently, of the 90 explants subjected to transformation, a total of 18 hygromycin B resistant transformed lines are recovered. Green shoots are subsequently cultured onto rooting medium. Rooted plants are transferred to pots containing autoclaved sand and soil (1:2), kept in humid conditions for two weeks and are then shifted to green house for further acclimatization.
(28) In yet another embodiment transformed, hardened W. somnifera plants with increased withanolide content are obtained. Transgenic plants thus obtained are normal in growth with no phenotypic aberrations.
(29) Randomly selected transformed lines T20, T58 and T79 exhibit increased mRNA transcript levels up to 2-5 fold as compared to the respective wild-type tissue. Favourably, the transcriptionally activated WsSQS gene catalysing the regulatory step leading to withanolide biosynthesis was up regulated in all the transformed tissues.
(30) Advantageously WsSQS activity in transformed leaf and stem tissues was found to be 2.7 and 2.1 fold higher, respectively, while it was 3.3 fold higher in case of root tissue compared to wild type tissues. The increase in WsSQS activity is transformed cell lines compared to wild type tissue is described in Table 1.
(31) In accordance with Western blot analysis the increased intensity of the immune-precipitated protein bands of transformed tissues confirms that WsSQS protein detected in the transformed lines is the product of the overexpressed WsSQS coding region.
(32) TABLE-US-00001 TABLE 1 Summary of WsSQS activity and squalene detected in the reactions WsSQS activity WsSQS Squalene (pKat/mg activity (mol/mg Plant Tissue Sample protein) (pKat/g FW) protein) Leaf Wild type Leaf 36 0.72 54 Transformed Leaf 54.7 1.98 82 Stem Wild type Stem 10 0.39 15 Transformed Stem 14.4 0.83 23 Root Wild Type Root 41 0.82 57 Transformed Root 139.4 2.78 180
Further, the WsSQS activity in the transformed plant tissues is in the range of 50-150 pKat/mgprotein. (Refer Table 1)
(33) In yet another preferred embodiment enhanced concentrations of withanolide secondary metabolites including withaferin A, withanolide A and B and withanone are obtained.
(34) LC-ESI-MS provides identification of Withaferin A, Withanolide A, Withanolide B and Withanone characterised by retention time (Rt) and mass spectrum facilitates their quantification.
(35) TABLE-US-00002 TABLE 2 Quantitative determination of different withanolide content by LC-MS in leaf, stem and root of transformed W. somnifera overexpressing WsSQS R.sub.t Leaf Stem Root Withanolides (min) Wild-type Transformed Wild-type Transformed Wild-type Transformed Withaferin A 11.31 0.15 0.012 0.65 0.09 0.32 0.04 0.63 0.07 0.31 0.05 0.66 0.08 Withanolide A 12.35 0.35 0.03 1.43 0.12 0.91 0.09 0.82 0.08 0.71 0.09 1.78 0.16 Withanolide B 15.00 0.92 0.10 0.98 0.09 0.86 0.07 1.36 0.18 0.92 0.12 1.12 0.14 Withanone 18.35 0.42 0.06 0.49 0.08 0.15 0.016 0.56 0.05 0.31 0.04 0.42 0.07
Values represent the mean of three independent experiments with their SD and expressed as mg/g DW of the respective tissue.
(36) The disclosure will now be illustrated with help of examples. The aforementioned embodiments and below mentioned examples are for illustrative purpose and are not meant to limit the scope of the disclosure. Various modifications of aforementioned embodiments and below mentioned examples are readily apparent to a person skilled in the art. All such modifications may be construed to fall within the scope and limit of this disclosure as defined by the appended claims.
EXAMPLES
Example 1
(37) Plant Material and Propagation
(38) Seeds of W. somnifera were procured from Vindhya herbals, Bhopal, MP, India. Seeds were surface sterilized with sterile distilled water and then rinsed with 1% (v/v) teepol for 1 min followed by sterile distilled water washings in laminar air flow cabinet. Seeds were then treated with 0.1% (w/v) mercuric chloride (HgCl.sub.2) for 5 min, washed thoroughly with sterile distilled water to remove traces of HgCl.sub.2. Seeds were inoculated on germination medium (half strength MS medium containing 3% (w/v) sucrose and solidified with 0.3% Phytagel) and incubated in dark for 15 days to germinate. Germinated seeds were transferred to liquid half strength MS medium for further seedling development. Seedlings were cut into apical and nodal segments of about 1 cm length containing a single node along with a small portion of petiole and micropropagated by inoculating into the proliferation medium (MS medium supplemented with 0.1 mg l.sup.1 kinetin, 0.2 mg l.sup.1 6-BAP) for shooting and subsequently transferred to rooting medium (half-strength MS liquid medium containing 2 mg l.sup.1 IBA) to develop into complete plants. Cultures were incubated under 60 mol m.sup.2s.sup.1 light intensity at 26+2 C. for 16 h photoperiod. Apical and nodal segments from in vitro grown shoots were used as explants for transformation.
Example 2
(39) Vector Construction
(40) Previously cloned full length WsSQS (GenBank GU732820) with an open reading frame of 1242 bp (SEQ ID NO. 1) was amplified using primers having sites for restriction enzymes KpnI and SacI. The resulting fragment was positioned between cauliflower mosaic virus (CaMV) 35S and a nopaline synthase (Nos) terminator in modified pCAMBIA 1301 vector (Omer et al., 2013) which had been already digested with the same enzymes. The correct orientation within the vector was confirmed by DNA sequencing and the construct was transformed into A. tumefaciens GV2260. The T-DNA region of the vector was constituted by gus (-Glucuronidase) reporter gene and a selectable marker hpt II (hygromycin phosphotransferase) gene imparting resistance to hygromycin B under the control of the constitutive CaMV 35S promoter (
Example 3
(41) Genetic Transformation of W. somnifera
(42) Genetic transformation in W. somnifera was achieved by A. tumefaciens GV2260 carrying WsSQS. A. tumefaciens was grown in yeast extract minimal medium containing 50 mg l.sup.1 rifampicin and 50 mg l.sup.1 kanamycin, harvested by centrifugation and the bacterial pellet was resuspended in MS medium to obtain appropriate bacterial cell density for infection. Two days pre-cultured explants were immersed in freshly prepared bacterial suspension for 15 min and co-cultivated with A. tumefaciens for 48 h in dark and then transferred to a proliferation medium containing 250 mg l.sup.1 cefotaxime for ten days. Expression of the inserted gene in transformed tissues was confirmed by Gus assay to detect the -Glucuronidase activity (Jefferson et al., 1987) and visualizing it under a stereoscope (Leica MZ 125, Switzerland). Explants exhibiting shoot development were then transferred to selection medium (proliferation medium containing 10 mg l.sup.1 hygromycin B). Hygromycin B-resistant Gus-positive shoots were continuously maintained on selection pressure while cefotaxime concentration was decreased to 100 mg l.sup.1. To produce independent transformed lines, shoots were detached from the transformed explant, cultured on proliferation medium and rooted onto rooting medium. Rooted plants were shifted to plastic pots containing autoclaved sand and soil (1:2), kept covered with plastic sheets to maintain humidity for two weeks and then transferred to green house for further acclimatization.
Example 4
(43) Molecular Identification of Transformants by PCR Analysis
(44) Presence of integrated DNA into genome of transformed tissues was confirmed by PCR (C1000 BIO-RAD thermal cycler, USA) using primers specific to hpt II and WsSQS. Total genomic DNA was extracted from tissues of wild-type and hygromycin B-resistant transformed shoots by using plant DNA extraction kit (Hipura Plant Genomic Purification kit, Himedia, India). The hpt II gene specific forward and reverse primer sequences used were (SEQ ID NO. 2) 5-TCCTGCAAGCTCCGGATGCCTC-3 and 5-CGTGCACAGGGTGTCACGTTGC-3 (SEQ ID NO. 3) respectively.
(45) For WsSQS gene specific PCR, the forward primer was designed from the sequence of CaMV 35S promoter (GeneBank GQ336528.1; 5-ACAGTCTCAGAAGACCAAAGGGCA-3) (SEQ ID NO. 4) and reverse primer was designed from the 3 terminal sequence of WsSQS (GeneBank GU732820; 5-GAGCTCCTAAGATCGGTTGCCAG-3) (SEQ ID NO. 5). Components of PCR reaction mixture were: 15 ng template DNA, 150 M dNTPs, hpt II/SQS gene specific forward and reverse primers (0.66 pmol each), 0.5 U of Taq DNA polymerase in a total volume of 15 l with 1 reaction buffer. The PCR reaction was carried out as follows: an initial denaturation at 94 C. for 5 min followed by 35 cycles of denaturation at 94 C. for 30 s, annealing at 55 C. for 30 s and extension at 72 C. for 1 min (for hpt II) and 1.6 min (for WsSQS) and a final 5 min extension at 72 C. The amplified products were subjected to 1% (w/v) agarose gel electrophoresis and visualized by ethidium bromide staining under UV. (Observed in
Example 5
(46) qRT-PCR Analysis
(47) Total RNA was isolated from different tissues (leaf, stem and root) of transformed lines and wild-type W. somnifera using Plant RNA Isolation Kit (Invitrogen) as per manual instructions and treated with DNase using DNase I Digest kit (Sigma, USA) to eliminate DNA contamination. Total RNA (2 g) was reverse transcribed into cDNA using AMV reverse transcription system (Promega, USA) with oligo dT primers in a 20 L reaction volume. The reaction mixture was incubated for 1 h at 42 C. For normalization of the relative expression data, ubiquitin gene was employed as an internal standard using primer mix from Eurogentec (Belgium). To quantify WsSQS transcripts, first-strand DNA was PCR amplified using gene-specific primers: SQS-F (5-TTTATGATCGTGAATGGCACTTTTC-3) (SEQ ID NO. 6) and SQS-R (5-AGCGGTTGAAACATGATGGAAC-3) (SEQ ID NO. 7) synthesized from WsSQS. All qRT-PCR reactions were performed with SYBR Green Brilliant II QPCR Master Mix (2 with low ROX, Stratagene, USA) on Mx 3000P instrument (Stratagene, USA) according to the manufacturer's instructions. PCR cycling conditions included a DNA denaturing stage of 95 C. for 10 min, followed by 40 cycles of 95 C. for 30 s, 55 C. for 45 s and 72 C. for 30 s. The amplified products were analyzed with MxPro software provided with the machine. Data was analyzed by comparative Ct method (Pfafll, 2001).
Example 6
(48) Indirect ELISA and Western Blot of WsSQS Protein
(49) Fresh tissues (500 mg each) of transformed and wild-type plants were ground in liquid nitrogen and resuspended in 1 ml phosphate buffered saline (PBS; 136 mM NaCl, 2 mM KCl, 8 mM Na.sub.2HPO.sub.4, 1 mM KH.sub.2PO.sub.4, pH 7.5) containing CHAPS (5 mM) to solubilize membrane proteins. The supernatant was collected after centrifugation and the total protein quantity was estimated by Bradford assay, using bovine serum albumin as standard. Antibodies against WsSQS raised in rabbits (New Zealand White) and the antibody titre of the anti-SQS serum were determined by plotting a graph of different antisera dilution (1:500, 1:1000, 1:5000, 1:10000 and 1:20000) against recombinant truncated WsSQS. For detection of WsSQS in total plant protein, the equal concentration of extracted protein (100 L/well) was coated on 96 well polystyrene microtitre plate (Costar, USA) for overnight at 4 C. followed by washings with PBST (PBS+0.05% Tween 20). Non-specific sites were blocked with blocking buffer (PBS+1% BSA) and incubated for 2 h at 37 C. After washing thrice with PBST, primary antibody (1:5000 dilution) was added and incubated for 2 h at 37 C. Unbound primary antibody was washed thrice with PBST and the plate was exposed to secondary antibody (goat anti-rabbit IgG-alkaline phosphatase conjugate, 1:20000) and followed by incubation for 1-2 h at 37 C. The presence of antigen was determined by the addition of enzyme specific substrate pNPP (p-Nitro phenyl phosphate; 1 mg/mL) followed by incubation of 45 min in dark for color development. The reaction was terminated by adding 10 mM EDTA and absorbance was measured at 405 nm using an xMark ELISA plate reader (BIO-RAD, USA). Detection limit of ELISA was determined by plotting a standard curve using the purified recombinant truncated WsSQS protein. Concentration of WsSQS present in total soluble protein extracted from wild-type and transformed plants were analyzed in each case of three replications from the standard curve.
(50) Total crude protein (50 g) from transformed and wild-type tissues was electrophoresed on 10% SDS-PAGE and electro-transferred on to PVDF membrane using iBlot gel transfer system (Invitrogen) as per manufacturer's instructions, with recombinant truncated WsSQS used as a size marker. Western Breeze kit (Invitrogen) was used for further processing of the blot. Blot was placed in blocking solution and incubated at room temperature for 30 min on rotatary shaker. The membrane was rinsed and incubated with primary antibody solution (1:5000 dilution, rabbit polyclonal IgG against WsSQS) for 1 h. The membrane was washed thrice and incubated in secondary antibody for 30 min. Signals were detected with ready to use 5-bromo-4-chloro-3-indolyl phosphate and nitroblue tetrazolium (BCIP/NBT) solution (Calbiochem, Germany) (Harlow and Lane, 1988).
Example 7
(51) WsSQS Enzyme Activity Determination
(52) Microsomal protein fractions were prepared for WsSQS activity measurements from different tissues of the transformed and wild-type plants. (Vgeli and Chappell, 1988). Essentially, 1 g frozen tissue was homogenized in 10 mL protein extraction buffer (PBS, pH 7.5, 1% PVP, 5 mM DTT and 0.5 M sucrose). Homogenates were filtered through 40 m mesh and centrifuged at 10,000 g for 25 min at 4 C. The supernatant was again centrifuged at 100,000 g for 60 min to obtain the microsomal pellet which was resuspended in 200 L of 100 mM Tris Cl (pH 7.5), 1.5 mM DTT and 20% glycerol and protein concentration was determined by Bradford method. Assay for WsSQS enzyme was carried out with 10 g microsomal protein according to the method described previously (Gupta et al., 2012).
(53) Enzyme Activity Determination by Fluorimetry
(54) Enzyme activity was determined flourimetrically by measuring NADPH depletion during the reaction on an LS 55 spectrofluorimeter (Perkin Elmer). Assay mixture was excited at 340 nm and emission was recorded in the range 400-500 nm with characteristic maxima around 460 nm corresponding to NADPH fluorescence. Excitation and emission slits were kept at 7.5 and 2.5 nm, respectively, with a scan speed of 100 nm min.sup.1. The reaction was carried out at 30 C. for 1 h and averaged fluorescence of 5 accumulated scans were recorded at regular time intervals. A standard curve was prepared by plotting fluorescence of commercially available NADPH (dissolved in 50 mM Tris-Cl; pH 8.0) at 460 nm against its different concentrations. Enzyme activity was defined as the pKat/mg protein.
(55) Enzyme Activity Determination by GC-MS
(56) In order to validate the enzyme reactions, squalene formed in each reaction was checked on GC-MS. Replicates of the above mentioned reactions, after 2 h of incubation, were extracted using tert-butyl methyl ether and concentrated to 100 L by bubbling dry nitrogen. The concentrate (1 L) was injected on GC-MS (Agilent 5975C mass selective detector interfaced with an Agilent 7890A gas chromatograph) fitted with a capillary column HP-5 (25 m0.25 mm, film thickness 0.33 m 5% methyl polysiloxane cross-linked capillary column, Hewlett-Packard, USA) with a split ratio of 10:1. The injector temperature was set at 290 C. with helium as the carrier gas (10 mL min.sup.1). The oven temperature was programmed from 150 C. to 250 C. at 10 C. min.sup.1 and from 250 C. to 310 C. at the rate of 5 C. min.sup.1, and maintained at final temperature for 5 min. The chromatogram obtained was compared with standard/commercially available squalene (Sigma, USA) for its retention time and mass fragmentation pattern. The squalene content was calculated from the standard curve plotted from the peak area versus concentrations of standard squalene, and expressed in nmol/mg protein.
Example 8
(57) Withanolides Extraction and LC-ESI-MS Analysis
(58) Dried tissues (100 mg each) were separately crushed to fine powder and percolated thrice with 5 ml methanol for 1 h under shaking conditions at room temperature. Extracts were pooled, filtered, concentrated under reduced pressure at 45 C. and thoroughly washed with equal volume of n-hexane. The methanol fraction was dried completely and further partitioned twice with water:chloroform (1:1). The chloroform fractions were pooled, concentrated and finally dissolved in 150 l methanol. The samples were filtered and subjected to liquid chromatography. All the solvents used in the study were HPLC grade purchased from Fischer Scientific, USA.
(59) LC-MS was performed on Waters Acquity UPLC system (Milford, Mass., USA) with an Acquity UPLC BEH C18 column (2.1100 mm, 1.7 m) attached to a positive ion elecrospray ionization-mass spectrometer (Waters) for identification and quantification of withanolides in W. somnifera extracts. Separations were achieved following a binary gradient elution using water (solvent A) and acetonitrile (solvent B) with the following program carried out at 25 C.: 10% B for 2 min; 45% B for 8 min; 75% B for 10 min; and 95% B for 5 min, at a flow-rate of 0.4 mL/min, with a total run time of 25 min. External standards of different withanolides (Chromadex, USA) were used to construct calibrated graph from peak area versus withanolide concentration, being linear over 10 measurements at different concentrations.
(60) TABLE-US-00003 SequenceListing Sequence SEQIDNO. Length Description Sequence SEQIDNO.1 1242bp DNAsequence atgggaacattgagggcgattttgaagaatccagatgatt Plant: tgtatccattgataaaactaaagcttgcggctagacatgc Withania ggagaagcagatcccgccggagccacattgggccttctgt somnifera tacttaatgcttcaaaaggtttctcgtagctttgctctcg ccattcaacagcttcctgttgagcttcgtgatgctgtatg catattctatttggttottcgagcacttgacactgttgag gatgacaccagcattcccgcagatgttaaagtacctattc tgatatcttttcatcagcatgtttatgatcgtgaatggca cttttcattgttaggtggcacgaaggagtacaaggttctc atggaccagttccatcatgtttcaaccgcttttctggaac ttgggaaacattatcagcaggcaattcaggatattacctt gaggatgggtgcaggaatggcaaaatttatatgcaaggag gtggaaacaaccgatgattatgacgaatattgtcactatg tagctgggcttgttggtttaggattgtcaaaactgtttca tgcctctgggaaggaagatctggctccagattctctctcc aactctatgggtttatttcttcagaaaacaaacatcatca gagattatttggaagacataaatgaggtgcccaagtgccg tatgttctggccccgtgagatttggagtaaatatgttaac aagcttgaggacttaaagtatgaggagaactcggtcaagg cagtgcaatgcctcaatgacatggtcaccaatgctttgtc acatgtagaagattgtttgacttacatgtccaatttgcgc gatcctgccatctttcgattctgtggtattccacaggtca tggcaattgggacattagctatgtgctacgacaacattga agtcttcagaggagtggttaaaatgaggcgtggtctgact gctaaggtcattgaccggactaggactatggcagatgtat atggtgctttttttgacttctcttgtatgctgaaatccaa ggttaataataatgatccaaattcaactaaaacgttgaag aagcttgaagcaatcctgaaaacttgcagaaattcgggaa tgttgaataaaaggaagtcttatgtaatcaggagtgagcc aaattacagtccagttctgattattgtcatcttcgtcata ctggctgttattctttcacaactttctggcaaccgatctt ag SEQIDNO.2 22bp PrimerF tcctgcaagctccggatgcctc hptIIgene specific forward primer sequence SEQIDNO.3 22bp PrimerR cgtgcacagggtgtcacgttgc hptIIgene specific reverse primer sequence SEQIDNO.4 24bp CaMV35S acagtctcagaagaccaaagggca promoter forward primer sequence SEQIDNO.5 23bp DNAsequence gagctcctaagatcggttgccag WsSQSgene reverse primer sequence SEQIDNO.6 25bp DNAsequence tttatgatcgtgaatggcacttttc WsSQSRT-PCR forward primer sequence (SQS-F) SEQIDNO.7 22bp DNA agcggttgaaacatgatggaac Sequence WsSQSRT-PCR reverse primer sequence (SQS-R)