Plasmodium falciparum sporozoite and liver stage antigens

09694062 ยท 2017-07-04

Assignee

Inventors

Cpc classification

International classification

Abstract

The invention provides novel malaria polypeptides expressed at the pre-erythrocytic stage of the malaria life-cycle. The antigens can be utilized to induce an immune response against malaria in a mammal by administering the antigens in vaccine formulations or expressing the antigens in DNA or other nucleic acid expression systems delivered as a vaccine formulation.

Claims

1. An immunogenic composition comprising a vector expression system, wherein said vector comprises nucleic acid sequences encoding separate polypeptides wherein the separate polypeptides comprise a polypeptide with the amino acid sequence of SEQ ID NOs: 6 and a polypeptide comprising the amino acid sequence of SEQ ID NO. 10, wherein said suitable vector expression system is a DNA plasmid or replicating or nonreplicating viral vector.

2. The immunogenic composition of claim 1, wherein said separate polypeptides are encoded by the nucleic acid sequences of SEQ ID NOs. 5 or 9 inserted into said suitable vector expression system.

3. A method of inducing an immune response against malaria in a mammal, which method comprises administering the immunogenic composition of claim 1.

4. The method of claim 3, wherein of said isolated polypeptides are encoded by the nucleic acid sequences of SEQ ID NOs. 5, or 9.

5. The method of claim 3, wherein said method further comprises administering to said mammal one or more priming and one or more boosting immunizations, wherein said priming and boosting immunizations of an immunologically effective amount of said polypeptides of claim 1 expressed by a suitable plasmid or replicating or nonreplicating viral vector.

6. The method of claim 5, wherein said suitable expression vector is selected from the group consisting of DNA plasmid, alphavirus replicon, adenovirus, poxvirus, adenoassociated virus, cytomegalovirus, canine distemper virus, yellow fever virus, retrovirus, RNA replicons, DNA replicons, alpha virus replicon particles, Venzuelean Equine Encephalitis Virus, Semliki Forest Virus and Sindbus Virus.

7. The method of claim 6, wherein the poxvirus is selected from the group consisting of cowpox, canarypox, vaccinia, modified vaccinia Ankara, or fowlpox.

8. The immunogenic composition of claim 1, wherein said vector expression system also comprises nucleic acid sequence of SEQ ID NO. 13 encoding the polypeptide with the amino acid sequence of SEQ ID NO. 14.

9. The immunogenic composition of claim 1 or claim 8, wherein said vector expression system also comprises nucleic acid sequence encoding one or more of the polypeptides with the amino acid sequences selected from the group consisting of SEQ ID NOs: 2, 4, 8, and 12.

10. The immunogenic composition of claim 9, wherein said nucleic acid sequences are selected from the group consisting of SEQ ID NOs: 1, 3, 7, and 13.

11. The method of claim 3, wherein said composition also comprises nucleic acid sequences encoding one or more of the polypeptides with the amino acid sequence selected from the group consisting of SEQ ID NOs. 2, 4, 8, 12 and 14.

12. The method of claim 11, wherein said nucleic acid sequences are selected from the group consisting of SEQ ID NOs. 1, 3, 7 and 13.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1. Protection of mice immunized (primed) with a with 100 g of DNA P. yoelii vector containing the indicated insert. Mice receiving more than one insert are indicated as receiving multiple doses (i.e., dose=1 to 3). The mice were boosted, on day 40, with vaccinia-P. yoelii vector containing the same insert as priming dosage. On day 50, the mice were challenged with P. yoelii sporozoites and at day 61-68, parasitemia was evaluated. In these experiments, N=14.

(2) FIG. 2. Protection of mice immunized as in FIG. 1. In these studies, N=14. Mice receiving more than one insert are indicated as receiving multiple doses (i.e., dose=1 or 3).

(3) FIG. 3. ELISpot screening of PF106 antigen using HLA-specific peptide pools as stimulants (IFN- spot-forming cells (SFC)/million peripheral blood mononuclear cells (PBMC)). A star indicates the highest IFN- induction.

(4) FIG. 4. ELISpot screening of PF 61 antigen using HLA-specific peptide pools as stimulants (IFN- spot-forming cells (SFC)/million PBMC). A star indicates the highest IFN- induction.

(5) FIG. 5. ELISpot screening of PF 56 antigen using HLA-specific peptide pools as stimulants (IFN- spot-forming cells (SFC)/million PBMC). A star indicates the highest IFN- induction.

(6) FIG. 6. ELISpot screening of PF 121 antigen using HLA-specific peptide pools as stimulants (IFN- spot-forming cells (SFC)/million PBMC). A star indicates the highest IFN- induction.

(7) FIG. 7. ELISpot screening of PF 144 antigen using HLA-specific peptide pools as stimulants (IFN- spot-forming cells (SFC)/million PBMC). A star indicates the highest IFN- induction.

(8) FIG. 8. ELISpot screening of PF 144 antigen using HLA-restricted (A2, A3 and B7) peptide pools as stimulants (IFN- spot-forming cells (SFC)/million PBMC). PBMC's were obtained from a subject pre- or post-immunization with irradiated sporozoite vaccine (ISV).

DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS

(9) One embodiment of the invention relates to isolated proteins expressed at the pre-erythrocytic stage of the malaria (i.e., Plasmodium falciparum) life-cycle. The isolated proteins can be incorporated in immunogenic formulations in order to induce an immune response. In this embodiment, the proteins can be incorporated singly or in combination. The immunogenic compositions of the invention also include adjuvants to improve or enhance the immune response elicited by the polypeptides. A further aspect of the invention is the ability of the proteins to induce an humoral and/or T-cell immune response.

(10) As used herein, the term polypeptide refers to a polymer of amino acids and does not refer to a specific length of the product. Proteins are included within the definition of polypeptides. The term mer, in conjunction with a number, such as 15-mer, refers to the length of a polypeptide in numbers of amino acids.

(11) Methods of predicting immunogenic regions, including predicting T-cell epitopes or HLA binding regions in a polypeptide are well-known in the art. The term motif refers to a polypeptide with a specific amino acid sequence that has been predicted to associate or bind to an HLA molecule.

(12) As used herein, the proteins may be prepared for inclusion of an effective amount of one or more polypeptides described herein into an immunogenic composition by first expressing the appropriate gene fragments by molecular methods, expression from plasmids or other expression systems such as viral systems and then isolated.

(13) An embodiment of the invention is the incorporation of DNA encoding the polypeptides in vector expression systems, wherein the system permits expression of one or more polypeptides in mammalian host cells, such as in humans to induce an immune response. The expression systems can be DNA plasmids or viral systems. Methods for preparing and administering a DNA vaccine expressing Plasmodium proteins are well known in the art and have been previously described (e.g., Doolan and Hoffman (2001), Int J. Parasitol. 31: 753-62; U.S. Patent Publication 2008/0248060 (Oct. 9, 2008)), herein incorporated by reference.

(14) In another embodiment, derivatives of the proteins can be used in immunogenic compositions. In a variant of this embodiment, the immunogenic derivatives of the P. falciparum proteins include at least 10 contiguous amino acids of an amino acid sequence of a full length polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 2, 4, 6, 8, 10, 12 and 14. Immunogenic derivatives of the polypeptides may be prepared by expresson of the appropriate gene fragments or by other methods such as by peptide synthesis. Additionally, derivatives may be a fusion polypeptide containing additional sequence encoding one or more epitopes of the P. falciparum polypeptides of selected from the group consisting of SEQ ID NOs: 2, 4, 6, 8, 10, 12 and 14. In these embodiments, the proteins can be directly incorporated in immunogenic formulations or expressed from DNA plasmids or viral expression systems.

(15) In some embodiments, the P. falciparum polypeptides include immunogenic derivatives with more than 80% amino acid sequence identity to the sequences of selected from the group consisting of SEQ ID NOs: 2, 4, 6, 8, 10, 12 and 14. In this context, the term identity refers to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues that are the same, when aligned for maximum correspondence. Where sequences differ in conservative substitutions, i.e., substitution of residues with identical properties, the percent sequence identity may be adjusted upwards to correct for the conservative nature of the substitution.

(16) Immunization of mice with irradiation-attenuated sporozoites elicits a strong protective immunity (Clyde et al., Am. J. Med. Sci, 266: 398-401 (1973a); Clyde et al., AM. J. Med. Sci, 266: 169-177 (1973b); Nussenzweig et al., Nature, 216: 160-162 (1967)). Use of irradiation-attenuated sporozoites, as a vaccine approach, appears to target multiple antigens, many of which are pre-erythrocytic, as evidenced by the identification of genetically restricted responses to pre-erythrocytic stage antigens other than CSP in volunteers immunized with the irradiated sporozoite vaccine (ISV). (Kryzch et al., J. Immunol, 155: 4072-4077 (1995); Wizel et al., J. Immunol., 155: 766-775 (1995a); Wizel et al., J. Exp. Med., 182: 1435-1445 (1995b)). Targeting of pre-erythrocytic stage antigens with the irradiation-attenuated vaccine leads to immunity against sporozoites or infected hepatocytes and, therefore, prevents the onset of blood infection by blocking the release of primary merozoites into the blood stream.

(17) Pre-erythrocytic proteins are likely critical in conferring protective immunity against malaria. Despite the relatively large number of malaria genes that have been identified, following sequencing of the malaria parasite genome, identification of anti-malaria drug vaccine candidates has been hampered, to a great extent, by the relatively complex life-cycle of malaria parasite. Furthermore, many genes of the malaria parasite are poorly defined, antigenically, as well as functionally. Therefore, high-throughput characterization of antigens encoded by numerous genes was undertaken in order to ascertain potential protective responses. Based on these responses specific genes were selected as potential vaccine formulations.

Example 1: Identification and Expression of P. falciparum Proteins

(18) Characterization of identified sequences requires the availability of effective protein expression platforms. This limitation has been problematic in the development of anti-malaria vaccines. In order to circumvent this restriction, a modified wheat germ cell-free system was employed for parallel expression and screening of recombinant proteins. A panel of 150 putative P. falciparum pre-erythrocytic stage genes was established, based on bioinformatic analysis and transciptome and proteome expression databases for sporozoite and liver stage parasites. Most of the genes in this list encode hypothetical proteins with unknown function. It was hypothesized that some of the genes in this panel could serve as vaccine antigens, as evidenced by immune reactivity to sera from irradiated sporozoite vaccine (ISV)immunized volunteers.

(19) Use of other expression systems proved difficult for further, necessary down-stream analysis and characterization. In order to improve expression, a modified wheat germ cell-free expression system was utilized. This system permitted expression of approximately 90% of clones evaluated. Genes selected, for further expression and characterization, were identified, based on proteome and/or transcriptome datasets, by their expression at the pre-erythrocytic stage. A total of 155 genes of P. falciparum were used to generate protein expression DNA constructs as GST- and 6 His-fusions using the pE-E01-GST-TEV-GW and pEU-E01-His-TEV-GW plasmids, respectively (Tsuboi, et al., 2008).

(20) Expression of Recombinant Proteins.

(21) The expression of recombinant proteins was conducted utilizing a wheat germ cell-free system. Gene-specific RNAs to be used as template in the in vitro translation reactions were synthesized in two scales: a. Small-scale. The small-scale batch-reaction was performed with all clones by first generating RNAse-free PCR DNAs and using them as templates in transcription reactions. Individual genes were PCR-amplified from plasmid mini-prep DNA using pEU-E01-specific primers and adapters. Primers used were SP6: 5 AGAGCGCGCAAGACGCGCAGGACCG 3; E01: 5 AGAGAGAGAGAGA ACAACAACACAAACA 3. All PCR-amplified gene sizes were confirmed in an agarose gel. Transcription reactions were set up with 2 l of PCR DNA template, 25 mM dNTPs, 1 U/l RNAse inhibitor, 1.2 U/l SP6 Polymerase and transcription buffer for 6 hours at 37 C. The sizes of the gene-specific transcripts were verified by agarose gel electrophoresis. The RNAs were ethanol-precipitated to remove unwanted transcription reagents, dissolved in RNAase-free water and used for protein expression reactions. b. Large-scale. The synthesis of RNAs for large-scale protein expression was performed using RNAse-free plasmid DNA as template, purified by a standard DNA isolation kit, and added directly into the transcription reactions as follows: 25 g of plasmid DNA were mixed with 2.5 mM of NTPs, 1 U/l of RNAsin, 1 U/l of SP6 polymerase in transcription buffer described above. The total reaction volume was 250 l and incubated at 37 C. for 6 hours. The qualities of all expressed RNAs were analyzed by agarose gel electrophoresis prior to setting up the translation reactions.

(22) As with RNA synthesis, recombinant proteins were expressed in two scales throughout this study, as follows: a. Small Scale. Batch reactions were set up in 96-well U-bottom plates using a protocol described earlier (Sawasaki et al., FEBS Lett, 514: 102-105 (2002b). Briefly, the reaction was assembled by overlaying 40 l of substrate mix (0.45 mg/ml Creatine kinase, 20 U of RNasin, 24 mM Hepes/KOH pH 7.8, 100 mM KOAc, 2.7 mM Mg(OAc), 0.4 mM Spermedine, 2.5 mM DTT, 1.2 mM ATP, 0.25 mM GTP, 16 mM Creatine-Phosphate, 0.005% NaN3 and 0.3 mM of each of the amino acids including [14C]leucine (2 Ci/ml)) over 10 l of translation mix containing 2 l of each RNA and 8 l of wheat germ extract OD240 (OD60 final concentration). The extract was purchased from CFSciences, Yokohama, Japan. However, other comparable sources can be used. The plate was covered with parafilm and incubated at 26 C. for 16 hours. b. Large-Scale. Large amounts of recombinant proteins were synthesized following general guidelines recommended by the manufacturer of the wheat germ extract (i.e., CFSciences, Yokohama, Japan). Depending on the specific quantity needs for each protein, variable numbers of reactions were set up using flat bottom 6-well plates. Each translation reaction contains a bilayer of 2 mixtures; the lower portion includes a total of 500 l of the transcribed RNA and the wheat germ extract and the upper mixture consists of 5.5 ml of dialysis buffer. In brief, the lower reaction mixture was prepared by mixing 250 l of the RNA reaction, 40 mg/ml creatine kinase and 120 OD/ml of wheat germ extract (WGE OD240, CFSciences, Yokohama, Japan). This lower mixture was transferred to a 6-well and carefully overlaid with 5.5 ml of sub-admix buffer supplied by the manufacturer (CFSciences, Yokohama, Japan) in order to form a bilayer reaction. Plates were sealed with parafilm and translation occurred at room temperature overnight.

(23) Purification of Proteins.

(24) Recombinant proteins tagged with GST were affinity-purified using a procedure that has been previously described (Tsuboi et al., Infect. Immun., 76: 1702-1708 (2008)). After translation reaction was complete, the protein-containing mix was absorbed into Glutathione Sepharose 4B resin (GE healthcare, Piscataway, N.J.) followed by protein elution with 20 U of tobacco etch virus protease (AcTEV, Invitrogen, Carlsbad, Calif.) and 1 mM of DTT. Eluted proteins were confirmed by SDS-PAGE stained by Coomassie blue or silver stains. Purified protein concentrations were determined by both Bradford protein assay kit and spectrophotometer and reported as g/ml.

(25) Expressed proteins were further characterized by in vitro and in vivo analysis. In vitro analysis included antibody based and T-cell mediated assays. Analysis of the selected genes were analyzed using the following methodologies:

Example 2: Assay Methods in Analysis of Pre-Erythrocytic Gene Products

(26) Indirect Fluorescence Antibody Assay (IFA).

(27) Sera from both mice and rabbits immunized with all proteins were tested for immune-reactivity to sporozoite, 4- and 6-day old exo-erythrocytic, asexual and sexual erytrocytic stages of P. falciparum. IFA protocols for testing sera against sporozoite and erythrocytic stages were as described in Aguiar et al., Vaccine, 20: 275-280 (2001).

(28) Liver stage parasites were generated and tested by two different methods. The first used in vitro generated liver stages by infecting 510.sup.4 HC04 hepatocytes (Sattabongkot et al., Am J Trop Med Hyg., 74: 708-715 (2006)) with 510.sup.5 P. falciparum sporozoites. After a brief incubation period of 4-6 hours, cells were washed and parasites were left to develop for a period of 2-, 4- and 6-days. Before infected hepatocytes were tested in IFA, cells were stained with Lysotracker (Invitrogen, Carlsbad, Calif.) following manufacturer's protocol and fixed with acetone. The second method used P. falciparum-infected liver stages parasite generated in chimeric mice as reported in a study describing this novel method (Sacci et al., Int J Parasitol., 36: 353-360 (2006)).

(29) In summary, mice were infected with 1.510.sup.6 P. falciparum sporozoites and their livers harvested between 3 and 8 days post-infection for cryosectioning. Selected lobes were embedded in tissue-Tek O.C.T. compound (Miles Scientific, Naperville, Ill.) and frozen in an isopentane/liquid nitrogen bath. Tissue sections (7 m) were cut on a Leica CM1900 (Leica Microsystems, Deerfield, Ill.), fixed in absolute methanol and stored at 80 C. until used. IFA on both types of infected hepatocytes were done with mouse and rabbit polyclonal sera at single 1:100 dilution. As a positive control, anti-heat shock protein-70 antibody was utilized. The IFA was developed by incubating cells with FITC-conjugated anti-mouse or anti-rabbit IgG and staining the nuclei with Hoechst 33258 pentahydrate. Slides were mounted in anti-fading Vectashield (Vector Laboratories, Burlingame, Calif.) and visualized by confocal microscopy.

(30) Immuno Electron Microscopy.

(31) The ultrastructural localization of Plasmodium antigen expression was examined by immunoelectron microscopy. Briefly, P. falciparum infected red blood cells and salivary glands P. falciparum infected Anopheles stephensi were fixed in PBS containing 1% paraformaldehyde, and 0.1% glutaraldehyde, for 24 h at room temperature. Ultra thin sections, embedded in LR-White resin (Polyscience, Inc., Warrington, Pa.) were cut and placed on nickel grids. The sections on the grids were etched by incubation with freshly prepared, saturated sodium-m-periodate for 5 minutes, followed by rinsing 3 times in deionized water. The grids were quenched with 0.1 M glycine in phosphate buffer for 20 minutes to prevent any free aldehyde groups from binding to the primary antibody. The grids were blocked by incubation in PBS, 1% BSA, 5% Fish gelatin for 30 minutes.

(32) Grids were incubated with the primary antibody (diluted 1:50) in a humidified environment for 2 hours, followed by washing 5 times in PBS-0.1% Tween-20 (polyoxyethylene (20) sorbitan monolaurate). The grids were then incubated for 30 minutes with a goat anti-mouse or rabbit antibody conjugated to 10 nm gold particles. The grids were washed as described above, then post-stained with 2% Uranyl acetate and rinsed with water.

(33) The sections were examined with a transmission electron microscope. Negative controls included uninfected cells and the use of nonspecific, irrelevant antibodies as the primary antibody.

(34) Western Blotting.

(35) Recombinant proteins were analyzed by Western blot using two protocol, summarized as follows: a. For the high throughput expression, [.sup.14C]Leucine-labeled proteins were separated by SDS-PAGE as three fractions; 2 l of the total translation reaction (T), after the 96-well plate was spun 2 l of supernatant (S) fraction and lastly the pellet (P) was re-suspended in sample buffer and separated as pellet fraction. Recombinant proteins were identified by autoradiography using an imaging analyzer. b. Purified recombinant proteins were screened using the regular Western blot protocol. Ten micrograms of each protein were separated on a pre-cast 4-20% gradient SDS polyacrylamide gel, and subsequently electrotransferred onto a PVDF membrane. Western blot with a 1:500 dilution of rabbit antisera immunized with the proteins or human immune sera. Peroxidase-conjugated goat anti-rabbit or human IgG antibody was used as the secondary antibody at a dilution of 1:10,000. The reaction was developed using ECL-Plus (General Electric Healthcare, Piscataway, N.J.) western blotting detection system according to the manufacturer's instructions.

(36) Enzyme-Linked ImmunoSorbent Assay (ELISA).

(37) Human sera, from volunteers immunized with ISV, were tested at 1:100 dilutions for antigen-specific reactivity measured by ELISA using recombinant proteins expressed by both small and large scale methodologies, as described in Example 1. Negative (GST and wheat germ extract) and positive (CSP and SSP2/Trap) control proteins were also expressed in the same scale. Immunolon II ELISA plates (Dynatech Laboratory Inc., Chantilly, Va.) were coated with 2-5 l of recombinant protein and wheat germ extract in PBS overnight at room temperature. Wells were washed three times with PBS containing 0.05% Tween 20 (polyoxethylene (20) sorbitan monolaurate) (washing buffer) and blocked with 100 l of 5% non-fat dry milk in PBS (blocking buffer) for 2 hours at 4 C. After washing three times, wells were incubated for 2 hours with 50 l of 1:100 dilution of test human sera. The wells were again washed three times and incubated for 1 hour with peroxidase-labeled goat anti-human IgG (KPL). After a three washes the wells were incubated for 20 minutes with 100 l of a solution containing ABTS substrate [2,2-azino-di-(3 ethylbenzthiazoline sulfonate] and H.sub.2O.sub.2. Color reaction was measured in a micro-ELISA automated reader at OD 410 nm. ELISA data were presented as the average of OD readings for tested sera dilutions. The sporozoite-specific antibodies in these human sera were assessed by the indirect fluorescent antibody test (IFAT) as previously described. Results were reported as the endpoint dilution, representing the last serum dilution at which fluorescence was scored as positive.

(38) Interferon ELIspot Assay.

(39) Multiscreen MAIPS4510 plates (Millipore, Billerica, Mass.) were coated with 100 l well of sterile carbonate/bicarbonate buffer containing 15 g/ml of anti-human IFN- mAb 1-D1K (purchased from Mabtech, Cincinnati, Ohio) overnight at 4 C. Plates were washed five times with 100 l/well RPMI medium containing 25 mM HEPES buffer and L-glutamine.

(40) The plates were blocked with 200 l/well HR-10 media containing 1% of the following: 200 mM L-glutamine, Pen/Strep, 10 mM MEM, 10% Human AB Serum and 87% RPMI medium. The plates were incubated with blocking solution at 4 C. for at least 24 hours. PBMCs (2010.sup.6) were thawed at 37 C. and resuspended in 10 mls R-10 media containing 10% FBS, 1% 200 mM L-glutamine, 1% Pen/Strep and 88% RPMI. The cells were washed twice at 1200 rpm, 25 C., 10 minutes and again with 10 mls R-10 and pelleted at 1000 rpm, 25 C., 10 minutes. The cells were re-suspended in an appropriate volume of HR-10 for counting. The volume of the cell suspension was increased with HR-10 and rested overnight at 37 C./5% CO2 incubator. Cells were counted again to calculate recovery and viability. The plates were washed from their block solution six times with RPMI medium and left at room temperature until the stimulants and cell suspension were prepared. The stimulants were diluted with HR-10 media to its optimal concentration. The cell suspension was diluted with HR-10 to its optimal concentration. The stimulants were added first to the -IFN- coated wells in quadruplicate at 100 l/well followed by the addition of 100 l/well cell suspension at a final concentrations of 100,000, 200,000 and 400,000 cells/well. Non-stimulant containing wells contained HR-10 media and the cell suspension were used as background controls. Plates were incubated for 36 hours at 37 C./5% CO2 then washed six times with 1PBS+0.05% Tween-20 (polyoxethylene (20) sorbitan monolaurate) solution. ELIspot was developed by adding 100 l of 1 g/ml biotinylated -IFN- mAb 7-B6-1 (purchased from Mabtech, Cincinnati, Ohio) and incubated at room temperature for three hours. Plates were washed six times with 1PBS+0.05% Tween-20 (polyoxethylene (20) sorbitan monolaurate) solution. Development was performed by adding 100 l of a 1:1000 streptavidin-alkaline phosphatase solution and incubated at room temperature for one hour. Plates were washed six times with 1PBS+0.05% Tween-20 (polyoxethylene (20) sorbitan monolaurate) followed by three washes with 1PBS solution. Alkaline Phosphatase Conjugate at 1:25 dilution was added and incubated at room temperature for 15 minutes. The chromogenic reaction was stopped by extensively washing the plates with water. Once dry, the spots were counted using the AID ELIspot plate reader (Strassberg, Germany).

Example 3: Immunogenicity and Life Cycle Expression of Pre-Erythrocytic P. falciparum Genes

(41) A summary of the expression and reactivity of 22 genes is shown in Table 1. An important aspect of the proteins in Table 1 is that they were recognized by human antibody and/or T-cells from volunteers immunized with IVS. Therefore, since they are recognized within the natural immune response against malaria sporozoites these proteins may be valuable in conferring immunity against malaria.

(42) Expressed proteins from all genes in Table 1 were recognized by ELISA and/or by Western blot analysis using ISV-immunized human sera. Additionally, some antigens were also recognized by immune T cells. This illustrates that the novel antigens exist within the natural structure of malaria sporozoites used for ISV immunization. Furthermore, the antigens are recognized as foreign to the human body and are therefore capable of eliciting a protective immune response. Additionally, reactivity of the sera also indicates that these antigens are associated with complete protection against malaria infection in these volunteers, which further indicates that these antigens are potential vaccine candidate antigens. The genes shown in Table 1 have been verified as being expressed at the pre-erythrocytic (sporozoite and liver) parasite stages by IFA. The antigen's subcellular localization was also determined by electron microscopy (EM).

(43) P. falciparum proteins in Table 1 expressed from the cloned sequences were recognized by human antibodies and/or T cells from volunteers immunized with ISV. As such, the novel proteins are recognized within the natural immune response against malaria sporozoites. Therefore, these proteins may be important in immunity against malaria.

(44) TABLE-US-00001 TABLE 1 Screen Screen IFA IFA IFA P. yoelii Individual Combined Antigen P. falciparum Immune Immune Sporozoite Liver Blood Ortholog Py Py ID # Gene Locus T cell antibody Stage Stage Stage Locus Protection Protection 1 PF26 PF11425w Negative Positive Negative Positive Negative PY00232 ND ND 2 PF56 PF08_0008 Positive Positive Positive Positive Positive PY07130 ND ND 3 PF61 PF10_0138 Positive Positive Positive Positive Positive PY04748 ND ND 4 PF106 PFI0580c Positive Positive Positive Positive Positive PY03424 7% 43% 5 PF116 PFI0460w Negative Positive Positive Positive Negative PY03130 ND ND 6 PF121 PF10_0319 Positive Positive Positive Positive Positive PY02600 ND ND 7 PF01 PF10_0098 ND Positive ND ND ND PY04010 ND ND 8 PF08 PFC0555c ND Positive Positive Pending ND PY03661 0% 43% 9 PF09 MAL7P1.32 ND Positive ND ND ND PY04689 ND ND 10 PF13 PFC0700c ND Positive ND ND ND PY03459 ND ND 11 PF24 PFC1055w ND Positive ND ND ND PY00359 ND ND 12 PF47 PF11_0156 ND Positive ND ND ND PY02926 ND ND 13 PF51 PFE0565w ND Positive ND ND ND PY00913 ND ND 14 PF59 PF14_0495 ND Positive ND ND ND PY06813 ND ND 15 PF68 PF14_0722 ND Positive ND ND ND PY00150 ND ND 16 PF72 MAL13P1.25 ND Positive NDd ND ND PY05161 ND ND 17 PF93 PF13_0012 ND Positive ND ND ND PY03011 7% 43% 18 PF119 PFD0235c ND Positive Positive Positive Positive PY01067 ND ND 19 PF78 MAL8P1.78 Positive Positive Positive Positive Negative PY00566 ND ND 20 PF02 PFE0785c ND Positive Positive Positive Positive PY00232 30% ND 21 PF144 PF14_0467 Positive Positive Positive Positive Positive PY05966 ND ND 22 PF131 MAL13P1.107 ND Positive ND ND ND PY131 ND ND

Example 4: Immunogenic Protection by P. yoelii Orthologous Genes

(45) P. yoelii genes, listed in Table 1, that are orthologous to P. falciparum genes were evaluated for their ability to protect mice from challenge. For protection studies, CD1 mice were injected intramuscularly in the tibialis anterior muscle with 100 l of vaccine (50 l in each leg). The DNA vaccine vectors were prepared in 1 Phosphate Buffered Saline (PBS) and diluted to the appropriate concentration for vaccination in 1PBS. The vaccinia vaccine vectors were prepared in 1 mM Tris (9.0) and diluted to the appropriate concentration for vaccination in 1PBS. Mice were challenged intravenously in the tail vein with 300 P. yoelii (17XNL) sporozoites. Sp[orozoites were hand dissected from infected mosquito salivary glands and diluted for challenge in M199 medium containing 5% normal mouse serum.

(46) In the first study, 14 mice per group were primed on day 0 with 100 g of DNA-P. yoelii vaccine vector and boosted on day 40 with 510.sup.7 plaque forming units (pfu) of vaccinia-P. yoelii vaccine vector containing the same P. yoelii insert. Mice immunized with a combination of vectors expressing PY03011, PY03424 and PY03661 were primed with a total of 300 g of DNA-P. yoelii vectors and boosted with a total of 1.510.sup.8 pfu of the vaccinia-P. yoelii vectors. On day 50, the mice were bled and sera prepared. On day 54, the mice were challenged with 300 P. yoelii sporozoitses. On days 61-68, parasitemia was evaluated by visualization of Giemsa-stained blood smears. Mice were considered positive if parasites were observed in any sample. To gauge the severity of the challenge, 4 groups of nave CD1 mice were challenged with 100, 33.3, 11.1 or 3.7 P. yoelii sporozoites. The results from these infectivity control mice indicated that the mice injected with 300 P. yoelii sporozoites were challenged with a dose equivalent to 7 times the ID.sub.50 dose.

(47) P. yoellii genes were cloned in a DNA and orthopox viruses, as above. The P. yoelii orthologous genes were cloned into plasmids for generating DNA vaccines. Poxvirus and adenovirus vectors expressing the P. yoelii orthologs were also generated. The DNA, poxvirus and adenovirus-based vaccine constructs were tested in mice using a prime-boost regimen and the mice challenged with P. yoelii sporozoites to assess protection.

(48) In the second study, 14 mice per group were primed on day 0 with 100 g of DNA-P. yoelii vaccine vector and 30 g of DNA vector expressing murine granulocyte-macrophage colony-stimulating factor (mGM-CSF) and boosted on day 42 with 3.310.sup.7 pfu of vaccinia-P. yoelii vaccine vector. Mice immunized with 2 or 3 DNA-P. yoelii vectors were primed with a total of 200 g or 300 g of the DNA-P. yoelii vectors and 30 g of the DNA-mGM-CSF vector and boosted with a total of 6.610.sup.7 pfu or 110.sup.8 pfu of the vaccinia-P. yoelii vectors, respectively. Three separate groups fo the negative control mice were immunized with 3 different doses o the DNA and vaccinia vectors that do not express a P. yoelii antigen. One group was primed with 100 g of an empty DNA vector and 30 g of a DNA-mGM-CSF vector and boosted with 3.310.sup.7 pfu of an empty vaccinia vector. A second group was primed with 200 g of an empty DNA vector and 30 g of a DNA-mGM-CSF vector and boosted with 6.610.sup.7 pfu of an empty vaccinia vector. A third group was primed with 300 g of an empty DNA vector and 30 g of a DNA-mGM-CSF vector and boosted with 110.sup.8 pfu of an empty vaccinia vector. On day 52, the mice were bled and sera prepared. On day 57, the mice were challenged with 300 P. yoelii sporozoites. On days 64-71, parasitemia was evaluated by visualization of Giemsa-stained blood smears. Mice were considered positive if parasites were observed in any sample. To gauge the severity of this challenge, 4 groups of nave mice were challenged with 100, 33.3, 11.1 or 3.7 P. yoelii sporozoites. The results from these infectivity control mice indicated that the mice injected with 300 P. yoelii sporozoites were challenged with a dose equivalent to 13.6 times the ID.sub.50 dose.

(49) It should be noted that the regimens for the two protection studies were slightly different. For example, the dose of the individual vaccinia-P. yoelii vectors was slightly higher in protection study one (510.sup.7 pfu) than protection study 2 (3.310.sup.7 pfu). Consequently, the total dose of the trivalent vaccine was 1.510.sup.8 pfu in protection study one and 110.sup.8 pfu in protection study two. Additionally, in protection study 2, the DNA vectors were mixed with a DNA-mGM-CSF plasmid. Although previous studies had indicated that co-administration of a DNA-PyCSP vector with the DNA-mGM-CSF plasmid could enhance the immunogenicity and efficacy of a DNA-vaccinia prime-boost regimen, the DNA-mGM-CSF plasmid did not appear to enhance the efficacy of the PyCSP or trivalent P. yoelii vaccines in protection study two, relative to one.

(50) As illustrated in Table 1 and FIG. 1 (panel A), none of the 14 mice immunized with vectors that express PY03011 or PY03661 were sterilely protected (i.e., 0% protection). Additionally, 2 out of 14 mice immunized with PY03424 were protected (i.e., 14%). However, when all three antigens were used (i.e., PY03011; PY03424 and PY03661), 57% protection was observed. This was greater than that seen with PyCSP.

(51) The results of a second study, FIG. 1 (panel B) and Table 1, further confirmed that additive protective effect of the P. yoelii polypeptides. As illustrated in Table 1 and in FIG. 1 (panel B), none of the mice immunized with vectors that express PY03661 were protected and only 1 of 14 mice immunized with vectors that express PY03011 or PY03424 were protected (7% protection). However, 6 of 14 mice immunized with PY03011 and PY03424 were protected (i.e., 43%), 3 of 14 mice immunized with PY03424 and PY03661 were protected (i.e., 21% protection) and 6 of 14 mice immunized with all 3 P. yoelii antigens were protected (i.e., 43% protection). The protection elicited by PY03011 and PY03424 in this study is statistically significant (PY03011/PY03424 (dose=2 vs Neg control (dose=2), p=0.0159). Similar to the previous study, the protection elicited by the combination of PY03011 and PY03424 or all 3 antigens was greater than the protection elicited by PyCSP (i.e., 43% vs. 14%).

(52) In another study, FIG. 2, 14 CD1 mice were again immunized using a DNA/adenovirus prime boost regime. In this study, a greater response was observed using PY3011 or PY3424, singly. In fact, the response to PY3424 was equivalent to that observed for PYCSP. A third antigen, PY4748 resulted in 1 out of 14 mice were protected. Interestingly, when all three antigens (i.e., PY3011, PY3424 and PY4748) were used to immunize CD1 mice, no protection was observed. The causation of this result is not clear.

(53) The results of this study illustrate the potential value of P. yoelii proteins in conferring immunity against P. yoelii. Of interest is that the additive effect of the proteins resulted in protection often beyond that which would have been predicted from mice immunized with only a single protein. For example, in FIG. 1, panel A, PY03011 or PY03661 did not result in protection. Similarly, immunization with PY03424 resulted in only 14% protection. However, immunization of the genes in combination, albeit at a higher dose due to all three being administered simultaneously, resulted in protection higher than PyCSP.

(54) From these analyses, the orthologous P. falciparum genes would be important candidates to be included in compositions for the induction of immunity against malaria. The P. falciparum orthologs are listed in Table 1. For all of these P. yoelii gene products tested in these murine protection studies, the P. falciparum orthologs reacted positively to either immune human serum and/or T-cell. A summary of the DNA and protein sequences are summarized in Table 2.

(55) TABLE-US-00002 TABLE 2 SEQ ID Gene Protein No. Clone Name or DNA SEQ 1 PF56 PF08_0008 DNA SEQ 2 PF56 PF08_0008 protein SEQ 3 PF61 PF10_0138 DNA SEQ 4 PF61 PF10_0138 protein SEQ 5 PF106 PFI0580c DNA SEQ 6 PF106 PFI0580c protein SEQ 7 PF121 PF10_0319 DNA SEQ 8 PF121 PF10_0319 protein SEQ 9 PF08 PFC0555c DNA SEQ 10 PF08 PFC0555c protein SEQ 11 PF144 PF14_0467 DNA SEQ 12 PF144 PF14_0467 Protein SEQ 13 PF93 PF13_0012 DNA SEQ 14 PF93 PF13_0012 Protein

Example 5: Immune Recognition of P. falciparum Genes Orthologous to P. yoelii

(56) From the P. yoelii protection data, orthologous P. falciparum genes were identified and further evaluated for their ability to confer cellular immunity. Illustrated in FIG. 3 are the results of utilizing the P. falciparum ortholog to PY3424, PF 106, as an antigen in inducing a T-cell response, as evidenced by its ability to induce IFN- in PBMCs in ELISpot assays. The results are presented in spot-forming cells (SPC)/million.

(57) In FIG. 3, the pool represents 15-mer peptides, overlapping by 10-mers, encompassing the entire length of the PF 106 protein. Additionally, HLA class I-specific 15-mer peptide pools were developed and also used as antigen. The HLA class I-specific pools contained 12 to 15 peptides, each containing an HLA class I binding motifs for specific HLA class I alleles. The HLA genotypes of the PBMCs are summarized in Table 3. All volunteers had been immunized with ISV, with some exhibiting a protective immune response. The results of these studies are illustrated in FIG. 3.

(58) TABLE-US-00003 TABLE 3 Volunteer Sex Age HLA-A HLA-B HLA DR Cohort DF0043 Male 37 A26, B15, DRB1*13, DRB3*02/03 Not A68 B38/39 protected MF0052 Male 39 A3002, B53, DRB1*03/06/11, DRB3*02/03 Not A3402 B0812 protected MR0053 Male 45 A1, B7, B18 DRB1*1503, DRB1*07MT, Not A6802 DRB4*01, DRB5BFK protected JS0065 Male 26 A1, A24 B8, B44 DRB1*13, DRB1*08DKZ, Not DRB3*01 protected DC0020 Male 41 A2, A32 B15, B44 DRB1*04BMS, DRB1*14APF, Not DRB3*02CAY protected GB0021 Male 29 A1, A11 B35, B57 DRB1*01AD, DRB1*07AC Protected DF0030 Male 47 A2, A3 B7, DRB1*01AD, DRB1.2 03YH, Protected B40DGE DRB3.1 01MN WW0058 Male 32 A2, A3 B7, B44 DRB1*02, DRB5*01/02 Protected ND0064 Male 21 A2, A3 B14, B51 DRB1*02, DRB1*03/06, Protected DRB3*02/03, DRB5*01BFK HG0066 Male 38 A2, A2 B18, B39 DRB1*08/14/(03), Protected DRB3*02/03

(59) As illustrated in FIG. 3, the peptide pool generally induced a significant T-cell response with a greater response in PBMC's from immunized volunteers, compared to pre-immunized PBMC. Post-immune PBMC's from several individuals, e.g., GB21; DF0030, showed relatively high induction of IFN-. In fact, the volunteer GB21 exhibited a protective immune response against malaria. Additionally, peptide antigens containing HLA class I binding motifs generally resulted in significant IFN- induction. Interestingly, PBMCs from GB21, which gave the overall greatest IFN- induction, yielded a level of IFN- SPC, using A11 HLA pools as antigen, equivalent to that observed with the pool of 15-mers. This suggests that PF106 not only contains anti-P. falciparum epitopes but that some epitopes may be important in immunity against malaria. Furthermore, regions of PF106 operate in an HLA-restricted fashion to induce class I T-cell immunity.

(60) In addition to PF106, other P. falciparum proteins were utilized as antigens in IFN- ELISpot assays resulted in HLA class I specific induction of IFN-. These include PF61, PF56, PF121 and PF144. The results of these studies are illustrated in FIGS. 3-7, respectively. Additionally, the results are summarized in Table 1. The DNA and protein sequence identification numbers are summarized in Table 2.

(61) The T-cell response elicited by PF144 was particularly noteworthy. As shown in FIG. 7, PBMC's from four individuals, exposed to PF144, resulted in a high level of IFN- secreting cells. Of note is that three of the four individuals were previously shown to have elicited a protective immune responses against malaria, suggesting the importance of this protein in protection. Furthermore, peptides containing HLA binding motifs to class I alleles induced an IFN- response, in some cases, such as in GB21, WW58 and DF30, equivalent or even greater than that observed when the pool of 15-mer peptides twere used.

(62) In furtherance to the notion that PF144 contains T-cell epitopes important in conferring immunity against malaria, polypeptide containing motifs associated with B7 were analyzed in greater detail for their ability to induce IFN-. As illustrated in FIG. 8, the IFN- responses to peptide pools were analyzed in PBMCs from WW58. As seen in FIG. 8, the results using A2 and A3 pools were consistent to that illustrated in FIG. 7. However, in using B7 pools as antigen, one peptide in particular, KLRHFFSILLKSLVI, containing a B7 binding motif, induced a high IFN- response in the immune PBMCs. This suggests the likely importance of B7 allele in class I T-cell immunity against PF144.

(63) The data in FIG. 1-8 strongly suggest that the protein antigens PF106, 61, 56, 121 and 144 contain epitopes important in conferring protection against P. falciparum malaria. Furthermore, the proteins are able to induce class I specific responses, as evidenced by their ability to induce a T-cell response to antigen containing specific HLA class I peptide binding motifs.

Example 6: Incorporation Into Expression Systems

(64) This example illustrates prophetic uses of the recombinant genes encoding the novel antigens by incorporating one or more of the antigens of Table 2, or nucleic acid encoding the antigens into vaccine formulations. Alternatively, immunogenic fragments of the antigens or derivatives of the antigens of Table 2 can be utilized. It is contemplated that the antigens can be expressed either as a component of a DNA vaccine or other platform system. An example of a contemplated expression system includes, but is not limited to, viral systems, including replicating and nonreplicating vectors. Examples of contemplated viral vectors include adenvirus, alphavirus, posvirus, cytopmegalovirus, canine distemper virus and yellow fever virus. The antigen could be incorporated as an insert of a DNA or other vaccine expression system, either as a single antigen or multiple antigen expression systems from a single or multiple promoters.

(65) The contemplated invention includes a method for inducing an immune response in mammals, including humans. In this example, antigens, either as polypeptide or incorporated into a nucleic acid expression system, such as a DNA or viral system, are administered in one or more doses. The method also contemplates inducing an immune response utilizing a prime-boost immunization regimen. In this embodiment, one or more priming immunization doses would be administered followed by one or more boosting immunizations.

(66) The priming and boosting immunization comprises a composition containing one or more malaria polypeptides, wherein the polypeptides contains the amino acid sequence of SEQ ID Nos. 2, 4, 6, 8, 10, 12 or 14, or immunogenic derivatives, thereof. Alternatively, the immunogenic composition can be comprised of an expression system capable of expressing the polypeptides. In this embodiment, nucleic acid molecules, encoding these polypeptides, with the nucleic acid sequences of SEQ ID Nos. 1, 3, 5, 7, 9, 11 or 13, can be inserted into a DNA plasmid or a viral expression vector. Examples of viral expression vector systems include: alphavirus (and alphavirus replicons), adenovirus, poxvirus, adeno-associated virus, cytomegalovirus, canine distemper virus, yellow fever virus and retrovirus.

(67) The contemplated methods include immunization regimens wherein the priming immunization comprises malarial peptides expressed from a DNA plasmid expression vector or an adenovirus, while the boosting immunization includes malaria peptides expressed from either: adenovirus, adenovirus that is heterologous to the priming adenovirus, poxvirus or one or more malaria polypeptides. The malaria polypeptides include polypeptides with the amino acid sequences of SEQ ID NO. 2, 4, 6, 8, 10, 12 or 14, or immunogenic derivatives, thereof.

(68) All references, including publications, patent applications and patents, cited herein are hereby incorporated by reference.

(69) Having described the invention, one of skill in the art will appreciate in the appended claims that many modifications and variations of the present invention are possible in light of the above teachings. It is therefore, to be understood that, within the scope of the appended claims, the invention may be practiced otherwise than as specifically described.