Vector for the selective silencing of a gene in astrocytes

09695443 ยท 2017-07-04

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to a viral vector for silencing a gene specifically in astrocytes comprising: an astrocyte-specific viral envelope protein, a first nucleic acid sequence encoding a transcription activator and at least one target sequence of a neuron-specific miR under the control of an astrocyte-specific promoter, anda second nucleic acid sequence encoding a RNA for silencing the gene under the control of a promoter inducible by the transcription activator.

Claims

1. A viral vector for silencing a gene specifically in astrocytes comprising: an astrocyte-specific viral envelope protein, a first nucleic acid sequence encoding a transcription activator and at least one target sequence of a neuron-specific microRNA (miR) under the control of an astrocyte-specific promoter, and a second nucleic acid sequence encoding a RNA for silencing the gene under the control of a promoter inducible by the transcription activator, wherein the first and second nucleic acid sequences are on the same nucleic acid molecule.

2. The viral vector according to claim 1, wherein the astrocyte-specific viral envelope protein is Mokola virus G protein (G-MOK).

3. The viral vector according to claim 1, wherein the transcription activator is the tetracycline transactivator (tTA) and the promoter inducible by the transcription activator is the tetracycline response element (TRE).

4. The viral vector according to claim 3, wherein the astrocyte specific promoter is the promoter of rat GS gene.

5. The viral vector according to claim 1, wherein the astrocyte specific promoter is the promoter of the glutamine synthase (GS) gene.

6. The viral vector according to claim 1, wherein the target sequence of the neuron-specific miR is a target sequence of miR124 (miR124T).

7. The viral vector according to claim 1, wherein the nucleic acid sequence encoding a RNA for silencing the gene encodes a siRNA or a shRNA targeting the gene mRNA.

8. The viral vector according to claim 7, wherein the shRNA is embedded in a miR sequence.

9. The viral vector according to claim 8, wherein the miR sequence is a miR30 sequence.

10. The viral vector according to claim 1, wherein the viral vector is a lentiviral vector.

11. The viral vector according to claim 10, wherein the lentiviral vector is an HIV-1 vector.

12. The viral vector according to claim 9, wherein the nucleic acid molecule comprises, from 5 to 3: a 5 long terminal repeat (LTR) sequence, a sequence encoding a shRNA targeting the gene embedded in a miR30 sequence, the GS rat promoter, a sequence encoding the tetracycline transactivator the woodchuck hepatitis post-transcriptional regulatory element (WPRE) a sequence encoding 4 copies of a miR124 target sequence, a 3 long terminal repeat (LTR) sequence comprising the tetracycline response element (TRE).

13. The viral vector according to claim 1, wherein the gene is the huntingtin gene.

14. The viral vector according to claim 1, for use in the prevention or treatment of astrocyte-mediated diseases.

15. A pharmaceutical composition comprising a viral vector according to claim 1 as an active ingredient and a pharmaceutically acceptable vehicle or excipient.

16. An in vitro method, of silencing a gene in astrocytes, comprising contacting the viral vector according to claim 1 with at least one astrocyte.

17. A nucleic acid molecule comprising from 5 to 3: a 5 long terminal repeat (LTR) sequence, a sequence comprising from 4 to 1000 nucleotides, the GS rat promoter, a sequence encoding the tetracycline transactivator, the woodchuck hepatitis post-transcriptional regulatory element (WPRE), a sequence encoding 4 copies of a miR124 target sequence, a 3 long terminal repeat (LTR) sequence comprising the tetracycline response element (TRE).

18. The nucleic acid sequence according to claim 17, wherein the sequence comprising from 4 to 1000 nucleotides is a multiple cloning site.

19. The nucleic acid sequence according to claim 17, wherein the sequence comprising from 4 to 1000 nucleotides is sequence encoding a siRNA or a shRNA.

Description

DESCRIPTION OF THE FIGURES

(1) FIGS. 1A and 1B: Transduction efficiency and tropism in adult mice of lentiviral vectors containing the astrocytic promoters. FIG. 1A) MOK-G pseudotyped LVs carrying either CMVa, GFA-ABC1D, EAAT1 or GS were injected into striatum of BAC-GLT1-eGFP mice. Acquisition parameters were optimized for each promoter. FIG. 1B) Quantification of DsRednuc-eGFP- and DsRednuc-NeuN-positive cells shows the astrocytic tropism of all vectors. Scale bar=10 m.

(2) FIGS. 2A and 2B: Combinatorial effect of MOK-G and miR124T on lentiviral vectors tropism with astrocytic promoters. FIG. 2A) Double immunofluorescence staining for GLT1-eGFP and DsRednuc after the injection of MOK-G pseudotyped LVs into striatum of BAC-GLT1-eGFP. Acquisition parameters were optimized for each promoter. FIG. 2B) Quantification of DsRednuc-eGFP- and DsRednuc-NeuN-positive cells shows the improvement of the astrocytic tropism for all vectors. Scale bar=10 m.

(3) FIG. 3: Principle of the astro-silencing lentiviral vector. The schema represents the different elements composing the astro-silencing vector based on the use of the tetracycline-regulated system. If the LV enters into a neuron, the binding of miR124 to its target leads to the degradation of the mRNA, preventing for silencing. However, as astrocytes do not contain miR124, there is no mRNA degradation. Hence, theoretically, silencing should be observed only in astrocytes.

(4) FIGS. 4A, 4B and 4C: Tropism of the astro-silencing lentiviral vector. FIG. 4A) To assess the tropism of the astro-silencing construct, a nuclear-localized GFP (AcGFPnuc) was used. MOK-G pseudotyped LVs were injected into striatum of BAC-GLAST-DsRed mice. As internal promoters, CMVb and GS were used. As control, a LV miR124T-less and containing CMVb was used. FIG. 4B) Quantification of AcGFPnuc-DsRed-, AcGFPnuc-S100-, AcGFPnuc-NeuN-positive cells shows a tropism preferentially astrocytic with CMVb-miR124T and GS-miR124T. FIG. 4C) Measurement of the mean fluorescence intensity per cell (MFI/cell) highlights the astrocytic activity of GS compared to the ubiquitous CMVb.

(5) FIGS. 5A, 5B, 5C and 5D: Validation of the astro-silencing construct with a siGFP into BAC-GLT1-eGFP mice. FIG. 5A) Typical aspect of striatum BAC-GLT1-eGFP mice injected with PBS. FIG. 5B) GS-siUNIV-miR124T and GS-siGFP-miR124T LVs have been injected into BAC-GLT1-eGFP striatum mice. To localize the injection site, BFP or DsRed have been co-injected with siUNIV and siGFP respectively. Injection of GS-siUNIV-miR124T induced a GFP decrease in the vicinity of BFP whereas injection of GS-siGFP-miR124T induced a large GFP decrease. FIG. 5C) The measurement of the GFP decrease volume shows a significant difference between siGFP and siUNIV, confirming the efficacy of the siGFP. FIG. 5D) GS-siGFP-miR124T LV has also been injected into BAC-GLAST-DsRed striatum mice to confirm that siGFP does not act on promoter to silence the transgene. Scale bar=200 m.

(6) FIGS. 6A and 6B: Specificity of the astro-silencing construct. FIG. 6A) Bicistronic vector encoding Cherry and GFP under the control of CMV minimal and PGK promoters, respectively. This LV has been pseudotyped with VSV-G in order to transduce only neurons. FIG. 6B) Quantification of Green/Red ratio reflects the silencing of GFP. LV-siUNIV (first column) is the internal control and represents the basal level of Green/Red ratio. As a control of the system efficiency, we have used a VSV-G pseudotyped LV encoding the siGFP under the control of the CMVb (third column) in order to target neurons. A significative Green/Red ratio is then observable. When the astro-silencing construct is used (second column), a slight decrease of Green/Red ratio is also observable, reflecting a low tropism for neurons.

(7) FIGS. 7A and 7B: Tropism of lentiviral vectors with a VSV-G envelope and astrocytic promoters. FIG. 7A) Double immunofluorescence staining for GLT1-eGFP and DsRednuc after the injection of VSV-G pseudotyped LVs into striatum of BAC-GLT1-eGFP. Acquisition parameters were optimized for each promoter. FIG. 7B) Quantification of DsRednuc-eGFP-positive cells shows a partial astrocytic tropism with VSV-G pseudotyped LVs with CMVa or GS. Scale bar=10 m.

(8) FIGS. 8A, 8B and 8C: Tropism of lentiviral vectors with a VSV-G envelope and GS promoter combining with miR124T. FIG. 8A) Double immunofluorescence staining for GLT1-eGFP and DsRednuc after the injection of VSV-G pseudotyped LV GS-DsRednuc-miR124T into striatum of BAC-GLT1-eGFP. FIG. 8B) Quantification of DsRednuc-eGFP- and DsRednuc-NeuN-positive cells shows an astrocytic tropism with miR124T compared to LV without miR124T. Scale bar=10 m. FIG. 8C) Comparison of LVs characteristics (i.e. transduction volume, number of transduced cells and MFI/cell) when pseudotyped by either MOK-G or VSV-G highlights no significant differences.

(9) FIGS. 9A and 9B: Validation of the astro-silencing construct with a VSV-G envelope. FIG. 9A) GS-siGFP-miR124T LV pseudotyped with VSV-G has been injected into BAC-GLT1-eGFP and BAC-GLAST-DsRed striatum mice; to localize the injection site, DsRed or GFP have been co-injected respectively. FIG. 9B) The measurement of the GFP decrease volume shows no significant difference between the two envelopes, MOK-G and VSV-G. Scale bar=200 m.

(10) FIGS. 10A and 10B: GFP silencing in neurons when appending miR124T directly to siGFP siRNA. FIG. 10A) The integration of miRT sequence at the 3 end of a PGK-miR30-siGFP expression cassette (siGFP-miR124T) is not efficacious for a cell-type specific silencing since a silencing (Volume of GFP silencing (mm.sup.3) vertical axis) non significantly (NS) different from that directed by the PGK-miR30-siGFP alone (siGFP) is obtained in the brain of mice injected with lentiviral vectors containing the cassettes (siUNIV and PBS: negative controls). FIG. 10B) The latter observation is due to the cleavage by dicer of the miR124T detargeting sequence during the processing of the miR30-embedded siGFP, which prevents the miR124-mediated destruction of the transcript harboring siGFP in neurons.

EXAMPLE

(11) In the present experimental setting, the tissue-specific promoter is driving the expression of the tetracycline transactivation and the miRT is further restricting the expression of the siRNA in astrocytes.

(12) As tissue-specific promoters, the inventors have analysed three astrocytic promoters: the one of the excitatory amino acid transporter 1 (EAAT1), the glutamine synthetase (GS) and the shortest form of the GFAP promoter (GFA-ABC1D). These promoters were first tested in a constitutive system and then integrated in a single regulated vector previously described (Vigna et al., 2005). Recent studies have demonstrated that siRNA embedded in a miRNA backbone may provide safer therapeutic for siRNA expression vectors, as compared to small hairpin RNAs, by decreasing the risk of saturation of the endogenous siRNA machinery (Boudreau et al., 2009). In addition pol II promoters, such as tissue-specific promoters, are used to express miR-embedded siRNA (Boudreau et al., 2009; Boudreau et al., 2008; McBride et al., 2008). As a proof-of-principle, the inventors have used a siRNA directed against the green fluorescent protein (GFP) reporter gene (siGFP). This siGFP has been embedded in miR30 (Boudreau et al., 2009; McBride et al., 2008); the design is such that the final mature siRNA is identical to the original H1-shRNA cassette (Boudreau et al., 2008). Finally, the inventors have compared VSV-G and MOK-G envelopes to target astrocytes when combined with a tissue-specific promoter and with or without the miR124T sequence. To facilitate the analysis, BAC-GLT1-eGFP mice, which express GFP exclusively in astrocytes (GLT1 is specific of astrocytes) have been used (Regan et al., 2007).

(13) Materials and Methods

(14) Plasmids

(15) For the tissue-specificity study, the inventors used self-inactivated (SIN) lentiviral vectors (LV) (Deglon et al., 2000) containing the woodchuck post-regulatory element (WPRE, W), encoding the nuclear-localized red fluorescent protein (pDsRed2-Nuc, Clontech, Saint-Germain-en-Laye, France) and with or without 4 copies of the synthetic target of the miR124 (miR124T coding sequence: TGGCATTCACCGCGTGCCTTA (SEQ ID NO: 4); SIN-W-DsRed2nuc and SIN-W-DsRed2nuc-miR124T).

(16) The following internal promoters were used: the ubiquitous mouse phosphoglycerate kinase 1 promoter (PGK; from 430 to +74 relative to the transcriptional start site (TSS); GenBank M18735.1 nt: 423 to 931) (Adra et al., 1987; Deglon et al., 2000) and the human cytomegalovirus (688 bp CMVa from pcDNA3.1 plasmid, Clontech, Saint-Germain-en-Laye, France; GenBank K03104, nt: 137 to 723 and sequences with a putative transcriptional start site, T7 primer binding site and multiple cloning sites). A slightly different fragment of the human cytomegalovirus promoter was cloned in the inducible vector (606 bp CMVb; GenBank K03104, nt: 207 to 791).

(17) The following promoters the inventors used for tissue-specific expression: the 2 kb human excitatory amino acid transporter 1 (EAAT1; synthesized by GeneArt (Invitrogen, Cergy-Pontoise, France; GenBank AF448436.1, nt: 1 to 2051) promoter (Kim et al., 2003); the shortest form, 681 pb, of the human glial fibrillary acidic protein (pGFA-ABC1D; courtesy of Dr Brenner, Birmingham, USA; GenBank NG_008401.1, nt: 3292 to 3793 and 4916 to 5094) promoter (Lee et al., 2008); and the 432 pb rat glutamine synthetase (GS; GenBank M91651.1, nt: 2111 to 2543) promoter which was amplified from rat genomic DNA with the following primers: 5-CACCATCGATGGCTCGCTCAACAAAGGGTAA-3 (SEQ ID NO: 15) and 5-GGATCCCTCGGCTGTGGAGGGTTGCGG-3 (SEQ ID NO: 16) (GenBank M91651.1, nt: 1 to 2132 with a CACC flanking sequence for oriented cloningand nt: 2524 to 2543 for forward and reverse primer, respectively) (Mill et al., 1991).

(18) For the silencing study, the inventors used a one-single inducible system (courtesy of Prof Naldini, Milano, Italy) (Vigna et al., 2005), self-inactivated LV with an internal cytomegalovirus promoter (pCCL) and containing: i) the transactivator sequence (tTA/S2), ii) the tetracycline response element (TRE), iii) the central polypurine tract (cPPT), iv) the GS promoter or the human cytomegalovirus promoter (CMVb; GenBank AY468486.1, nt: 2020 to 2624), v) the WPRE, vi) four copies of miR124T, and vii) a multiple cloning site (MCS) (pCCL-MCS-cPPT-GS-tTA/S2-W-miR124T-TRE-SIN). To assess the tissue-specificity of such a vector, they first cloned the nuclear-localized green fluorescent protein (pAcGFP1-Nuc; Clontech, Saint-Germain-en-Laye, France) by a NheI restriction enzyme digestion into the MCS (pCCL-AcGFPnuc-cPPT-GS-tTA/S2-W-miR124T-TRE-SIN). To evaluate the silencing potential of the vector, the inventors used an siRNA directed against the green fluorescent protein (siGFP; Drouet et al. 2009) and as control a siRNA with no sequence homology in the genome (siUNIV). These siRNAs were embedded in a miR30 5 and 3 flanking regions and synthesized by GeneArt (Invitrogen, Cergy-Pontoise, France). A SacI-KpnI fragment was excised from the pENTR plasmid, end-filled with T4 DNA polymerase (Invitrogen, Cergy-Pontoise, France) and inserted as a blunt-ended fragment into the destination plasmid (pCCL-miR30-siRNA-cPPT-GS-tTA/S2-W-miR124T-TRE-SIN). To localize the injection site, the inventors used LVs expressing reporter genes under the control of the mouse PGK: either the DsRed (SIN-W-PGK-DsRed) or the blue fluorescent protein (BFP, SIN-W-PGK-BFP).

(19) To evaluate the specificity of our silencing contructs, the inventors used a bicistronic vector (pCCL-mCherry-CMVmin-hPGK-eGFP-WPRE-SIN; courtesy of Prof Naldini, Milano, Italy) containing: i) the red fluorescent protein (Cherry) reporter gene under the control of a minimal CMV promoter, ii) the GFP reporter gene under the control of the mouse PGK promoter, iii) the WPRE, and iv) an unidirectional polyA signal derived from the SV40. This LV encodes both Cherry and GFP.

(20) Lentiviral Vector Production

(21) Lentiviral vectors were produced in 293T cells, using a four-plasmid system, as previously described (Hottinger et al., 2000). The HIV-1 vectors were pseudotyped with either the vesicular stomatitis virus G protein (VSV-G) or a codon-optimized version of the G protein of Mokola lyssavirus (MOK-G) (pMOK-G; GeneArt). Viruses were concentrated by ultracentrifugation and resuspended in phosphate-buffered saline (PBS)/1% bovine serum albumin (BSA). The viral particle content of each batch was determined by p24 antigen enzyme-linked immunosorbent assay (RETROtek; Gentaur, Paris, France). The stocks were stored at 80 C. until use.

(22) Animals

(23) Male C57BL/6 mice (weight, 20 g; Iffa Credo/Charles River, France) and adult transgenic mice (BAC-GLT1-eGFP and BAC-GLAST-DsRed) (weight, around 20-25 g; lineage perpetrated in our own animal house) (Regan et al., 2007) were used. The animals were housed in a temperature-controlled room and maintained on a 12 h day/night cycle. Food and water were available ad libitum. All experimental procedures were performed in strict accordance with the recommendations of the European Community directive (86/609/EEC) concerning the care and use of laboratory animals.

(24) Stereotaxic Injections

(25) Tissue-Specificity Study

(26) Concentrated viral stocks were thawed on ice and resuspended by vortexing and repeated pipetting. SIN-W-promoter-DsRed2nuc LVs with or without the miR124T were diluted in PBS/1% BSA to a final concentration of 67 ng p24/l. BAC-GLT1-eGFP mice were anesthetized by intraperitoneal injection with a mixture of 150 mg/kg ketamine and 10 mg/kg xylazine (Coveto, Montaigu, France). Suspensions of lentiviral vectors were injected into the brain using a 34-gauge blunt-tip needle linked to a Hamilton syringe by a polyethylene catheter. Stereotaxic coordinates for injection into mouse striatum were, from bregma: anteroposterior +1 mm; lateral +/2 mm and ventral 2.5 mm from the dura, with tooth bar set at 0 mm (Franklin and Paxinos, 1997). Mice received a total volume of 3 l of the vector preparation, administered at a rate of 0.2 l/min. At the end of injections, needles were left in place for 5 min before being slowly removed. The skin was sutured and mice were allowed to recover.

(27) Silencing Study

(28) To assess the tropism of the silencing vector, pCCL-AcGFPnuc-cPPT-GS-tTA/S2-W-miR124T-TRE-SIN was diluted in PBS/1% BSA to a final concentration of 67 ng p24/l. BAC-GLAST-DsRed mice were anesthetized by intraperitoneal injection with a mixture of 150 mg/kg ketamine and 10 mg/kg xylazine (Coveto, Montaigu, France). Suspensions of lentiviral vectors were injected into the brain using a 34-gauge blunt-tip needle linked to a Hamilton syringe by a polyethylene catheter. Stereotaxic coordinates for injection into mouse striatum were, from bregma: anteroposterior +1 mm; lateral +/2 mm and ventral 2.5 mm from the dura, with tooth bar set at 0 mm (Franklin and Paxinos, 1997). Mice received a total volume of 3 l of the vector preparation, administered at a rate of 0.2 l/min. At the end of injections, needles were left in place for 5 min before being slowly removed. The skin was sutured and mice were allowed to recover.

(29) For evaluating the specificity of the silencing vector, the bicistronic LV was diluted in PBS/1% BSA to a final concentration of 33 ng p24/l. C57BL/6 mice were anesthetized and injected as described above. Mice received a total volume of 3 l of the vector preparation, administered at a rate of 0.2 l/min. At the end of injections, needles were left in place for 5 min before being slowly removed. The skin was sutured and mice were allowed to recover.

(30) For the silencing, pCCL-miR30-siGFP or miR30-siUNIV-cPPT-GS-tTA/S2-W-miR124T-TRE-SIN were diluted in PBS/1% BSA to a final concentration of 67 ng p24/l; localization LVs SIN-W-PGK-DsRed and SIN-W-PGK-BFP were diluted to a final concentration of 17 ng p24/l. BAC-GLT1-eGFP mice were anesthetized and injected as described above. Mice received a total volume of 3 l of the vector preparation, administered at a rate of 0.2 l/min. At the end of injections, needles were left in place for 5 min before being slowly removed. The skin was sutured and mice were allowed to recover.

(31) Histological Processing

(32) Tissue Preparation

(33) Two (silencing study) or three weeks (tissue-specificity study) post-lentiviral injection, the animals were killed with an overdose of sodium pentobarbital and transcardially perfused with a 4% paraformaldehyde (PFA; Sigma-Aldrich, Saint-Quentin Fallavier, France) solution. The brains were removed and post-fixed by incubation in 4% PFA for about 12 h and then cryoprotected first in 15% sucrose/0.1 M PBS overnight and then in 30% sucrose/0.1 M PBS for 24 h. A sledge microtome with a freezing stage at 30 C. (SM2400; Leica, Nanterre, France) was used to cut brain coronal sections 30 m thick. Slices throughout the entire striatum were collected and stored in tubes as free-floating sections in PBS supplemented with 0.14M sodium azide. Tubes were stored at 4 C. until immunohistochemical processing.

(34) Primary Antibodies

(35) The following primary antibodies were used: mouse monoclonal anti-neuronal nuclei antibody (NeuN, dilution 1/200; MAB377, Millipore, Molsheim, France); mouse monoclonal antibody recognizing the subunit of the S100 protein (S100, dilution 1/500; S2532, Sigma-Aldrich, Saint-Quentin Fallavier, France).

(36) Immunohistochemical Procedure

(37) For the tissue-specificity study and the silencing study, one serial was mounted directly in an aqueous medium (FluorSave, Life Technologies, Saint Aubin, France).

(38) For the study of SIN-W-promoter-DsRedmiR124T tropism, sections from BAC-GLT1-eGFP mice were labeled with NeuN antibody. Staining was performed with the mouse-on-mouse detection kit Vector M.O.M. kit (Basic) (Clinisciences, Nanterre, France). As secondary antibody, the AlexaFluor 350 (blue) anti-mouse diluted 1/500 (Life Technologies, Saint Aubin, France) was used.

(39) For the tropism of pCCL-AcGFPnuc-cPPT-GS-tTA/S2-W-miR124T-TRE-SIN, two serials from BAC-GLAST-DsRed mice were labeled with either NeuN or S100 antibodies also by using the basic M.O.M. kit (Clinisciences, Nanterre, France). As secondary antibody, the AlexaFluor 350 (blue) anti-mouse diluted 1/500 (Life Technologies, Saint Aubin, France) was used.

(40) Quantitative Analysis

(41) Co-Localization with Astrocytic or Neuronal Markers

(42) Sections labeled for GLT1-eGFP, NeuN or S100 were analyzed by epifluorescence microscopy with a Leica DM6000B (Leica, Nanterre, France) microscope equipped with an automated motorized stage and image acquisition software (MorphoStrider, Explora nova, La Rochelle, France).

(43) For the tissue-specificity study, the numbers of DsRed2nuc-NeuN-positive cells and DsRed2nuc-GLT1-eGFP-positive cells were determined on images acquired with a 40 objective (six animals, three sections per animal, six images per section) by ImageJ software (rsb.info.nih.gov/ij/).

(44) To assess the tropism of pCCL-AcGFPnuc-cPPT-GS-tTA/S2-W-miR124T-TRE-SIN, the numbers of AcGFPnuc-NeuN-positive cells and AcGFPnuc-S10013-positive or AcGFPnuc-GLAST-DsRed-positive cells were determined on images acquired with a 40 objective (six animals, three sections per animal, six images per section) by ImageJ software (rsb.info.nih.gov/ij/).

(45) Mean Fluorescence Intensity Per Cell

(46) For the silencing study, to quantify the mean fluorescence intensity per cell (MFI/cell) in neurons and in astrocytes, photomicrographs of AcGFPnuc-positive BAC-GLAST-DsRed mice sections, stained with NeuN or S100, were acquired with a 40 objective (Morphostrider software; Explora Nova, La Rochelle, France). The acquisition parameters of the Leica DM6000B microscope (excitation neutral attenuator filters and obturator) were maintained equivalent for all acquisitions while camera parameters (time of exposure from 300 to 900 ms, and gain from 1 to 3) were adjusted for each group (e.g. pCCL-AcGFPnuc-cPPT-GS-tTA/S2-W-miR124T-TRE-S1N and pCCL-AcGFPnuc-cPPT-CMVb-tTA/S2-W-miR124T-TRE-SIN) to maximize fluorescence but without saturation (avoided using display of pixel fluorescence intensity histogram). Co-localization with NeuN or S100 was used to delimit the neurons (70 on average for each group) and the astrocytes (400 in average for each group) and the ImageJ software automatically calculated the mean gray level of the various objects drawn. To allow semi-quantitative comparison between the constructs, fluorescence levels for each group (construct) was normalized to the same time exposure (500 ms, gain 1). The inventors experimentally checked that fluorescence emission (gray levels) GFP containing brain sections was linearly proportional to exposure time in the range they used (300-900 ms) and for the different gains used.

(47) For the comparison of VSV-G and MOK-G envelopes with SIN-W-GS-DsRed2nuc-miR124T, photomicrographs of DsRednuc-positive BAC-GLT1-eGFP mice sections were acquired with a 10 objective. Mosaic pictures covering the entire striatum were generated (Morphostrider software; Explora Nova, La Rochelle, France) and used to measure the fluorescence intensity. The acquisition parameters of the Leica DM6000B microscope (excitation neutral attenuator filters and obturator) were maintained equivalent for all acquisitions as the camera parameters. The section closest to the injection site was used to measure the MFI/cell. The DsRednuc-positive area was delimited and a gray level threshold was applied for automated segmentation and count of infected cells expressing GFP (the lower limit of the gray level was set-up at 9). The ImageJ software automatically calculated the number of transduced cells and the mean gray level of the various objects identified. To determine the transduction volume, DsRednuc-positive area was delimited for each section and the volume calculated based on this data as we know that at 10 objective, 1 pixel represents 0.643299 m.

(48) To measure the silencing level in neurons with the bicistronic vector, photomicrographs of the GFP-Cherry-positive C57BL/6 mice sections were acquired with a 10 objective. Mosaic pictures covering the entire striatum were generated (Morphostrider software; Explora Nova, La Rochelle, France) and used to measure the fluorescence intensity for each reporter gene. The acquisition parameters of the Leica DM6000B microscope (excitation neutral attenuator filters and obturator) were maintained equivalent for all acquisitions as the camera parameters. GFP-positive and Cherry-positive areas were delimited and the mean fluorescence intensity automatically calculated (Mercator software; Explora Nova, La Rochelle, France). Green/Red ratio was then calculated.

(49) Statistical Analysis

(50) Data were analyzed using GraphPad Prism 4 Software (GraphPad Software, La Jolla, USA). A paired t test analysis was used to evaluate the significance differences of MFI/neuron vs MFI/astrocyte (set at P<0.05). Unpaired t test analysis were used to appraise the significance differences of the volume of GFP decrease (siUNIV vs siGFP and VSV-G vs MOK-G) in the silencing study and to compare the features of VSV-G and MOK-G pseudotyped LVs (set at P<0.05). One-way ANOVA with a post-hoc Newman-Keuls test analysis was used to assess the significance of differences (set at P<0.05) for the study of specificity based on the use of the bicistronic vector. Data are presented as meansstandard error of the mean (SEM).

(51) Results

(52) Effect of Astrocytic Promoters on LVs Tropism

(53) As a first step toward the establishment of an astrocyte-specific silencing, the inventors evaluate three astrocytic promoters. The human glial fibrillary acidic protein (GFAP), the human excitatory amino acid transporter 1 (EAAT1) and the rat glutamine synthetase (GS) were cloned upstream of a nuclear DsRed (SIN-W-DsRed2nuc) and pseudotyped with the MOK-G envelope. As controls, LVs with the housekeeping PGK and CMVa promoters (SIN-W-PGK/CMVa-DsRed2nuc) and a VSV-G envelope were used (Deglon et al., 2000). The constructs were injected into striatum of adult BAC-GLT1-eGFP mice, and three weeks later the mice were sacrificed and sections of the striatum were processed for immunofluorescence. DsRed was detected in nuclei around the injection site in all animals; no fluorescence was detected in the untreated contralateral striatum. Antibody against the neuronal marker NeuN and the endogenous GLT1-eGFP, expressed only in astrocytes, were used to determine the phenotype of the transduced cells (FIG. 1). Microscopic analysis and cell counts revealed that for all astrocytic promoters, more than 90% of the transduced cells co-localized with GLT1-eGFP, whereas only scarce DsRed2nuc-positive cells were double-stained for NeuN (FIG. 1). Thus, all these promoters retained an astrocytic specificity. Interestingly, CMVa leads to the same results as observed with astrocytic promoters, confirming its transcriptional pattern to be more astrocytic than PGK: 92% of DsRed-positive cells were astrocytes on average, 96.41.1% for CMVa and only 62.92.7% for PGK. LV PGK specifically targets neurons with more than 90% of co-localization with the marker NeuN; whereas, pseudotyping with a MOK-G envelope shifts the tropism of the LV-PGK-DsRed2nuc with more than 70% of transduced cells co-localizing with GLT1-eGFP-positive astrocytes.

(54) Effect of the Combination of an Astrocytic Promoter with the miR124T Detargeting Strategy on LVs Tropism

(55) To further improve the selectivity of the transgene expression, the inventors then used a detargeting strategy based on the addition of four copies of a synthetic miR124T sequence after the transgene. CMVa, EAAT1, GFA-ABC1D and GS promoters were inserted into SIN-W-DsRed2nuc-miR124T LVs and pseudotyped with MOK-G. The constructs were administered by injection into striatum of adult BAC-GLT1-eGFP mice. Three weeks later, mice were sacrificed and sections of the striatum were double-stained with the marker NeuN for co-localization analysis. Quantification of this co-localization between DsRed2nuc and either GLT1-eGFP or NeuN revealed a strong astrocytic tropism for all LVs tested: around 95% of DsRed2nuc positive cells were GLT1-eGFP-positive (FIG. 2). In particular, for GS promoter, there is a great improvement in targeting astrocytes by addition of the miR124T compared to LVs without miR124T (96.32.5% and 88.22.9%, respectively) (FIG. 1 and FIG. 2). Based on those results, we have chosen to pursue the studies with the GS promoter.

(56) Construction and Tropism of the Astro-Silencing Lentiviral Vector

(57) The next step in the development of an astrocyte-specific silencing was the integration of all these elements in a single tetracycline-regulated lentiviral backbone (Vigna et al., 2005) (FIG. 3). Briefly, the strategy is based on the integration of four copies of the miR124T sequence on the 3-end of the transactivator (tTA/S2) mRNA in order to prevent neuronal expression of the transgene. Moreover, to ensure an astrocytic expression, the tTA/S2-miR124T cassette is under the control of an astrocytic promoter. Hence, if LV enters into neurons, mRNA corresponding to tTA/S2-miR124T is degraded whereas if LV enters into astrocytes, there is no degradation and tTA/S2 binds to the tetracycline response element (TRE) and activate the CMV minimal promoter.

(58) Based on previous results, the inventors have placed tTA/S2 under the control of either the GS promoter or CMVb as control (FIG. 4) and added four copies of the miR124T. The tropism of LVs was assessed with a nuclear GFP (AcGFPnuc) reporter gene. The vectors were pseudotyped with MOK-G and injected into striatum of adult BAC-GLAST-DsRed mice. Quantitative analysis of NeuN- and S100-positive cells three weeks post-injection in the striatum confirmed the importance of the presence of miR124T with 694.6% for CMVb against 80.32.3% for CMVb-miR124T of double-stained astrocytes (FIG. 4B). With GS promoter combined with miR124T, 75.23.5% of astrocytes are transduced (FIG. 4B).

(59) To further quantify the residual transcriptional activity in neurons, the mean fluorescence intensity per cell (MFI/cell) was measured. The inventors show that with the GS promoter, a lower MFI/cell was observed in neurons compared with astrocytes (16.62.3 vs 44.27.1 grey level, respectively; P=0.0347, paired t test) (FIG. 4C) whereas with the CMVb, there was no significant difference in transcriptional activity between neurons and astrocytes (60.66.7 vs 68.011.5 grey level, respectively; P=0.0885, paired t test) (FIG. 4C). Hence, it confirms the interest of the GS promoter in this configuration.

(60) Validation of the Astro-Silencing Construct with a siGFP

(61) To validate the efficacy of the astro-silencing, the inventors cloned a siRNA directed against the GFP (siGFP). As control, they have used a universal siRNA (siUNIV), a negative control designed to have no homology to known gene sequences. The LVs-W-GS-siGFP/siUNIV were pseudotyped with MOK-G. They have injected them in adult BAC-GLT1-eGFP mice. To visualize the injection site, they have co-injected a LV expressing the BFP or the DsRed, respectively. Two weeks later, mice were sacrificed and direct fluorescence of striatum sections observed (FIG. 5). The inventors can clearly see a decrease of the GFP expression in animals injected with the siGFP in the red area (FIG. 5B-C); whereas, for animals injected with the siUNIV, such a silencing is not observed (FIG. 5B-C). Measure of GFP-less area confirms those observations. The volume of GFP decreases significantly more with the siGFP than with the siUNIV (5.11.4 mm.sup.3 vs 1.50.4 mm.sup.3; unpaired t test, P=0.0161) (FIG. 5C).

(62) To exclude a potential non-specific loss of GFP expression due to either the surgical procedure or the injection of viral particles, the inventors have tested this construct in BAC-GLAST-DsRed mice. They have not observed any alteration of DsRed expression (FIG. 5D) confirming the efficacy of the silencing.

(63) Specificity of the Astro-Silencing Construct

(64) To test the selectivity of their astro-silencing construct (i.e. absence or residual silencing in neurons), the inventors have used a vector carrying a bicistronic cassette and expressing both the Cherry and the GFP reporter genes in all infected cells (LV-Cherry-GFP) (FIG. 6A). The LV-Cherry-GFP was pseudotyped with VSV-G to transduce neurons (Naldini et al., 1996). In this context, two scenario could occur: i) a decrease in Cherry/GFP fluorescent ratio reflecting a residual silencing of GFP expression in neurons or ii) no change in Cherry/GFP fluorescent ratio demonstrating the tissue-specificity of the silencing.

(65) Adult C57/b16 mice were co-injected with the LV-Cherry-GFP and either the LV-GS-siUNIV or the LV-GS-siGFP. Two weeks later, mice were sacrificed and striatum sections analyzed. The green/red ratio obtained with the control siUNIV (1.060.07) represents the reference for the experiment. When the inventors used, as positive control, LV-CMVb-siGFP pseudotyped with VSV-G (neuronal condition), the green/red ratio is drastically decreased (0.150.05; P<0.001, one-way ANOVA with Newman-Keuls post-hoc test). When LV-Cherry-GFP is co-injected with LV-GS-siGFP, the green/red ratio (0.890.03) is slightly decreased by 16% (P<0.01, one-way ANOVA with Newman-Keuls post-hoc test) compared to the control LV-GS-siUNIV (FIG. 6). These results are in agreement with residual activity of our astro-silencing construct in neurons (FIG. 4).

(66) Impact of Pseudotyping and Promoters on VSV-G Tropism

(67) The inventors have re-investigated the paradigm of the promoter-dependence tropism of VSV-G pseudotyped LVs. Indeed, some studies have shown that LVs pseudotyped with VSV-G and carrying an astrocytic promoter (such as GFAP or CMV) lead to an astrocytic tropism (Jakobsson et al., 2003; Meunier et al., 2008; Miletic et al., 2004).

(68) Therefore, they have used PGK, CMVa and GS which were inserted into SIN-W-DsRed2nuc. VSV-G pseudotyped LVs were administered into adult BAC-GLT1-eGFP mice, and three weeks later, mice were sacrificed and striatum sections processed for fluorescence immunostaining. They first assess the tropism by quantify the co-localization between DsRed2nuc and either NeuN or GLT1-eGFP staining (FIG. 7). LV carrying PGK was shown to be highly neurotropic. Interestingly, LVs with either CMVa or GS show a partial astrocytic tropism (58.315.2% and 52.810.3%, respectively) (FIG. 7). These data confirm the promoter-dependence of VSV-G envelope when compared to results obtained with the MOK-G envelope.

(69) miR124T Detargeting Strategy and VSV-G Tropism

(70) To further improve the astrocytic tropism of VSV-G, the inventors added the miR124T to SIN-W-GS-DsRed2nuc. BAC-GLT1-eGFP mice were injected and sacrificed three weeks later. Co-localization analysis shows that addition of miR124T enhances astrocytic tropism by 1.6-fold (52.810.3% without miR124T vs 858.2% with miR124T) (FIG. 8). Furthermore, they have compared VSV-G and MOK-G pseudotyped LVs for three main features important for in vivo experiments: i) the transduction volume, ii) the number of transduced cells, and iii) the MFI/cell. No significant differences were measured, although a weak tendency seems to appear in favor of MOK-G concerning the two first points (FIG. 8). Finally, they have evaluated the potential of VSV-G pseudotyped LVs to silence specifically a transgene in astrocytes. LV-GS-siGFP was pseudotyped with VSV-G and co-injected into BAC-GLT1-eGFP mice with a LV expressing the DsRed to localize the injection area. Two weeks later, mice were sacrificed and striatum sections directly observed for endogenous fluorescence. As observed with LV-GS-siGFP pseudotyped with MOK-G, they have obtained a large GFP-less volume (FIG. 9). This consolidates the previous results and substantiates the potency of VSV-G pseudotyped LVs for antro-specific silencing.

(71) Discussion

(72) Tools allowing local and cell-type specific silencing is an essential prerequisite to further reveal cell-autonomous functions and identify processes that depend on cell-cell interactions in neurodegenerative diseases. In the present study the inventors developed a system to selectively silence a ubiquitous gene in astrocytes, based on MOK-G- or VSV-G-LVs carrying an astrocytic promoter, the miR124T sequence and an inducible system.

(73) Previous studies have shown that MOK-G pseudotyped LVs with a CMV promoter have a partial tropism for astrocytes (Cannon et al., 2010; Desmaris et al., 2001; Pertusa et al., 2008; Watson et al., 2002). Although CMV is a ubiquitous promoter, it has been shown to be more astrocytic than neuronal (Jakobsson et al., 2003; Li et al., 2010; Meunier et al., 2008) may be as a consequence of the inhibition of CMV neuronal activity by surrounding astrocytes (Kugler et al., 2001; Sarkis et al., 2000). Hence, a partial astrocytic targeting could be achieved with MOK-G pseudotyped LVs and an ubiquitous promoter.

(74) To improve the tissue-specific expression, the inventors compare MOK-G pseudotyped LVs carrying three astrocytic promoters. The tropism was investigated in transgenic mice expressing the GFP reporter gene under the control of the glutamate transporter 1 (GLT1 aka solute carrier family 1 member 2, Slc1a2) promoter (Regan et al., 2007). GLT1 is the dominant glutamate transporter throughout the forebrain and the spinal cord (Berger and Hediger, 1998; Furuta et al., 1997) and has been considered as an astroglial protein (Chaudhry et al., 1995; Lehre et al., 1995; Rothstein et al., 1994; Torp et al., 1994; Yang et al., 2011). Nonetheless, GLT1 promoter has also low neuronal activity in specific area of the brain (Chen et al., 2002; de Vivo et al., 2010; Mennerick et al., 1998); notably in the neocortex and the hippocampus (de Vivo et al., 2010). However, the neuronal expression of GLT1 is observed during development or after injury (Martin et al., 1997; Mennerick et al., 1998; Northington et al., 1999). When injected in the striatum of adult mice, more than 92% of tranduced cells expressing the DsRednuc reporter gene co-localized with GLT1-GFP. These data demonstrate that EAAT1, GFA-ABC1D and GS promoters improve the tropism of LV, as previously reported for the GFAP promoter (Jakobsson et al., 2003; Kuroda et al., 2008; Liu et al., 2008).

(75) The addition of the miR124T sequence further improves this astrocytic targeting (Colin et al., 2009). The miR124T target sequence acts at the post-transcriptional level, by inducing the degradation of the mRNA (Brown et al., 2007b; Brown et al., 2006). This detargeting effect is particularly evident for GS. Indeed, albeit GS is highly expressed in astrocytes and in liver, the promoter is also active at a lower level in neurons (Mearow et al., 1989; Mill et al., 1991). Thus, addition of miR124T sequence in the LV backbone prevents the neuronal expression of the transgene. The inventors then combined this GS-miR124T with the tetracycline regulated system (Vigna et al., 2005). First of all, they assessed the tropism of this construct with the nuclear-localized GFP and shown that if they target preferentially astrocytes, the residual expression in neurons was higher than with the constitutive system. Similar results were obtained with a siRNA targeting the GFP. One hypothesis to explain this difference is that the tetracycline system is creating amplification loop, which enhances transgene expression (Blench et al., 2005; Regulier et al., 2002). So, it is conceivable in the constitutive system the weak GS transcriptional activity was not associated with detectable transgene expression in neurons whereas in the inducible system, residual reporter gene expression was measured. One possibility to overcome this partial leakiness of the system would be to incorporate not only miR124T sequence but combine several miRT to provide an additive or synergistic effects as previously reported (Brown et al., 2007b; Doench et al., 2003). Indeed, combinatorial arrangement of tissue-specific miRNA-targets efficiently suppresses transgene expression (Brown et al., 2007b). Therefore, the use of several neuronal-specific miRNAs, such as the miR124 and miR10 (Smith et al., 2010) could be considered to prevent more effectively the neuronal transgene expression. As an alternative, one could consider to use an astrocytic minimal promoter instead of the human CMV minimal promoter in the tetracycline system. The use of a glial core promoter, such as the core promoter of the human glutamate carboxypeptidase II or the human JC papovavirus promoter (Han et al., 2007; Krebs et al., 1995), instead of a CMV core promoter should prevent neuronal expression. Finally, a better characterization of astrocytes-specific promoters may further improve tissue-specific expression in the brain (ENCODE and Pleiade projects) (D'Souza et al., 2008; ENCODE, 2004; Portales-Casamar et al., 2010; Yang et al., 2009).

(76) To test the silencing system, the inventors have used a siRNA directed against the GFP reporter gene embedded in a miR30 sequence (Shin et al., 2006). The efficacy of the silencing was demonstrated in BAC-GLT1-eGFP mice. To exclude potential non-specific effects of the LV due to the surgical procedure, injection of viral particles and potential impact on GLT1 promoter activity (Place et al., 2008), they used BAC-GLAST-DsRed mice and they shown that the silencing was specific. Recently, Liu and colleagues have used a miR30-based gene driven by the GFA-ABC1D promoter to express siRNA (Liu et al., 2010). However, in this study, the tropism of the vector was not assessed in vivo. The proof-of-principle study was limited to luciferase measurement in the brain, whether this signal was exclusively due to transgene expression in astrocytes was not investigated. Furthermore, they perform triple injections of LVs which can lead to an astrogliosis, modifying the natural tropism of LVs.

(77) In the last part of study, the inventors have re-investigated the potential of VSV-G pseudotyping LVs for astrocytic targeting. VSV-G envelope is of particular interest because viral vectors are easier to produce and have higher viral titers than with MOK-G envelope (Colin et al., 2009; Desmaris et al., 2001; Liu et al., 2008). Here, they confirmed the promoter-dependence on the tropism of VSV-G pseudotyped LV (Jakobsson et al., 2003; Liu et al., 2010; Meunier et al., 2008; Miletic et al., 2004). The receptor for VSV-G is still unknown: phosphatidylserine has first been proposed (Schlegel et al., 1983), but following studies suggest that it is enhancing viral entry and is not the receptor for the VSV-G envelope (Coil and Miller, 2004, 2005). Recently, it has been shown that the endoplasmic reticulum chaperone gp96, ubiquitously expressed, is essential for the occurrence of functional VSV-G receptors at the cell surface (Bloor et al., 2010). This finding provides evidence for a broad host range of VSV-G pseudotyped LVs including neurons and astrocytes. Hence, tropism of VSV-G pseudotyped LVs is the result of the combined effect of the envelope and the promoter. By combining the VSV-G pseudotyping with GS promoter, miR124T, and an inducible system, the inventors finally show that an astrocytic silencing is efficiently achieved.

(78) These vectors would be particularly suitable for HD study. Indeed, GS promoter activity is not affected by the expression of mHtt. The protein level is unaltered in HD patients (Carter, 1982) and in R6/2 HD transgenic mice (Behrens et al., 2002).

REFERENCES

(79) 1. Adra, C. N., Boer, P. H., and McBurney, M. W. (1987). Cloning and expression of the mouse pgk-1 gene and the nucleotide sequence of its promoter. Gene 60, 65-74. 2. Behrens, P. F., Franz, P., Woodman, B., Lindenberg, K. S., and Landwehrmeyer, G. B. (2002). Impaired glutamate transport and glutamate-glutamine cycling: downstream effects of the Huntington mutation. Brain 125, 1908-1922. 3. Berger, U. V., and Hediger, M. A. (1998). Comparative analysis of glutamate transporter expression in rat brain using differential double in situ hybridization. Anat Embryol (Berl) 198, 13-30. 4. Blesch, A., Conner, J., Pfeifer, A., Gasmi, M., Ramirez, A., Britton, W., Alfa, R., Verma, I., and Tuszynski, M. H. (2005). Regulated lentiviral NGF gene transfer controls rescue of medial septal cholinergic neurons. Mol Ther 11, 916-925. 5. Bloor, S., Maelfait, J., Krumbach, R., Beyaert, R., and Randow, F. (2010). Endoplasmic reticulum chaperone gp96 is essential for infection with vesicular stomatitis virus. Proc Natl Acad Sci USA 107, 6970-6975. 6. Boudreau, R. L., Martins, I., and Davidson, B. L. (2009). Artificial microRNAs as siRNA shuttles: improved safety as compared to shRNAs in vitro and in vivo. Mol Ther 17, 169-175. 7. Boudreau, R. L., Monteys, A. M., and Davidson, B. L. (2008). Minimizing variables among hairpin-based RNAi vectors reveals the potency of shRNAs. RNA 14, 1834-1844. 8. Brown, B. D., Cantore, A., Annoni, A., Sergi, L. S., Lombardo, A., Della Valle, P., D'Angelo, A., and Naldini, L. (2007a). A microRNA-regulated lentiviral vector mediates stable correction of hemophilia B mice. Blood 110, 4144-4152. 9. Brown, B. D., Gentner, B., Cantore, A., Colleoni, S., Amendola, M., Zingale, A., Baccarini, A., Lazzari, G., Galli, C., and Naldini, L. (2007b). Endogenous microRNA can be broadly exploited to regulate transgene expression according to tissue, lineage and differentiation state. Nat Biotechnol 25, 1457-1467. 10. Brown, B. D., Venneri, M. A., Zingale, A., Sergi Sergi, L., and Naldini, L. (2006). Endogenous microRNA regulation suppresses transgene expression in hematopoietic lineages and enables stable gene transfer. Nat Med 12, 585-591. 11. Cannon, J. R., Sew, T., Montero, L., Burton, E. A., and Greenamyre, J. T. (2010). Pseudotype-dependent lentiviral transduction of astrocytes or neurons in the rat substantia nigra. Exp Neurol. 228, 41-52 12. Carter, C. J. (1982). Glutamine synthetase activity in Huntington's disease. Life Sci 31, 1151-1159. 13. Chaudhry, F. A., Lehre, K. P., van Lookeren Campagne, M., Ottersen, O. P., Danbolt, N. C., and Storm-Mathisen, J. (1995). Glutamate transporters in glial plasma membranes: highly differentiated localizations revealed by quantitative ultrastructural immunocytochemistry. Neuron 15, 711-720. 14. Chen, W., Aoki, C., Mahadomrongkul, V., Gruber, C. E., Wang, G. J., Blitzblau, R., Irwin, N., and Rosenberg, P. A. (2002). Expression of a variant form of the glutamate transporter GLT1 in neuronal cultures and in neurons and astrocytes in the rat brain. J Neurosci 22, 2142-2152. 15. Coil, D. A., and Miller, A. D. (2004). Phosphatidylserine is not the cell surface receptor for vesicular stomatitis virus. J Virol 78, 10920-10926. 16. Coil, D. A., and Miller, A. D. (2005). Enhancement of enveloped virus entry by phosphatidylserine. J Virol 79, 11496-11500. 17. Colin, A., Faideau, M., Dufour, N., Auregan, G., Hassig, R., Andrieu, T., Brouillet, E., Hantraye, P., Bonvento, G., and Deglon, N. (2009). Engineered lentiviral vector targeting astrocytes in vivo. Glia 57, 667-679. 18. D'Souza, C. A., Chopra, V., Varhol, R., Xie, Y. Y., Bohacec, S., Zhao, Y., Lee, L. L., Bilenky, M., Portales-Casamar, E., He, A., et al. (2008). Identification of a set of genes showing regionally enriched expression in the mouse brain. BMC Neurosci 9, 66. 19. de Vivo, L., Melone, M., Rothstein, J. D., and Conti, F. (2010). GLT-1 Promoter Activity in Astrocytes and Neurons of Mouse Hippocampus and Somatic Sensory Cortex. Front Neuroanat 3, 31. 20. Deglon, N., Tseng, J. L., Bensadoun, J. C., Zurn, A. D., Arsenijevic, Y., Pereira de Almeida, L., Zufferey, R., Trono, D., and Aebischer, P. (2000). Self-inactivating lentiviral vectors with enhanced transgene expression as potential gene transfer system in Parkinson's disease. Hum Gene Ther 11, 179-190. 21. Deo, M., Yu, J. Y., Chung, K. H., Tippens, M., and Turner, D. L. (2006). Detection of mammalian microRNA expression by in situ hybridization with RNA oligonucleotides. Dev Dyn 235, 2538-2548. 22. Desmaris, N., Bosch, A., Salaun, C., Petit, C., Prevost, M. C., Tordo, N., Perrin, P., Schwartz, O., de Rocquigny, H., and Heard, J. M. (2001). Production and neurotropism of lentivirus vectors pseudotyped with lyssavirus envelope glycoproteins. Mol Ther 4, 149-156. 23. Doench, J. G., Petersen, C. P., and Sharp, P. A. (2003). siRNAs can function as miRNAs. Genes Dev 17, 438-442. 24. ENCODE (2004). The ENCODE (ENCyclopedia Of DNA Elements) Project. Science 306, 636-640. 25. Franklin, K., and Paxinos, G. (1997). The Mouse Brain in Stereotaxic Coordinates. San Diego: Academic Press. 26. Furuta, A., Rothstein, J. D., and Martin, L. J. (1997). Glutamate transporter protein subtypes are expressed differentially during rat CNS development. J Neurosci 17, 8363-8375. 27. Han, L., Wong, D. L., Tsai, G., Jiang, Z., and Coyle, J. T. (2007). Promoter analysis of human glutamate carboxypeptidase II. Brain Res 1170, 1-12. 28. Hottinger, A. F., Azzouz, M., Deglon, N., Aebischer, P., and Zurn, A. D. (2000). Complete and long-term rescue of lesioned adult motoneurons by lentiviral-mediated expression of glial cell line-derived neurotrophic factor in the facial nucleus. J Neurosci 20, 5587-5593. 29. Jakobsson, J., Ericson, C., Jansson, M., Bjork, E., and Lundberg, C. (2003). Targeted transgene expression in rat brain using lentiviral vectors. J Neurosci Res 73, 876-885. 30. Jakobsson, J., and Lundberg, C. (2006). Lentiviral vectors for use in the central nervous system. Mol Ther 13, 484-493. 31. Kim, S. Y., Choi, S. Y., Chao, W., and Volsky, D. J. (2003). Transcriptional regulation of human excitatory amino acid transporter 1 (EAAT1): cloning of the EAAT1 promoter and characterization of its basal and inducible activity in human astrocytes. J Neurochem 87, 1485-1498. 32. Krebs, C. J., McAvoy, M. T., and Kumar, G. (1995). The JC virus minimal core promoter is glial cell specific in vivo. J Virol 69, 2434-2442. 33. Kugler, S., Meyn, L., Holzmuller, H., Gerhardt, E., Isenmann, S., Schulz, J. B., and Bahr, M. (2001). Neuron-specific expression of therapeutic proteins: evaluation of different cellular promoters in recombinant adenoviral vectors. Mol Cell Neurosci 17, 78-96. 34. Kuroda, H., Kutner, R. H., Bazan, N. G., and Reiser, J. (2008). A comparative analysis of constitutive and cell-specific promoters in the adult mouse hippocampus using lentivirus vector-mediated gene transfer. J Gene Med 10, 1163-1175. 35. Lagos-Quintana, M., Rauhut, R., Yalcin, A., Meyer, J., Lendeckel, W., and Tuschl, T. (2002). Identification of tissue-specific microRNAs from mouse. Curr Biol 12, 735-739. 36. Lee, Y., Messing, A., Su, M., and Brenner, M. (2008). GFAP promoter elements required for region-specific and astrocyte-specific expression. Glia 56, 481-493. 37. Lehre, K. P., Levy, L. M., Ottersen, O. P., Storm-Mathisen, J., and Danbolt, N. C. (1995). Differential expression of two glial glutamate transporters in the rat brain: quantitative and immunocytochemical observations. J Neurosci 15, 1835-1853. 38. Li, M., Husic, N., Lin, Y., Christensen, H., Malik, I., McIver, S., Daniels, C. M., Harris, D. A., Kotzbauer, P. T., Goldberg, M. P., et al. (2010). Optimal promoter usage for lentiviral vector-mediated transduction of cultured central nervous system cells. J Neurosci Methods 189, 56-64. 39. Liu, B., Paton, J. F., and Kasparov, S. (2008). Viral vectors based on bidirectional cell-specific mammalian promoters and transcriptional amplification strategy for use in vitro and in vivo. BMC Biotechnol 8, 49. 40. Liu, B., Xu, H., Paton, J. F., and Kasparov, S. (2010). Cell- and region-specific miR30-based gene knock-down with temporal control in the rat brain. BMC Mol Biol 11, 93. 41. Martin, L. J., Brambrink, A. M., Lehmann, C., Portera-Cailliau, C., Koehler, R., Rothstein, J., and Traystman, R. J. (1997). Hypoxia-ischemia causes abnormalities in glutamate transporters and death of astroglia and neurons in newborn striatum. Ann Neurol 42, 335-348. 42. McBride, J. L., Boudreau, R. L., Harper, S. Q., Staber, P. D., Monteys, A. M., Martins, I., Gilmore, B. L., Burstein, H., Peluso, R. W., Polisky, B., et al. (2008). Artificial miRNAs mitigate shRNA-mediated toxicity in the brain: implications for the therapeutic development of RNAi. Proc Natl Acad Sci USA 105, 5868-5873. 43. Mearow, K. M., Mill, J. F., and Vitkovic, L. (1989). The ontogeny and localization of glutamine synthetase gene expression in rat brain. Brain Res Mol Brain Res 6, 223-232. 44. Mennerick, S., Dhond, R. P., Benz, A., Xu, W., Rothstein, J. D., Danbolt, N. C., Isenberg, K. E., and Zorumski, C. F. (1998). Neuronal expression of the glutamate transporter GLT-1 in hippocampal microcultures. J Neurosci 18, 4490-4499. 45. Meunier, A., Mauborgne, A., Masson, J., Mallet, J., and Pohl, M. (2008). Lentiviral-mediated targeted transgene expression in dorsal spinal cord glia: tool for the study of glial cell implication in mechanisms underlying chronic pain development. J Neurosci Methods 167, 148-159. 46. Miletic, H., Fischer, Y. H., Neumann, H., Hans, V., Stenzel, W., Giroglou, T., Hermann, M., Deckert, M., and Von Laer, D. (2004). Selective transduction of malignant glioma by lentiviral vectors pseudotyped with lymphocytic choriomeningitis virus glycoproteins. Hum Gene Ther 15, 1091-1100. 47. Mill, J. F., Mearow, K. M., Purohit, H. J., Haleem-Smith, H., King, R., and Freese, E. (1991). Cloning and functional characterization of the rat glutamine synthetase gene. Brain Res Mol Brain Res 9, 197-207. 48. Mishima, T., Mizuguchi, Y., Kawahigashi, Y., and Takizawa, T. (2007). RT-PCR-based analysis of microRNA (miR-1 and -124) expression in mouse CNS. Brain Res 1131, 37-43. 49. Naldini, L., Blomer, U., Gallay, P., Ory, D., Mulligan, R., Gage, F. H., Verma, I. M., and Trono, D. (1996). In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector. Science 272, 263-267. 50. Northington, F. J., Traystman, R. J., Koehler, R. C., and Martin, L. J. (1999). GLT1, glial glutamate transporter, is transiently expressed in neurons and develops astrocyte specificity only after midgestation in the ovine fetal brain. J Neurobiol 39, 515-526. 51. Pertusa, M., Garcia-Matas, S., Mammeri, H., Adell, A., Rodrigo, T., Mallet, J., Cristofol, R., Sarkis, C., and Sanfeliu, C. (2008). Expression of GDNF transgene in astrocytes improves cognitive deficits in aged rats. Neurobiol Aging 29, 1366-1379. 52. Place, R. F., Li, L. C., Pookot, D., Noonan, E. J., and Dahiya, R. (2008). MicroRNA-373 induces expression of genes with complementary promoter sequences. Proc Natl Acad Sci USA 105, 1608-1613. 53. Portales-Casamar, E., Swanson, D. J., Liu, L., de Leeuw, C. N., Banks, K. G., Ho Sui, S. J., Fulton, D. L., Ali, J., Amirabbasi, M., Arenillas, D. J., et al. (2010). A regulatory toolbox of MiniPromoters to drive selective expression in the brain. Proc Natl Acad Sci USA 107, 16589-16594. 54. Regan, M. R., Huang, Y. H., Kim, Y. S., Dykes-Hoberg, M. I., Jin, L., Watkins, A. M., Bergles, D. E., and Rothstein, J. D. (2007). Variations in promoter activity reveal a differential expression and physiology of glutamate transporters by glia in the developing and mature CNS. J Neurosci 27, 6607-6619. 55. Regulier, E., Pereira de Almeida, L., Sommer, B., Aebischer, P., and Deglon, N. (2002). Dose-dependent neuroprotective effect of ciliary neurotrophic factor delivered via tetracycline-regulated lentiviral vectors in the quinolinic acid rat model of Huntington's disease. Hum Gene Ther 13, 1981-1990. 56. Rothstein, J. D., Martin, L., Levey, A. I., Dykes-Hoberg, M., Jin, L., Wu, D., Nash, N., and Kuncl, R. W. (1994). Localization of neuronal and glial glutamate transporters. Neuron 13, 713-725. 57. Sarkis, C., Serguera, C., Petres, S., Buchet, D., Ridet, J. L., Edelman, L., and Mallet, J. (2000). Efficient transduction of neural cells in vitro and in vivo by a baculovirus-derived vector. Proc Natl Acad Sci USA 97, 14638-14643. 58. Schlegel, R., Tralka, T. S., Willingham, M. C., and Pastan, I. (1983). Inhibition of VSV binding and infectivity by phosphatidylserine: is phosphatidylserine a VSV-binding site? Cell 32, 639-646. 59. Shin, K. J., Wall, E. A., Zavzavadjian, J. R., Santat, L. A., Liu, J., Hwang, J. I., Rebres, R., Roach, T., Seaman, W., Simon, M. I., et al. (2006). A single lentiviral vector platform for microRNA-based conditional RNA interference and coordinated transgene expression. Proc Natl Acad Sci USA 103, 13759-13764. 60. Slezak, M., Goritz, C., Niemiec, A., Frisen, J., Chambon, P., Metzger, D., and Pfrieger, F. W. (2007). Transgenic mice for conditional gene manipulation in astroglial cells. Glia 55, 1565-1576. 61. Smirnova, L., Grafe, A., Seiler, A., Schumacher, S., Nitsch, R., and Wulczyn, F. G. (2005). Regulation of miRNA expression during neural cell specification. Eur J Neurosci 21, 1469-1477. 62. Smith, B., Treadwell, J., Zhang, D., Ly, D., McKinnell, I., Walker, P. R., and Sikorska, M. (2010). Large-scale expression analysis reveals distinct microRNA profiles at different stages of human neurodevelopment. PLoS One 5, e11109. 63. Torp, R., Danbolt, N. C., Babaie, E., Bjoras, M., Seeberg, E., Storm-Mathisen, J., and Ottersen, O. P. (1994). Differential expression of two glial glutamate transporters in the rat brain: an in situ hybridization study. Eur J Neurosci 6, 936-942. 64. Vigna, E., Amendola, M., Benedicenti, F., Simmons, A. D., Follenzi, A., and Naldini, L. (2005). Efficient Tet-dependent expression of human factor IX in vivo by a new self-regulating lentiviral vector. Mol Ther 11, 763-775. 65. Watson, D. J., Kobinger, G. P., Passini, M. A., Wilson, J. M., and Wolfe, J. H. (2002). Targeted transduction patterns in the mouse brain by lentivirus vectors pseudotyped with VSV, Ebola, Mokola, LCMV, or MuLV envelope proteins. Mol Ther 5, 528-537. 66. Wong, L. F., Goodhead, L., Prat, C., Mitrophanous, K. A., Kingsman, S. M., and Mazarakis, N. D. (2006). Lentivirus-mediated gene transfer to the central nervous system: therapeutic and research applications. Hum Gene Ther 17, 1-9. 67. Yang, G. S., Banks, K. G., Bonaguro, R. J., Wilson, G., Dreolini, L., de Leeuw, C. N., Liu, L., Swanson, D. J., Goldowitz, D., Holt, R. A., et al. (2009). Next generation tools for high-throughput promoter and expression analysis employing single-copy knock-ins at the Hprt1 locus. Genomics 93, 196-204. 68. Yang, Y., Vidensky, S., Jin, L., Jie, C., Lorenzini, I., Frankl, M., and Rothstein, J. D. (2011). Molecular comparison of GLT1+ and ALDH1L1+ astrocytes in vivo in astroglial reporter mice. Glia 59, 200-207.