Promoters for Regulating Expression in Plants

20170183675 ยท 2017-06-29

    Inventors

    Cpc classification

    International classification

    Abstract

    Isolated nucleic acid molecules capable of regulating expression in plants, as well as expression [cassettes, vectors and transgenic plants comprising the same are provided.

    Claims

    1. An isolated nucleic acid molecule capable of regulating expression in plants selected from the list comprising i) a nucleic acid molecule comprising a nucleic acid sequence described by SEQ ID NOS: 5, 35, 36, 37, or 38, ii) a fragment of at least 250 consecutive bases of a molecule comprising a nucleic acid sequence described by any of SEQ ID NOS: 5, 35, 36, 37, or 38, iii) a nucleotide molecule with a sequence identity of at least 60% to a transcription regulating nucleotide molecule comprising a nucleic acid sequence described by any of SEQ ID NO NOS: 5, 35, 36, 37, or 38, and iv) a nucleotide molecule of at least 250 consecutive bases with a sequence identity of at least 60% to a transcription regulating nucleotide molecule comprising a nucleic acid sequence described by any of SEQ ID NOS: 5, 35, 36, 37, or 38, v) a nucleotide molecule of at least 250 bases capable of hybridizing under conditions equivalent to hybridization in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO.sub.4, 1 mM EDTA at 50 C. with washing in 0.1SSC, 0.1% SDS at 50 C. to a transcription regulating nucleotide molecule comprising a nucleic acid sequence described by any of SEQ ID NOS: 5, 35, 36, 37, or 38, or the complement thereof; vi) a nucleotide molecule of at least 250 bases capable of hybridizing under conditions equivalent to hybridization in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO.sub.4, 1 mM EDTA at 50 C. with washing in 0.1SSC, 0.1% SDS at 50 C. to a nucleic acid comprising 250 or more consecutive nucleotides of a transcription regulating nucleotide molecule comprising a nucleic acid sequence described by any of SEQ ID NOS: 5, 35, 36, 37, or 38, or the complement thereof; and vii) a nucleotide molecule which is the complement or reverse complement of any of the previously mentioned nucleotide molecules under i) to vi).

    2. (canceled)

    3. (canceled)

    4. The isolated nucleic acid molecule of claim 1, wherein the sequences specified under ii), iii), iv), v), vi) and vii) are capable of modifying transcription in a plant or part thereof.

    5. The isolated nucleic acid molecule of claim 1, wherein the sequences specified under ii), iii), iv), v), vi) and vii) have substantially the same transcription regulating activity as a transcription regulating nucleotide molecule comprising the nucleic acid sequence of SEQ ID NO: 5.

    6. An expression cassette for regulating expression in plants comprising a) at least one isolated nucleic acid molecule capable of regulating expression in plants as defined in claim 1, and functionally linked thereto b) at least one nucleic acid molecule which is heterologous in relation to said isolated nucleic acid molecule capable of regulating expression in plants.

    7. A vector comprising the isolated nucleic acid molecule of claim 1.

    8. A transgenic host cell or non-human organism comprising the isolated nucleic acid sequence of claim 1.

    9. A transgenic plant or plant cell comprising the isolated nucleic acid sequence of claim 1.

    10. The transgenic plant or plant cell of claim 9, wherein said plant or plant cell is from a dicotyledonous plant.

    11. (canceled)

    12. A method for the production of an expression cassette comprising the steps of: a. providing an isolated nucleic acid molecule of claim 1; and b. functionally linking said isolated nucleic acid molecule to a nucleic acid molecule heterologous to said isolated nucleic acid molecule.

    13. A method for the production of a transgenic plant comprising the steps of: a. providing the expression cassette of claim 6; b. transforming said expression cassette into a plant part or plant cell; and c. regenerating a plant from said transformed plant part or plant cell.

    14. A vector comprising the expression cassette of claim 6.

    15. A transgenic host cell or non-human organism comprising the expression cassette of claim 6.

    16. A transgenic plant or plant cell comprising the expression cassette of claim 6.

    17. A method for the production of a transgenic plant comprising the steps of: a. providing the vector of claim 7; b. transforming said vector into a plant part or plant cell; and c. regenerating a plant from said transformed plant part of plant cell.

    Description

    DETAILED DESCRIPTION OF THE INVENTION

    [0140] The present invention thus provides for isolated nucleic acid molecules comprising a plant nucleotide sequence that directs transcription in epidermis of an operably linked nucleic acid fragment in a plant or part thereof.

    [0141] The present invention further provides for isolated nucleic acid molecules comprising a plant nucleotide sequence that directs transcription in epidermis of an operably linked nucleic acid fragment in a plant or part thereof upon induction by a pathogen, preferably a fungal pathogen.

    [0142] The present invention further provides for isolated nucleic acid molecules comprising a plant nucleotide sequence that directs constitutive transcription of an operably linked nucleic acid fragment in a plant or part thereof.

    [0143] The present invention further provides for isolated nucleic acid molecules comprising a plant nucleotide sequence that directs mesophyll specific or mesophyll preferable transcription of an operably linked nucleic acid fragment in a plant or part thereof.

    [0144] The present invention further provides for isolated nucleic acid molecules comprising a plant nucleotide sequence that directs mesophyll and epidermis specific or mesophyll and epidermis preferable transcription of an operably linked nucleic acid fragment in a plant or part thereof upon induction by a pathogen, preferably a fungal pathogen.

    [0145] In addition, the present invention provides transgenic expression cassettes for regulating expression in plant epidermis, inducible expression in plant epidermis and/or mesophyll or constitutive expression comprising [0146] a) at least one transcription regulating nucleotide molecule derived from any of the Glycine max genes described by the GenBank Glycine max genome loci Glyma11g14950, Glyma14g06680, Glyma02g47670, Glyma1 4g02930, Glyma17g27610, Glyma13g44640, Glyma08g37270, Glyma04g40860.1, Glyma01g33070.2, Glyma15g05820.1, Glyma01g42660.1, Glyma17g14320 or Glyma01g01510.1 or their orthologous genes and functionally linked thereto [0147] b) at least one nucleic acid molecule which is heterologous in relation to said transcription regulating nucleotide molecule.

    [0148] In addition, the present invention provides transgenic expression cassettes for regulating expression in plant mesophyll comprising [0149] a) at least one transcription regulating nucleotide molecule derived from any of the Arabidopsis thaliana genes described by the GenBank Arabidopsis thaliana genome loci At1g49750, At3g62410, At1g61520, At1g30380 or At1g65490 or their orthologous genes and functionally linked thereto [0150] b) at least one nucleic acid molecule which is heterologous in relation to said transcription regulating nucleotide sequence.

    [0151] tissue-specific transcription in the context of this invention means the transcription of a nucleic acid molecule by a transcription regulating nucleic acid molecule in a way that transcription of said nucleic acid molecule in said tissue contribute to more than 90%, preferably more than 95%, more preferably more than 99% of the entire quantity of the RNA transcribed from said nucleic acid molecule in the entire plant during any of its developmental stage. The transcription regulating nucleotide molecules specifically disclosed herein are considered to be tissue-specific transcription regulating nucleotide molecules.

    [0152] tissue-preferential transcription in the context of this invention means the transcription of a nucleic acid molecule by a transcription regulating nucleic acid molecule in a way that transcription of said nucleic acid sequence in the said tissue contribute to more than 50%, preferably more than 70%, more preferably more than 80% of the entire quantity of the RNA transcribed from said nucleic acid sequence in the entire plant during any of its developmental stage.

    [0153] substantially the same transcription regulating activity in the context of this invention means the transcription of a nucleic acid molecule by a transcription regulating nucleic acid molecule which is a fragment or a homolog or a variant of any of SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 or 18 has the same tissue specific or tissue preferential transcription as the transcription regulating nucleic acid molecule it is derived from and has at least 50% preferably at least 60%, more preferably at least 80% or 90%, even more preferably at least 95%, most preferably the same expression strength as the transcription regulating nucleic acid molecule it is derived from.

    [0154] Preferably a transcription regulating nucleotide molecule of the invention comprises at least one promoter sequence of the respective gene (e.g., a sequence localized upstream of the transcription start of the respective gene capable to induce transcription of the downstream sequences). Said transcription regulating nucleotide molecule may comprise the promoter sequence of said genes but may further comprise other elements such as the 5-untranslated sequence, enhancer, introns etc. Preferably, said promoter sequence directs transcription of an operably linked nucleic acid segment in a plant epidermis or plant epidermis cell e.g., a linked plant DNA comprising an open reading frame for a structural or regulatory gene.

    [0155] As specified above in the DEFINTION section, identities between nucleotide sequences are preferably measured by the BLASTN program using default parameters with a wordlength (W) of 11, an expectation (E) of 10, a cutoff of 100, M=5, N=4, and a comparison of both strands. For measuring identity between amino acid sequences, the BLASTP program is used with default parameters with a wordlength (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff & Henikoff, 1989). The BLAST Program version 1.4.7 or later is used.

    [0156] Preferably, such homolog or fragment of said isolated nucleotide sequence (e.g., the sequences specified under ii), iii), iv) v), vi) and vii) above) is capable to modify transcription in a plant cell or organism, more preferably said homolog or fragment (e.g., the sequences specified under ii), iii), iv) v) and vi) above) has substantially the same transcription regulating activity as the transcription regulating nucleotide molecule described by SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 or 18. Preferably, the homolog or fragment (e.g., the sequences specified under iv) or v) above) is hybridizing under stringent conditions (i.e. medium stringent, more preferably high stringent conditions) with the specified target sequence.

    [0157] Preferably, the transcription regulating nucleotide molecule employed in the expression cassettes of the invention is selected from the group of molecules consisting of the molecules described by SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88 and 89 or any homolog or fragment thereof. More preferably the transcription regulating nucleotide molecule employed in the expression cassette of the invention is selected from the group of molecules consisting of [0158] i) the molecule described by SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88 and 89, and [0159] ii) a fragment of at least 250 consecutive bases, preferably at least 300 consecutive bases, more preferably at least 400 consecutive bases, even more preferably at least 500 consecutive bases, most preferably at least 750 consecutive bases of a molecule described by any of SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88 and 89 and [0160] iii) a nucleotide molecule of at least 250 consecutive bases, preferably at least 300 consecutive bases, more preferably at least 400 consecutive bases, even more preferably at least 500 consecutive bases, most preferably at least 750 consecutive bases with a sequence identity of at least 60%, 65% or 70%, preferably at least 75%, 80% or 85%, more preferably at least 90% or 95%, even more preferably at least 96% or 97%, most preferably at least 98% or 99% to a transcription regulating nucleotide molecule described by any of SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88 or 89, and [0161] iv) a nucleotide molecule having a sequence identity of at least 60%, 65%, 70%, 75% or 80%, preferably at least 85%, more preferably at least 90% or 95%, even more preferably at least 96% or 97%, most preferably at least 98% or 99% to an isolated nucleic acid molecule capable of regulating expression in plants described by SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88 and 89, and [0162] v) a nucleotide molecule of at least 250 bases, preferably at least 300 bases, more preferably at least 400 bases, even more preferably at least 500 bases, most preferably at least 750 bases capable of hybridizing preferably under conditions equivalent to hybridization in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO.sub.4, 1 mM EDTA at 50 C. with washing in 0.1SSC, 0.1% SDS at 50 C., more desirably in 7% SDS, 0.5 M NaPO.sub.4, 1 mM EDTA at 50 C. with washing in 0.1SSC, 0.1% SDS at 65 C. to an isolated nucleic acid molecule capable of regulating expression in plants described by SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88 and 89, or the complement thereof; [0163] vi) a nucleotide molecule of at least 250 bases, preferably at least 300 bases, more preferably at least 400 bases, even more preferably at least 500 bases, most preferably at least 750 bases capable of hybridizing preferably under conditions equivalent to hybridization in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO.sub.4, 1 mM EDTA at 50 C. with washing in 0.1SSC, 0.1% SDS at 50 C., more desirably in 7% SDS, 0.5 M NaPO.sub.4, 1 mM EDTA at 50 C. with washing in 0.1SSC, 0.1% SDS at 65 C. to a nucleic acid comprising at least 250 preferably at least 300, more preferably at least 400, even more preferably at least 500, most preferably at least 750 consecutive nucleotides of an isolated nucleic acid molecule capable of regulating expression in plants described by SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88 and 89, or the complement thereof; [0164] vii) an isolated nucleic acid molecule capable of regulating expression in plants which is the complement or reverse complement of any of the previously mentioned nucleic acid molecules under i) to vi).

    [0165] Preferably, such homolog or fragment of the transcription regulating nucleotide molecule to be employed in the expression cassette of the invention (e.g., the sequences specified under ii), iii), iv) v), vi) and vii) above) is capable to modify transcription in a plant cell or organism, more preferably said homolog or fragment (e.g., the sequences specified under ii), iii), iv) v) and vi) above) has substantially the same transcription regulating activity as the transcription regulating nucleotide molecule described by SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 and 18. Preferably, the homolog or fragment (e.g., the sequences specified under iii) above) has a sequence identity of at least 60% or 65%, preferably at least 70%, 75% or 80%, more preferably at least 90% or 95%, most preferably at least 97%, 98% or 99% to a sequence described by SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 and 18. Preferably, the homologs or fragments (e.g., the sequences specified under iv) or vi) above) are hybridizing under stringent conditions (i.e. preferably medium stringent, more preferably high stringent conditions) with the specified target sequence.

    [0166] In the applications U.S. 61/419,895 and EP 10193800.9 methods for the production of such homologs having the same expression pattern as the reference sequence as defined by SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 and 18 are described.

    [0167] The homologs or fragments of the transcription regulating nucleotide molecule of the invention (e.g., the sequence described by any of SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 and 18) may be obtained or is obtainable from plant genomic DNA from a gene which is encoding an amino acid sequence having at least 90% amino acid sequence identity, more preferably at least 90% or 95%, most preferably at least 97% or 98% amino acid sequence identity, to a polypeptide as described by SEQ ID NO: 221, 223, 225, 227, 229, 231, 233, 235, 237, 239, 241, 243, 245, 247, 249, 251, 253 and 255.

    [0168] The activity of a transcription regulating nucleotide molecule is considered equivalent if transcription is initiated in the same tissues as is by the reference molecule. Such expression profile is preferably demonstrated using reporter genes operably linked to said transcription regulating nucleotide sequence. Preferred reporter genes (Schenborn 1999) in this context are green fluorescence protein (GFP) (Chuff 1996; Leffel 1997), chloramphenicol transferase, luciferase (Millar 1992), beta-glucuronidase or beta-galactosidase. Especially preferred is beta-glucuronidase (Jefferson 1987).

    [0169] Beside this the transcription regulating activity of a functional equivalent homolog or fragment of the transcription regulating nucleotide molecule may vary from the activity of its parent sequence, especially with respect to expression level. The expression level may be higher or lower than the expression level of the parent sequence. Both derivations may be advantageous depending on the nucleic acid sequence of interest to be expressed. Preferred are such functional equivalent sequences, whichin comparison with its parent sequencedoes, not derivate from the expression level of said parent sequence by more than 50%, preferably 25%, more preferably 10% (as to be preferably judged by either mRNA expression or protein (e.g., reporter gene) expression). Furthermore preferred are equivalent sequences which demonstrate an increased expression in comparison to its parent sequence, preferably an increase by at least 50%, more preferably by at least 100%, most preferably by at least 500%.

    [0170] Preferably a functional equivalent of the transcription regulating nucleotide molecule of the invention can be obtained or is obtainable from plant genomic DNA from a gene expressing a mRNA described by a cDNA comprising a sequence which is substantially similar and preferably has at least 90%, preferably at least 92% or 95%, more preferably at least 96% or 97%, most preferably at least 99% sequence identity to a sequence described by any SEQ ID NOs: 220, 222, 224, 226, 228, 230, 232, 234, 236, 238, 240, 242, 244, 246, 248, 250, 252 and 254. Preferably said transcription regulating nucleotide molecule exhibits promoter activity in the same tissue/s as the reference molecule as defined by SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 and 18.

    [0171] Such functional equivalent of the transcription regulating nucleotide molecule may be obtained from other plant species by using the Arabidopsis thaliana, or Glycine max promoter sequences described herein as probes to screen for homologous structural genes in other plants by hybridization under low, moderate or stringent hybridization conditions. Regions of the promoter sequences of the present invention which are conserved among species could also be used as PCR primers to amplify a segment from a species other than Arabidopsis thaliana, or Glycine max, and that segment used as a hybridization probe (the latter approach permitting higher stringency screening) or in a transcription assay to determine promoter activity. Moreover, the promoter sequences could be employed to identify structurally related sequences in a database using computer algorithms.

    [0172] More specifically, based on the nucleic acid sequences of the present invention, orthologs may be identified or isolated from the genome of any desired organism, preferably from another plant, according to well known techniques based on their sequence similarity to the Arabidopsis thaliana, or Glycine max nucleic acid sequences, e.g., hybridization, PCR or computer generated sequence comparisons. For example, all or a portion of a particular Arabidopsis thaliana, or Glycine max nucleic acid sequence is used as a probe that selectively hybridizes to other gene sequences present in a population of cloned genomic DNA fragments or cDNA fragments (i.e., genomic or cDNA libraries) from a chosen source organism. Further, suitable genomic and cDNA libraries may be prepared from any cell or tissue of an organism. Such techniques include hybridization screening of plated DNA libraries (either plaques or colonies; see, e.g., Sambrook 1989) and amplification by PCR using oligonucleotide primers preferably corresponding to sequence domains conserved among related polypeptide or subsequences of the nucleotide sequences provided herein (see, e.g., Innis 1990). These methods are particularly well suited to the isolation of gene sequences from organisms closely related to the organism from which the probe sequence is derived. The application of these methods using the Arabidopsis thaliana, or Glycine max sequences as probes is well suited for the isolation of gene sequences from any source organism, preferably other plant species. In a PCR approach, oligonucleotide primers can be designed for use in PCR reactions to amplify corresponding DNA sequences from cDNA or genomic DNA extracted from any plant of interest. Methods for designing PCR primers and PCR cloning are generally known in the art.

    [0173] In hybridization techniques, all or part of a known nucleotide sequence is used as a probe that selectively hybridizes to other corresponding nucleotide sequences present in a population of cloned genomic DNA fragments or cDNA fragments (i.e., genomic or cDNA libraries) from a chosen organism. The hybridization probes may be genomic DNA fragments, cDNA fragments, RNA fragments, or other oligonucleotides, and may be labeled with a detectable group such as .sup.32P, or any other detectable marker. Thus, for example, probes for hybridization can be made by labeling synthetic oligonucleotides based on the sequence of the invention. Methods for preparation of probes for hybridization and for construction of cDNA and genomic libraries are generally known in the art and are disclosed in Sambrook et al. (1989). In general, sequences that hybridize to the sequences disclosed herein will have at least about 50% to 70% and even about 80% 85%, 90%, 95% to 98% or more identity with the disclosed sequences. That is, the sequence similarity of sequences may range, sharing at least about 50% to 70%, and even about 80%, 85%, 90%, 95% to 98% sequence similarity.

    [0174] The nucleic acid molecules of the invention can also be identified by, for example, a search of known databases for genes encoding polypeptides having a specified amino acid sequence identity or DNA having a specified nucleotide sequence identity. Methods of alignment of sequences for comparison are well known in the art and are described hereinabove.

    [0175] Hence, the isolated nucleic acid molecules of the invention include the orthologs of the Arabidopsis thaliana, or Glycine max sequences disclosed herein, i.e., the corresponding nucleotide sequences in organisms other than Arabidopsis thaliana, or Glycine max including, but not limited to, plants other than Arabidopsis thaliana, or Glycine max, preferably dicotyledonous plants, e.g., alfalfa, sunflower, rape seed, cotton, peanut, tobacco, or sugar beet, but also cereal plants such as corn, wheat, rye, turfgrass, sorghum, millet, sugarcane, barley and banana. An orthologous gene is a gene from a different species that encodes a product having the same or similar function, e.g., catalyzing the same reaction as a product encoded by a gene from a reference organism. Thus, an ortholog includes polypeptides having less than, e.g., 50% amino acid sequence identity, but which ortholog encodes a polypeptide having the same or similar function. Databases such GenBank may be employed to identify sequences related to the Arabidopsis thaliana, or Glycine max sequences, e.g., orthologs in other dicotyledonous plants. Alternatively, recombinant DNA techniques such as hybridization or PCR may be employed to identify sequences related to the Arabidopsis thaliana, or Glycine max sequences or to clone the equivalent sequences from different DNAs.

    [0176] The transcription regulating nucleotide sequences of the invention or their functional equivalents can be obtained or isolated from any plant or non-plant source, or produced synthetically by purely chemical means. Preferred sources include, but are not limited to the plants defined in the DEFINITION section above.

    [0177] Thus, another preferred embodiment of the invention relates to a method for identifying and/or isolating a transcription regulating nucleotide molecule characterized that said identification and/or isolation utilizes a nucleic acid molecule encoding a polypeptide comprising a sequence as described by SEQ ID NO: 221, 223, 225, 227, 229, 231, 233, 235, 237, 239, 241, 243, 245, 247, 249, 251, 253 and 255, or a part of said nucleic acid sequence. Preferred are nucleic acid molecules comprising nucleic acid sequences described by or comprising any of SEQ ID NO: 220, 222, 224, 226, 228, 230, 232, 234, 236, 238, 240, 242, 244, 246, 248, 250, 252 and 254 or parts thereof. Part in this context means a nucleic acid sequence of at least 15 consecutive nucleotides, preferably at least 25 consecutive nucleotides, more preferably at least 50 consecutive nucleotides.

    [0178] The method for identification and/or isolation can be based on (but is not limited to) the methods described above such as polymerase chain reaction, hybridization or database screening. Preferably, this method of the invention is based on a polymerase chain reaction, wherein said nucleic acid sequence or its part is utilized as oligonucleotide primer. The person skilled in the art is aware of several methods to amplify and isolate the promoter of a gene starting from part of its coding sequence (such as, for example, part of a cDNA). Such methods may include but are not limited to method such as inverse PCR (iPCR) or thermal asymmetric interlaced PCR (TAIL PCR).

    [0179] Thus, another embodiment of the invention relates to a method for providing or producing a transgenic expression cassette for heterologous expression in plants comprising the steps of: [0180] I. isolating of a transcription regulating nucleotide molecule of a plant gene utilizing at least one nucleic acid sequence comprising any of SEQ ID NO: 220, 222, 224, 226, 228, 230, 232, 234, 236, 238, 240, 242, 244, 246, 248, 250, 252 and 254, or a part of at least 15, preferably at least 20 consecutive nucleotides of said nucleic acid sequence, and [0181] II. functionally linking said transcription regulating nucleotide molecule to another nucleotide molecule of interest, which is heterologous in relation to said transcription regulating nucleotide molecule.

    [0182] Still another embodiment of the invention relates to a method for providing a transgenic expression cassette for expression comprising the steps of: [0183] I. isolating of a transcription regulating nucleotide molecule utilizing at least one nucleic acid molecule or a part thereof, wherein said molecule is encoding a protein comprising any of SEQ ID NO: 221, 223, 225, 227, 229, 231, 233, 235, 237, 239, 241, 243, 245, 247, 249, 251, 253 and 255, or a part of at least 15 consecutive nucleotides thereof, and [0184] II. functionally linking said transcription regulating nucleotide molecule to another nucleotide molecule of interest, which is heterologous in relation to said transcription regulating nucleotide molecule.

    [0185] Preferably, the nucleic acid molecule employed for the isolation comprises at least 15 consecutive nucleotides, preferably at least 25 consecutive nucleotides, more preferably at least 50 consecutive nucleotides of a nucleic acid molecule comprising a sequence described by any of SEQ ID NO: 220, 222, 224, 226, 228, 230, 232, 234, 236, 238, 240, 242, 244, 246, 248, 250, 252 and 254. Preferably, the isolation of the transcription regulating nucleotide molecule is realized by a polymerase chain reaction utilizing said nucleic acid sequence as a primer. The operable linkage can be realized by standard cloning method known in the art such as ligation-mediated cloning or recombination-mediated cloning.

    [0186] Preferably, the transcription regulating nucleotide sequences and promoters of the invention include a consecutive stretch of about 250 consecutive bases, preferably at least 300 consecutive bases, more preferably at least 400 consecutive bases, even more preferably at least 500 consecutive bases, most preferably at least 750 consecutive bases, of any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 and 18, or the promoter orthologs thereof, which include the minimal promoter region.

    [0187] Preferably, the transcription regulating nucleotide sequences and promoters of the invention include a consecutive stretch of about 250 consecutive bases, preferably at least 300 consecutive bases, more preferably at least 400 consecutive bases, even more preferably at least 500 consecutive bases, most preferably at least 750 consecutive bases, of any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 and 18, or the promoter orthologs thereof, which include the minimal promoter region. In a particular embodiment of the invention said consecutive stretch of about 250 consecutive bases, preferably at least 300 consecutive bases, more preferably at least 400 consecutive bases, even more preferably at least 500 consecutive bases, most preferably at least 750 consecutive bases, has at least 50% or 60%, preferably at least 70% or 80%, more preferably at least 90% even more preferably at least 95% or 97%, most preferably 98% or 99%, nucleic acid sequence identity with a corresponding consecutive stretch of about 250 consecutive bases, preferably at least 300 consecutive bases, more preferably at least 400 consecutive bases, even more preferably at least 500 consecutive bases, most preferably at least 750 consecutive bases, of any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 and 18 or the promoter orthologs thereof, which include the minimal promoter region. The above-defined stretch of contiguous nucleotides preferably comprises one or more promoter motifs selected from the group consisting of TATA box, GC-box, CAAT-box and a transcription start site.

    [0188] The transcription regulating nucleotide sequences of the invention or their functional equivalents are capable of driving expression of a coding sequence in a target cell, particularly in a plant cell. The promoter sequences and methods disclosed herein are useful in regulating expression, respectively, of any heterologous nucleotide sequence in a host plant or part thereof in order to vary the phenotype of that plant. These promoters can be used with combinations of enhancer, upstream elements, and/or activating sequences from the 5 flanking regions of plant expressible structural genes. Similarly the upstream element can be used in combination with various plant promoter sequences.

    [0189] The transcription regulating nucleotide sequences and promoters of the invention are useful to modify the phenotype of a plant. Various changes in the phenotype of a transgenic plant are desirable, i.e., modifying the fatty acid composition in a plant, altering the amino acid content of a plant, altering a plant's pathogen defense mechanism, and the like. These results can be achieved by providing expression of heterologous products or increased expression of endogenous products in plants. Alternatively, the results can be achieved by providing for a reduction of expression of one or more endogenous products, particularly enzymes or cofactors in the plant. These changes result in an alteration in the phenotype of the transformed plant.

    [0190] Generally, the transcription regulating nucleotide sequences and promoters of the invention may be employed to express a nucleic acid segment that is operably linked to said promoter such as, for example, an open reading frame, or a portion thereof, an anti-sense sequence, a sequence encoding for a double-stranded RNA sequence, or a transgene in plants.

    [0191] An operable linkage mayfor examplecomprise an sequential arrangement of the transcription regulating nucleotide molecule of the invention (for example a sequence as described by SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88 and 89) with a nucleic acid sequence to be expressed, andoptionallyadditional regulatory elements such as for example polyadenylation or transcription termination elements, enhancers, introns etc., in a way that the transcription regulating nucleotide molecule can fulfill its function in the process of expressing the nucleic acid sequence of interest under the appropriate conditions. The term appropriate conditions means preferably the presence of the expression cassette in a plant cell. Preferred are arrangements, in which the nucleic acid sequence of interest to be expressed is placed down-stream (i.e., in 3-direction) of the transcription regulating nucleotide molecule of the invention in a way, that both sequences are covalently linked. Optionally additional sequences may be inserted in-between the two sequences. Such sequences may be for example linker or multiple cloning sites. Furthermore, sequences can be inserted coding for parts of fusion proteins (in case a fusion protein of the protein encoded by the nucleic acid of interest is intended to be expressed). Preferably, the distance between the nucleic acid sequence of interest to be expressed and the transcription regulating nucleotide molecule of the invention is not more than 200 base pairs, preferably not more than 100 base pairs, more preferably no more than 50 base pairs.

    [0192] An operable linkage in relation to any expression cassette or of the invention may be realized by various methods known in the art, comprising both in vitro and in vivo procedure. Thus, an expression cassette of the invention or an vector comprising such expression cassette may by realized using standard recombination and cloning techniques well known in the art (see e.g., Maniatis 1989; Silhavy 1984; Ausubel 1987).

    [0193] An expression cassette may also be assembled by inserting a transcription regulating nucleotide molecule of the invention (for example a sequence as described by SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88 and 89) into the plant genome. Such insertion will result in an operable linkage to a nucleic acid sequence of interest which as such already existed in the genome. By the insertion the nucleic acid of interest is expressed in a way due to the transcription regulating properties of the transcription regulating nucleotide sequence. The insertion may be directed or by chance. Preferably the insertion is directed and realized by for example homologous recombination. By this procedure a natural promoter may be exchanged against the transcription regulating nucleotide molecule of the invention, thereby modifying the expression profile of an endogenous gene. The transcription regulating nucleotide molecule may also be inserted in a way, that antisense mRNA of an endogenous gene is expressed, thereby inducing gene silencing.

    [0194] Similar, a nucleic acid sequence of interest to be expressed may by inserted into a plant genome comprising the transcription regulating nucleotide molecule in its natural genomic environment (i.e. linked to its natural gene) in a way that the inserted sequence becomes operably linked to the transcription regulating nucleotide sequence, thereby forming an expression cassette of the invention.

    [0195] The expression cassette may be employed for numerous expression purposes such as for example expression of a protein, or expression of an antisense RNA, sense or double-stranded RNA. Preferably, expression of the nucleic acid sequence confers to the plant an agronomically valuable trait.

    [0196] The open reading frame to be linked to the transcription regulating nucleotide molecule of the invention may be obtained from an insect resistance gene, a disease resistance gene such as, for example, a bacterial disease resistance gene, a fungal disease resistance gene, a viral disease resistance gene, a nematode disease resistance gene, a herbicide resistance gene, a gene affecting grain composition or quality, a nutrient utilization gene, a mycotoxin reduction gene, a male sterility gene, a selectable marker gene, a screenable marker gene, a negative selectable marker, a positive selectable marker, a gene affecting plant agronomic characteristics, i.e., yield, standability, and the like, or an environment or stress resistance gene, i.e., one or more genes that confer herbicide resistance or tolerance, insect resistance or tolerance, disease resistance or tolerance (viral, bacterial, fungal, oomycete, or nematode), stress tolerance or resistance (as exemplified by resistance or tolerance to drought, heat, chilling, freezing, excessive moisture, salt stress, or oxidative stress), increased yields, food content and makeup, physical appearance, male sterility, drydown, standability, prolificacy, starch properties or quantity, oil quantity and quality, amino acid or protein composition, and the like. By resistant is meant a plant, which exhibits substantially no phenotypic changes as a consequence of agent administration, infection with a pathogen, or exposure to stress. By tolerant is meant a plant, which, although it may exhibit some phenotypic changes as a consequence of infection, does not have a substantially decreased reproductive capacity or substantially altered metabolism.

    [0197] The expression regulating nucleotide sequences specified above may be optionally operably linked to other suitable regulatory sequences, e.g., a transcription terminator sequence, operator, repressor-binding site, transcription factor binding site and/or an enhancer.

    [0198] The present invention further provides a recombinant vector containing the expression cassette of the invention, and host cells comprising the expression cassette or vector, e.g., comprising a plasmid. The expression cassette or vector may augment the genome of a transformed plant or may be maintained extra-chromosomally. The expression cassette or vector of the invention may be present in the nucleus, chloroplast, mitochondria and/or plastid of the cells of the plant. Preferably, the expression cassette or vector of the invention is comprised in the chromosomal DNA of the plant nucleus. The present invention also provides a transgenic plant prepared by this method, a seed from such a plant and progeny plants from such a plant including hybrids and inbreds. The expression cassette may be operatively linked to a structural gene, the open reading frame thereof, or a portion thereof. The expression cassette may further comprise a Ti plasmid and be contained in an Agrobacterium tumefaciens cell; it may be carried on a microparticle, wherein the microparticle is suitable for ballistic transformation of a plant cell; or it may be contained in a plant cell or protoplast. Further, the expression cassette or vector can be contained in a transformed plant or cells thereof, and the plant may be a dicot or a monocot. In particular, the plant may be a dicotyledonous plant. Preferred transgenic plants are transgenic maize, soybean, barley, alfalfa, sunflower, canola, soybean, cotton, peanut, sorghum, tobacco, sugarbeet, rice, wheat, rye, turfgrass, millet, sugarcane, tomato, or potato.

    [0199] The invention also provides a method of plant breeding, e.g., to prepare a crossed fertile transgenic plant. The method comprises crossing a fertile transgenic plant comprising a particular expression cassette of the invention with itself or with a second plant, e.g., one lacking the particular expression cassette, to prepare the seed of a crossed fertile transgenic plant comprising the particular expression cassette. The seed is then planted to obtain a crossed fertile transgenic plant. The plant may be a monocot or a dicot. In a particular embodiment, the plant is a dicotyledonous plant. The crossed fertile transgenic plant may have the particular expression cassette inherited through a female parent or through a male parent. The second plant may be an inbred plant. The crossed fertile transgenic may be a hybrid. Also included within the present invention are seeds of any of these crossed fertile transgenic plants.

    [0200] The transcription regulating nucleotide sequences of the invention further comprise sequences which are complementary to one (hereinafter test sequence) which hybridizes under stringent conditions with a nucleic acid molecule as described by SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88 and 89, as well as RNA which is transcribed from the nucleic acid molecule. When the hybridization is performed under stringent conditions, either the test or nucleic acid molecule of invention is preferably supported, e.g., on a membrane or DNA chip. Thus, either a denatured test or nucleic acid molecule of the invention is preferably first bound to a support and hybridization is effected for a specified period of time at a temperature of, e.g., between 55 and 70 C., in double strength citrate buffered saline (SC) containing 0.1% SDS followed by rinsing of the support at the same temperature but with a buffer having a reduced SC concentration. Depending upon the degree of stringency required such reduced concentration buffers are typically single strength SC containing 0.1% SDS, half strength SC containing 0.1% SDS and one-tenth strength SC containing 0.1% SDS. More preferably hybridization is carried out under high stringency conditions (as defined above).

    [0201] Virtually any DNA composition may be used for delivery to recipient plant cells, e.g., dicotyledonous cells, to ultimately produce fertile transgenic plants in accordance with the present invention. For example, DNA segments or fragments in the form of vectors and plasmids, or linear DNA segments or fragments, in some instances containing only the DNA element to be expressed in the plant, and the like, may be employed. The construction of vectors, which may be employed in conjunction with the present invention, will be known to those of skill of the art in light of the present disclosure (see, e.g., Sambrook 1989; Gelvin 1990).

    [0202] The nucleotide sequence of interest linked to one or more of the transcription regulating nucleotide sequences of the invention can, for example, code for a ribosomal RNA, an antisense RNA or any other type of RNA that is not translated into protein. In another preferred embodiment of the invention, said nucleotide sequence of interest is translated into a protein product. The transcription regulating nucleotide molecule and/or nucleotide sequence of interest linked thereto may be of homologous or heterologous origin with respect to the plant to be transformed. A recombinant DNA molecule useful for introduction into plant cells includes that which has been derived or isolated from any source, that may be subsequently characterized as to structure, size and/or function, chemically altered, and later introduced into plants. An example of a nucleotide sequence or segment of interest derived from a source, would be a nucleotide sequence or segment that is identified as a useful fragment within a given organism, and which is then chemically synthesized in essentially pure form. An example of such a nucleotide sequence or segment of interest isolated from a source, would be nucleotide sequence or segment that is excised or removed from said source by chemical means, e.g., by the use of restriction endonucleases, so that it can be further manipulated, e.g., amplified, for use in the invention, by the methodology of genetic engineering. Such a nucleotide sequence or segment is commonly referred to as recombinant.

    [0203] Therefore a useful nucleotide sequence, segment or fragment of interest includes completely synthetic DNA, semi-synthetic DNA, DNA isolated from biological sources, and DNA derived from introduced RNA. Generally, the introduced DNA is not originally resident in the plant genotype which is the recipient of the DNA, but it is within the scope of the invention to isolate a gene from a given plant genotype, and to subsequently introduce multiple copies of the gene into the same genotype, e.g., to enhance production of a given gene product such as a storage protein or a protein that confers tolerance or resistance to water deficit.

    [0204] The introduced recombinant DNA molecule includes but is not limited to, DNA from plant genes, and non-plant genes such as those from bacteria, yeasts, animals or viruses. The introduced DNA can include modified genes, portions of genes, or chimeric genes, including genes from the same or different genotype. The term chimeric gene or chimeric DNA is defined as a gene or DNA sequence or segment comprising at least two DNA sequences or segments from species which do not combine DNA under natural conditions, or which DNA sequences or segments are positioned or linked in a manner which does not normally occur in the native genome of untransformed plant.

    [0205] The introduced recombinant DNA molecule used for transformation herein may be circular or linear, double-stranded or single-stranded. Generally, the DNA is in the form of chimeric DNA, such as plasmid DNA that can also contain coding regions flanked by regulatory sequences, which promote the expression of the recombinant DNA present in the resultant plant. Generally, the introduced recombinant DNA molecule will be relatively small, i.e., less than about 30 kb to minimize any susceptibility to physical, chemical, or enzymatic degradation which is known to increase as the size of the nucleotide molecule increases. As noted above, the number of proteins, RNA transcripts or mixtures thereof, which is introduced into the plant genome, is preferably preselected and defined, e.g., from one to about 5-10 such products of the introduced DNA may be formed.

    [0206] Two principal methods for the control of expression are known, viz.: overexpression and underexpression. Overexpression can be achieved by insertion of one or more than one extra copy of the selected gene. It is, however, not unknown for plants or their progeny, originally transformed with one or more than one extra copy of a nucleotide sequence, to exhibit the effects of underexpression as well as overexpression. For underexpression there are two principle methods, which are commonly referred to in the art as antisense downregulation and sense downregulation (sense downregulation is also referred to as cosuppression). Generically these processes are referred to as gene silencing. Both of these methods lead to an inhibition of expression of the target gene.

    [0207] Obtaining sufficient levels of transgene expression in the appropriate plant tissues is an important aspect in the production of genetically engineered crops. Expression of heterologous DNA sequences in a plant host is dependent upon the presence of an operably linked promoter that is functional within the plant host. Choice of the promoter sequence will determine when and where within the organism the heterologous DNA sequence is expressed.

    [0208] It is specifically contemplated by the inventors that one could mutagenize a promoter to potentially improve the utility of the elements for the expression of transgenes in plants. The mutagenesis of these elements can be carried out at random and the mutagenized promoter sequences screened for activity in a trial-by-error procedure. Alternatively, particular sequences which provide the promoter with desirable expression characteristics, or the promoter with expression enhancement activity, could be identified and these or similar sequences introduced into the sequences via mutation. It is further contemplated that one could mutagenize these sequences in order to enhance their expression of transgenes in a particular species.

    [0209] The means for mutagenizing a DNA segment encoding a promoter sequence of the current invention are well known to those of skill in the art. As indicated, modifications to promoter or other regulatory element may be made by random, or site-specific mutagenesis procedures. The promoter and other regulatory element may be modified by altering their structure through the addition or deletion of one or more nucleotides from the sequence which encodes the corresponding unmodified sequences.

    [0210] Mutagenesis may be performed in accordance with any of the techniques known in the art, such as, and not limited to, synthesizing an oligonucleotide having one or more mutations within the sequence of a particular regulatory region. In particular, site-specific mutagenesis is a technique useful in the preparation of promoter mutants, through specific mutagenesis of the underlying DNA. The technique further provides a ready ability to prepare and test sequence variants, for example, incorporating one or more of the foregoing considerations, by introducing one or more nucleotide sequence changes into the DNA. Site-specific mutagenesis allows the production of mutants through the use of specific oligonucleotide sequences which encode the DNA sequence of the desired mutation, as well as a sufficient number of adjacent nucleotides, to provide a primer sequence of sufficient size and sequence complexity to form a stable duplex on both sides of the deletion junction being traversed. Typically, a primer of about 17 to about 75 nucleotides or more in length is preferred, with about 10 to about 25 or more residues on both sides of the junction of the sequence being altered.

    [0211] In general, the technique of site-specific mutagenesis is well known in the art, as exemplified by various publications. As will be appreciated, the technique typically employs a phage vector, which exists in both a single stranded and double stranded form. Typical vectors useful in sitedirected mutagenesis include vectors such as the M13 phage. These phages are readily commercially available and their use is generally well known to those skilled in the art. Double stranded plasmids also are routinely employed in site directed mutagenesis, which eliminates the step of transferring the gene of interest from a plasmid to a phage.

    [0212] In general, site-directed mutagenesis in accordance herewith is performed by first obtaining a single-stranded vector or melting apart of two strands of a double stranded vector which includes within its sequence a DNA sequence which encodes the promoter. An oligonucleotide primer bearing the desired mutated sequence is prepared, generally synthetically. This primer is then annealed with the single-stranded vector, and subjected to DNA polymerizing enzymes such as E. coli polymerase I Klenow fragment, in order to complete the synthesis of the mutation-bearing strand. Thus, a heteroduplex is formed wherein one strand encodes the original non-mutated sequence and the second strand bears the desired mutation. This heteroduplex vector is then used to transform or transfect appropriate cells, such as E. coli cells, and cells are selected which include recombinant vectors bearing the mutated sequence arrangement. Vector DNA can then be isolated from these cells and used for plant transformation. A genetic selection scheme was devised by Kunkel et al. (1987) to enrich for clones incorporating mutagenic oligonucleotides. Alternatively, the use of PCR with commercially available thermostable enzymes such as Taq polymerase may be used to incorporate a mutagenic oligonucleotide primer into an amplified DNA fragment that can then be cloned into an appropriate cloning or expression vector. The PCR-mediated mutagenesis procedures of Tomic et al. (1990) and Upender et al. (1995) provide two examples of such protocols. A PCR employing a thermostable ligase in addition to a thermostable polymerase also may be used to incorporate a phosphorylated mutagenic oligonucleotide into an amplified DNA fragment that may then be cloned into an appropriate cloning or expression vector. The mutagenesis procedure described by Michael (1994) provides an example of one such protocol.

    [0213] The preparation of sequence variants of the selected promoter-encoding DNA segments using site-directed mutagenesis is provided as a means of producing potentially useful species and is not meant to be limiting, as there are other ways in which sequence variants of DNA sequences may be obtained. For example, recombinant vectors encoding the desired promoter sequence may be treated with mutagenic agents, such as hydroxylamine, to obtain sequence variants.

    [0214] As used herein; the term oligonucleotide directed mutagenesis procedure refers to template-dependent processes and vector-mediated propagation which result in an increase in the concentration of a specific nucleic acid molecule relative to its initial concentration, or in an increase in the concentration of a detectable signal, such as amplification. As used herein, the term oligonucleotide directed mutagenesis procedure also is intended to refer to a process that involves the template-dependent extension of a primer molecule. The term template-dependent process refers to nucleic acid synthesis of an RNA or a DNA molecule wherein the sequence of the newly synthesized strand of nucleic acid is dictated by the well-known rules of complementary base pairing (see, for example, Watson and Rarnstad, 1987). Typically, vector mediated methodologies involve the introduction of the nucleic acid fragment into a DNA or RNA vector, the clonal amplification of the vector, and the recovery of the amplified nucleic acid fragment. Examples of such methodologies are provided by U.S. Pat. No. 4,237,224. A number of template-dependent processes are available to amplify the target sequences of interest present in a sample, such methods being well known in the art and specifically disclosed herein below.

    [0215] Where a clone comprising a promoter has been isolated in accordance with the instant invention, one may wish to delimit the essential promoter regions within the clone. One efficient, targeted means for preparing mutagenizing promoters relies upon the identification of putative regulatory elements within the promoter sequence. This can be initiated by comparison with promoter sequences known to be expressed in similar tissue-specific or developmentally unique manner. Sequences, which are shared among promoters with similar expression patterns, are likely candidates for the binding of transcription factors and are thus likely elements that confer expression patterns. Confirmation of these putative regulatory elements can be achieved by deletion analysis of each putative regulatory region followed by functional analysis of each deletion construct by assay of a reporter gene, which is functionally attached to each construct. As such, once a starting promoter sequence is provided, any of a number of different deletion mutants of the starting promoter could be readily prepared.

    [0216] Functionally equivalent fragments of a transcription regulating nucleotide molecule of the invention can also be obtained by removing or deleting non-essential sequences without deleting the essential one. Narrowing the transcription regulating nucleotide molecule to its essential, transcription mediating elements can be realized in vitro by trial-and-error deletion mutations, or in silico using promoter element search routines. Regions essential for promoter activity often demonstrate clusters of certain, known promoter elements. Such analysis can be performed using available computer algorithms such as PLACE (Plant Cis-acting Regulatory DNA Elements; Higo 1999), the BIOBASE database Transfac (Biologische Datenbanken GmbH, Braunschweig; Wingender 2001) or the database PlantCARE (Lescot 2002).

    [0217] A method for producing such regulatory nucleic acid molecules with mutated sequences regulating the same expression specificity as the parent sequence or reference sequence is for example defined in U.S. 61/419,895 and EP 10193800.9.

    [0218] Preferably, functional equivalent fragments of one of the transcription regulating nucleotide sequences of the invention comprises at least 250 base pairs, preferably, at least 300 base pairs, more preferably at least 400 base pairs, even more preferably 500 base pairs, most preferably 750 base pairs of a transcription regulating nucleotide molecule as described by SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 or 18, . More preferably this fragment is starting from the 3-end of the indicated sequences.

    [0219] Especially preferred are equivalent fragments of transcription regulating nucleotide sequences, which are obtained by deleting the region encoding the 5-untranslated region of the mRNA, thus only providing the (untranscribed) promoter region. The 5-untranslated region can be easily determined by methods known in the art (such as 5-RACE analysis). Accordingly, some of the transcription regulating nucleotide sequences of the invention are equivalent fragments of other sequences.

    [0220] An expression cassette of the invention may comprise further regulatory elements. The term in this context is to be understood in a broad meaning comprising all sequences, which may influence construction or function of the expression cassette. Regulatory elements may for example modify transcription and/or translation in prokaryotic or eukaryotic organism. In an preferred embodiment the expression cassette of the invention comprised downstream (in 3-direction) of the nucleic acid sequence to be expressed a transcription termination sequence andoptionally additional regulatory elementseach operably liked to the nucleic acid sequence to be expressed (or the transcription regulating nucleotide sequence).

    [0221] Additional regulatory elements may comprise additional promoter, minimal promoters, or promoter elements, which may modify the expression regulating properties. For example the expression may be made depending on certain stress factors such water stress, abscisin (Lam 1991) or heat stress (Schoffl 1989). Furthermore additional promoters or promoter elements may be employed, which may realize expression in other organisms (such as E. coli or Agrobacterium). Such regulatory elements can be found in the promoter sequences or bacteria such as amy and SPO2 or in the promoter sequences of yeast or fungal promoters (such as ADC1, MFa, AC, P-60, CYC1, GAPDH, TEF, rp28, and ADH).

    [0222] Furthermore, it is contemplated that promoters combining elements from more than one promoter may be useful. For example, U.S. Pat. No. 5,491,288 discloses combining a Cauliflower Mosaic Virus promoter with a histone promoter. Thus, the elements from the promoters disclosed herein may be combined with elements from other promoters. Promoters, which are useful for plant transgene expression include those that are inducible, viral, synthetic, constitutive (Odell 1985), temporally regulated, spatially regulated, tissue-specific, and spatial-temporally regulated.

    [0223] Where expression in specific tissues or organs is desired, tissue-specific promoters may be used. In contrast, where gene expression in response to a stimulus is desired, inducible promoters are the regulatory elements of choice. Such inducible promoters may additionally be tissue or organ specifically expressed and or induced. Where continuous expression is desired throughout the cells of a plant, constitutive promoters are utilized. Additional regulatory sequences upstream and/or downstream from the core promoter sequence may be included in expression constructs of transformation vectors to bring about varying levels of expression of heterologous nucleotide sequences in a transgenic plant.

    [0224] A variety of 5 and 3 transcriptional regulatory sequences are available for use in the present invention. Transcriptional terminators are responsible for the termination of transcription and correct mRNA polyadenylation. The 3 nontranslated regulatory DNA sequence preferably includes from about 50 to about 1,000, more preferably about 100 to about 1,000, nucleotide base pairs and contains plant transcriptional and translational termination sequences. Appropriate transcriptional terminators and those which are known to function in plants include the CaMV 35S terminator, the tml terminator, the nopaline synthase terminator, the pea rbcS E9 terminator, the terminator for the T7 transcript from the octopine synthase gene of Agrobacterium tumefaciens, and the 3 end of the protease inhibitor I or II genes from potato or tomato, although other 3 elements known to those of skill in the art can also be employed. Alternatively, one also could use a gamma coixin, oleosin 3 or other terminator from the genus Coix.

    [0225] Preferred 3 elements include those from the nopaline synthase gene of Agrobacterium tumefaciens (Bevan 1983), the terminator for the T7 transcript from the octopine synthase gene of Agrobacterium tumefaciens, and the 3 end of the protease inhibitor I or II genes from potato or tomato.

    [0226] As the DNA sequence between the transcription initiation site and the start of the coding sequence, i.e., the untranslated leader sequence, can influence gene expression, one may also wish to employ a particular leader sequence. Preferred leader sequences are contemplated to include those, which include sequences, predicted to direct optimum expression of the attached gene, i.e., to include a preferred consensus leader sequence, which may increase or maintain mRNA stability and prevent inappropriate initiation of translation. The choice of such sequences will be known to those of skill in the art in light of the present disclosure. Sequences that are derived from genes that are highly expressed in plants will be most preferred.

    [0227] Preferred regulatory elements also include the 5-untranslated region, introns and the 3-untranslated region of genes. Such sequences that have been found to enhance gene expression in transgenic plants include intron sequences (e.g., from Adh1, bronze1, actin1, actin2 (WO 00/760067), or other plant introns as disclosed in WO2011/023537, WO2011/023539, WO2006/094976.

    [0228] Additional preferred regulatory elements are enhancer sequences or polyadenylation sequences.

    [0229] The heterologous nucleotide sequence to be expressed is preferably furthermore operablylinked to 3-untranslated regions, transcription termination and/or polyadenylation signal. 3-untranslated regions are suitable to stabilize mRNA expression and structure. This can result in prolonged presence of the mRNA and thus enhanced expression levels. Termination and polyadenylation signals are suitable to stabilize mRNA expression, to ensure constant mRNA transcript length and to prevent read-through transcription. Especially in multigene expression constructs this is an important feature. Furthermore correct termination of transcription is linked to re-initiation of transcription from the regulatory 5nucleotide sequence resulting in enhanced expression levels. The above-mentioned signals can be any signal functional in plants and can for example be isolated from plant genes, plant virus genes or other plant pathogens. However, in a preferred embodiment the 3-untranslated regions, transcription termination and polyadenylation signals are from the genes employed as the source for the promoters of this invention.

    [0230] Preferred polyadenylation sequences are those from plant genes or Agrobacterium T-DNA genes (such as for example the terminator sequences of the OCS (octopine synthase) or NOS (nopaline synthase) genes).

    [0231] Examples of enhancers include elements from the CaMV 35S promoter, octopine synthase genes (Ellis el al., 1987), the rice actin I gene, the maize alcohol dehydrogenase gene (Callis 1987), the maize shrunken I gene (Vasil 1989), TMV Omega element (Gallie 1989) and promoters from non-plant eukaryotes (e.g. yeast; Ma 1988). Vectors for use in accordance with the present invention may be constructed to include the ocs enhancer element. This element was first identified as a 16 bp palindromic enhancer from the octopine synthase (ocs) gene of ultilane (Ellis 1987), and is present in at least 10 other promoters (Bouchez 1989). The use of an enhancer element, such as the ocs elements and particularly multiple copies of the element, will act to increase the level of transcription from adjacent promoters when applied in the context of plant transformation.

    [0232] An expression cassette of the invention (or a vector derived thereof) may comprise additional functional elements, which are to be understood in the broad sense as all elements, which influence construction, propagation, or function of an expression cassette or a vector or a transgenic organism comprising them. Such functional elements may include origin of replications (to allow replication in bacteria; for the ORI of pBR322 or the P15A ori; Sambrook 1989), or elements required for Agrobacterium T-DNA transfer (such as for example the left and/or rights border of the T-DNA).

    [0233] Ultimately, the most desirable DNA segments for introduction into, for example, a dicot genome, may be homologous genes or gene families which encode a desired trait (e.g., increased yield per acre, fungal resistance) and which are introduced under the control of novel promoters or enhancers, etc., or perhaps even homologous or tissue specific (e.g., root-, collar/sheath-,whorl-, stalk-, earshank-, kernel- or leaf-specific) promoters or control elements. Indeed, it is envisioned that a particular use of the present invention will be the expression of a gene in the epidermis or mesophyll or inducible in the epidermis and/or mesophyll.

    [0234] Additionally, vectors may be constructed and employed in the intracellular targeting of a specific gene product within the cells of a transgenic plant or in directing a protein to the extracellular environment. This will generally be achieved by joining a DNA sequence encoding a transit or signal peptide sequence to the coding sequence of a particular gene. The resultant transit or signal peptide will transport the protein to a particular intracellular or extracellular destination, respectively, and will then be post-translationally removed. Transit or signal peptides act by facilitating the transport of proteins through intracellular membranes, e.g., vacuole, vesicle, plastid and mitochondrial membranes, whereas signal peptides direct proteins through the extracellular membrane.

    [0235] A particular example of such a use concerns the direction of a herbicide resistance gene, such as the EPSPS gene, to a particular organelle such as the chloroplast rather than to the cytoplasm. This is exemplified by the use of the rbcs transit peptide which confers plastid-specific targeting of proteins. In addition, it is proposed that it may be desirable to target certain genes responsible for male sterility to the mitochondria, or to target certain genes for resistance to phytopathogenic organisms to the extracellular spaces, or to target proteins to the vacuole.

    [0236] By facilitating the transport of the protein into compartments inside and outside the cell, these sequences may increase the accumulation of gene product protecting them from proteolytic degradation. These sequences also allow for additional mRNA sequences from highly expressed genes to be attached to the coding sequence of the genes. Since mRNA being translated by ribosomes is more stable than naked mRNA, the presence of translatable mRNA in front of the gene may increase the overall stability of the mRNA transcript from the gene and thereby increase synthesis of the gene product. Since transit and signal sequences are usually post-translationally removed from the initial translation product, the use of these sequences allows for the addition of extra translated sequences that may not appear on the final polypeptide. Targeting of certain proteins may be desirable in order to enhance the stability of the protein (U.S. Pat. No. 5,545,818).

    [0237] It may be useful to target DNA itself within a cell. For example, it may be useful to target introduced DNA to the nucleus as this may increase the frequency of transformation. Within the nucleus itself it would be useful to target a gene in order to achieve site-specific integration. For example, it would be useful to have a gene introduced through transformation replace an existing gene in the cell. Other elements include those that can be regulated by endogenous or exogenous agents, e.g., by zinc finger proteins, including naturally occurring zinc finger proteins or chimeric zinc finger proteins (see, e.g., U.S. Pat. No. 5,789,538, WO 99/48909; WO 99/45132; WO 98/53060; WO 98/53057; WO 98/53058; WO 00/23464; WO 95/19431; and WO 98/54311) or myb-like transcription factors. For example, a chimeric zinc finger protein may include amino acid sequences, which bind to a specific DNA sequence (the zinc finger) and amino acid sequences that activate (e.g., GAL 4 sequences) or repress the transcription of the sequences linked to the specific DNA sequence.

    [0238] It is one of the objects of the present invention to provide recombinant DNA molecules comprising a nucleotide sequence according to the invention operably linked to a nucleotide segment of interest.

    [0239] A nucleotide segment of interest is reflective of the commercial markets and interests of those involved in the development of the crop. Crops and markets of interest changes, and as developing nations open up world markets, new crops and technologies will also emerge. In addition, as the understanding of agronomic traits and characteristics such as yield and heterosis increase, the choice of genes for transformation will change accordingly. General categories of nucleotides of interest include, for example, genes involved in information, such as zinc fingers, those involved in communication, such as kinases, and those involved in housekeeping, such as heat shock proteins. More specific categories of transgenes, for example, include genes encoding important traits for agronomics, insect resistance, disease resistance, herbicide resistance, sterility, grain characteristics, and commercial products. Genes of interest include, generally, those involved in starch, oil, carbohydrate, or nutrient metabolism, as well as those affecting kernel size, sucrose loading, zinc finger proteins, see, e.g., U.S. Pat. No. 5,789,538, WO 99/48909; WO 99/45132; WO 98/53060; WO 98/53057; WO 98/53058; WO 00/23464; WO 95/19431; and WO 98/54311, and the like.

    [0240] One skilled in the art recognizes that the expression level and regulation of a transgene in a plant can vary significantly from line to line. Thus, one has to test several lines to find one with the desired expression level and regulation. Once a line is identified with the desired regulation specificity of a chimeric Cre transgene, it can be crossed with lines carrying different inactive replicons or inactive transgene for activation.

    [0241] Other sequences, which may be linked to the gene of interest, which encodes a polypeptide, are those which can target to a specific organelle, e.g., to the mitochondria, nucleus, or plastid, within the plant cell. Targeting can be achieved by providing the polypeptide with an appropriate targeting peptide sequence, such as a secretory signal peptide (for secretion or cell wall or membrane targeting, a plastid transit peptide, a chloroplast transit peptide, e.g., the chlorophyll a/b binding protein, a mitochondrial target peptide, a vacuole targeting peptide, or a nuclear targeting peptide, and the like. For example, the small subunit of ribulose bisphosphate carboxylase transit peptide, the EPSPS transit peptide or the dihydrodipicolinic acid synthase transit peptide may be used, for examples of plastid organelle targeting sequences (see WO 00/12732). Plastids are a class of plant organelles derived from proplastids and include chloroplasts, leucoplasts, amyloplasts, and chromoplasts. The plastids are major sites of biosynthesis in plants. In addition to photosynthesis in the chloroplast, plastids are also sites of lipid biosynthesis, nitrate reduction to ammonium, and starch storage. And while plastids contain their own circular genome, most of the proteins localized to the plastids are encoded by the nuclear genome and are imported into the organelle from the cytoplasm.

    [0242] Transgenes used with the present invention will often be genes that direct the expression of a particular protein or polypeptide product, but they may also be non-expressible DNA segments, e.g., transposons such as Ds that do no direct their own transposition. As used herein, an expressible gene is any gene that is capable of being transcribed into RNA (e.g., mRNA, antisense RNA, etc.) or translated into a protein, expressed as a trait of interest, or the like, etc., and is not limited to selectable, screenable or non-selectable marker genes. The invention also contemplates that, where both an expressible gene that is not necessarily a marker gene is employed in combination with a marker gene, one may employ the separate genes on either the same or different DNA segments for transformation. In the latter case, the different vectors are delivered concurrently to recipient cells to maximize cotransformation.

    [0243] The choice of the particular DNA segments to be delivered to the recipient cells will often depend on the purpose of the transformation. One of the major purposes of transformation of crop plants is to add some commercially desirable, agronomically important traits to the plant. Such traits include, but are not limited to, herbicide resistance or tolerance; insect resistance or tolerance; disease resistance or tolerance (viral, bacterial, fungal, nematode); stress tolerance and/or resistance, as exemplified by resistance or tolerance to drought, heat, chilling, freezing, excessive moisture, salt stress; oxidative stress; increased yields; food content and makeup; physical appearance; male sterility; drydown; standability; prolificacy; starch properties; oil quantity and quality; and the like. One may desire to incorporate one or more genes conferring any such desirable trait or traits, such as, for example, a gene or genes encoding pathogen resistance.

    [0244] In certain embodiments, the present invention contemplates the transformation of a recipient cell with more than one advantageous transgene. Two or more transgenes can be supplied in a single transformation event using either distinct transgene-encoding vectors, or using a single vector incorporating two or more gene coding sequences. For example, plasmids bearing the bar and aroA expression units in either convergent, divergent, or colinear orientation, are considered to be particularly useful. Further preferred combinations are those of an insect resistance gene, such as a Bt gene, along with a protease inhibitor gene such as pinII, or the use of bar in combination with either of the above genes. Of course, any two or more transgenes of any description, such as those conferring herbicide, insect, disease (viral, bacterial, fungal, nematode) or drought resistance, male sterility, drydown, standability, prolificacy, starch properties, oil quantity and quality, or those increasing yield or nutritional quality may be employed as desired.

    EXAMPLES

    Materials and General Methods

    [0245] Unless indicated otherwise, chemicals and reagents in the Examples were obtained from Sigma Chemical Company (St. Louis, Mont.), restriction endonucleases were from New England Biolabs (Beverly, Mass.) or Roche (Indianapolis, Ind.), oligonucleotides were synthesized by MWG Biotech Inc. (High Point, N.C.), and other modifying enzymes or kits regarding biochemicals and molecular biological assays were from Clontech (Palo Alto, Calif.), Pharmacia Biotech (Piscataway, N.J.), Promega Corporation (Madison, Wis.), or Stratagene (La Jolla, Calif.). Materials for cell culture media were obtained from Gibco/BRL (Gaithersburg, Md.) or DIFCO (Detroit, Mich.). The cloning steps carried out for the purposes of the present invention, such as, for example, restriction cleavages, agarose gel electrophoresis, purification of DNA fragments, transfer of nucleic acids to nitrocellulose and nylon membranes, linking DNA fragments, transformation of E. coil cells, growing bacteria, multiplying phages and sequence analysis of recombinant DNA, are carried out as described by Sambrook (1989). The sequencing of recombinant DNA molecules is carried out using ABI laser fluorescence DNA sequencer following the method of Sanger (Sanger 1977).

    Example 1

    Identification and Validation of Promoters from Soybean Putatively Conferring Constitutive Expression or Expression in Epidermis of a Plant

    [0246] 1.1 Identification of Promoters Putatively Conferring Constitutive Expression or Expression in Epidermis

    [0247] A soybean gene expression profiling analysis was carried out by a commercial supplier of AFLP comparative expression technology (Keygene N.V., P.O. Box 216, 6700 AE Wageningen, The Netherlands) using RNA samples from 34 soybean tissues generated by BASF (Table 1). AFLP bands were selected for constitutive expression in all tissues and expression in epidermis.

    TABLE-US-00001 TABLE 1 Soybean samples for AFLP screen Sam- ple # Tissue Source Stage Treatment 1 Leaf - Epidermis unifoliolate leaf V2-3 2 Leaf - mesophyll unifoliolate leaf V2-3 3 Leaf - Epidermis* unifoliolate leaf V2-3 mock 8 + 16 h 4 Leaf - Epidermis* unifoliolate leaf V2-3 +ASR 8 hai 5 Leaf - Epidermis* unifoliolate leaf V2-3 +ASR 16 hai 6 Leaf - Epidermis* unifoliolate leaf V2-3 +ASR 112 hai 7 Leaf - unifoliolate leaf V2-3 mock 8 + 16 h Mesophyll* 8 Leaf - unifoliolate leaf V2-3 +ASR 16 hai Mesophyll* 9 Leaf - unifoliolate leaf V2-3 +ASR 112 hai Mesophyll* 10 Leaf unifoliolate leaves V2-3 11 Leaf trifoliolate leaves V2-3 12 Leaf trifoliolate leaves R1-2 13 Leaf trifoliolate leaves R7 14 Stem complete VC 15 Stem complete V2-3 16 Stem complete R2 17 Shoot tip complete VC 18 root complete VC 19 root complete R2 20 flowers buds R1 21 fowers complete R2 22 embryo 18-20 days R5 23 embryo 5-9 mm R5 24 embryo complete R6 25 embryo complete R7 26 embryo complete R8 27 whole seeds 14 days R4 28 endosperm 14 days R4 early 29 endosperm complete R4 late 30 endosperm complete R5 31 endosperm complete R6 32 siliques seeds R3 33 siliques seeds R4 34 siliques seeds R6 hai = hours after infection; ASR = Asian Soybean Rust

    [0248] 1.2 Identification of the Genes Corresponding to AFLP Bands

    [0249] Expressed Sequence Tag (EST) sequences of AFLP bands were used as query for BLASTN searching against a soybean sequence database. The corresponding genes are listed in table 2.

    TABLE-US-00002 TABLE 2 Overview over corresponding genes for G. max promoters conferring constitutive expression and expression in the epidermis Feature name SEQ ID # Glyma11g14950_gene 220 Glyma14g06680_gene 222 Glyma02g47670_gene 224 Glyma14g02930_gene 226 Glyma17g27610_gene 228

    [0250] 1.3 Confirmation of Allele-Specific Expression Pattern Using Quantitative Reverse Transcriptase-Polymerase Chain Reaction (qRT-PCR)

    [0251] In order to confirm the native expression patterns of the identified soybean genes in an allele-specific manner, quantitative reverse transcription PCR (qRT-PCR) was performed using total RNA isolated from the same materials as were used for the AFLP expression profiling (Table 1).

    [0252] Primers for qRT-PCR were designed based on the sequences of the isolated EST fragments using the Vector NTI software package (Invitrogen, Carlsbad, Calif., USA). Primers were designed to distinguish individual alleles of the candidate gene in the tetraploid soybean genome. Primers for qRT-PCR are listed in table 3. The tubulin gene served as a control for normalization purposes.

    TABLE-US-00003 TABLE3 PrimersequencesforqRT-PCR SEQ Feature ID name Primer Sequence # Glyma11 Loy1294 CCTTCATAGACCTGAATCAACACACCG 90 g14950 Loy1296 GGAGGAGTCATGACTGTGTTGATTCC 91 Glyma14 Loy1275 CGCCGGGTTTATGTGTC 92 g06680 Loy1278 CCGGGGCTAAGTCTAAGTGT 93 Glyma02 Loy1420 CGTCTGCTACAGCGTGTGGAAGGACGAGG 94 g47670 Loy1421 GAGACGTGGCGGTGCTTCTTGCGGTAATC 95 Glyma14 Loy1425 TGGAATCAAAGACAGGTAGACTGGC 96 g02930 Loy1427 CTGCTTTCAGTGTAATGGTTTCCAGA 97 Glyma17 Loy1429 TTGTCTGGTTTGGAAAGAAGAAAGTTGTGA 98 g27610 Loy1430 CACACAGAGCACAAGGAATAGTGGCAAT 99 Tubulin Loy1145 TGGGAATCCACTCAACGAAGT 100 Loy1146 CCTGACAGCATCAGCCATGT 101

    [0253] qRT-PCR was performed using QuantiTect Kit (Qiagen, Hilden, Germany) and SYBR Green qPCR Master Mix (Roche Diagnostics, Mannheim, Germany) in a Roche LightCycler (Roche Diagnostics, Mannheim, Germany). cDNA was synthesized using 800 ng of total RNA and 1 l reverse transcriptase in a 20 l volume. The cDNA was diluted with 60 l of RNAse free water to a final volume of 80 l. 4 l of diluted cDNA were used in a 10 l PCR reaction according to manufacturer's instruction. The thermocycling conditions were as follows: Denature at 95 C. for 2 minutes, and run 45 cycles at 95 C. for 10 seconds and 60 C. for 20 seconds and 72 C. for 20 seconds for amplification. After the final cycle of the amplification, the dissociation curve analysis was carried out to verify that the amplification occurred specifically and no primer dimer product was generated during the amplification process. The tubulin gene (primer sequences in table 3) was used as an endogenous reference gene to normalize the calculation using the Comparative Ct (Cycle of threshold) value method. The DeltaCt value was obtained by subtracting the Ct value of tubulin gene from the Ct value of the respective candidate gene, and the relative transcription quantity (expression level) of the candidate gene was expressed as 2.sup.-DeltaCt.

    [0254] 1.4 Identification of the Promoter Region

    [0255] For promoter identification purposes, the sequence upstream of the start codon of the identified genes was defined as the respective promoter. To characterize these promoter regions, 5RACE PCR analyses were performed using the primers listed in table 4.

    TABLE-US-00004 TABLE4 Primersequencesfor5RACEPCR SEQ Feature ID name Primer Sequence # Glyma11 Loy1685 CATCGCCGATCAACCGTTCTGTG 102 g14950 Glyma14 Loy1682 GACTTAGCCCCGGCGACTCCCATA 103 g06680 Glyma02 Loy1649 TGATCAAACGCTCTGTAAACTTTCTTCACA 104 g47670 Glyma14 Loy1665 GACTGAACTGGGGTTGAAGGTGAACACT 105 g02930 Glymal7 Loy1672 CATCTTCTGGTGCCGAGGCAGGGAT 106 g27610

    [0256] 1.5 Isolation of the Promoter Region by PCR Amplification

    [0257] The promoter regions of the respective genes were isolated via genomic PCR using the following sequence specific primers (table 5):

    [0258] Promoters putatively conferring constitutive expression or expression in the epidermis amplified with these primer pairs are listed in table 6.

    [0259] In addition 5-deletions of the promoters are made by using different 5 primers in combination with the same 3 oligonucleotide primer. The resulting promoters are indicated by their respective length in base pairs (cp. table 6) and the corresponding primer pairs for PCR are listed in table 5.

    [0260] Promoters are bioinformatically analyzed with Matlnspector Professional 8.0.4, Release August 2010 (Genomatix Software GmbH; Munich, Germany) for transcription factor binding sites. Regions free of core motifs are permutated and the resulting nucleic acid sequences are synthesized. The principles for generating permutated promoters that retain their respective tissue specificities are described in EP10193800.9 and U.S. 61/419,895. The resulting sequences are indicated by the original identifier of the corresponding gene followed by _perm (cp. table 6).

    TABLE-US-00005 TABLE5 PrimersequencesforPCRamplificationofpromotersputativelyconferring constitutiveexpressionorexpressionintheepidermis SEQ ID Featurename Primer Sequence # Glyma11g14950_1939bp Loy1436 TATATAGGTACCAAAGAGCCAAGTTGTTATTC 107 Loy1437 TATATACCATGGTACTCACTCACACACAAAC 108 Glyma14g06680_1056bp Loy1432 TATATAGGTACCATTTCCAACTCCTGACTGAGA 109 Loy1433 TATATACCATGGTCTTTCTCCTCGCCTGGGA 110 Glyma02g47670_1753bp Loy1490 TATATAGGTACCTCTCAATCAAGGCCTTTAT 111 Loy1491 TATATACCATGGTTAATTAATTTCAATCTCTCCCTCTCTAT 112 Glyma14g02930_1688bp Loy1492 TATATAGGTACCCGGTTATTCTTAATCCTTTTCA 113 Loy1493 TATATACCATGGTTAATTAAGCTGTGTGACCACTGATG 114 Glyma17g27610_1889bp Loy1494 TATATAGGTACCGATTCTAGATATTGAAGTTTGTGA 115 Loy1495 TATATACCATGGTTAATTAATGTTGTGTTAACAAAGGGT 116 Glyma11g14950_500bp Loy1436.500 TATATAGGTACCCGCGCTTTACACGGAGTTAGTGAA 117 Loy1437 TATATACCATGGTACTCACTCACACACAAAC 108 Glyma11g14950_1000bp Loy1436.1000 TATATAGGTACCAAGAAAAAAAACATATCGGAGGAGGA 118 Loy1437 TATATACCATGGTACTCACTCACACACAAAC 108 Glyma11g14950_1500bp Loy1436.1500 TATATAGGTACCAATTTCAATTTCTCACCTTTTTAATTGT 119 Loy1437 TATATACCATGGTACTCACTCACACACAAAC 108 Glyma14g06680_500bp Loy1432.500 TATATAGGTACCGGAGAAAAGAAAAACTGTTGAC 120 Loy1433 TATATACCATGGTCTTTCTCCTCGCCTGGGA 110 Glymal4g06680_700bp Loy1432.700 TATATAGGTACCATTTATACCACATGTGGGAAGTATTG 121 Loy1433 TATATACCATGGTCTTTCTCCTCGCCTGGGA 110 Glyma14g06680_1000bp Loy1432.1000 TATATAGGTACCCATCTTTCACGCTACAAAACATTGGT 122 Loy1433 TATATACCATGGTCTTTCTCCTCGCCTGGGA 110 Glyma02g47670_500bp Loy1490.500 TATATAGGTACCCTGAAGATTACACCAGTAGTTAGT 123 Loy1491 TATATACCATGGTTAATTAATTTCAATCTCTCCCTCTCTAT 112 Glyma02g47670_1000bp Loy1490.1000 TATATAGGTACCTATGCCAGAATCAACAATGAAAC 124 Loy1491 TATATACCATGGTTAATTAATTTCAATCTCTCCCTCTCTAT 112 Glyma02g47670_1500bp Loy1490.1500 TATATAGGTACCAGCTAGGTAGCGGGTGGTGGTAGGA 125 Loy1491 TATATACCATGGTTAATTAATTTCAATCTCTCCCTCTCTAT 112 Glyma14g02930_500bp Loy1492.500 TATATAGGTACCCCACCGACCTTTTTTTATATAAAAAAAATC 126 Loy1493 TATATACCATGGTTAATTAAGCTGTGTGACCACTGATG 114 Glyma14g02930_1000bp Loy1492.1000 TATATAGGTACCTTAAATTACATGAATAACGAAATTAAG 127 Loy1493 TATATACCATGGTTAATTAAGCTGTGTGACCACTGATG 114 Glyma14g02930_1500bp Loy1492.1500 TATATAGGTACCAAACAAAATTATCCATCTCACA 128 Loy1493 TATATACCATGGTTAATTAAGCTGTGTGACCACTGATG 114 Glyma17g27610_500bp Loy1494.500 TATATAGGTACCAATAAACATATTAATCAACTATGAAAC 129 Loy1495 TATATACCATGGTTAATTAATGTTGTGTTAACAAAGGGT 116 Glyma17g27610_1000bp Loy1494.1000 TATATAGGTACCAAACTCATTCCACATGGACTGTGGCCT 130 Loy1495 TATATACCATGGTTAATTAATGTTGTGTTAACAAAGGGT 116 Glyma17g27610_1500bp Loy1494.1500 TATATAGGTACCTTGATTAACAAAAGTTTTATAAATAAAC 131 Loy1495 TATATACCATGGTTAATTAATGTTGTGTTAACAAAGGGT 116

    TABLE-US-00006 TABLE 6 Overview over G. max promoters conferring constitutive expression and expression in the epidermis Feature name SEQ ID # p-Glyma11g14950_1939bp 1 p-Glyma14g06680_1056bp 2 p-Glyma02g47670_1753bp 3 p-Glyma14g02930_1688bp 4 p-Glyma17g27610_1889bp 5 p-Glyma11g14950_1939bp_perm 19 p-Glyma11g14950_500bp 20 p-Glyma11g14950_1000bp 21 p-Glyma11g14950_1500bp 22 p-Glyma14g06680_1056bp_perm 23 p-Glyma14g06680_500bp 24 p-Glyma14g06680_700bp 25 p-Glyma14g06680_1000bp 26 p-Glyma02g47670_1753bp_perm 27 p-Glyma02g47670_500bp 28 p-Glyma02g47670_1000bp 29 p-Glyma02g47670_1500bp 30 p-Glyma14g02930_1688bp_perm 31 p-Glyma14g02930_500bp 32 p-Glyma14g02930_1000bp 33 p-Glyma14g02930_1500bp 34 p-Glyma17g27610_1889bp_perm 35 p-Glyma17g27610_500bp 36 p-Glyma17g27610_1000bp 37 p-Glyma17g27610_1500bp 38

    [0261] 1.6 Cloning of Promoter Elements into the Context of a GUS Reporter Gene Cassette

    [0262] To facilitate sub-cloning, promoter elements were modified by the addition of KpnI+Acc65I restriction enzyme sites at their 5 end and PacI+NcoI sites at their 3end. Using the Multisite Gateway System (Invitrogen, Carlsbad, Calif., USA), the promoter::reporter-gene cassettes were assembled into binary constructs for plant transformation. The respective Glycine max promoters (with the prefix p- denoting promoter) were used in the reporter gene construct, and betaglucoronidase coding sequence (GUS) was utilized as reporter protein for subsequent histo-chemical analysis.

    [0263] An ENTR/A vector containing the betaglucoronidase coding sequence followed by the t-nos nopalin synthase transcriptional terminator (Genbank V00087) was generated. Glycine max promoters were cloned using the restriction enzyme sites (see above) added by PCR amplification at either end. Positive pENTR/A clones underwent sequence analysis to ensure correctness.

    [0264] The pENTR/B and pENTR/C did not contain any additional elements. By performing a site-specific recombination (LR-reaction), the created pENTR/A, pENTR/B and pENTR/C were combined with the pSUN destination vector (pSUN derivative) according to the manufacturers (Invitrogen, Carlsbad, Calif., USA) Multisite Gateway manual. The reactions yielded binary vectors LJK291, LJK296, LJK303, LJK304, LJK305 (cp. table7) with the respective Glycine max promoter, the GUS coding sequence c-GUS and the t-nos terminator, with promoter molecules having the prefix p-, coding sequences having the prefix c-, and terminator molecules having the prefix t-.

    [0265] Table 7 shows an overview over reporter gene constructs with promoter elements putatively conferring constitutive expression or expression in the epidermis.

    TABLE-US-00007 TABLE 7 Overview over G. max reporter gene constructs with promoters conferring constitutive expression or expression in the epidermis Feature name SEQ ID # LJK291 LJK296 256 LJK303 257 LJK304 LJK305

    [0266] 1.7 Generation of Transgenic Soybean Plants (Amended Protocol According to WO2005/121345; Olhoft et al., 2007).

    [0267] Soybean seed germination, propagation, A. rhizogenes and axillary meristem explant preparation, and inoculations were done as previously described (WO2005/121345; Olhoft et al., 2007) with the exception that the LJK291, LJK296, LJK303, LJK304, LJK305 (cp. example 1.6) each contained a mutated AHAS gene driven by the parsley ubiquitin promoter PcUbi4-2, mediating tolerance to imidazolinone herbicides for selection.

    [0268] 1.8 Promoter Evaluation in Transgenic Soybean

    [0269] Expression patterns and levels driven by the constitutive promoters and promoters putatively conferring expression in the epidermis measured using GUS histo-chemical analysis following a protocol known in the art (Jefferson 1987). GUS expression was assayed in the following vegetative and reproductive tissue for the constitutive promoters at various developmental stages: [0270] 1) leaf surface [0271] 2) root [0272] 3) stem [0273] 4) stem section [0274] 5) meristem [0275] 6) petioles [0276] 7) flowers [0277] 8) bud [0278] 9) embryo [0279] 10) seedcoat [0280] 11) silique seed-pocket [0281] 12) silique end

    [0282] Expression in the epidermis was assayed in leaf surface views and sections based on visual assessment of the GUS staining. LJK291 and LJK296 showed constitutive expression in all analyzed tissues. LJK303, LJK304 and LJK305 showed strong expression in the lower leaf epidermis and parts of the spongy layer of mesophyll as well as some background expression in reproductive stages of the plant and can therefore be considered as epidermis preferential promoters. The permutated promoters and the 5deleted versions of the promoters show the same expression patterns as the original promoters they are derived from. The results are indicated in table 8.

    TABLE-US-00008 TABLE 8 Expression profiles of constitutive promoters and promoters conferring expression in the epidermis leaf section upper lower spongy palisade Construct Feature Name Specificity Events leaf epidermis epidermis mesophyll mesophyll root stem LJK291 p-Glyma11g14950_1939bp constitutive 17 ++ n.d. n.d. n.d. n.d. ++ +++ LJK296 p-Glyma14g06680_1056bp constitutive 15 +++ n.d. n.d. n.d. n.d. ++ ++ LJK303 p-Glyma02g47670_1753bp epidermis 8 ++ + +++ +++ + n.d. n.d. LJK304 p-Glyma14g02930_1688bp epidermis 4 ++ + +++ +++ + n.d. n.d. LJK305 p-Glyma17g27610_1889bp[ epidermis 5 + + ++ ++ + n.d. n.d. Stem silique seed silique Induction Construct section meristem petioles flower bud embryo seedcoat pocket end yes/no LJK291 +++ + + + + ++ +++ +++ +++ no LJK296 ++ ++ ++ ++ ++ +++ +++ ++ ++ no LJK303 n.d. n.d. n.d. n.d. n.d. + + + + no LJK304 n.d. n.d. n.d. n.d. n.d. ++ ++ ++ ++ no LJK305 n.d. n.d. n.d. n.d. n.d. + + + + no 0 no GUS staining; + minimal GUS staining; medium GUS staining; +++ strong GUS staining; n.d. no analysis

    Example 2

    Identification and Validation of Pathogen-Inducible Promoters from Soybean

    [0283] 2.1 Identification of Pathogen-Inducible Transcripts by AFLP

    [0284] AFLP bands from table 1 were selected for pathogen-inducible expression in epidermis or both mesophyll and epidermis.

    [0285] 2.2 Identification of the Genes Corresponding to AFLP Bands

    [0286] Expressed Sequence Tag (EST) sequences of AFLP bands were used as query for BLASTN searching against a soybean sequence database. The corresponding genes are listed in table 9

    [0287] 2.3 Identification of Pathogen-Inducible Transcripts by Microarray

    [0288] In addition to identification of ESTs by AFLP, a microarray experiment was performed in triplicate for samples 3 and 5-8 from table 1, which identified the following genes: Glyma01g33070.2; Glyma01g42660.1 (cp. Table 9).

    TABLE-US-00009 TABLE 9 Overview over corresponding genes for G. max promoters conferring pathogen-inducible expression Feature name SEQ ID # Glyma13g44640_gene 230 Glyma08g37270_gene 232 Glyma04g40860.1_gene 234 Glyma01g33070.2_gene 236 Glyma15g05820.1_gene 238 Glyma01g42660.1_gene 240 Glyma17g14320_gene 242 Glyma01g01510.1_gene 244

    [0289] 2.4 Confirmation of Allele-Specific Expression Pattern Using Quantitative Reverse Transcriptase-polymerase chain reaction (qRT-PCR)

    [0290] In order to confirm the native expression patterns of soybean genes in an allele-specific manner from both AFLP and microarray approaches, quantitative reverse transcription PCR (qRT-PCR) was performed using total RNA isolated from the same materials as were used for the AFLP expression profiling and the microarray experiment (cp. table 1).

    [0291] Primers for qRT-PCR were designed based on the sequences of the isolated EST fragments or on microarray data using the Vector NTI software package (Invitrogen, Carlsbad, CA, USA). Primers were designed to distinguish individual alleles of the candidate gene in the tetraploid soybean genome. Primers for qRT-PCR are listed in table 10. The tubulin gene served as a control for normalization purposes (cp. table 3).

    TABLE-US-00010 TABLE10 PrimersequencesforqRT-PCR SEQ Feature ID name Primer Sequence # Glyma13 Loy1405 GCCATGCCTCAGCTAACCGACAGATCA 132 g44640 Loy1407 ACAGCCACTGCAGCAACCTGATACAAATGC 133 Glyma08 Loy1335 GCTGGAGCTAGCGCTTATGCACGTCTC 134 g37270 Loy1337 CAGCTGCAACCAATCCACTGATGTG 135 Glyma04 Loy1306 AGTGGCTAGACCAGTTGAATTGCAACGA 136 g40860.1 Loy1307 CATGCAAGCGAGGTGTTTACATTTTGCT 137 Glyma01 Loy1456 AAATGGCTTTCGGAGTTTCCCTAGTGGCA 138 g33070.2 Loy1457 GAACTGAAGCAAGAACAGCATTCCCCACAC 139 Glyma15 Loy1382 TCACTATGCCCTCAAAACGGTGACG 140 g05820.1 Loy1383 GCTTGATCAGATTGCAGAATTCCACGA 141 Glyma01 Loy1443 CTCAGGCAGCGAACTTCAACATCACAAAT 142 g42660.1 Loy1444 CCACGATTCGCCAGGGTTAAGCCTT 143 Glyma17 Loy1330 AAAGAAGGTGGAATTGGAAGGGGC 144 g14320 Loy1331 TTAACGTGGGTGATGGTGAGTGGC 145 Glyma01 Loy1373 AACATTGTTTCAGGACATGCACACCG 146 g01510.1 Loy1375 TGAAGTGGGGGTATTGATCAAGAGCCT 147
    qRT-PCR was performed using QuantiTect Kit (Qiagen, Hilden, Germany) and SYBR Green qPCR Master Mix (Roche Diagnostics, Mannheim, Germany) in a Roche LightCycler (Roche Diagnostics, Mannheim, Germany). cDNA was synthesized using 800 ng of total RNA and 1 l reverse transcriptase in a 20 l volume. The cDNA was diluted with 60 l of RNAse free water to a final volume of 80 l. 4 l of diluted cDNA were used in a 10 l PCR reaction according to manufacturer's instruction. The thermocycling conditions were as follows: Denature at 95 C. for 2 minutes, and run 45 cycles at 95 C. for 10 seconds and 60 C. for 20 seconds and 72 C. for 20 seconds for amplification. After the final cycle of the amplification, the dissociation curve analysis was carried out to verify that the amplification occurred specifically and no primer dimer product was generated during the amplification process. The tubulin gene (primer sequences in table 2) was used as an endogenous reference gene to normalize the calculation using the Comparative Ct (Cycle of threshold) value method. The DeltaCt value was obtained by subtracting the Ct value of tubulin gene from the Ct value of the respective candidate gene, and the relative transcription quantity (expression level) of the candidate gene was expressed as 2.sup.-DeltaCt.

    [0292] 2.5 Identification of the Promoter Region

    [0293] For promoter identification purposes, the sequence upstream of the start codon of the identified genes was defined as the respective promoters. To characterize these promoter regions, 5RACE PCR analyses were performed using the primers listed in table 11.

    TABLE-US-00011 TABLE11 Primersequencesfor5 RACEPCR SEQ Feature ID name Primer Sequence # Glyma13 Loy1667 CAGGAATAGGAAGACTCCAACAAGAAGAGC 148 g44640 Glyma08 Loy1657 GGCATTGAAGAGAGGGCGCAGAGGCTTG 149 g37270 Glyma04 Loy1307 CATGCAAGCGAGGTGTTTACATTTTGCT 150 g40860.1 Glyma01 Loy1765 AAGCAAGAACAGCATTCCCCACAC 151 g33070.2 Glyma15 Loy1383 GCTTGATCAGATTGCAGAATTCCACGA 152 g05820.1 Glyma01 Loy1663 GCTTTTCGTGACGGCCATTGTAAATT 153 g42660.1 Glyma17 Loy1711 CAACAAAAACTGCAGAAAGTCCATCC 154 g14320 Glyma01 Loy1766 ATCCAATAAGCTGCAGCAACCATACCAC 155 g01510.1

    [0294] 2.6 Isolation of the Promoter Region by PCR Amplification

    [0295] The promoter regions of the respective genes were isolated via genomic PCR using the following sequence specific primers (table 12).

    [0296] Promoters putatively conferring pathogen-inducible expression amplified with these primer pairs are listed in table 13.

    [0297] In addition 5-deletions of the promoters are made by using different 5 primers in combination with the same 3 oligonucleotide primer. The resulting promoters are indicated by their respective length in base pairs (cp. table 13) and the corresponding primer pairs for PCR are listed in table 12.

    [0298] Promoters are bioinformatically analyzed with Matlnspector professional 8.0.4, Release August 2010 (Genomatix Software GmbH; Munich, Germany) for transcription factor binding sites. Regions free of core motifs are permutated and the resulting nucleic acid sequences are synthesized. The principles for generating permutated promoters that retain their respective tissue specificities are described in EP10193800.9 and U.S. 61/419,895. The resulting sequences are indicated by the original identifier of the corresponding gene followed by _perm (cp. table 13).

    TABLE-US-00012 TABLE12 PrimersequencesforPCRamplificationofpathogen-induciblepromoters SEQ ID Featurename Primer Sequence # Glyma13g44640_1047 Loy1700 TATATAGGTACCGGGATGTTTATTTAAGGCATGGTCA 156 bp Loy1501 TATATACCATGGTTAATTAACAAGGGAGTGGAA-TAACTT 157 Glyma08g37270_2043 Loy1712 TATATAGGTACCAGCTCATTACCTCAAATTTCCCTAC 158 bp Loy1713 TATATACCATGGTTCTCGCACACACAGAACAGAGA 159 Glyma04g40860.1_1917 Loy1527 TATATAGGTACCTTTCTTAGATAAACATACGTACGTT 160 bp Loy1528 TATATACCATGGTTAATTAATTCTAACAATACAA-AATCTGTATATG 161 Glyma01g33070.2_1921 Loy1525 TATATAGGTACCAATTGACAAGTTGATTGTTGTA 162 bp Loy1526 TATATACCATGGTTAATTAAGGAAATTAACTGAAC-CAATTACT 163 Glyma15g05820.1_1393 Loy1548 TATATAGGTACCAAATTATAGGTGAAAAAATTC 164 bp Loy1549 ATATATCCATGGTTTTGTGAGGAAATTAAAGG 165 Glyma01g42660.1_1948 Loy1518 TATATAGGTACCTGAGAGAGATGCCAATTTTA-CAAGCC 166 bp Loy1519 TATATACCATGGTGTAAATTAATTGCCGTTCGTTA-AAGA 167 Glyma17g14320_1607 Loy1779 TATATAGGTACCTAAATAATTAATTTATTTCAAACACT 168 bp Loy1482 TATATACCATGGTGTTGCGATATGAACGCAGAGA-GAGG 169 Glyma01g01510.1_2016 Loy1788 TATATAGGTACCGTTGAAGATTCACCACTTCTC 170 bp Loy1544 TATATACCATGGTTAAAGAATTGCAAAGAAGAAG-GAAG 171 Glyma13g44640_500 Loy1700.500 TATATAGGTACCATAATGTAGCGTTGAATGTACT 172 bp Loy1501 TATATACCATGGTTAATTAACAAGGGAGTGGAA-TAACTT 157 Glyma13g44640_700 Loy1700.700 TATATAGGTACCAGTCACATACTGTTAACAATTATTC 173 bp Loy1501 TATATACCATGGTTAATTAACAAGGGAGTGGAA-TAACTT 157 Glyma13g44640_1000 Loy1700.1000 TATATAGGTACCTAATTAATCACAAAGTGAAGAAC 174 bp Loy1501 TATATACCATGGTTAATTAACAAGGGAGTGGAA-TAACTT 157 Glyma08g37270_500 Loy1712.500 TATATAGGTACCTTATGATTAGTATAAATCTATTG 175 bp Loy1713 TATATACCATGGTTCTCGCACACACAGAACAGAGA 159 Glyma08g37270_1000 Loy1712.1000 TATATAGGTACCTAGATTTTTAAATATTTATAATAA-AATAATAAG 176 bp Loy1713 TATATACCATGGTTCTCGCACACACAGAACAGAGA 159 Glyma08g37270_1500 Loy1712.1500 TATATAGGTACCTCATTAATTGAGTTATTTATATAA-AATG 177 bp Loy1713 TATATACCATGGTTCTCGCACACACAGAACAGAGA 159 Glyma04g40860.1_500 Loy1527.500 TATATAGGTACCTAATATAAGCGGAACTATACGGT 178 bp Loy1528 TATATACCATGGTTAATTAATTCTAACAATACAA-AATCTGTATATG 161 Glyma04g40860.1_1000 Loy1527.1000 TATATAGGTACCGTTGATAAATAATTTTTTATGAATAA 179 bp Loy1528 TATATACCATGGTTAATTAATTCTAACAATACAA-AATCTGTATATG 161 Glyma04g40860.1_1500 Loy1527.1500 TATATAGGTACCGAAATATTTGATTCACAAGT 180 bp Loy1528 TATATACCATGGTTAATTAATTCTAACAATACAAAATCTGTATATG 161 Glyma01g33070.2_500 Loy1525.500 TATATAGGTACCATTGAATTCACTAATTTTATATTTTATAATTTG 181 bp Loy1526 TATATACCATGGTTAATTAAGGAAATTAACTGAACCAATTACT 163 Glyma01g33070.2_1000 Loy1525.1000 TATATAGGTACCCAACAGATTAAGATCTAGAATAAATAAAC 182 bp Loy1526 TATATACCATGGTTAATTAAGGAAATTAACTGAACCAATTACT 163 Glyma01g33070.2_1500 Loy1525.1500 TATATAGGTACCTACTTATGAATTAAGCTTAGTTCTTGCA 183 bp Loy1526 TATATACCATGGTTAATTAAGGAAATTAACTGAACCAATTACT 163 Glyma15g05820.1_500 Loy1548.500 TATATAGGTACCAATTTTTTTTTTCAGTATTATTTCTATCT 184 bp Loy1549 ATATATCCATGGTTTTGTGAGGAAATTAAAGG 165 Glyma15g05820.1_700 Loy1548.700 TATATAGGTACCTCATCACAATCGAAAAATTCCATC 185 bp Loy1549 ATATATCCATGGTTTTGTGAGGAAATTAAAGG 165 Glyma15g05820.1_1000 Loy1548.1000 TATATAGGTACCGCGCGCGCTCTCTTAGAACTTTTTTTG 186 bp Loy1549 ATATATCCATGGTTTTGTGAGGAAATTAAAGG 165 Glyma01g42660.1_500 Loy1518.500 TATATAGGTACCCATTTTCAACATTCAGAGTGGGT 187 bp Loy1519 TATATACCATGGTGTAAATTAATTGCCGTTCGTTAAAGA 167 Glyma01g42660.1_1000 Loy1518.1000 TATATAGGTACCTTTTTCACCCAATTAATTAGAGTATTTC 188 bp Loy1519 TATATACCATGGTGTAAATTAATTGCCGTTCGTTAAAGA 167 Glyma01g42660.1_1500 Loy1518.1500 TATATAGGTACCGTTTTGCTATTGACTTTTGTTTTATTTCGT 189 bp Loy1519 TATATACCATGGTGTAAATTAATTGCCGTTCGTTAAAGA 167 Glyma17g14320_500 Loy1779.500 TATATAGGTACCTTTTTTAATCTACTTTTTATTTGTTTAATC 190 bp Loy1482 TATATACCATGGTGTTGCGATATGAACGCAGAGAGAGG 169 Glyma17g14320_1000 Loy1779.1000 TATATAGGTACCTTTAATTTGGAATAATTTTTTTCTTCTC 191 bp Loy1482 TATATACCATGGTGTTGCGATATGAACGCAGAGAGAGG 169 Glyma17g14320_1500 Loy1779.1500 TATATAGGTACCTTAGAGGAAAAATTTTGTCATCCATAA 192 bp Loy1482 TATATACCATGGTGTTGCGATATGAACGCAGAGAGAGG 169 Glyma01g01510.1_500 Loy1788.500 TATATAGGTACCACATGGCAACATTTTTTTTTATCTCT 193 bp Loy1544 TATATACCATGGTTAAAGAATTGCAAAGAAGAAGGAAG 171 Glyma01g01510.1_1000 Loy1788.1000 TATATAGGTACCTATATATATATATATATAATAAACTATATCT 194 bp Loy1544 TATATACCATGGTTAAAGAATTGCAAAGAAGAAGGAAG 171 Glyma01g01510.1_1500 Loy1788.1500 TATATAGGTACCTACCTGTTCACTAGCTAGTTACAAAAATATATC 195 bp Loy1544 TATATACCATGGTTAAAGAATTGCAAAGAAGAAGGAAG 171

    TABLE-US-00013 TABLE 13 Overview over G. max promoters conferring pathogen-inducible expression Feature name SEQ ID # p-Glyma13g44640_1047bp 6 p-Glyma08g37270_2043bp 7 p-Glyma04g40860.1_1917bp 8 p-Glyma01g33070.2_1921bp 9 pGlyma15g05820.1_1393bp 10 p-Glyma01g42660.1_1948bp 11 p-Glyma17g14320_1607bp 12 p-Glyma01g01510.1_2016bp 13 p-Glyma13g44640_1047bp_perm 39 p-Glyma13g44640_500bp 40 p-Glyma13g44640_700bp 41 p-Glyma13g44640_1000bp 42 p-Glyma08g37270_2043bp_perm 43 p-Glyma08g37270_500bp 44 p-Glyma08g37270_1000bp 45 p-Glyma08g37270_1500bp 46 p-Glyma04g40860.1_1917bp_perm 47 p-Glyma04g40860.1_500bp 48 p-Glyma04g40860.1_1000bp 49 p-Glyma04g40860.1_1500bp 50 p-Glyma01g33070.2_1921bp_perm 51 p-Glyma01g33070.2_500bp 52 p-Glyma01g33070.2_1000bp 53 p-Glyma01g33070.2_1500bp 54 p-Glyma15g05820.1_1393bp_perm 55 p-Glyma15g05820.1_500bp 56 p-Glyma15g05820.1_700bp 57 p-Glyma15g05820.1_1000bp 58 p-Glyma01g42660.1_1948bp_perm 59 p-Glyma01g42660.1_500bp 60 p-Glyma01g42660.1_1000bp 61 p-Glyma01g42660.1_1500bp 62 p-Glyma17g14320_1607bp_perm 63 p-Glyma17g14320_500bp 64 p-Glyma17g14320_1000bp 65 p-Glyma17g14320_1500bp 66 p-Glyma01g01510.1_2016bp_perm 67 p-Glyma01g01510.1_500bp 68 p-Glyma01g01510.1_1000bp 69 p-Glyma01g01510.1_1500bp 70

    [0299] 2.7 Cloning of Promoter Elements into the Context of a GUS Reporter Gene Cassette

    [0300] To facilitate sub-cloning, promoter elements were modified by the addition of KpnI and Acc65I restriction enzyme sites at their 5 end and PacI and NcoI sites at their 3end. Using the Multisite Gateway System (Invitrogen, Carlsbad, Calif., USA), the promoter::reporter-gene cassettes were assembled into binary constructs for plant transformation. The respective Glycine max promoters (with the prefix p- denoting promoter) were used in the reporter gene construct, and beta-glucoronidase coding sequence (GUS) was utilized as reporter protein for subsequent histo-chemical analysis.

    [0301] An ENTR/A vector containing the beta-glucoronidase coding sequence followed by the t-nos nopalin synthase transcriptional terminator (Genbank V00087) was generated. Glycine max promoters were cloned using the restriction enzyme sites (see above) added by PCR amplification at either end. Positive pENTR/A clones underwent sequence analysis to ensure correctness.

    [0302] The pENTR/B and pENTR/C did not contain any additional elements. By performing a site-specific recombination (LR-reaction), the created pENTR/A, pENTR/B and pENTR/C were combined with the pSUN destination vector (pSUN derivative) according to the manufacturers (Invitrogen, Carlsbad, Calif., USA) Multisite Gateway manual. The reactions yielded binary vectors LJK306, LJK331, LJK334, LJK358, LJK360, LJK361, LJK363, LJK372 (cp. table 14) with the respective Glycine max promoter, the GUS coding sequence c-GUS and the t-nos terminator, with promoter molecules having the prefix p-, coding sequences having the prefix c-, and terminator molecules having the prefix t-.

    [0303] Table 14 shows an overview over reporter gene constructs with promoter elements putatively conferring pathogen-inducible expression.

    TABLE-US-00014 TABLE 14 Overview over G. max reporter gene constructs with promoters conferring pathogen-inducible expression Feature name SEQ ID # LJK306 258 LJK331 LJK334 LJK358 LJK360 259 LJK361 LJK363 LJK372

    [0304] 2.8 Generation of Transgenic Soybean Plants (Amended Protocol According to WO2005/121345; Olhoft et al., 2007).

    [0305] Soybean seed germination, propagation, A. rhizogenes and axillary meristem explant preparation, and inoculations were done as previously described (WO2005/121345; Olhoft et al., 2007) with the exception that the constructs LJK306, LJK331, LJK334, LJK358, LJK360, LJK361, LJK363, LJK372 (cp. example 2.7) each contained a mutated AHAS gene driven by the parsley ubiquitin promoter PcUbi4-2, mediating tolerance to imidazolinone herbicides for selection.

    [0306] 2.9 Promoter Evaluation in Transgenic Soybean

    [0307] Expression patterns and levels driven by the putatively pathogen-inducible promoters were measured using GUS histochemical analysis following a protocol known in the art (Jefferson 1987). Soybean transformation was conducted using an Agrobacterium-mediated transformation system.

    [0308] The rust fungus is a wild isolate from Brazil. The plants were inoculated with P. pachyrhizi.

    [0309] In order to obtain appropriate spore material for the inoculation, soy leaves which had been infected with rust 15-20 days ago, were taken 2-3 days before the inoculation and transferred to agar plates (1% agar in H.sub.2O). The leaves were placed with their upper side onto the agar, which allowed the fungus to grow through the tissue and to produce very young spores. For the inoculation solution, the spores were knocked off the leaves and were added to a Tween-H.sub.2 solution. The counting of spores was performed under a light microscope by means of a Thoma counting chamber. For the inoculation of the plants, the spore suspension was added into a compressed-air operated spray flask and applied uniformly onto the plants or the leaves until the leaf surface is well moisturized. For macroscopic assays a spore density of 1-510.sup.5 spores/ml was used. For microscopy, a density of >510.sup.5 spores / ml was used. The inoculated plants were placed for 24 hours in a darkened greenhouse chamber with an average of 22 C. and >90% of air humidity. The following cultivation was performed in a chamber with an average of 25 C. and 70% of air humidity for 48 hours.

    [0310] GUS expression for pathogen-inducible promoters putatively conferring expression in the epidermis or in mesophyll and epidermis was assayed in leaf surface views and sections based on visual inspection. All promoters showed inducibility by soybean rust, either preferentially in the epidermis or in both epidermis and mesophyll. The permutated promoters and the 5deleted versions of the promoters show the same expression patterns as the original promoters they are derived from.

    [0311] The results are indicated in table 15.

    TABLE-US-00015 TABLE 15 Expression profiles of pathogen-inducible promoters leaf section upper lower spongy palisade silique si- Induc- Con- epi- epi- meso- meso- em- seed- seed lique tion struct Feature name Specificity events leaf dermis dermis phyll phyll bryo coat pocket end yes/no LJK306 p-Glyma13g44640_1047bp epidermis 12 ++ + ++ ++ + + + + + y induced LJK331 p-Glyma08g37270_2043bp mesophyll + 12 ++ + ++ ++ ++ 0 0 0 0 y epidermis induced LJK334 p-Glyma04g40860.1_1917bp mesophyll + 12 +++ ++ ++ ++ ++ 0 0 0 0 y epidermis induced LJK358 p-Glyma01g33070.2_1921bp mesophyll + 17 + + + + + 0 0 0 0 y epidermis induced LJK360 p-Glyma15g05820.1_1393bp mesophyll + 16 +++ ++ ++ +++ +++ + + + + y epidermis induced LJK361 p-Glyma01g42660.1_1948bp mesophyll + 12 + 0 + + + 0 0 0 0 y epidermis induced LJK363 p-Glyma17g14320_1607bp mesophyll + 12 +++ ++ ++ ++ ++ 0 0 0 0 y epidermis induced LJK372 p-Glyma01g01510.1_2016bp mesophyll + 14 ++ 0 + ++ ++ 0 0 0 0 y epidermis induced 0 no GUS staining; + minimal GUS staining; medium GUS staining; +++ strong GUS staining; n.d. no analysis

    Example 3

    A. thaliana Promoters Putatively Conferring Expression in Green Tissue

    [0312] 3.1 Isolation of the Promoter Regions from of A. thaliana Putatively Conferring Expression in Green Tissue of Plants by PCR Amplification

    [0313] A. thaliana promoter elements putatively conferring expression in green tissue of plants were amplified by PCR using the primers listed in table 21. Preferentially the cloned region encompassed 1-2 kb upstream of the transcriptional start site or up to the stop codon of the previous open-reading frame. The corresponding genes are listed in table 22. The corresponding promoter sequences are listed in table 23.

    [0314] In addition 5-deletions of the promoters are made by using different 5 primers in combination with the same 3 oligonucleotide primer. The resulting promoters are indicated by their respective length in base pairs (cp. table 23) and the corresponding primer pairs for PCR are listed in table 21.

    [0315] Promoters are bioinformatically analyzed with Matlnspector professional 8.0.4, Release August 2010 (Genomatix Software GmbH; Munich, Germany) for transcription factor binding sites. Regions free of core motifs are permutated and the resulting nucleic acid sequences are synthesized. The principles for generating permutated promoters that retain their respective tissue specificities are described in EP10193800.9 and U.S. 61/419,895. The resulting sequences are indicated by the original identifier of the corresponding gene followed by _perm (cp. table 23).

    TABLE-US-00016 TABLE21 PrimersequencesforPCRamplificationA. thalianapromotersputativelyconferring expressioningreentissueofplants SEQ ID GeneID Primer Sequence # At1g30380_ Loy1116 TATATACCCGGGTACCATGCAGA 196 1970bp GGAT-CAAGAAGATTCTCC Loy1117 TATATACCATGGTTTCTTAGTTG 197 ATTCTA-CAAATCTTTTATTTTC At1g49750_ Loy1124 TATATACCCGGGTACCGTGAAAG 198 1922bp CAGT-GAAGCCGTGA Loy1125 TATATACCATGGTGAGTTGATGA- 199 GATTTTGTGGTGAGT At3g62410_ Loy1128 TATATACCCGGGTACCGACATCTG 200 332bp TCTT-GACTTTTCCTTAAACAGTG TGTG Loy1133 TATATACCATGGCTTTGGATGGAG 201 AAGG-TACACGGCAG At1g61520_ Loy1120 TATATACCCGGGTACCGACGAACT- 202 1970bp CATGCTACTACTACAG Loy1121 TATATAACATGTT- 203 GAGCTCTTTCTCTGTTCCT- CAACTCTTTTCT At1g65490_ Loy1130 TATATACCCGGGTACCGAAACGAA 204 1953bp ACT-GAACCGCCTCCTTT Loy1131 TATATAACATGTT- 205 GAGCTCTTCGTTCTTCGTTGCGTT TTTGGTCATCG At1g30380_ Loy TATATACCCGGGTACCTGACTAAT- 206 500bp 1116.500 TAAGCTCGAAAGTGTTCTTCA Loy1117 TATATACCATGGTTTCTTAGTTGAT 197 TCTA-CAAATCTTTTATTTTC At1g30380_ Loy TATATACCCGGGTACCGGCTTTTG 207 1000bp 1116.1000 CGT-TAGGTTATATAACTCCA Loy1117 TATATACCATGGTTTCTTAGTTGAT 197 TCTA-CAAATCTTTTATTTTC At1g30380_ Loy TATATACCCGGGTACCTGTAGCAA- 208 1500bp 1116.1500 GAATTGATCGATATGCTTTG Loy1117 TATATACCATGGTTTCTTAGTTGAT 197 TCTA-CAAATCTTTTATTTTC At1g49750_ Loy TATATACCCGGGTACCGGACTCAAT 209 500bp 1124.500 AAA-CAACTCAAAGATGA Loy1125 TATATACCATGGTGAGTTGATGA- 199 GATTTTGTGGTGAGT At1g49750_ Loy TATATACCCGGGTACCTCACT- 210 1000bp 1124.1000 GATGTTCTCTAATGAACGTTC Loy1125 TATATACCATGGTGAGTTGATGA- 199 GATTTTGTGGTGAGT At1g49750_ Loy TATATACCCGGGTACCAAGTGAAA 211 1500bp 1124.1500 ATA-TAATATTCATACCTCTTG Loy1125 TATATACCATGGTGAGTTGATGA- 199 GATTTTGTGGTGAGT At3g62410_ Loy TATATACCCGGGTACCACGCACAC 212 100bp 1128.100 TTCA-TATATCTTG Loy1133 TATATACCATGGCTTTGGATGGAG 201 AAGG-TACACGGCAG At3g62410_ Loy TATATACCCGGGTACCAAATTTTC 213 200bp 1128.200 AA-CATCGTACTGCTTCATAAAC Loy1133 TATATACCATGGCTTTGGATGGAG 201 AAGG-TACACGGCAG At1g61520_ Loy TATATACCCGGGTACCGTTGAATT 214 500bp 1120.500 GTTA-TATCAAAATTTGA Loy1121 TATATAACATGTT- 203 GAGCTCTTTCTCTGTTCCT- CAACTCTTTTCT At1g61520_ Loy TATATACCCGGGTACCTTTGGCTG 215 1000bp 1120.1000 AAT-CAGCTTCAGCAGA Loy1121 TATATAACATGTT- 203 GAGCTCTTTCTCTGTTCCT- CAACTCTTTTCT At1g61520_ Loy TATATACCCGGGTAC- 216 1500bp 1120.1500 CAATGGTTCTGTTGCTCCTAATG TAGA Loy1121 TATATAACATGTT- 203 GAGCTCTTTCTCTGTTCCT- CAACTCTTTTCT At1g65490_ Loy TATATACCCGGGTACCTTTTTG 217 500bp 1130.500 TAAA-CAATTTTTTGTGATATATAT Loy1131 TATATAACATGTT- 205 GAGCTCTTCGTTCTTCGTTGCGTT TTTGGTCATCG At1g65490_ Loy TATATACCCGGGTACCCAGAATTTT 218 1000bp 1130.1000 AAA-GACACACAAAGCA Loy1131 TATATAACATGTT- 205 GAGCTCTTCGTTCTTCGTTGCGTTT TTGGTCATCG At1g65490_ Loy TATATACCCGGGTACCACCGCTTAA- 219 1500bp 1130.1500 TATCGTATGATTAG Loy1131 TATATAACATGTT- 205 GAGCTCTTCGTTCTTCGTTGCGTTTT TGGTCATCG

    TABLE-US-00017 TABLE 22 Overview over corresponding genes for A. thaliana promoters conferring expression in green tissue of plants Feature name SEQ ID # At1g30380_gene 246 At1g49750_gene 248 At3g62410_gene 250 At1g61520_gene 252 At1g65490_gene 254

    TABLE-US-00018 TABLE 23 Overview over A. thaliana promoters conferring expression in green tissue of plants Feature name SEQ ID # p-mes-At1g30380_1970bp 14 p-mes-At1g49750_1922bp 15 p-mes-At3g62410_332bp 16 p-photo-At1g61520_1970bp 17 p-mes-At1g65490_1953bp 18 p-mes-At1g30380_1970bp_perm 71 p-mes-At1g30380_500bp 72 p-mes-At1g30380_1000bp 73 p-mes-At1g30380_1500bp 74 p-mes-At1g49750_1922bp_perm 75 p-mes-At1g49750_500bp 76 p-mes-At1g49750_1000bp 77 p-mes-At1g49750_1500bp 78 p-mes-At3g62410_332bp_perm 79 p-mes-At3g62410_100bp 80 p-mes-At3g62410_200bp 81 p-photo-At1g61520_1970bp_perm 82 p-photo-At1g61520_500bp 83 p-photo-At1g61520_1000bp 84 p-photo-At1g61520_1500bp 85 p-mes-At1g65490_1953bp_perm 86 p-mes-At1g65490_500bp 87 p-mes-At1g65490_1000bp 88 p-mes-At1g65490_1500bp 89

    [0316] 3.2 Cloning of Promoter Elements into the Context of a GFP Reporter Gene Cassette

    [0317] To facilitate sub-cloning the following restriction sites were added to the ends of the promoter element (table 24):

    TABLE-US-00019 TABLE 24 Restriction enzyme sites for cloning A. thaliana promoters putatively conferring expression in green tissue of plants Promoter 5end 3end p-mes-At1g30380_1970bp KpnI NcoI p-mes-At1g49750_1922bp KpnI NcoI p-mes-At3g62410_332bp KpnI NcoI p-photo-At1g61520_1970bp KpnI PciI p-mes-At1g65490_1953bp KpnI PciI
    Using the Multisite Gateway System (Invitrogen, Carlsbad, Calif., USA), the promoter::reporter-gene cassettes were assembled into binary constructs for plant transformation. The respective Arabidopsis thaliana promoters (with the prefix p- denoting promoter) were used in the reporter gene construct, and Green Fluorescent Protein coding sequence (c-AcGFP1; Clontech Laboratories Inc., Mountain View, Calif., USA) was utilized as reporter protein for subsequent fluorescence microscopic analysis.

    [0318] An ENTR/A vector containing the Green Fluorescent protein coding sequence followed by the t-OCS agrobacterium terminator (Genbank DQ005456) was generated. Arabidopsis thaliana promoters were cloned using the restriction enzyme sites (see above) added by PCR amplification at either end. Positive pENTR/A clones underwent sequence analysis to ensure correctness.

    [0319] The pENTR/B and pENTR/C did not contain any additional elements. By performing a site-specific recombination (LR-reaction), the created pENTR/A, pENTR/B and pENTR/C were combined with the pSUN destination vector (pSUN derivative) according to the manufacturers (Invitrogen, Carlsbad, Calif., USA) Multisite Gateway manual. The reactions yielded binary vectors LJK186, LJK189, LJK190, LJK192 and LJK193 (cp. table 25); with the respective Arabidopsis thaliana promoter, the Green Fluorescent Protein coding sequence c-AcGFP1 and the t-OCS terminator, with promoter molecules having the prefix p-, coding sequences having the prefix c-, and terminator molecules having the prefix t-.

    TABLE-US-00020 TABLE 25 GFP reporter gene constructs for A. thaliana promoters putatively conferring expression in green tissue of plants Vector promoter element used SEQ ID # LJK186 p-mes-At1g30380_1970bp 260 LJK189 p-mes-At1g49750_1922bp LJK190 p-mes-At3g62410_332bp LJK192 p-photo-At1g61520_1970bp LJK193 p-mes-At1g65490_1953bp

    [0320] 3.3 Test of the A. thaliana Promoters Putatively Conferring Expression in Green Tissue of Plants in Transgenic Soybean

    [0321] Expression patterns and levels driven by the promoters putatively conferring expression in green tissue of plants were measured using GFP analysis. Analysis was performed with the Leica DM5000B microscope and the DFC490 camera with the following settings: Saturation 1.01; Gain 1; Exposure 2.1s; GFP-filter: L5; Excitation 480/40nm; Dichromatic mirror: 505nm; Suppression filter: 527/30 nm.

    [0322] The three promoter elements in vectors LJK 189, LJK 190 and LJK 192 showed medium to strong expression based on visual analysis exclusively in the mesophyll layer of leaves and can thus be rated mesophyll-specific. Promoter elements corresponding to LJK186 and LJK193 conferred preferential expression in the mesophyll layer of leaves as well as weak expression in the green tissue of the shoot and can thus be rated mesophyll-preferential. The permutated promoters and the 5deleted versions of the promoters show the same expression patterns as the original promoters they are derived from. The results are listed in table 26.

    TABLE-US-00021 TABLE 26 Expression profiles of A. thaliana promoters conferring expression in the green tissue of plants expression level Putative Leaf Other leaf shoot (chlorophyll shoot (non- construct specificity promoter mesophyll tissues containing layer) green) root flower LJK186 mesophyll p-mes-At1g30380_1970bp +++ 0 + 0 0 0 LJK189 mesophyll p-mes-At1g49750_1922bp ++ 0 0 0 0 0 LJK190 mesophyll p-mes-At3g62410_332bp ++ 0 0 0 0 0 LJK192 mesophyll p-photo-At1g61520_1970bp +++ 0 0 0 0 0 LJK193 mesophyll p-mes-At1g65490_1953bp +++ 0 + 0 0 0 0 no expression; + minimal expression; medium expression; +++ strong expression; n.d. no analysis

    TABLE-US-00022 TABLE 27 Overview of Promoters of the Invention and corresponding homologs and fragments thereof Original promoter derivative promoters Seq ID Seq ID NO feature name NO feature name 1 p-Glyma11g14950_1939bp 19 p-Glyma11g14950_1939bp_perm 20 p-Glyma11g14950_500bp 21 p-Glyma11g14950_1000bp 22 p-Glyma11g14950_1500bp 2 p-Glyma14g06680_1056bp 23 p-Glyma14g06680_1056bp_perm 24 p-Glyma14g06680_500bp 25 p-Glyma14g06680_700bp 26 p-Glyma14g06680_1000bp 3 p-Glyma02g47670_1753bp 27 p-Glyma02g47670_1753bp_perm 28 p-Glyma02g47670_500bp 29 p-Glyma02g47670_1000bp 30 p-Glyma02g47670_1500bp 4 p-Glyma14g02930_1688bp 31 p-Glyma14g02930_1688bp_perm 32 p-Glyma14g02930_500bp 33 p-Glyma14g02930_1000bp 34 p-Glyma14g02930_1500bp 5 p-Glyma17g27610_1889bp 35 p-Glyma17g27610 1889bp_perm 36 p-Glyma17g27610_500bp 37 p-Glyma17g27610_1000bp 38 p-Glyma17g27610_1500bp 6 p-Glyma13g44640_1047bp 39 p-Glyma13g44640_1047bp_perm 40 p-Glyma13g44640_500bp 41 p-Glyma13g44640_700bp 42 p-Glyma13g44640_1000bp 7 p-Glyma08g37270_2043bp 43 p-Glyma08g37270_2043bp_perm 44 p-Glyma08g37270_500bp 45 p-Glyma08g37270_1000bp 46 p-Glyma08g37270_1500bp 8 p-Glyma04g40860.1_1917bp 47 p-Glyma04g40860.1_1917bp_perm 48 p-Glyma04g40860.1_500bp 49 p-Glyma04g40860.1_1000bp 50 p-Glyma04g40860.1_1500bp 9 p-Glyma01g33070.2_1921bp 51 p-Glyma01g33070.2_1921bp_perm 52 p-Glyma01g33070.2_500bp 53 p-Glyma01g33070.2_1000bp 54 p-Glyma01g33070.2 1500bp 10 pGlyma15905820.1_1393bp 55 p-Glyma15g05820.1_1393bp_perm 56 p-Glyma15g05820.1_500bp 57 p-Glyma15g05820.1_700bp 58 p-Glyma15g05820.1_1000bp 11 p-Glyma01g42660.1_1948bp 59 p-Glyma01g42660.1_1948bp_perm 60 p-Glyma01g42660.1_500bp 61 p-Glyma01g42660.1_1000bp 62 p-Glyma01g42660.1_1500bp 12 p-Glyma17g14320_1607bp 63 p-Glyma17g14320_1607bp_perm 64 p-Glyma17g14320_500bp 65 p-Glyma17g14320_1000bp 66 p-Glyma17g14320_1500bp 13 p-Glyma01g01510.1_2016bp 67 p-Glyma01g01510.1_2016bp_perm 68 p-Glyma01g01510.1_500bp 69 p-Glyma01g01510.1_1000bp 70 p-Glyma01g01510.1_1500bp 14 p-mes-At1g30380 1970bp 71 p-mes-At1g30380_1970bp_perm 72 p-mes-At1g30380_500bp 73 p-mes-At1g30380_1000bp 74 p-mes-At1g30380_1500bp 15 p-mes-At1g49750_1922bp 75 p-mes-At1g49750_1922bp_perm 76 p-mes-At1g49750_500bp 77 p-mes-At1g49750_1000bp 78 p-mes-At1g49750_1500bp 16 p-mes-At3g62410_332bp 79 p-mes-At3g62410_332bp_perm 80 p-mes-At3g62410_100bp 81 p-mes-At3g62410_200bp 17 p-photo-At1g61520_1970bp 82 p-photo-At1g61520_1970bp_perm 83 p-photo-At1g61520_500bp 84 p-photo-At1g61520_1000bp 85 p-photo-At1g61520_1500bp 18 p-mes-At1965490_1953bp 86 p-mes-At1g65490_1953bp_perm 87 p-mes-At1g65490_500bp 88 p-mes-At1g65490_1000bp 89 p-mes-At1g65490_1500bp