METHODS OF ISOLATION OF CELL FREE COMPLEXES AND CIRCULATING CELL-FREE NUCLEIC ACID
20170183712 ยท 2017-06-29
Inventors
Cpc classification
C12Q1/6806
CHEMISTRY; METALLURGY
C12Q1/6806
CHEMISTRY; METALLURGY
International classification
Abstract
The present disclosure provides methods for the isolation of a cell free complex comprising a circulating, cell free nucleic acid component. The nucleic acid component of the complex is, at least in part, associated with cellular components, such as polypeptides and lipids. The methods of the present disclosure provide for the isolation of circulating cell free nucleic acids that are longer and less fragmented as compared to prior art methods. Furthermore, the circulating, cell free nucleic acid represent biologically relevant nucleic acid targets as the methods described selectively remove non-functional nucleic acids from the isolated material. The nucleic acid component of the isolated complexes reflects a wide spectrum of genomic representation enabling successful detection of mutations, polymorphisms, methylation status and other genomic markers for use in diagnostic and therapeutic applications. Furthermore, the additional cellular components in the cell free complexes isolated provide information regarding the proteomic and lipidomic status of the subject
Claims
1. (canceled)
2. (canceled)
3. (canceled)
4. (canceled)
5. (canceled)
6. (canceled)
7. (canceled)
8. (canceled)
9. A method for analysis of a cell free complex comprising circulating, cell-free nucleic acid and associated cellular components, the method comprising isolating the cell free complex by subjecting a sample containing the cell free complex to centrifugation, optionally further processing the cell free complex and analyzing the nucleic acid, associated cellular components or a combination of the foregoing to determine a characteristic of the nucleic acid, associated cellular components or a combination of the foregoing.
10. The method of claim 9, wherein the method further comprises isolating at least one cell-free nucleic acid from the complex.
11. The method of claim 10, wherein the cell-free nucleic acid is associated with a cellular component.
12. The method of claim 12, wherein the cellular component is such as a polypeptide or a lipid.
13. The method of claim 9, wherein the cell-free nucleic acid is DNA or RNA.
14. The method of claim 9, wherein the centrifugation is density gradient ultracentrifugation.
15. (canceled)
16. The method of claim 15, wherein the density gradient has a buoyant density from 1.3 to 1.45 g/cm.sup.3.
17. The method of claim 9, wherein the characteristic is a nucleic acid characteristic, a polypeptide characteristic or a lipid characteristic.
18. The method of claim 9, wherein the nucleic acid characteristic is presence of a mutation, presence of a polymorphism, methylation state, concentration of a nucleic acid, level of expression of a nucleic acid, a nucleic acid profile or a combination of the foregoing.
19. The method of claim 9, wherein the polypeptide characteristic is presence of a mutation, the presence of post-translational modification, presence of insertions or deletions, concentration of a polypeptide, the expression level of a polypeptide, a polypeptide profile or a combination of the foregoing.
20. The method of claim 9, wherein the lipid characteristic is presence of altered forms of a lipid, the presence of a lipid modification, the concentration, the expression level of a lipid, the lipid profile or a combination of the foregoing.
21. A method for determining a biologically relevant profile of a subject, the method comprising isolating a cell free complex comprising circulating, cell-free nucleic acid and associated cellular components by subjecting a sample containing the cell free complex to centrifugation, optionally further processing the cell free complex and identifying a plurality of nucleic acids or associated cellular components to produce the profile.
22. The method of claim 22 further comprising comparing the profile of the subject to a corresponding profile indicative of a disease state and determining the subject is suffering from or at risk for a particular disease or condition if the subject profile contains one or more characteristics of the corresponding profile indicative of a disease state
23. The method of claim 22, wherein a plurality of nucleic acids are identified to create a genetic profile.
24. The method of claim 22, wherein the associated cellular components are a polypeptide or a lipid.
25. The method of claim 24, wherein a plurality of polypeptides are identified to create a polypeptide profile.
26. The method of claim 24, wherein a plurality of lipids are identified to create a lipid profile.
27. The method of claim 21, wherein the method further comprises isolating at least one cell-free nucleic acid from the complex.
28. The method of claim 27, wherein the cell-free nucleic acid is associated with a cellular component.
29. The method of claim 28, wherein the cellular component is a polypeptide or a lipid.
30. The method of claim 22, wherein the cell-free nucleic acid is DNA or RNA.
31. The method of claim 22, wherein the centrifugation is density gradient ultracentrifugation.
32. (canceled)
33. The method of claim 32, wherein the density gradient has a buoyant density from 1.3 to 1.45 g/cm.sup.3.
34. The method of claim 22, wherein the corresponding profile is a disease fingerprint.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0005]
[0006]
[0007]
[0008]
[0009]
[0010]
[0011]
[0012]
SUMMARY OF THE DISCLOSURE
[0013] In a first aspect, the present disclosure provides a method for the isolation of a cell free complex comprising circulating, cell-free nucleic acid and associated cellular components, the method comprising subjecting a sample containing the cell free complex to centrifugation and isolating the cell free complex. Such method may further comprise isolating at least one cell-free nucleic acid from the complex, the nucleic acid optionally associated with a cellular component, such as, but not limited to, a polypeptide and/or a lipid. Such method may further comprise isolating at least cellular component from the complex. In one instance, the cellular component is a lipid or a protein. Such nucleic acid may be DNA and/or RNA.
[0014] In a second aspect, the present disclosure provides a method for the isolation of a cell free complex comprising circulating, cell-free nucleic acid and associated cellular components, the method comprising subjecting a sample containing the cell free complex to density gradient centrifugation and isolating the cell free complex from the gradient. Such method may further comprise isolating at least one cell-free nucleic acid from the complex, the nucleic acid optionally associated with a cellular component, such as, but not limited to, a polypeptide and/or a lipid. Such method may further comprise isolating at least cellular component from the complex. In one instance, the cellular component is a lipid or a protein. Such nucleic acid may be DNA and/or RNA.
[0015] In a third aspect, the present disclosure provides a method for the isolation of a cell free complex comprising circulating, cell-free nucleic acid and associated cellular components, the method comprising subjecting a sample containing the cell free complex to density gradient centrifugation with a buoyant density of 1.3 to 1.45 g/cm.sup.3 and isolating the cell free complex from the gradient. Such method may further comprise isolating at least one cell-free nucleic acid from the complex, the nucleic acid optionally associated with a cellular component, such as, but not limited to, a polypeptide and/or a lipid. Such method may further comprise isolating at least cellular component from the complex. In one instance, the cellular component is a lipid or a protein. Such nucleic acid may be DNA and/or RNA.
[0016] In a fourth aspect, the present disclosure provides a method for the isolation of a cell free complex comprising circulating, cell-free nucleic acid and associated cellular components, the method comprising subjecting a sample containing the cell free complex to cesium-chloride (CsCl) density gradient centrifugation with a buoyant density of 1.3 to 1.45 g/cm.sup.3 and isolating the cell free complex from the gradient. Such method may further comprise isolating at least one cell-free nucleic acid from the complex, the nucleic acid optionally associated with a cellular component, such as, but not limited to, a polypeptide and/or a lipid. Such method may further comprise isolating at least cellular component from the complex. In one instance, the cellular component is a lipid or a protein. Such nucleic acid may be DNA and/or RNA.
[0017] In a fifth aspect, the present disclosure provides a method for the detection of a cell free complex comprising circulating, cell-free nucleic acid and associated cellular components, the method comprising isolating the cell free complex as set forth in any one of the first through fourth aspects, optionally further processing the cell free complex and associated cellular components and detecting the cell-free nucleic acid, the associated cellular component or a combination of the foregoing. Such cellular components include, but are not limited to, polypeptides and lipids. Such nucleic acid may be DNA and/or RNA.
[0018] In a sixth aspect, the present disclosure provides a method for analysis of a cell free complex comprising circulating, cell-free nucleic acid and associated cellular components, the method comprising isolating the cell free complex as set forth in any one of the first through fourth aspects, optionally further processing the cell free complex and analyzing the cell-free nucleic acid, associated cellular components or a combination of the foregoing to determine a characteristic of the nucleic acid, associated cellular components or a combination of the foregoing. Such cellular components include, but are not limited to, polypeptides and lipids. Such nucleic acid may be DNA and/or RNA.
[0019] In a seventh aspect, the present disclosure provides a method for analysis of a cell free complex comprising circulating, cell-free nucleic acid and associated cellular components, the method comprising isolating the cell free complex as set forth in any one of the first through fourth aspects, optionally further processing the cell free complex and analyzing the cell-fee nucleic acid to determine a nucleic acid characteristic. The method may further comprise analyzing a cellular component. Such additional cellular components include, but are not limited to, polypeptides and lipids. Such nucleic acid may be DNA and/or RNA.
[0020] In an eighth aspect, the present disclosure provides a method for analysis of a cell free complex comprising circulating, cell-free nucleic acid and associated cellular components, the method comprising isolating the cell free complex as set forth in any one of the first through fourth aspects, optionally further processing the cell free complex and analyzing the associated polypeptide component to determine a polypeptide characteristic. The method may further comprise analyzing a nucleic acid component and/or an additional cellular component. Such additional cellular components include, but are not limited to, lipids. Such nucleic acid may be DNA and/or RNA.
[0021] In a ninth aspect, the present disclosure provides a method for analysis of a cell free complex comprising circulating, cell-free nucleic acid and associated cellular components, the method comprising isolating cell free complex as set forth in any one of the first through fourth aspects, optionally further processing the cell free complex and analyzing the associated lipid component to determine a lipid characteristic. The method may further comprise analyzing a nucleic acid component and/or an additional cellular component. Such cellular additional components include, but are not limited to, polypeptides. Such nucleic acid may be DNA and/or RNA.
[0022] In tenth aspect, the present disclosure provides a method for analysis of a cell free complex comprising circulating, cell-free nucleic acid and associated cellular components, the method comprising isolating the cell free complex as set forth in any one of the first through fourth aspects, optionally further processing the cell free complex and analyzing the cell-free nucleic acid to determine the presence of a mutation, the presence of a polymorphism, the methylation state, the concentration of a nucleic acid, the level of expression of a nucleic acid or a combination of the foregoing. The method may further comprise analyzing a cellular component. Such cellular components include, but are not limited to, polypeptides and lipids. Such nucleic acid may be DNA and/or RNA.
[0023] In an eleventh aspect, the present disclosure provides a method for determining a biologically relevant profile of a subject, the method comprising isolating a cell free complex comprising circulating, cell-free nucleic acid and associated cellular components as set forth in any one of the first through fourth aspects, optionally further processing the cell free complex and identifying a plurality of nucleic acids or associated cellular components to produce the profile. Such method may further comprise comparing the subject profile to a corresponding profile indicative of a disease state and determining the subject is suffering from or at risk for a particular disease or condition if the subject profile contains one or more characteristics of the corresponding profile indicative of a disease state. The profile may be a nucleic acid profile, a polypeptide profile, a lipid profile or a combination of the foregoing. Such nucleic acid may be DNA and/or RNA.
[0024] In a twelfth aspect, the present disclosure provides a method for determining a biologically relevant nucleic acid profile of a subject, the method comprising isolating a cell free complex comprising circulating, cell-free nucleic acid and associated cellular components as set forth in any one of the first through fourth aspects, optionally further processing the cell free complex and identifying a plurality of cell-free nucleic acids to produce the nucleic acid profile. Such method may further comprise comparing the subject profile to a corresponding nucleic acid profile indicative of a disease state and determining the subject is suffering from or at risk for a particular disease or condition if the subject profile contains one or more characteristics of the corresponding nucleic acid profile indicative of a disease state.
[0025] In a thirteenth aspect, the present disclosure provides a method for determining a biologically relevant polypeptide profile of a subject, the method comprising isolating a cell free complex comprising circulating, cell-free nucleic acid and associated cellular components as set forth in any one of the first through fourth aspects, optionally further processing the cell free complex and identifying a plurality of polypeptides in the associated cellular components to produce a polypeptide profile. Such method may further comprise comparing the subject profile to a corresponding polypeptide profile indicative of a disease state and determining the subject is suffering from or at risk for a particular disease or condition if the subject profile contains one or more characteristics of the corresponding polypeptide profile indicative of a disease state.
[0026] In a fourteenth aspect, the present disclosure provides a method for determining a biologically relevant lipid profile of a subject, the method comprising isolating a cell free complex comprising circulating, cell-free nucleic acid and associated cellular components as set forth in any one of the first through fourth aspects, optionally further processing the cell free complex and identifying a plurality of lipids in the isolated associated cellular components to produce a lipid profile. Such method may further comprise comparing the subject profile to a corresponding lipid profile indicative of a disease state and determining the subject is suffering from or at risk for a particular disease or condition if the subject profile contains one or more characteristics of the corresponding lipid profile indicative of a disease state.
[0027] In a fifteenth aspect, the present disclosure provides a method for determining if a subject is suffering from or at risk for a disease, the method comprising isolating a cell free complex comprising circulating, cell-free nucleic acid and associated cellular components as set forth in any one of the first through fourth aspects, optionally further processing the cell free complex and determining the presence of a characteristic associated with the disease in the components of the complex. Such characteristic may be the presence of nucleic acid characteristic, a proteomic characteristic or a lipid characteristic.
[0028] In a sixteenth aspect, the present disclosure provides a method for determining if a subject is suffering from or at risk for a disease, the method comprising isolating a cell free complex comprising circulating, cell-free nucleic acid and associated cellular components as set forth in any one of the first through fourth aspects, optionally further processing the cell free complex and determining the presence of a nucleic acid characteristic in the cell-free nucleic acid, wherein the subject is judged to be suffering from or at risk for a disease if the presence of any of the characteristic is associated with the disease. Such nucleic acid characteristic includes, but is not limited to, a mutation, a polymorphism, methylation state, concentration of a nucleic acid, level of expression of a nucleic acid, the profile of the nucleic acids or a combination of the foregoing.
[0029] In a seventeenth aspect, the present disclosure provides a method for determining if a subject is suffering from or at risk for a disease, the method comprising isolating a cell free complex comprising circulating, cell-free nucleic acid and associated cellular components as set forth in any one of the first through fourth aspects, optionally further processing the cell free complex and determining the presence of a polypeptide and/or lipid characteristic in the cellular component, wherein the subject is judged to be suffering from or at risk for a disease if the presence of any of the characteristic is associated with the disease. Such polypeptide characteristic includes, but is not limited to, a mutation, the presence of post-translational modifications, the presence of insertions or deletions, the concentration, level of expression of a nucleic acid, the profile of the polypeptides or a combination of the foregoing. Such lipid characteristic includes, but is not limited to, the presence of altered forms, the presence of modifications, the concentration, the expression level, the profile of lipids or a combination of the foregoing.
[0030] In an eighteenth aspect, the present disclosure provides a method for determining if a subject is suffering from or at risk for a disease, the method comprising generating a nucleic acid, polypeptide and/or lipid profile from a subject as set forth in the twelfth to fourteenth aspects and comparing the generated profile to a corresponding disease fingerprint and determining the subject is suffering from or at risk for a particular disease or condition if the subject profile contains one or more characteristics of the disease fingerprint.
[0031] In an nineteenth aspect, the present disclosure provides a method for the isolation of circulating, cell-free nucleic acid, the method comprising subjecting a sample containing the circulating, cell-free nucleic acid to centrifugation and isolating the circulating, cell-free nucleic acid. In one embodiment of this aspect, the circulating, cell-free nucleic acid is present in a cell free complex and such method may further comprise isolating at least one cell-free nucleic acid from the complex. In another embodiment, the circulating, cell-free nucleic acid is associated with a cellular component, such as, but not limited to, a polypeptide and/or a lipid, and such method may further comprise isolating at least one cell-free nucleic acid from the cellular components. Such method may further comprise isolating at least one cellular component from the circulating, cell-free nucleic acid and analyzing the cellular component. In one instance, the cellular component is a lipid or a protein. Such nucleic acid may be DNA and/or RNA.
[0032] In a twentieth aspect, the present disclosure provides a method for the isolation of circulating, cell-free nucleic acid, the method comprising subjecting a sample containing the to density gradient centrifugation and isolating the circulating, cell-free nucleic acid from the gradient. In one embodiment of this aspect, the circulating, cell-free nucleic acid is present in a cell free complex and such method may further comprise isolating at least one cell-free nucleic acid from the complex. In another embodiment, the circulating, cell-free nucleic acid is associated with a cellular component, such as, but not limited to, a polypeptide and/or a lipid, and such method may further comprise isolating at least one cell-free nucleic acid from the cellular components. Such method may further comprise isolating at least one cellular component from the circulating, cell-free nucleic acid and analyzing the cellular component. In one instance, the cellular component is a lipid or a protein. Such nucleic acid may be DNA and/or RNA.
[0033] In a twenty-first aspect, the present disclosure provides a method for the isolation of circulating, cell-free nucleic acid, the method comprising subjecting a sample containing the circulating, cell free nucleic acid to density gradient centrifugation with a buoyant density of 1.3 to 1.45 g/cm.sup.3 and isolating the circulating, cell free nucleic acid from the gradient. In one embodiment of this aspect, the circulating, cell-free nucleic acid is present in a cell free complex and such method may further comprise isolating at least one cell-free nucleic acid from the complex. In another embodiment, the circulating, cell-free nucleic acid is associated with a cellular component, such as, but not limited to, a polypeptide and/or a lipid, and such method may further comprise isolating at least one cell-free nucleic acid from the cellular components. Such method may further comprise isolating at least one cellular component from the circulating, cell-free nucleic acid and analyzing the cellular component. In one instance, the cellular component is a lipid or a protein. Such nucleic acid may be DNA and/or RNA.
[0034] In a twenty-second aspect, the present disclosure provides a method for the isolation of the circulating, cell-free nucleic acid, the method comprising subjecting a sample containing the cell free complex to cesium-chloride (CsCl) density gradient centrifugation with a buoyant density of 1.3 to 1.45 g/cm.sup.3 and isolating the circulating, cell-free nucleic acid from the gradient. In one embodiment of this aspect, the circulating, cell-free nucleic acid is present in a cell free complex and such method may further comprise isolating at least one cell-free nucleic acid from the complex. In another embodiment, the circulating, cell-free nucleic acid is associated with a cellular component, such as, but not limited to, a polypeptide and/or a lipid, and such method may further comprise isolating at least one cell-free nucleic acid from the cellular components. Such method may further comprise isolating at least one cellular component from the circulating, cell-free nucleic acid and analyzing the cellular component. In one instance, the cellular component is a lipid or a protein. Such nucleic acid may be DNA and/or RNA.
[0035] In a twenty-third aspect, the present disclosure provides a method for the detection of circulating, cell-free nucleic acid, the method comprising isolating the circulating, cell-free nucleic acid as set forth in any one of the nineteenth to twenty-second aspects, optionally further processing the circulating, cell-free nucleic acid and detecting the circulating, cell-free nucleic acid. In one embodiment of this aspect, the circulating, cell-free nucleic acid is present in a cell free complex and such method may further comprise isolating at least one cell-free nucleic acid from the complex. In another embodiment, the circulating, cell-free nucleic acid is associated with a cellular component, such as, but not limited to, a polypeptide and/or a lipid, and such method may further comprise isolating at least one cell-free nucleic acid from the cellular components. Such method may further comprise isolating at least one cellular component from the circulating, cell-free nucleic acid and detecting the cellular component. In one instance, the cellular component is a lipid or a protein. Such nucleic acid may be DNA and/or RNA.
[0036] In a twenty-fourth aspect, the present disclosure provides a method for analysis of circulating, cell-free nucleic acid, the method comprising isolating the circulating, cell-free nucleic acid as set forth in any one of the nineteenth to twenty-second aspects, optionally further processing the circulating, cell-free nucleic acid and analyzing the circulating, cell-free nucleic acid to determine a characteristic of the nucleic acid. Such nucleic acid characteristic includes, but is not limited to, a mutation, a polymorphism, methylation state, concentration of a nucleic acid, level of expression of a nucleic acid, the profile of the nucleic acids or a combination of the foregoing. In one embodiment of this aspect, the circulating, cell-free nucleic acid is present in a cell free complex and such method may further comprise isolating at least one cell-free nucleic acid from the complex. In another embodiment, the circulating, cell-free nucleic acid is associated with a cellular component, such as, but not limited to, a polypeptide and/or a lipid, and such method may further comprise isolating at least one cell-free nucleic acid from the cellular components. Such method may further comprise isolating at least one cellular component from the circulating, cell-free nucleic acid and analyzing the cellular component. In one instance, the cellular component is a lipid or a protein. Such nucleic acid may be DNA and/or RNA.
[0037] In an twenty-fifth aspect, the present disclosure provides a method for analysis of circulating, cell-free nucleic acid, the method isolating the circulating, cell-free nucleic acid as set forth in any one of the nineteenth to twenty-second aspects, optionally further processing the circulating, cell-free nucleic acid and analyzing the circulating, cell-free nucleic acid to determine the presence of a mutation, the presence of a polymorphism, the methylation state, the concentration of a nucleic acid, the level of expression of a nucleic acid or a combination of the foregoing. In one embodiment of this aspect, the circulating, cell-free nucleic acid is present in a cell free complex and such method may further comprise isolating at least one cell-free nucleic acid from the complex. In another embodiment, the circulating, cell-free nucleic acid is associated with a cellular component, such as, but not limited to, a polypeptide and/or a lipid, and such method may further comprise isolating at least one cell-free nucleic acid from the cellular components. Such method may further comprise isolating at least one cellular component from the circulating, cell-free nucleic acid and analyzing the cellular component. In one instance, the cellular component is a lipid or a protein. Such nucleic acid may be DNA and/or RNA.
[0038] In a twenty-sixth aspect, the present disclosure provides a method for determining a biologically relevant nucleic acid profile of a subject, the method comprising isolating circulating, cell-free nucleic acid as set forth in any one of the nineteenth to twenty-second aspects, optionally further processing the circulating, cell-free nucleic acid and identifying a plurality of nucleic acids to produce the nucleic acid profile. Such method may further comprise comparing the subject profile to a corresponding nucleic acid profile indicative of a disease state and determining the subject is suffering from or at risk for a particular disease or condition if the subject profile contains one or more characteristics of the corresponding nucleic acid profile indicative of a disease state. In one embodiment of this aspect, the circulating, cell-free nucleic acid is present in a cell free complex and such method may further comprise isolating at least one cell-free nucleic acid from the complex. In another embodiment, the circulating, cell-free nucleic acid is associated with a cellular component, such as, but not limited to, a polypeptide and/or a lipid, and such method may further comprise isolating at least one cell-free nucleic acid from the cellular components. Such method may further comprise isolating at least one cellular component from the circulating, cell-free nucleic acid and analyzing the cellular component. In one instance, the cellular component is a lipid or a protein. Such nucleic acid may be DNA and/or RNA.
[0039] In a twenty-seventh aspect, the present disclosure provides a method for determining if a subject is suffering from or at risk for a disease, the method comprising isolating circulating, cell-free nucleic acid as set forth in any one of the nineteenth to twenty-second aspects, optionally further processing the cell-free nucleic acid and determining the presence of a nucleic acid characteristic, wherein the subject is judged to be suffering from or at risk for a disease if the presence of any of the characteristic is associated with the disease. Such nucleic acid characteristic includes, but is not limited to, a mutation, a polymorphism, methylation state, concentration of a nucleic acid, level of expression of a nucleic acid, the profile of the nucleic acids or a combination of the foregoing. In one embodiment of this aspect, the circulating, cell-free nucleic acid is present in a cell free complex and such method may further comprise isolating at least one cell-free nucleic acid from the complex. In another embodiment, the circulating, cell-free nucleic acid is associated with a cellular component, such as, but not limited to, a polypeptide and/or a lipid, and such method may further comprise isolating at least one cell-free nucleic acid from the cellular components. Such method may further comprise isolating at least one cellular component from the circulating, cell-free nucleic acid and analyzing the cellular component. In one instance, the cellular component is a lipid or a protein. Such nucleic acid may be DNA and/or RNA.
[0040] In a twenty-eight aspect, the present disclosure provides a method for determining if a subject is suffering from or at risk for a disease, the method comprising generating a nucleic acid profile from a subject as set forth in the twenty-sixth aspect and comparing the generated profile to a corresponding disease fingerprint and determining the subject is suffering from or at risk for a particular disease if the subject profile contains one or more characteristics of the disease fingerprint. In one embodiment of this aspect, the circulating, cell-free nucleic acid is present in a cell free complex and such method may further comprise isolating at least one cell-free nucleic acid from the complex. In another embodiment, the circulating, cell-free nucleic acid is associated with a cellular component, such as, but not limited to, a polypeptide and/or a lipid, and such method may further comprise isolating at least one cell-free nucleic acid from the cellular components. Such method may further comprise isolating at least one cellular component from the circulating, cell-free nucleic acid and analyzing the cellular component. In one instance, the cellular component is a lipid or a protein. Such nucleic acid may be DNA and/or RNA
DETAILED DESCRIPTION
Definitions
[0041] As used herein the term cell free complex refers to a complex comprising a cell free nucleic acid component and at least one cellular component. Such cellular components include but are not limited to, polypeptides, proteins and lipids. The cell free complex may contain a nucleic acid component, a polypeptide component and a lipid component or a nucleic acid component and one of a polypeptide component and a lipid component. For clarity, while the term cell free complex requires the presence of a nucleic acid component and at least one cellular component, the term also includes nucleic acids that are not associated with a cellular component provided that at least a portion of the nucleic acids in the cell free complex are associated with at least one additional cellular component.
[0042] As used herein, the term genomic characteristic or nucleic acid characteristic refers to a characteristic of the nucleic acid contained in the cell free complex. Any characteristic that is used to provide information regarding the nucleic acid may be used. Such characteristics include, but are not limited to, the presence of mutations, the presence of polymorphisms, the methylation pattern, the concentration, the expression level and the profile of nucleic acids contained in the cell free complex or associated with the cell-free nucleic acid. The foregoing characteristics may be determined by comparing to a wild-type counterpart of the nucleic acid.
[0043] As used herein, the term proteomic characteristic or polypeptide characteristic refers to a characteristic of the polypeptides contained in the cell free complex. Any characteristic that is used to provide information regarding the polypeptide may be used. Such characteristics include, but are not limited to, the presence of mutations, the presence of post-translational modifications (for example, phosphorylation), the presence of insertions or deletions, the concentration, the expression level and the profile of polypeptides contained in the cell free complex or associated with the cell-free nucleic acid. The foregoing characteristics may be determined by comparing to a wild-type counterpart of the polypeptide.
[0044] As used herein, the term lipidomic characteristic or lipid characteristic refers to a characteristic of the lipids contained in the cell free complex. Any characteristic that is used to provide information regarding the lipid may be used. Such characteristics include, but are not limited to, the presence of altered forms (for example, carbon chain length), the presence of modifications (for example, changes in numbers of double and/or triple bonds), the concentration, the expression level and the profile of lipids contained in the cell free complex or associated with the cell-free nucleic acid. The foregoing characteristics may be determined by comparing to a wild-type counterpart of the lipid.
[0045] As used herein, the term isolated means the partial purification or increase in concentration of a component of a sample, such as the cell free complex or a component thereof. Such isolation does not require absolute purification. For example, when isolated is used in reference to a nucleic acid, the nucleic acid may comprise 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, 95% or more of 99% or more of the material (by weight) in the mixture isolated.
[0046] As used herein, the term subject may be any mammal and in one embodiment is a human. The human subject may be any age. The human subject may also be an unborn child.
Introduction
[0047] As discussed above, the present methods for isolating circulating, cell free nucleic acid suffer from several disadvantages. The present disclosure overcomes these disadvantages by providing novel centrifugation methods for the isolation of circulating, cell free nucleic acid and/or a cell free complex comprising a circulating, cell free nucleic acid component along with associated cellular components. When a cell free complex is isolated, the nucleic acid component of the complex, in one embodiment, is associated with cellular components, such as, but not limited to, polypeptides and lipids. In certain embodiment, the circulating cell free nucleic acid is associated with both polypeptides and lipids. Such association may be direct or indirect. However, the nucleic acid is not required to be physically associated with the cellular components. For example, the nucleic acid component may simply be located in the same density gradient as the cellular components. Furthermore, in certain embodiment, the circulating cell free nucleic acid may not be associated with a cellular component. The methods of the present disclosure provide for the isolation of circulating cell free nucleic acids that are longer and less fragmented as compared to prior art methods. In one embodiment, such a result is due, at least in part, to protection from degradation of the nucleic acid component by the associated cellular components. Furthermore, the circulating, cell free nucleic acid represent biologically relevant nucleic acid targets as the methods described selectively remove non-functional nucleic acids from the isolated material. The nucleic acid component of the isolated complexes reflects a wide spectrum of genomic representation enabling successful detection of mutations, polymorphisms, methylation status and other genomic markers for use in diagnostic and therapeutic applications. Furthermore, the additional cellular components in the cell free complexes isolated provide information regarding the proteomic and lipidomic status of the subject. Such markers are also useful in diagnostic and therapeutic applications. The resulting isolated cell free complex therefore provides a rich source of information regarding the genomic, proteomic and lipidomic status of a subject.
[0048] In principle, such centrifugation approaches requires no prior information about the cell free complexes, including the identity or composition of the nucleic acid, protein and lipid components, and is very sensitive since little starting material is needed. Most importantly, taking into account the fact that the vast majority of human genome doesn't code for proteins (over 98%), the selective enrichment provided by the methods of the present disclosure are superior to the methods of the prior art which rely on blind extraction methods that can lose up to 80% of circulating, cell free nucleic acids during extraction.
[0049] While not wishing to be bound by any particular theory, certain regions of nucleic acid (for example, enhancers, transcribed exons, or active promoters) are associated with cellular components during normal function. As a result, such nucleic acids have a density that is intermediate between free nucleic acid and protein. Therefore, density gradient centrifugation methods may be used to preferentially isolated cell free complexes that contain a nucleic acid component that is associated with additional cellular components.
Methods of Isolating Cell Free Complexes and Components Therein
[0050] The methods of the present disclosure provide for the isolation of cell free complexes. Such cell free complexes comprise a cell free nucleic acid and at least one cellular component. Such cellular components include but are not limited to, polypeptides, proteins and lipids. The circulating, cell-free nucleic acids and cell free complexes isolated provide a biologically relevant, information rich source of information regarding the subject.
[0051] In one embodiment, the present disclosure provides a method for the isolation of a cell free complex comprising circulating, cell-free nucleic acid and associated cellular components, the method comprising subjecting a sample containing the cell free complex to centrifugation and isolating the cell free complex. Such method may further comprise isolating at least one cell-free nucleic acid from the complex, the nucleic acid optionally associated with a cellular component, such as, but not limited to, a polypeptide and/or a lipid.
[0052] In one embodiment, the present disclosure provides a method for the isolation of a cell free complex circulating, cell-free nucleic acid and associated cellular components, the method comprising subjecting a sample containing the cell free complex to density gradient centrifugation and isolating the cell free complex from the gradient. Such method may further comprise isolating at least one cell-free nucleic acid from the complex, the nucleic acid optionally associated with a cellular component, such as, but not limited to, a polypeptide and/or a lipid. Such method may further comprise isolating at least cellular component from the complex.
[0053] In one embodiment, the present disclosure provides a method for the isolation of a cell free complex comprising circulating, cell-free nucleic acid and associated cellular components, the method comprising subjecting a sample containing the cell free complex to density gradient centrifugation with a buoyant density of 1.3 to 1.45 g/cm.sup.3 and isolating the cell free complex from the gradient. Such method may further comprise isolating at least one cell-free nucleic acid from the complex, the nucleic acid optionally associated with a cellular component, such as, but not limited to, a polypeptide and/or a lipid. Such method may further comprise isolating at least cellular component from the complex.
[0054] In one embodiment, the present disclosure provides a method for the isolation of a cell free complex comprising circulating, cell-free nucleic acid and associated cellular components, the method comprising subjecting a sample containing the cell free complex to cesium-chloride (CsCl) density gradient centrifugation with a buoyant density of 1.3 to 1.45 g/cm.sup.3 and isolating the cell free complex from the gradient. Such method may further comprise isolating at least one cell-free nucleic acid from the complex, the nucleic acid optionally associated with a cellular component, such as, but not limited to, a polypeptide and/or a lipid. Such method may further comprise isolating at least cellular component from the complex.
[0055] In a particular embodiment of the foregoing, the density gradient is formed from CsCl. In a further particular embodiment, the CsCl density gradient has a density of between 1.30 and 1.45 g/cm.sup.3, 1.35 to 1.40 g/cm.sup.3, 1.35 to 1.45 g/cm.sup.3, 1.38 to 1.43 g/cm.sup.3 or 1.39 to 1.42 g/cm.sup.3. In a further particular embodiment, the nucleic acid is DNA, RNA or a combination of both DNA and RNA. Any form of known form of nucleic acid is included in the definition of nucleic acid.
[0056] In a particular embodiment, the length of the nucleic acid fragment isolated in the cell free complexes is over 500, over 750, over 1000, over 2000 or over 50000 base pairs. In another embodiment, the lent hog the nucleic acid fragments in the cell free complex is between 500 and 5000 base pairs, 1000 to 10,000 base pairs, 1000 to 5000 base pairs, or 10,000 to 20,000 base pairs.
[0057] In a particular embodiment of the foregoing, the nucleic acid is DNA, RNA or a combination of the foregoing. In a further particular embodiment, the nucleic acid is DNA. In a further particular embodiment, the nucleic acid is RNA.
[0058] In a particular embodiment of the foregoing, the associated cellular component is a lipid, a protein, a polypeptide or a combination of the foregoing. In a further particular embodiment, the cellular component is a lipid. In a further particular embodiment, the cellular component is a protein. In a further particular embodiment, the cellular component is a polypeptide.
[0059] In a particular embodiment of the foregoing, the cell free complex may be subject to additional processing steps, for example, to further isolate the cell-free nucleic acid and/or the cellular components from the cell free complex. Any means known in the art to accomplish such ends is included in the scope of the present disclosure.
Methods of Isolating Circulating, Cell-Free Nucleic Acid
[0060] The methods of the present disclosure provide for the isolation of circulating, cell-free nucleic acids. Such nucleic acid may be DNA and/or RNA. The circulating, cell-free nucleic acids provide a biologically relevant, information rich source of information regarding the subject.
[0061] In one embodiment, the present disclosure provides a method for the isolation of a circulating, cell-free nucleic acid comprising subjecting a sample containing the circulating, cell-free nucleic acid to centrifugation and isolating the circulating, cell-free nucleic acid.
[0062] In another embodiment, the present disclosure provides a method for the isolation of a circulating, cell-free nucleic acid comprising subjecting a sample containing the circulating, cell-free nucleic acid to density gradient centrifugation and isolating the circulating, cell-free nucleic acid from the gradient.
[0063] In another embodiment, the present disclosure provides a method for the isolation of a circulating, cell-free nucleic acid comprising subjecting a sample containing the circulating, cell free nucleic acid to density gradient centrifugation with a buoyant density of 1.3 to 1.45 g/cm.sup.3 and isolating the circulating, cell free nucleic acid from the gradient.
[0064] In another embodiment, the present disclosure provides a method for the isolation of a circulating, cell-free nucleic acid comprising subjecting a sample containing the cell free complex to cesium-chloride (CsCl) density gradient centrifugation with a buoyant density of 1.3 to 1.45 g/cm.sup.3 and isolating the circulating, cell-free nucleic acid from the gradient.
[0065] In a particular embodiment of the foregoing, the circulating, cell-free nucleic acid may be present in a cell free complex and such method may further comprise isolating at least one cell-free nucleic acid from the complex. In a further particular embodiment of the foregoing, the circulating, cell-free nucleic acid is associated with a cellular component, such as, but not limited to, a polypeptide and/or a lipid, and such method may further comprise isolating at least one cell-free nucleic acid from the cellular components. Such method may further comprise isolating at least one cellular component from the circulating, cell-free nucleic acid. In one instance, the cellular component is a lipid or a protein.
[0066] In a particular embodiment, the length of the nucleic acid fragment isolated in the cell free complexes is over 500, over 750, over 1000, over 2000 or over 50000 base pairs. In another embodiment, the lent hog the nucleic acid fragments in the cell free complex is between 500 and 5000 base pairs, 1000 to 10,000 base pairs, 1000 to 5000 base pairs, or 10,000 to 20,000 base pairs.
[0067] In a particular embodiment of the foregoing, the nucleic acid is DNA, RNA or a combination of the foregoing. In a further particular embodiment, the nucleic acid is DNA. In a further particular embodiment, the nucleic acid is RNA.
[0068] In a particular embodiment of the foregoing, the associated cellular component is a lipid, a protein, a polypeptide or a combination of the foregoing. In a further particular embodiment, the cellular component is a lipid. In a further particular embodiment, the cellular component is a protein. In a further particular embodiment, the cellular component is a polypeptide.
[0069] In a particular embodiment of the foregoing, the circulating cell free nucleic acid may be subject to additional processing steps, for example, to further isolate the cell-free nucleic acid from a cell free complex or associated cellular components. Any means known in the art to accomplish such ends is included in the scope of the present disclosure.
Methods of Detection and Analysis of Cell Free Complexes
[0070] The present disclosure also provides methods for the detection and analysis of the circulating, cell-free nucleic acid and the components of the cell free complex isolated as described herein.
[0071] In one embodiment, the present disclosure provides a method for the detection of a cell free complex comprising circulating, cell-free nucleic acid and associated cellular components, the method comprising isolating the cell free complex as set forth in any one of the first through fourth aspects, optionally further processing the cell free complex and associated cellular components and detecting the cell-free nucleic acid, the associated cellular component or a combination of the foregoing.
[0072] In one embodiment, the present disclosure provides a method for analysis of a cell free complex comprising circulating, cell-free nucleic acid and associated cellular components, the method comprising isolating the cell free complex as set forth in any of the methods described herein, optionally further processing the cell free complex and analyzing the cell-free nucleic acid, associated cellular components or a combination of the foregoing to determine a characteristic of the nucleic acid, associated cellular components or a combination of the foregoing.
[0073] In one embodiment, the present disclosure provides a method for analysis of a cell free complex comprising circulating, cell-free nucleic acid and associated cellular components, the method comprising isolating the cell free complex as set forth in any of the methods described herein, optionally further processing the cell free complex and analyzing the cell-fee nucleic acid to determine a nucleic acid characteristic. The method may further comprise analyzing a cellular component.
[0074] In one embodiment, the present disclosure provides a method for analysis of a cell free complex comprising circulating, cell-free nucleic acid and associated cellular components, the method comprising isolating the cell free complex as set forth in any of the methods described herein, optionally further processing the cell free complex and analyzing the associated polypeptide component to determine a polypeptide characteristic. The method may further comprise analyzing a nucleic acid component and/or an additional cellular component.
[0075] In one embodiment, the present disclosure provides a method for analysis of a cell free complex comprising circulating, cell-free nucleic acid and associated cellular components, the method comprising isolating cell free complex as set forth in any of the methods described herein, optionally further processing the cell free complex and analyzing the associated lipid component to determine a lipid characteristic. The method may further comprise analyzing a nucleic acid component and/or an additional cellular component.
[0076] In one embodiment, the present disclosure provides a method for analysis of a cell free complex comprising circulating, cell-free nucleic acid and associated cellular components, the method comprising isolating the cell free complex as set forth in any of the methods described herein, optionally further processing the cell free complex and analyzing the cell-free nucleic acid to determine the presence of a mutation, the presence of a polymorphism, the methylation state, the concentration of a nucleic acid, the level of expression of a nucleic acid, the nucleic acid profile or a combination of the foregoing. The method may further comprise analyzing a cellular component.
[0077] In one embodiment, the present disclosure provides a method for analysis of a cell free complex comprising circulating, cell-free nucleic acid and associated cellular components, the method comprising isolating the cell free complex as set forth in any of the methods described herein, optionally further processing the cell free complex and analyzing the polypeptide component to determine the presence of a mutation, the presence of a post-translational modification, the presence of insertions or deletions, the concentration, level of expression of a nucleic acid, the profile of the polypeptides or a combination of the foregoing. The method may further comprise analyzing an additional cellular component or a nucleic acid.
[0078] In one embodiment, the present disclosure provides a method for analysis of a cell free complex comprising circulating, cell-free nucleic acid and associated cellular components, the method comprising isolating the cell free complex as set forth in any of the methods described herein, optionally further processing the cell free complex and analyzing the lipid component to determine the presence of altered forms, the presence of modifications, the concentration, the expression level, the profile of lipids or a combination of the foregoing.
[0079] In a particular embodiment of the foregoing, the nucleic acid is DNA, RNA or a combination of the foregoing. In a further particular embodiment, the nucleic acid is DNA. In a further particular embodiment, the nucleic acid is RNA.
[0080] In a particular embodiment, the length of the nucleic acid fragment isolated in the cell free complexes is over 500, over 750, over 1000, over 2000 or over 50000 base pairs. In another embodiment, the lent hog the nucleic acid fragments in the cell free complex is between 500 and 5000 base pairs, 1000 to 10,000 base pairs, 1000 to 5000 base pairs, or 10,000 to 20,000 base pairs.
[0081] In a particular embodiment of the foregoing, the associated cellular component is a lipid, a protein, a polypeptide or a combination of the foregoing. In a further particular embodiment, the cellular component is a lipid. In a further particular embodiment, the cellular component is a protein. In a further particular embodiment, the cellular component is a polypeptide.
[0082] In a particular embodiment of the foregoing, the circulating cell free nucleic acid may be subject to additional processing steps, for example, to further isolate the cell-free nucleic acid from a cell free complex or associated cellular components. Any means known in the art to accomplish such ends is included in the scope of the present disclosure.
Methods of Detection and Analysis of Circulating Cell-Free Nucleic Acid
[0083] The present disclosure also provides methods for the detection and analysis of circulating, cell-free nucleic acid.
[0084] In one embodiment, the present disclosure provides a method for analysis of circulating, cell-free nucleic acid, the method comprising isolating the circulating, cell-free nucleic acid as set forth in any of the methods described herein, optionally further processing the circulating, cell-free nucleic acid and analyzing the circulating, cell-free nucleic acid to determine a characteristic of the nucleic acid. Such nucleic acid characteristic includes, but is not limited to, a mutation, a polymorphism, methylation state, concentration of a nucleic acid, level of expression of a nucleic acid, the profile of the nucleic acids or a combination of the foregoing.
[0085] In one embodiment, the present disclosure provides a method for analysis of circulating, cell-free nucleic acid, the method comprising isolating the circulating, cell-free nucleic acid as set forth in any of the methods described herein, optionally further processing the circulating, cell-free nucleic acid and analyzing the circulating, cell-free nucleic acid to determine the presence of a mutation, the presence of a polymorphism, the methylation state, the concentration of a nucleic acid, the level of expression of a nucleic acid or a combination of the foregoing
[0086] In a particular embodiment of the foregoing, the circulating, cell-free nucleic acid may be present in a cell free complex and such method may further comprise isolating at least one cell-free nucleic acid from the complex. In a further particular embodiment of the foregoing, the circulating, cell-free nucleic acid is associated with a cellular component, such as, but not limited to, a polypeptide and/or a lipid, and such method may further comprise isolating at least one cell-free nucleic acid from the cellular components. Such method may further comprise isolating at least one cellular component from the circulating, cell-free nucleic acid and analyzing the at least one cellular component. In one instance, the cellular component is a lipid or a protein.
[0087] In a particular embodiment, the length of the nucleic acid fragment isolated in the cell free complexes is over 500, over 750, over 1000, over 2000 or over 50000 base pairs. In another embodiment, the lent hog the nucleic acid fragments in the cell free complex is between 500 and 5000 base pairs, 1000 to 10,000 base pairs, 1000 to 5000 base pairs, or 10,000 to 20,000 base pairs.
[0088] In a particular embodiment of the foregoing, the nucleic acid is DNA, RNA or a combination of the foregoing. In a further particular embodiment, the nucleic acid is DNA. In a further particular embodiment, the nucleic acid is RNA.
[0089] In a particular embodiment of the foregoing, the associated cellular component is a lipid, a protein, a polypeptide or a combination of the foregoing. In a further particular embodiment, the cellular component is a lipid. In a further particular embodiment, the cellular component is a protein. In a further particular embodiment, the cellular component is a polypeptide.
[0090] In a particular embodiment of the foregoing, the circulating cell free nucleic acid may be subject to additional processing steps, for example, to further isolate the cell-free nucleic acid from a cell free complex or associated cellular components. Any means known in the art to accomplish such ends is included in the scope of the present disclosure.
Biologic Profiles
[0091] The present disclosure also allows the generation of biologically relevant profiles of the cell-free nucleic acid, polypeptides and/or lipids isolated as described herein. In one embodiment, the profile comprises one or more nucleic acid, polypeptide or lipid characteristics. In another embodiment, the profile comprises one or more nucleic acids, polypeptides or lipids isolated as described herein. Such biological profiles may be used for various purposes, including but not limited to, monitoring the health of a subject over time and for use in methods of diagnosis or treatment.
[0092] In one embodiment, the present disclosure provides a method for determining a biologically relevant nucleic acid, polypeptide or lipid profile of a subject, the method comprising isolating a cell free complex comprising circulating cell free nucleic acid and associated cellular components, optionally further processing the complex and identifying one or more nucleic acids, polypeptides and/or lipids present in the complex. Such method may further comprise comparing the subject profile to a corresponding profile indicative of a disease state and determining the subject is suffering from or at risk for a particular disease or condition if the subject profile contains one or more characteristics of the corresponding profile indicative of a disease state. Such corresponding profile may be a disease fingerprint as described herein.
[0093] In one embodiment, the present disclosure provides a method for determining a biologically relevant nucleic acid, polypeptide or lipid profile of a subject, the method comprising isolating a cell free complex comprising circulating cell free nucleic acid and associated cellular components, optionally further processing the complex and identifying one or more nucleic acid, polypeptide or lipid characteristics of the nucleic acids, polypeptides and/or lipids present in the complex. Such method may further comprise comparing the subject profile to a corresponding profile indicative of a disease state and determining the subject is suffering from or at risk for a particular disease or condition if the subject profile contains one or more characteristics of the corresponding profile indicative of a disease state. Such corresponding profile may be a disease fingerprint as described herein.
[0094] In one embodiment, the present disclosure provides a method for determining a biologically relevant nucleic acid profile of a subject, the method comprising isolating a cell free complex comprising circulating, cell-free nucleic acid and associated cellular components as set forth in any one the methods described herein, optionally further processing the cell free complex and identifying a plurality of cell-free nucleic acids or one or more nucleic acid characteristics to produce the nucleic acid profile. Such method may further comprise comparing the subject profile to a corresponding nucleic acid profile indicative of a disease state and determining the subject is suffering from or at risk for a particular disease or condition if the subject profile contains one or more characteristics of the corresponding nucleic acid profile indicative of a disease state. Such corresponding profile may be a disease fingerprint as described herein.
[0095] In one embodiment, the present disclosure provides a method for determining a biologically relevant polypeptide profile of a subject, the method comprising isolating a cell free complex comprising circulating, cell-free nucleic acid and associated cellular components as set forth in any one the methods described herein, optionally further processing the cell free complex and identifying a plurality of polypeptides or one or more polypeptide characteristics to produce the polypeptide profile. Such method may further comprise comparing the subject profile to a corresponding polypeptide profile indicative of a disease state and determining the subject is suffering from or at risk for a particular disease or condition if the subject profile contains one or more characteristics of the corresponding polypeptide profile indicative of a disease state. Such corresponding profile may be a disease fingerprint as described herein.
[0096] In one embodiment, the present disclosure provides a method for determining a biologically relevant lipid profile of a subject, the method comprising isolating a cell free complex comprising circulating, cell-free nucleic acid and associated cellular components as set forth in any one the methods described herein, optionally further processing the cell free complex and identifying a of lipids or one or more lipid characteristics to produce the lipid profile. Such method may further comprise comparing the subject profile to a corresponding lipid profile indicative of a disease state and determining the subject is suffering from or at risk for a particular disease or condition if the subject profile contains one or more characteristics of the corresponding lipid profile indicative of a disease state. Such corresponding profile may be a disease fingerprint as described herein.
[0097] In one embodiment, the present disclosure provides a method for determining a biologically relevant nucleic acid profile of a subject, the method comprising isolating circulating, cell-free nucleic acid as set forth in any one of the nineteenth to twenty-second aspects, optionally further processing the circulating, cell-free nucleic acid and identifying a plurality of nucleic acids to produce the nucleic acid profile. Such method may further comprise comparing the subject profile to a corresponding nucleic acid profile indicative of a disease state and determining the subject is suffering from or at risk for a particular disease or condition if the subject profile contains one or more characteristics of the corresponding nucleic acid profile indicative of a disease state. In one embodiment of this aspect, the circulating, cell-free nucleic acid is present in a cell free complex and such method may further comprise isolating at least one cell-free nucleic acid from the complex. In another embodiment, the circulating, cell-free nucleic acid is associated with a cellular component, such as, but not limited to, a polypeptide and/or a lipid, and such method may further comprise isolating at least one cell-free nucleic acid from the cellular components. Such method may further comprise isolating at least one cellular component from the circulating, cell-free nucleic acid and analyzing the cellular component. In one instance, the cellular component is a lipid or a protein. Such nucleic acid may be DNA and/or RNA. Such corresponding profile may be a disease fingerprint as described herein.
[0098] In another embodiment, the present disclosure provides for a method of determining a disease fingerprint of a particular disease or condition, the method comprising isolating a cell free complex comprising circulating cell free nucleic acid from a subject known to have a particular disease or condition (or known/deemed to be healthy or not suffering from the disease or condition), optionally further processing the cell free complex, generating a nucleic acid, polypeptide or lipid profile of the disease or condition, generating a corresponding nucleic acid, polypeptide or lipid profile from a subject that is not suffering from a particular disease or condition, and comparing the disease and control profiles to identify nucleic acid, polypeptide and/or lipid characteristics in the disease profile that are absent in the control profile or that are present in the control profile, but absent in the disease profile. Such characteristics may be referred to as a disease fingerprint and compared to the corresponding profiles generated from subjects according to the methods of the present disclosure
Methods of Diagnosis
[0099] Through the use of the isolated cell free complexes of the present disclosure, it can be determined if a subject is suffering from or at risk for a disease or condition. The disease or condition may be any disease or condition known in the art, such as for example, cancer, heart disease, or diseases and conditions associated with genetic or protein abnormalities.
[0100] In one embodiment, the present disclosure provides a method for determining if a subject is suffering from or at risk for a disease, the method comprising isolating a cell free complex comprising circulating, cell-free nucleic acid and associated cellular components or circulating cell-free nucleic acid as set forth in any one of the methods described herein, optionally further processing the cell free complex and determining the presence of a characteristic associated with the disease in the components of the complex. Such characteristic may be the presence of nucleic acid characteristic, a proteomic characteristic or a lipid characteristic.
[0101] In another embodiment, the present disclosure provides a method for determining if a subject is suffering from or at risk for a disease, the method comprising isolating a cell free complex comprising circulating, cell-free nucleic acid and associated cellular components or circulating cell-free nucleic acid as set forth in any one of the methods described herein, optionally further processing the cell free complex and determining the presence of a nucleic acid characteristic in the cell-free nucleic acid. In one embodiment the subject is judged to be suffering from or at risk for a disease if the presence of any of the characteristic is associated with the disease. Such nucleic acid characteristic includes, but is not limited to, a mutation, a polymorphism, methylation state, concentration of a nucleic acid, level of expression of a nucleic acid, the profile of the nucleic acids or a combination of the foregoing.
[0102] In another embodiment, the present disclosure provides a method for determining if a subject is suffering from or at risk for a disease, the method comprising isolating a cell free complex comprising circulating, cell-free nucleic acid and associated cellular components as set forth in any of the methods described herein, optionally further processing the cell free complex and determining the presence of a polypeptide and/or lipid characteristic in the cellular component. In one embodiment, the subject is judged to be suffering from or at risk for a disease if the presence of any of the characteristic is associated with the disease. Such polypeptide characteristic includes, but is not limited to, a mutation, the presence of post-translational modifications, the presence of insertions or deletions, the concentration, level of expression of a nucleic acid, the profile of the polypeptides or a combination of the foregoing. Such lipid characteristic includes, but is not limited to, the presence of altered forms, the presence of modifications, the concentration, the expression level, the profile of lipids or a combination of the foregoing.
[0103] In another embodiment, the present disclosure provides a method for determining if a subject is suffering from or at risk for a disease, the method comprising generating a nucleic acid, polypeptide or lipid profile from a subject and comparing the generated profile to a corresponding disease fingerprint and determining the subject is suffering from or at risk for a particular disease or condition if the subject profile contains one or more characteristics of the disease fingerprint.
[0104] In another embodiment, the present disclosure provides a method for determining if a subject is suffering from or at risk for a disease, the method comprising isolating circulating, cell-free nucleic acid as set forth in any one of methods described herein, optionally further processing the cell-free nucleic acid and determining the presence of a nucleic acid characteristic. In one embodiment, the subject is judged to be suffering from or at risk for a disease if the presence of any of the characteristic is associated with the disease. Such nucleic acid characteristic includes, but is not limited to, a mutation, a polymorphism, methylation state, concentration of a nucleic acid, level of expression of a nucleic acid, the profile of the nucleic acids or a combination of the foregoing. In one embodiment of this aspect, the circulating, cell-free nucleic acid is present in a cell free complex and such method may further comprise isolating at least one cell-free nucleic acid from the complex. In another embodiment, the circulating, cell-free nucleic acid is associated with a cellular component, such as, but not limited to, a polypeptide and/or a lipid, and such method may further comprise isolating at least one cell-free nucleic acid from the cellular components. Such method may further comprise isolating at least one cellular component from the circulating, cell-free nucleic acid and analyzing the cellular component. In one instance, the cellular component is a lipid or a protein. Such nucleic acid may be DNA and/or RNA.
[0105] In another embodiment, the present disclosure provides a method for determining if a subject is suffering from or at risk for a disease, the method comprising generating a nucleic acid profile from a subject as set forth in any of the methods described herein and comparing the generated profile to a corresponding disease fingerprint and determining the subject is suffering from or at risk for a particular disease if the subject profile contains one or more characteristics of the disease fingerprint. In one embodiment of this aspect, the circulating, cell-free nucleic acid is present in a cell free complex and such method may further comprise isolating at least one cell-free nucleic acid from the complex. In another embodiment, the circulating, cell-free nucleic acid is associated with a cellular component, such as, but not limited to, a polypeptide and/or a lipid, and such method may further comprise isolating at least one cell-free nucleic acid from the cellular components. Such method may further comprise isolating at least one cellular component from the circulating, cell-free nucleic acid and analyzing the cellular component. In one instance, the cellular component is a lipid or a protein. Such nucleic acid may be DNA and/or RNA
[0106] In any of the foregoing, the circulating, cell-free nucleic acid and cell free complex may be isolated by any method described herein. The determined characteristic, whether a nucleic acid, polypeptide or lipid characteristic, may inform a healthcare provider if the subject is suffering from or at risk for a particular disease or condition. For example, if a nucleic acid characteristic is analyzed, such as the presence of a mutation disposing an individual to a cancer risk, the individual may be monitored for the increased risk, undergo additional testing or initiate lifestyle changes or a combination of the foregoing.
[0107] Furthermore, in the foregoing embodiment, the determined characteristic, whether a nucleic acid, polypeptide or lipid characteristic may be compared to a control to determine if the subject is at risk for a particular disease or condition. For example, a nucleic acid profile of the nucleic acid components in the cell free complex may be prepared as described herein. The nucleic acid profile may be compared to a control nucleic acid profile obtained under the same or similar conditions that is free of a particular disease. Furthermore, profiles may be taken from individuals known to have a particular disease or condition, and these profiles compared to a control profile to identify nucleic acids that are subject to increased or decreased concentration to generate a nucleic acid fingerprint of a particular disease or condition comprising such nucleic acids that undergo changes in concentration. The presence of one or more such nucleic acids in a subject nucleic acid profile may indicate that the subject is suffering from or at risk for the disease or condition. The same analysis may be undertaken for the polypeptide components and the lipid components of the cell free complexes.
Determining Methods of Treatment
[0108] The present disclosure also provides for determining a beneficial or optimal course of treatment for an individual. Such treatment decisions can be of use to a healthcare provider when choosing between various forms of treatment, especially when physiological feature of the subject may impact the efficacy of such treatment or inform the healthcare provider on the dose of a particular medication to be used in such treatment.
[0109] In one embodiment, the present disclosure provides a method for determining beneficial or optimal course of treatment, the method comprising isolating a cell free complex comprising circulating cell free nucleic acid and associated cellular components or circulating cell-free nucleic acid, optionally further processing the cell free complex and determining the presence of a characteristic that may impact a particular course of treatment and modifying the course of treatment if the characteristic is present. Such characteristic may be the presence of genomic characteristic, a proteomic characteristic or a lipidomic characteristic.
[0110] For example, consider planning a course of treatment using the drug Plavix. Plavix is used to prevent blood clots after a recent heart attack or stroke, and in people with certain disorders of the heart or blood vessels. The effectiveness of Plavix in some individuals is dependent on the metabolism of the drug by certain liver enzymes, particularly CYP2C19. Metabolism is required for optimal effectiveness of the drug. Certain polymorphisms are indicative of those individuals that do not metabolize Plavix effectively and as a result may not receive the full benefits of the drug at standard dosing. By identifying such polymorphisms, a healthcare provider may plan the most beneficial or optimal course of treatment by prescribing another drug or adjusting the administered dose of Plavix.
Cell Free Complexes
[0111] The present disclosure provides methods for the isolation of cell free complexes comprising a cell free nucleic acid component and at least one cellular component. The at least one cellular component may be associated with a nucleic acid directly, or indirectly (such as through interaction with another cellular component). Such additional cellular components include but are not limited to, polypeptides, proteins and lipids. The presence of the at least one cellular component may aid in the preservation of the nucleic acid component, such as by protecting the nucleic acid component from degradation. As a result, nucleic acids of increased molecular weight are isolated by the methods of the present disclosure as compared to prior art methods. In one embodiment, at least 50%, 60%, 70%, 80%, 90%, 95% or 99% of the nucleic acids in the cell free complex are associated with at least one additional cellular component.
[0112] The cell free complex isolated as disclosed herein may be analyzed as is known by one of ordinary skill in the art. For example, the nucleic acid component may be analyzed by any known genomic methods to determine a genomic characteristic, the polypeptide component may be analyzed by any known proteomic methods to determine a proteomic characteristic and the lipid component may be analyzed by any known lipidomic methods to determine a lipidomic characteristic. As such, information regarding the status of the subject may be obtained and used for diagnostic, prognostic or therapeutic applications.
Samples
[0113] In one embodiment of the above method, a sample is obtained from the patient. Any type of sample routinely used in the art may be used, such as but not limited to, blood, plasma, serum, bone marrow, urine, amniotic fluid, placental blood, buccal swabs or other sample types. In one embodiment, the sample is a blood sample or plasma obtained from the patient. The blood sample may be collected and processed as is known in the art. In one embodiment, the blood samples are collected in an anti-chelating agent such as EDTA or another calcium binding agent. The blood sample may be subject to purification, such as, but not limited to, centrifugation, in order to separate the plasma fraction from other components of the blood. In one embodiment, the sample is a plasma sample. The sample may be stored at 4 degrees Celsius or lower prior to the purification step if desired. The sample may be stored cryogenically after purification for future analysis. In one embodiment, the sample is may be processed to remove cellular components, such as blood cells. In one embodiment, the sample is not subject to steps to purify or concentrate nucleic acid or another cellular component contained in the sample, with the understanding that procedures to separate plasma from blood and similar processing steps are not considered to be steps that purify or concentration nucleic acid or another cellular component contained in the sample.
Isolation of Cell Free Complexes and Circulating Cell-Free Nucleic Acid
[0114] The circulating cell-free nucleic acid and cell free complexes are separated using centrifugation. The embodiments described herein are useful in isolating both circulating cell-free nucleic acid and cell free complexes. In certain embodiments, the methods isolate both circulating cell-free nucleic acid and cell free complexes. In one embodiment, density gradient centrifugation is used. In a particular embodiment vertical spin density gradient ultracentrifugation is used. However, any density gradient separation means known in the art may be used.
[0115] In a typical samples, using density gradient centrifugation, the circulating cell-free nucleic acid and/or cell free complexes are separated from other components in the sample. For a typical sample containing free nucleic acid, nucleic acid complexes and polypeptides/proteins, the foregoing are separated in the following order (from the bottom of the density gradient to the top of the density gradient): polypeptide/proteins, circulating cell-free nucleic acid (which may be associated with cellular components) and cell free complexes as described herein and free nucleic acid. A variety of density gradient centrifugation conditions may be used. The composition of the density gradient may impact the separation between various components in the sample. The following are illustrated by way of example only and should not be interpreted as limiting the scope of the separation techniques to density gradient centrifugation or as limiting the conditions employed in density gradient centrifugation to those conditions specified.
[0116] As discussed above, in some cases certain a given sample may contain more than one type of component. Specific density gradient centrifugation conditions may be employed to provide maximum resolution of the various components in a sample or may be employed to provide maximum resolution of a selected component in the sample, such as the cell free complexes described herein.
[0117] In one embodiment, the density gradient centrifugation conditions and parameters are selected to provide maximum resolution of the circulating cell-free nucleic acid and/or cell free complexes described herein. Conditions and parameters that may be varied include, but are not limited to, density of the gradient, density of the layers comprising the density gradient, volume of the layers comprising the density gradient, centrifugation time settings, acceleration setting (impacting the time it takes for the centrifuge to reach a set RPM), deceleration settings (impacting the time it takes for the centrifuge to come to a stop from the set RPM at the end a specified time setting), speed of the centrifuge (measured in RMP), centrifugal force applied to the sample (measured in x g) and temperature of the centrifugation run. The various parameters discussed above may be varied singly or in any combination desired.
[0118] In one embodiment, the density gradient comprises a formed gradient of uniform composition. In another embodiment, the density gradient comprises two layers of gradient material (referred to as a top and bottom layer). A commonly used density gradient material is CsCl. Other commonly used density gradient materials include KBr, sucrose, and colloidal silica particles coated with polyvinylpyrrolidone (such as the product sold as Percoll). Any density gradient solution known in the art to create the required density range may be used. In one embodiment, the density gradient is formed from CsCl. Centrifugation will be performed in an appropriate vessel, such as a centrifuge tube. A variety of suitable centrifuge tubes are commercially available, for example from Beckman-Coulter, of Brea, Calif. In a specific embodiment separation is achieved using a single spin.
[0119] In one embodiment, the density of the gradient is from 1.30 to 1.45 g/cm.sup.3. In another embodiment, the density of the gradient is from 1.30 to 1.40 g/cm.sup.3. In another embodiment, the density of the gradient is from 1.35 to 1.40 g/cm.sup.3. In another embodiment, the density of the gradient is from 1.35 to 1.45 g/cm.sup.3. In another embodiment, the density of the gradient is from 1.38 to 1.43 g/cm.sup.3. In another embodiment, the density of the gradient is from 1.39 to 1.42 g/cm.sup.3. In another embodiment, the density of the gradient is from 1.35 to 1.42 g/cm.sup.3. In one embodiment, the volume of the density gradient is from 3-5 mls. In one embodiment, the volume of the density gradient is 5.0 mls.
[0120] In one embodiment where two layers of density gradient material are used, the bottom layer ranges from 1.10 to 1.40 g/cm.sup.3, from 1.15 to 1.30 g/cm.sup.3 or from 1.15 to 1.25 g/cm.sup.3 and the density of the top layer ranges from 0.5 to 1.2 g/cm.sup.3, from 1.0 to 1.15 g/cm.sup.3 or from 1.0 to 1.10 g/cm.sup.3. In another aspect of this embodiment, the density of the bottom layer is 1.21 g/ml or 1.30 g/cm.sup.3 and the density of the top layer is 1.05 g/cm.sup.3. Further, in one aspect of this embodiment, the volume of the bottom layer ranges from 0.2 to 4.0 ml, from 0.8 to 2.5 ml or from 1 to 2 ml and the volume of the top layer ranges from 1 to 4.8 ml, from 1.2 ml to 3.0 ml or from 3.0 to 4.0 ml. In another aspect of this embodiment, the volume of the bottom layer is 2.0 ml or 1.0 ml and the volume of the top layer is 2.90 ml or 3.9 ml.
[0121] Further, in one aspect of this embodiment, the settings for the ultracentrifuge are varied as follow: (i) centrifugation time from 1 to 4 hours (note that centrifugation time does not include the time required for deceleration of the centrifuge rotor), from 1 to 3 hours or from 2 to 4 hours; (ii) centrifugation speed from 190,000g to 555,000g or 275,000g to 480,000g; and (iii) centrifugation temperature from 15 to 30 degrees Celsius or from 20 to 25 degrees Celsius. Furthermore, in one aspect of this embodiment, the acceleration and deceleration settings are selected provide appropriate acceleration and deceleration profiles in order to maximize the desired separation. In one aspect, the acceleration and/or deceleration phases of the spin are set to be slow in order to minimize vibrations that may occur during a quick acceleration and/or deceleration. In one aspect, the acceleration and/or deceleration phases of the spin are set to be fast in order to resolve a given class of lipoprotein. For example, using a Beckman Coulter ultracentrifuge (Optima XL-100 K Ultracentrifuge), the acceleration and/or deceleration settings may range from 5 to 9 or 8 to 9 (with 9 being the slowest setting). In another aspect of this embodiment, the acceleration and/or deceleration settings may range from 1 to 5 or 2 to 4 (with 1 being the fastest setting).
[0122] In one embodiment, the following conditions are used: (i) density gradient of 1.30 to 1.45 g/cm3; (ii) 3 hour spin time; (iii) 20 degrees Celsius; (iv) 416,000g and (v) minimum acceleration/deceleration settings. TIMES G
Use of Comparative Database
[0123] As disclosed herein, the results of analysis of the components of the cell free complex, including cell-free nucleic acid, obtained as described herein may be compared with a standard or control. For example, such a control may be a sample from a subject who is determined to have or be free of a given disease or condition. Furthermore, the control may be a compilation of the results obtained from a population of individuals who are determined to have or be free of a given disease or condition. In such a case, the results may be contained within a comparative database.
[0124] When a comparative database is used as a control, the comparative database may be constructed in a variety of ways. Furthermore, the individuals in the comparative database may be matched to the subject being tested based on a stratification criterion or may be non-matched as compared to the subject. In one embodiment, the stratification criterion is age. In another embodiment, the stratification criterion is ethnic origin. For example, if the subject is 65 years of age, in one embodiment the comparative database may be composed of individuals with ages from, for example, 60 to 70 years, or in a second embodiment, the comparative database may be composed of individuals with ages from, for example, 25 to 40 years. The use of a comparative database comprising a younger population may offer certain advantages since the younger subjects that comprise the population will be more likely to be free of disease states and other conditions that may impact the analysis. Using an age matched population for the comparison may actually decrease the sensitivity of the method since the age matched population of the comparative database may in fact have a certain risk for the disease or condition being analyzed.
[0125] The individuals making up the comparative database may be healthy (i.e., disease free) or they may be selected based on their diagnosis of a particular disease or condition, or both. If healthy individuals are selected, the characteristic determined from the subject, such as the presence of a particular mutation or polymorphism or the nucleic acid and/or polypeptide profile, can be compared with the corresponding characteristic from healthy individuals in the comparative database. If individuals with a diagnosed disease state are selected, the characteristic determined from the subject, such as the presence of a particular mutation or polymorphism or the nucleic acid and/or polypeptide profile, can be compared with the corresponding characteristic from individuals diagnosed with a disease states and/or defined stages of a disease state in the comparative database. In this manner, the comparison may be able to predict if a subject is at risk for a particular disease or condition (from a comparison with healthy individuals in the comparative database), if the subject is suffering from a particular disease or condition (from a comparison with individuals in the comparative database diagnosed with such disease or condition) or to diagnose severity (from a comparison with individuals in the comparative database diagnosed with various stages of a disease or condition). The stratification of the database, as discussed below, may aid in making such comparisons.
[0126] The comparative database may be stratified based on a number of stratification criteria. These criteria may be risk factors, demographic factors, other relevant factors or a combination of the preceding. Demographic factors include, but are not limited to, age, gender and ethnicity. The inclusion of a specific stratification criteria as a risk factor or demographic factor may be modified (for example, age may be considered both a risk factor and a demographic factor). The individuals in the comparative database may be tagged or otherwise identified, such that the appropriate population of individuals in the comparative database may be selected for the comparison to the subject.
[0127] Furthermore, the comparative database may be refined over time. The individuals in the database may be followed over time and their health status monitored. If an individual no longer meets an inclusion criterion for the comparative database, the individual may be removed or their information modified. In this manner the quality of the comparative database may be improved over time, resulting in a database with improved sensitivity and specificity.
[0128] The characteristic determined from the subject, such as the presence of a particular mutation or polymorphism or the nucleic acid, lipid and/or polypeptide profile, may then be compared to the corresponding characteristic from appropriately selected defined group of individuals in a comparative database. Appropriately selected means that the selected characteristic from a defined group of individuals in the comparative database is selected for comparison to the selected characteristic determined for the subject. The defined group may be all the individuals in the comparative database or less than all the individuals in the comparative database. The defined group may be selected on the basis of stratification criteria as discussed above. The healthcare provider may select the defined group, with such selection based on one or more defining characteristics of the subject. In one embodiment, the defined group may be selected on the basis of ethnicity (African-American), gender (male), health status (disease free or diagnosed with a particular disease or condition), and age (20-45 years of age or 55-65 years of age). Furthermore, the comparison may be carried out multiple times for any given subject to various iterations of the comparative database. For example, given a 60 year old, non-smoking, African-American male subject, comparisons could be made using a defined group from the database selected on the basis of gender (male) only, gender and age, or selected to include all individuals in the comparative database.
Results
Example 1General Procedures
Sample Handling
[0129] Blood samples were collected in 10 ml lavender top EDTA collection tubes using standard phlebotomy practices. Immediately after collection, the tubes were gently inverted 4-6 times and then centrifuged at 2,500 RPM for 15 minutes at 4 C. The supernatant plasma was transferred into 2 ml cryogenic vials and frozen at 80 C. until analysis. No further modification of manipulation of the blood sample is required. The supernatant plasma is used directly in the methods as described without further amplification of purification of any component of the plasma, such as, but not limited to, nucleic acids and polypeptides.
VAP Analysis
[0130] VAP cholesterol patent tests were performed at Atherotech Diagnostic Laboratories (Birmingham, Ala.) according to internal standard operating procedures. The VAP method separates lipoproteins based on their density using single vertical-spin density gradient ultracentrifugation, then quantifies cholesterol content (Kulkarni, et al., Clin Lab Methods, 26, 787-802, 2006; Kulkarni et al., J. Lipid Res, 35, 159-168, 1994; Kulkarni et al., J Lipid Res, 38, 2353, 2364, 1997).
Density Gradient Centrifugation
[0131] Twenty l of plasma was diluted in 980 l of 1 phosphate buffered saline (PBS) prior to mixing with a CsCl gradient solution. The CsCl gradient was prepared by adding 2.19 g of CsCl to 4 ml of 1 Tris-EDTA buffer; sample volume was adjusted to 5 ml to a final density of 1.30 to 1.45 g/cm3. The resulting sample was centrifuged using a Beckman Coulter Optima XL-100K ultracentrifuge and Beckman VTI 65.2 rotor 3 hours at 65,000 RPM at 20 C. (416,000g). 250 l fractions (fractions 1-20) were collected with a peristalitic pump. Detection and quantification of the cell free nucleic acid was conducted by measuring uv absorbance at 260 nm by a NanoDrop ND-8000 spectrophotometer (ThermoScientific).
[0132] For further analysis of the nucleic acid, polypeptide and lipid components, the fractions were desalted and concentrated on a Microcon DNA fast flow centrifugal filter column. Nucleoprotein complexes in the solution were disassociated by alkaline denaturation. Free nucleic acid complexes were subject to isothermal amplification to amplify cell free DNA acid or reverse transcription on cell free RNA. Subsequent analysis was carried out using commercially available kits according to manufacturers' instructions.
Example 2Overview of General Procedure
[0133]
[0134] At the end of the centrifugation procedure, the vessel containing the sample is gently removed and the bottom of the tube is punctured to allow removel of the sample from the bottom of the tube. Fractions are collected using a peristaltic pump for analysis. Using this method, the bulk nucleic acid (containing less or no associated cellular components) is lower in the density gradient and is collected first (generally having a density around 1.70 g/cm.sup.3), followed by the cell free nucleic acid associated with cellular components and cell free complexes (generally having a density around 1.30 to 1.45 g/cm.sup.3), followed by a protein fraction (generally having a density around 1.25 g/cm.sup.3). Any convenient aliquot volume may be used, for example 250 l fractions. The collected fractions are subject to ultraviolet absorbance measurement at 260 nm using a spectrophotometer (such as a NanoDrop ND-8000) to detect and quantify the nucleic acid and other components present in the collected fractions.
[0135] The fractions may then be further processed as is known in the art for subsequent analysis. For example, for genomic analysis the fractions may be deslated and concentrated using methods known in the art (for example, a Microcon DNA Fast Flow centrifugal filter column). Nucleoprotein complexes may be dissociated using standard techniques (such as alkaline denaturation). Other processing steps may also be performed as is known in the art. In one embodiment, such further processing steps do not involve the purification of nucleic acid isolated. Subsequent analytic techniques include, but are not limited to genomics, proteomics and lipidomics. Genomic analysis includes, but is not limited to, gene profiling and identification, analysis of methylation patterns, mutation analysis, polymorphism analysis and gene expression analysis. Proteomic analysis includes, but is not limited to, polypeptide profiling and identification, mutation analysis, polypeptide modification analysis and polypeptide expression analysis. Lipidomic analysis includes, but is not limited to, lipid profiling and identification, lipid modification analysis and lipid expression analysis.
Example 3Characterization of Isolated Fractions
[0136]
[0137] For
TABLE-US-00001 Ret High Width Asym Trailing Sample Time Area Area % Height Value Width 50% Res 10% 10% VAP3 18.03 35525.77 14.93 372.65 367.78 257.6 80.8 0.876 1.6 1.3 20.41 3188.21 1.34 75.01 70.28 122.6 245.2 0.744 0.1 0.55 VAP4 26.67 40841.19 17.16 362.62 357.85 275 129.4 0.507 0.65 0.82 27.94 6616.56 2.78 204.92 200.09 165.2 164.8 2.827 0.12 0.56
[0138] As discussed herein, the methods described separate circulating cell-free nucleic acid/cell free complex comprising a pool of circulating cell free nucleic acid that are associated with cellular components, such as polypeptides and lipids, from circulating cell free nucleic acid that is not associated with such cellular components (or not associated with such cellular components to an appreciable degree) and polypeptides. Each of these classes migrates in a distinct pattern during density gradient centrifugation. As described herein, the circulating cell free nucleic acid that is associated with a cellular component represents a biologically relevant fraction of such nucleic acids and as a result, the methods described herein provide a mechanism to isolate this biologically relevant pool of circulating, cell free nucleic acid for analysis.
[0139] In order to further characterize the material isolated, the plasma samples were prepared as described above and treated with various agents before being subject to density gradient centrifugation (conditions for sample preparation, density gradient preparation and centrifugation were as described for
[0140] In
Example 4Comparison of the Methods of the Present Disclosure with Commercially Available Extraction Kits
[0141] Table 2 shows a comparison of the methods of the present disclosure with two commercially available kits for the isolation of circulating cell free nucleic acid. Procedures for the commercially available kits were carried out according to manufacturers' instructions. The commercially available kits were the NucleoSpin Kit from Clontech and the QIAamp Circulating Nucleic Acid Kit from Qiagen.
[0142] The QIAamp Circulating Nucleic Acid Kit simplifies isolation of circulating DNA and RNA from plasma or serum. No phenol-chloroform extraction is required and nucleic acids bind specifically to the QIAamp Mini column, while contaminants pass through. PCR inhibitors, such as divalent cations and proteins, are completely removed in 3 wash steps, leaving pure nucleic acids to be eluted in a buffer provided with the kit. The QIAamp Circulating Nucleic Acid technology yields circulating DNA and RNA from human plasma, serum, or urine. Circulating RNA can be purified with DNA digestion using the RNase-Free DNase Set.
[0143] The NucleoSpin Plasma XS kit is designed to isolate fragmented DNA larger than 50 bp from human EDTA blood plasma. NucleoSpin Plasma XS allows elution in only 5-20 l, resulting in highly concentrated DNA.
[0144] For the methods of the present disclosure, sample preparation, density gradient preparation and centrifugation were carried out as described for
TABLE-US-00002 TABLE 2 QIAamp Circulating NucleoSpin Kit Nucleic Present (Clontech) Acid Kit (Qiagen) Disclosure Throughput 30 min/6 2 hr/24 3 hr/16 samples samples samples Sample Volume 200 l 200 l 20 l RNA Carrier No Yes No Required Large Volume to Yes Yes (up to 5 ml) No Improve Yield Yield, range 0.61 to 50.11 9.43 to 46.27 97.30 to 132.25 (ng/l) n = 6 Yield, means 12.58 18.68 18.58 13.80 108.46 11.17 SD, n = 6 Yield, % CV, 148.42 74.26 10.30 n = 6 Purity (A260/ >1.8 >2.0 0.57 to 0.63 280), n = 6
[0145]
Example 5Detection of Gene Polymorphisms from Circulating, Cell Free DNA
[0146] This example illustrates the detection of multiple gene polymorphisms on circulating cell free DNA isolated using the methods of the present disclosure as well as comparing such detection using circulating cell free DNA isolated using the commercially available kits of Example 4. For the methods of the present disclosure, circulating cell free DNA was prepared as described in for
[0147] This example shows the detection of 7 single nucleotide polymorphisms (SNP) over a single gene for PCSK9, 3 SNPs over 2 genes related to warfarin sensitivity, 11 SNP's in a single gene for plavix sensitivity and 4 SNPs over 3 genes related to thrombophilia risk. The PCSK9 genotyping test was developed by the Applicants; genotyping for warfarin sensitivity, plavix sensitivity and thrombophilia risk were carried out using commercially available kits from GenmarkDx using the eSensor platform.
[0148] Table 3 shows the general PCR conditions used in the genotyping experiments while Table 4 shows the probes used in the PCSK9 genotyping experiments. Probes and primers for the commercially available kits are not available to the general public.
TABLE-US-00003 TABLE 3 Reference SNP Gene Name SNP ID Allele PCR Conditions PCSK9 PCSK9 rs562556 A > G 95 C..sup.10 min 1 cycle; PCSK9 rs505151 A > G (92 C..sup.15 sec-60 C..sup.1 min) PCSK9 rs11206510 T > C 50 cycles PCSK9 rs1151147 G > T PCSK9 rs28362286 C > A PCSK9 rs28362263 G > A PCSK9 rs7517090 G > A Thrombophilia Risk Factor II 20210 G > A 95 C..sup.4 min 1 cycle; (Prothrombin) (95 C..sup.25 sec-60 C..sup.30 sec- Factor V 1691 G > A 72 C..sup.25 sec) (Leiden) 35 cycles MTHFR 677 C > T 1298 A > C Warfarin Sensitivity CYP450 2C19 430 C > T 95 C..sup.4 min 1 cycle; *2, *3 1075 A > C (93 C..sup.45 sec-56 C..sup.45 sec- VKORC1 1639 G > A 68 C..sup.45 sec) 39 cycles; 68 C..sup.7 min 1 cycle Plavix Sensitivity CYP450 2C19 681 G > A 94 C..sup.4 min 1 cycle; CYP450 2C19 636 G > A (94 C..sup.20 sec-56 C..sup.45 sec- CYP450 2C19 1 A > G 70 C..sup.45 sec) CYP450 2C19 1297 C > T 37 cycles; CYP450 2C19 396 G > A CYP450 2C19 19249 T > A CYP450 2C19 358 T.C CYP450 2C19 12784 G > A CYP450 2C19 19153 C > T CYP450 2C19 87290 C > T CYP450 2C19 806 C > T
TABLE-US-00004 TABLE4 GeneName SNPID TaqmanProbe PCSK9 rs562556 GGGGCCTACACGGATGGCCACAGCC[A/G]TCG CCCGCTGCGCCCCAGATGAGGA PCSK9 rs505151 AGCACTACAGGCAGCACCAGCGAAG[A/G]GG CCGTGACAGCCGTTGCCATCTGC PCSK9 rs11206510 AAGGATATAGGGAAAACCTTGAAAG[C/T]GA TGTCTGTGGTGGCCGTCTTTGGC PCSK9 rs11591147 TACGAGGAGCTGGTGCTAGCCTTGC[G/T]TTC CGAGGAGGACGGCCTGGCCGAA PCSK9 rs28362286 CCGTGACAGCCGTTGCCATCTGCTG[A/C]CGG AGCCGGCACCTGGCGCAGGCCT PCSK9 rs28362263 GGTACTGACCCCCAACCTGGTGGCC[A/G]CCC TGCCCCCCAGCACCCATGGGGC PCSK9 rs7517090 GAGTGTGGCCTGTGCAGAAGGGACC[A/G]AG GCTGGTGAGACCAGGAGGGCCTG
[0149] Table 5 shows the results of the genotyping experiments using the circulating, cell free DNA isolated by the methods of the present disclosure (designated V) and the two commercially available kits described above (designated C for the NucleoSpin Kit and Q for the QIAamp kit). The data in Table 5 shows that genotyping experiments using circulating cell free DNA purified by the methods of the present disclosure allowed the accurate determination of SNP genotype for all 25 SNPs tested.
TABLE-US-00005 TABLE 5 Kit C Kit Q V PCSK9, n = 6 95.2% 90.5% 100% Warfarin Sensitivity, n = 6 66.7% 100% 100% Plavix Sensitivity, n = 6 83.3% 100% 100% Thrombophilia Risk, n = 6 83.3% 100% 100%
Example 6Detection of KRAS Gene Mutations from Circulating, Cell Free DNA
[0150] This example illustrates the detection of KRAS gene mutations on circulating cell free DNA isolated using the methods of the present disclosure as well as comparing such detection using circulating cell free DNA isolated using the commercially available kits of Example 4. For the methods of the present disclosure, circulating cell free DNA was prepared as described in for
[0151] The KRAS mutation is found in several cancers including colorectal, lung, thyroid, and pancreatic cancers and cholangiocarcinoma. KRAS mutations are often located within codons 12 and 13 of exon 2, which may lead to abnormal growth signaling by the p21-ras protein. These alterations in cell growth and division may trigger cancer development as signaling is excessive. A KRAS mutation often serves as a useful prognostic marker of drug response. For example, a KRAS mutation is considered to be a strong prognostic marker of response to tyrosine kinase inhibitors such as gefitinib (Iressa) or erlotinib (Tarceva). Recently, KRAS mutations have been detected in many colorectal cancer patients and may be associated with responses to cetuximab (Erbitux) or panitumumab (Vectibix), which are used in colon cancer therapy Mutations in KRAS codons 12 and 13 have been associated with lack of response to EGFR-targeted therapies in both colorectal cancer and non-small cell lung cancer patients. The National Comprehensive Cancer Network recommends KRAS mutation testing before initiating EGFR-targeted therapies for such diseases.
[0152] KRAS mutation analysis was performed using (PNAClamp KRAS Mutation Detection Kit; Panagene, Daejeon, Korea). The mutation analysis was performed according to manufactures' instructions. Table 6 shows the results of the KRAS mutation experiments using the circulating, cell free DNA isolated by the methods of the present disclosure (designated V) and the two commercially available kits described above (designated C for the NucleoSpin Kit and Q for the QIAamp kit). PCR conditions were: 94 C..sup.5 min1 cycle; (94 C..sup.30sec70 C..sup.20sec63 C..sup.30sec72 C..sup.30sec)40 cycles.
[0153] The data in Table 6 shows that KRAS mutation analysis using circulating cell free DNA purified by the methods of the present disclosure allowed the accurate determination of KRAS mutation status that was superior to the results obtained with commercially available kit Q.
TABLE-US-00006 TABLE 6 Kit C Kit Q V KRAS Mutation ND 4/14 detected 9/14 detected Status (Codon 12/13); n = 7
Example 7Detection of TP53 Exon Amplification Products from Circulating, Cell Free DNA
[0154] This example illustrates the detection of TP53 exon amplification products from circulating cell free DNA isolated using the methods of the present disclosure as well as comparing such detection using circulating cell free DNA isolated using the commercially available kits of Example 4. For the methods of the present disclosure, circulating cell free DNA was prepared as described in for
[0155] TP53 exon amplification analysis was performed on exon 1 of TP53 using (Multiplex PCR kit for Human TP53 Oncogene from Bio SB). The analysis was performed according to manufactures' instructions. PCR conditions were: 95 C..sup.5 min1 cycle; (95 C..sup.25sec64 C..sup.20sec72 C..sup.20sec)15 cycles; (93 C..sup.25sec60 C..sup.35sec72 C..sup.20sec)28 cycles.
[0156] Table 7 shows the results of the TP53 exon amplification experiments using the circulating, cell free DNA isolated by the methods of the present disclosure (designated V) and the two commercially available kits described above (designated C for the NucleoSpin Kit and Q for the QIAamp kit). The data in Table 7 shows that exon amplification of the TP53 gene using circulating cell free DNA purified by the methods of the present disclosure was equal to (Kit Q) or superior to (Kit C) the results obtained with commercially available kit Q.
TABLE-US-00007 TABLE 7 Kit C Kit Q V TP53 Exon + +++ +++ Amplification (392- 1,143 bp), n = 6
Example 8Detection of Short Tandem Repeat DNA Profiling from Circulating, Cell Free DNA
[0157] This example illustrates the detection of short tandem repeat (STR) profiling from circulating cell free DNA isolated using the methods of the present disclosure as well as comparing such detection using circulating cell free DNA isolated using the commercially available kits of Example 4. STRs are highly polymorphic, repeating sequences and represent non-coding DNA sequences. STRs are frequently used in determining identity. As STRs are non-coding DNA regions, the nucleic acid containing such STRs should not be enriched in the methods of the present disclosure. For the methods of the present disclosure, circulating cell free DNA was prepared as described in for
[0158] 16 STRs were analyzed using the AmpFLSTR Identifiler PCR Amplification kit. This kit allows the determination of 15 tetranucleotide repeat loci (D8S1179, D21S11, D7S820, CSF1PO, D351358, TH01, D13S317, D165539, D21S1338, D195433, vWA, TPDX, D18S51, D5S818, FGA and the Amelogenin gender-determining marker) in a single PCR amplification. Reactions were carried out according to manufacturers' instructions on circulating, cell free DNA isolated using the methods of the present disclosure and circulating, cell free DNA isolated using the commercial kits described above. PCR conditions were: 95 C..sup.11min1 cycle; (94 C..sup.60sec59 C..sup.60sec72 C..sup.60sec)28 cycles; 60 C..sup.60min1 cycle.
[0159] Table 8 shows the results of the STR profiling experiments using the circulating, cell free DNA isolated by the methods of the present disclosure (designated V) and the two commercially available kits described above (designated C for the NucleoSpin Kit and Q for the QIAamp kit). The data in Table 8 shows that STR profiling using circulating cell free DNA isolated using the methods of the present disclosure was less effective, as expected, than using circulating cell free DNA isolated using Kit Q in detection of these non-coding STR markers.
TABLE-US-00008 TABLE 8 (; Kit C Kit Q V STR DNA Profiling; ND 6/16, 9/15, 0/16, 8/15, n = 4 4/16, 0/16 1/16, 0/16
Example 9Array Comparative Genomic Hybridization from Circulating, Cell Free DNA
[0160] This example illustrates the use of array comparative genomic hybridization (aCGH) from circulating cell free DNA isolated using the methods of the present disclosure as well as comparing such detection using circulating cell free DNA isolated using the commercially available kits of Example 4. For the methods of the present disclosure, circulating cell free DNA was prepared as described in for
[0161] In this example, the InfiniumDx CytoSNP-12 Assay (Illumina) was used to screen over 294,000 SNP markers over the entire genome. Reactions were carried out according to manufacturers' instructions on circulating, cell free DNA isolated using the methods of the present disclosure and circulating, cell free DNA isolated using the commercial kits described above. aCGH analysis is useful in detecting genomic structural variation such as copy number changes, copy neutral loss of heterozygosity, uniparental disomy, mitotic recombination, gene conversion and mosaicism.
[0162] Table 9 shows the results of the aCGH experiments using the circulating, cell free DNA isolated by the methods of the present disclosure (designated V) and the two commercially available kits described above (designated C for the NucleoSpin Kit and Q for the QIAamp kit). The data in Table 9 shows that aCGH SNP profiling of whole human genome using circulating cell free DNA purified by the methods of the present disclosure was more representative of cell genomic DNA than using circulating cell free DNA isolated with Kit Q.
TABLE-US-00009 TABLE 9 Kit C Kit Q V Array GCH ND Poorly Highly Analysis; n = 4 Representative Representative
[0163]
[0164]
[0165] The results in Table 9 and
Example 10Analysis of Lipid and Polypeptide Composition
[0166] As discussed herein, the nucleic acids isolated according to the methods of the present disclosure are associated with cellular components, such as but not limited to, polypeptides and lipids. These associated cellular components aid in protecting the nucleic acids from degradation and provide an additional source of information regarding the subject. As a result, the biological information that can be obtained from the material isolated as described herein is greater than obtainable with commercially available kits which extract only the nucleic acids. To investigate the nature of the associated cellular components that are isolated with the circulating cell free nucleic acid, circulating cell free nucleic acid and its associated cellular components were isolated as described for
[0167] The isolated material was subject to Vertical Auto Profile (VAP) analysis as described in Example 1 to identify the nature of the lipid component associated with the nucleic acid. Nucleic acid/histone complexes were detected in density gradient fractions using the Cell Death Detection ELISA kit (Roche, catalogue number 1774425). This assay detects histone associated DNA complexes, both mono- and loig-onucleosomes, using a photometric enzyme immunoassay and was used to determine the fractions containing DNA associated with cellular components. As shown in
[0168] In addition, polypeptide components associated with the isolated nucleic acid were analyzed by LC-MS/MS analysis to determine the identity of the associated polypeptides. As shown in Table 10, over 700 associated polypeptides were identified, indicating that a variety of polypeptides are associated with the isolated nucleic acids.
TABLE-US-00010 TABLE 10 Accession Molecular Identified Proteins Taxonomy RepID Number Weight 14-3-3 protein epsilon Amniota 1433E_HUMAN P62258 29 kDa 14-3-3 protein eta Simiiformes 1433F_HUMAN Q04917 28 kDa (+1) 14-3-3 protein gamma Amniota 1433G_HUMAN P61981 28 kDa 14-3-3 protein sigma Hominoidea 1433S_HUMAN P31947 28 kDa 14-3-3 protein theta Eutheria 1433T_HUMAN P27348 28 kDa 14-3-3 protein zeta/delta Amniota 1433Z_HUMAN P63104 28 kDa 26S protease regulatory Homo sapiens E9PM69_HUMAN E9PM69 44 kDa subunit 6A (+1) 26S protease regulatory Eutheria PRS7_HUMAN P35998 49 kDa subunit 7 26S protease regulatory Eutheria A8K3Z3_HUMAN A8K3Z3 45 kDa subunit 8 (+1) 26S proteasome non-ATPase Homo sapiens PSMD1_HUMAN Q99460 106 kDa regulatory subunit 1 26S proteasome non-ATPase Catarrhini PSD12_HUMAN O00232 53 kDa regulatory subunit 12 26S proteasome non-ATPase Homo sapiens B4DJ66_HUMAN B4DJ66 35 kDa regulatory subunit 13 (+2) 26S proteasome non-ATPase Homininae PSMD2_HUMAN Q13200 100 kDa regulatory subunit 2 (+4) 26S proteasome non-ATPase Homininae C9IZE4_HUMAN C9IZE4 52 kDa regulatory subunit 6 (+1) 28S ribosomal protein S9, Homo sapiens RT09_HUMAN P82933 46 kDa mitochondrial 3-hydroxyacyl-CoA Homininae HCD2_HUMAN Q99714 27 kDa dehydrogenase type-2 3-ketoacyl-CoA thiolase Catarrhini B4E2W0_HUMAN B4E2W0 49 kDa (+1) 40S ribosomal protein S11 Amniota RS11_HUMAN P62280 18 kDa 40S ribosomal protein S12 Mammalia RS12_HUMAN P25398 15 kDa 40S ribosomal protein S14 Euteleostomi RS14_HUMAN P62263 16 kDa 40S ribosomal protein S15a Mammalia RS15A_HUMAN P62244 15 kDa 40S ribosomal protein S18 Euarchontoglires Q5GGW2_HUMAN Q5GGW2 4 kDa 40S ribosomal protein S2 Homo sapiens E9PQD7_HUMAN E9PQD7 25 kDa (+2) 40S ribosomal protein S20 Homo sapiens E5RIP1_HUMAN E5RIP1 5 kDa (+2) 40S ribosomal protein S24 Homo sapiens E7EPK6_HUMAN E7EPK6 32 kDa (+1) 40S ribosomal protein S25 Amniota RS25_HUMAN P62851 14 kDa 40S ribosomal protein S3 Eukaryota RS3_HUMAN P23396 27 kDa 40S ribosomal protein S3a Eutheria RS3A_HUMAN P61247 30 kDa 40S ribosomal protein S4, X Eutheria RS4X_HUMAN P62701 30 kDa isoform 40S ribosomal protein S5 Mammalia RS5_HUMAN P46782 23 kDa 40S ribosomal protein S7 Theria RS7_HUMAN P62081 22 kDa 40S ribosomal protein S9 Eutheria RS9_HUMAN P46781 23 kDa 4F2 cell-surface antigen Homo sapiens B4E2Z3_HUMAN B4E2Z3 56 kDa heavy chain (+2) 5-aminoimidazole-4- Homo sapiens A8K202_HUMAN A8K202 65 kDa carboxamide ribonucleotide (+1) formyltransferase/IMP cyclohydrolase, isoform CRA_g 5-azacytidine induced 1 Homo sapiens B2RN10_HUMAN B2RN10 122 kDa (+1) 60 kDa heat shock protein, Homo sapiens CH60_HUMAN P10809 61 kDa mitochondrial 60S acidic ribosomal protein Homo sapiens F8VWS0_HUMAN F8VWS0 30 kDa P0 (+2) 60S acidic ribosomal protein Catarrhini RLA2_HUMAN P05387 12 kDa P2 60S ribosomal protein L10 Euarchontoglires F8W7C6_HUMAN F8W7C6 19 kDa (+1) 60S ribosomal protein L10a Eutheria RL10A_HUMAN P62906 25 kDa 60S ribosomal protein L12 Eutheria RL12_HUMAN P30050 18 kDa 60S ribosomal protein L13 Homo sapiens RL13_HUMAN P26373 24 kDa 60S ribosomal protein L13a Hominidae RL13A_HUMAN P40429 24 kDa (+1) 60S ribosomal protein L17 Homininae B4E3C2_HUMAN B4E3C2 17 kDa (+1) 60S ribosomal protein L18 Homo sapiens B4DDY5_HUMAN B4DDY5 16 kDa (+3) 60S ribosomal protein L18a Homo sapiens B2R4C0_HUMAN B2R4C0 21 kDa (+2) 60S ribosomal protein L19 Theria RL19_HUMAN P84098 23 kDa 60S ribosomal protein L23 Euteleostomi RL23_HUMAN P62829 15 kDa 60S ribosomal protein L23a Eutheria RL23A_HUMAN P62750 18 kDa 60S ribosomal protein L24 Eutheria RL24_HUMAN P83731 18 kDa 60S ribosomal protein L28 Catarrhini RL28_HUMAN P46779 16 kDa 60S ribosomal protein L3 Catarrhini RL3_HUMAN P39023 46 kDa 60S ribosomal protein L32 Homininae F8W727_HUMAN F8W727 18 kDa (+1) 60S ribosomal protein L4 Homo sapiens E7EWF1_HUMAN E7EWF1 46 kDa (+1) 60S ribosomal protein L5 Hominoidea RL5_HUMAN P46777 34 kDa 60S ribosomal protein L6 Homininae RL6_HUMAN Q02878 33 kDa 60S ribosomal protein L7 Homininae RL7_HUMAN P18124 29 kDa 60S ribosomal protein L7a Eutheria RL7A_HUMAN P62424 30 kDa 60S ribosomal protein L8 Homo sapiens E9PIZ3_HUMAN E9PIZ3 24 kDa (+1) 6-phosphofructokinase Homo sapiens Q6ZTT1_HUMAN Q6ZTT1 93 kDa (+1) 6-phosphofructokinase type Homo sapiens K6PP_HUMAN Q01813 86 kDa C 6-phosphofructokinase, liver Homo sapiens K6PL_HUMAN P17858 85 kDa type 6-phosphogluconate Homo sapiens 6PGD_HUMAN P52209 53 kDa dehydrogenase, (+1) decarboxylating 78 kDa glucose-regulated Catarrhini GRP78_HUMAN P11021 72 kDa protein 7-dehydrocholesterol Homo sapiens DHCR7_HUMAN Q9UBM7 54 kDa reductase ABC50 protein Homo sapiens Q2L6I2_HUMAN Q2L6I2 92 kDa (+1) Abhydrolase domain- Homo sapiens B4DNR3_HUMAN B4DNR3 20 kDa containing protein 14B (+2) Acetolactate synthase-like Homo sapiens ILVBL_HUMAN A1L0T0 68 kDa protein Acetyl-CoA Homininae THIL_HUMAN P24752 45 kDa acetyltransferase, mitochondrial Aconitase 2, mitochondrial Homo sapiens A2A274_HUMAN A2A274 88 kDa (+2) Actin, cytoplasmic 1, N- Simiiformes B4E335_HUMAN B4E335 39 kDa terminally processed (+3) Actin-related protein 2/3 Homo sapiens C9JWM7_HUMAN C9JWM7 22 kDa complex subunit 4 (+3) ADAM metallopeptidase Catarrhini A8MY20_HUMAN A8MY20 63 kDa domain 10, isoform CRA_a (+1) Adaptor-related protein Homo sapiens H0UID3_HUMAN H0UID3 105 kDa complex 2, beta 1 subunit, (+3) isoform CRA_d Adenine Homo sapiens H3BQZ9_HUMAN H3BQZ9 17 kDa phosphoribosyltransferase (+1) Adenosylhomocysteinase Homininae SAHH_HUMAN P23526 48 kDa (+1) Adenylosuccinate synthetase Homo sapiens B4E1L0_HUMAN B4E1L0 48 kDa (+1) Adenylyl cyclase-associated Homo sapiens B2RDY9_HUMAN B2RDY9 52 kDa protein (+1) ADP/ATP translocase 2 Homo sapiens ADT2_HUMAN P05141 33 kDa (+1) ADP-ribosylation factor 3 Euteleostomi ARF3_HUMAN P61204 21 kDa (+2) ADP-ribosylation factor 6 Homo sapiens Q5U025_HUMAN Q5U025 20 kDa Afamin Homo sapiens AFAM_HUMAN P43652 69 kDa A-kinase anchor protein 13 Homo sapiens H0Y4V5_HUMAN H0Y4V5 305 kDa (+3) Alanine--tRNA ligase, Homo sapiens SYAC_HUMAN P49588 107 kDa cytoplasmic Alcohol dehydrogenase class- Homo sapiens ADHX_HUMAN P11766 40 kDa 3 (+2) Aldehyde dehydrogenase X, Homo sapiens AL1B1_HUMAN P30837 57 kDa mitochondrial Aldose reductase Homo sapiens ALDR_HUMAN P15121 36 kDa Alpha-1-antichymotrypsin Homo sapiens AACT_HUMAN P01011 48 kDa Alpha-1-antitrypsin Homo sapiens A1AT_HUMAN P01009 47 kDa Alpha-1B-glycoprotein Homo sapiens A1BG_HUMAN P04217 54 kDa Alpha-2-antiplasmin Homininae A2AP_HUMAN P08697 55 kDa Alpha-2-macroglobulin Homo sapiens A2MG_HUMAN P01023 163 kDa Alpha-actinin-1 Homo sapiens ACTN1_HUMAN P12814 103 kDa Alpha-actinin-4 Catarrhini ACTN4_HUMAN O43707 105 kDa Alpha-aminoadipic Homo sapiens E7EPT3_HUMAN E7EPT3 54 kDa semialdehyde dehydrogenase (+1) Alpha-enolase Catarrhini ENOA_HUMAN P06733 47 kDa Aminoacyl tRNA synthase Homo sapiens AIMP1_HUMAN Q12904 34 kDa complex-interacting multifunctional protein 1 Aminoacyl tRNA synthase Homo sapiens F8W950_HUMAN F8W950 28 kDa complex-interacting (+2) multifunctional protein 2 Aminopeptidase B Homo sapiens AMPB_HUMAN Q9H4A4 73 kDa Angiotensinogen Homo sapiens ANGT_HUMAN P01019 53 kDa (+2) Ankyrin repeat domain- Homo sapiens ANR31_HUMAN Q8N7Z5 211 kDa containing protein 31 Ankyrin-3 Homo sapiens ANK3_HUMAN Q12955 480 kDa Annexin Homo sapiens B7Z8A7_HUMAN B7Z8A7 72 kDa (+1) Annexin Homo sapiens B2R657_HUMAN B2R657 53 kDa Annexin A1 Homininae ANXA1_HUMAN P04083 39 kDa Annexin A2 Catarrhini ANXA2_HUMAN P07355 39 kDa Annexin A3 Homo sapiens ANXA3_HUMAN P12429 36 kDa Annexin A4 Homo sapiens ANXA4_HUMAN P09525 36 kDa Annexin A5 Homininae ANXA5_HUMAN P08758 36 kDa Antithrombin-III Homo sapiens ANT3_HUMAN P01008 53 kDa AP-3 complex subunit beta-1 Homo sapiens AP3B1_HUMAN O00203 121 kDa AP-3 complex subunit mu-1 Eutheria AP3M1_HUMAN Q9Y2T2 47 kDa Apolipoprotein A-I Homininae APOA1_HUMAN P02647 31 kDa Apolipoprotein A-II Homininae APOA2_HUMAN P02652 11 kDa Apolipoprotein A-IV Homo sapiens APOA4_HUMAN P06727 45 kDa Apolipoprotein B (Including Homo sapiens C0JYY2_HUMAN C0JYY2 516 kDa Ag(X) antigen) Apolipoprotein C-III Homo sapiens APOC3_HUMAN P02656 11 kDa Apolipoprotein D Homo sapiens APOD_HUMAN P05090 21 kDa Apolipoprotein E Homo sapiens APOE_HUMAN P02649 36 kDa Apolipoprotein F Homo sapiens APOF_HUMAN Q13790 35 kDa Apolipoprotein L1 Homo sapiens E9PF24_HUMAN E9PF24 42 kDa (+1) Apolipoprotein M Homo sapiens APOM_HUMAN O95445 21 kDa (+2) Apolipoprotein(a) Catarrhini APOA_HUMAN P08519 501 kDa (+1) Arginine--tRNA ligase, Homo sapiens SYRC_HUMAN P54136 75 kDa cytoplasmic Asparagine synthetase Homo sapiens ASNS_HUMAN P08243 64 kDa [glutamine-hydrolyzing] (+1) Asparagine--tRNA ligase, Homo sapiens SYNC_HUMAN O43776 63 kDa cytoplasmic Aspartate aminotransferase, Homo sapiens AATM_HUMAN P00505 48 kDa mitochondrial (+1) Aspartate--tRNA ligase, Homo sapiens SYDC_HUMAN P14868 57 kDa cytoplasmic Aspartyl/asparaginyl beta- Homo sapiens ASPH_HUMAN Q12797 86 kDa hydroxylase Atlastin-3 Homininae F5H6I7_HUMAN F5H6I7 59 kDa (+1) ATP synthase subunit alpha Homo sapiens B4DY56_HUMAN B4DY56 58 kDa (+1) ATP synthase subunit beta, Eutheria ATPB_HUMAN P06576 57 kDa mitochondrial ATP-binding cassette sub- Homininae E7EUE1_HUMAN E7EUE1 78 kDa family D member 3 (+1) ATP-binding cassette sub- Euarchontoglires ABCE1_HUMAN P61221 67 kDa family E member 1 ATP-citrate synthase Homo sapiens ACLY_HUMAN P53396 121 kDa ATP-dependent RNA Homininae DHX9_HUMAN Q08211 141 kDa helicase A ATP-dependent RNA Homo sapiens DDX25_HUMAN Q9UHL0 55 kDa helicase DDX25 (+1) ATP-dependent RNA Homo sapiens B5BTY4_HUMAN B5BTY4 73 kDa helicase DDX3X (+1) ATP-dependent RNA Homo sapiens DHX29_HUMAN Q7Z478 155 kDa helicase DHX29 AT-rich interactive domain- Homo sapiens ARI4A_HUMAN P29374 143 kDa containing protein 4A Basic leucine zipper and W2 Eutheria BZW1_HUMAN Q7L1Q6 48 kDa domain-containing protein 1 Basigin Homo sapiens BASI_HUMAN P35613 42 kDa (+1) Beta-2-glycoprotein 1 Homo sapiens APOH_HUMAN P02749 38 kDa Beta-lactamase-like protein 2 Homo sapiens LACB2_HUMAN Q53H82 33 kDa Bifunctional Homo sapiens SYEP_HUMAN P07814 171 kDa glutamate/proline--tRNA ligase Brain acid soluble protein 1 Homo sapiens BASP1_HUMAN P80723 23 kDa BRCA1-A complex subunit Simiiformes BRE_HUMAN Q9NXR7 44 kDa BRE Brefeldin A-inhibited Homo sapiens BIG1_HUMAN Q9Y6D6 209 kDa guanine nucleotide-exchange protein 1 C-1-tetrahydrofolate Homo sapiens C1TC_HUMAN P11586 102 kDa synthase, cytoplasmic C4b-binding protein alpha Homo sapiens C4BPA_HUMAN P04003 67 kDa chain CAD protein Homo sapiens PYR1_HUMAN P27708 243 kDa Calnexin Homo sapiens CALX_HUMAN P27824 68 kDa Calpain small subunit 1 Hominidae CPNS1_HUMAN P04632 28 kDa Calpain-1 catalytic subunit Homo sapiens CAN1_HUMAN P07384 82 kDa Calpain-2 catalytic subunit Homo sapiens H0Y323_HUMAN H0Y323 83 kDa (+1) Calponin-2 Homo sapiens B4DDF4_HUMAN B4DDF4 33 kDa (+3) Calponin-3 Homo sapiens F8WA86_HUMAN F8WA86 31 kDa (+1) cAMP-dependent protein Hominoidea KAP0_HUMAN P10644 43 kDa kinase type I-alpha regulatory subunit Caprin-1 Catarrhini CAPR1_HUMAN Q14444 78 kDa Carbonyl reductase Homininae CBR1_HUMAN P16152 30 kDa [NADPH] 1 Carboxypeptidase N subunit 2 Homo sapiens CPN2_HUMAN P22792 61 kDa Casein kinase II subunit Eutheria CSK21_HUMAN P68400 45 kDa alpha (+3) Caspase recruitment domain- Homo sapiens CAR11_HUMAN Q9BXL7 133 kDa containing protein 11 Catenin alpha-1 Homo sapiens F6XBD8_HUMAN F6XBD8 103 kDa (+1) Catenin beta-1 Homo sapiens B5BU28_HUMAN B5BU28 86 kDa (+1) Cathepsin D Homo sapiens CATD_HUMAN P07339 45 kDa CCT7 protein Homo sapiens Q6IBT3_HUMAN Q6IBT3 59 kDa (+1) cDNA PSEC0119 fis, clone Homo sapiens Q8NBL9_HUMAN Q8NBL9 62 kDa PLACE1002376, highly (+1) similar to GPI transamidase component PIG-S Cell division control protein Theria CDC42_HUMAN P60953 21 kDa 42 homolog Cell migration-inducing Homo sapiens A1KYQ7_HUMAN A1KYQ7 105 kDa protein 17 (+1) Cellular apoptosis Homo sapiens A3RLL6_HUMAN A3RLL6 104 kDa susceptibility protein variant (+1) 2 Centromere protein F Homo sapiens CENPF_HUMAN P49454 368 kDa Ceruloplasmin Homo sapiens CERU_HUMAN P00450 122 kDa Chaperonin containing TCP1, Homo sapiens G5E9B2_HUMAN G5E9B2 59 kDa subunit 8 (Theta), isoform (+1) CRA_a Chloride intracellular channel Homininae CLIC1_HUMAN O00299 27 kDa protein 1 Chromobox protein homolog Eutheria CBX3_HUMAN Q13185 21 kDa 3 Citrate synthase, Homo sapiens CISY_HUMAN O75390 52 kDa mitochondrial (+1) Citron Homo sapiens Q2M5E1_HUMAN Q2M5E1 237 kDa C-Jun-amino-terminal Catarrhini JIP4_HUMAN O60271 146 kDa kinase-interacting protein 4 Clathrin heavy chain 1 Eutheria CLH1_HUMAN Q00610 192 kDa Clusterin Homo sapiens CLUS_HUMAN P10909 52 kDa Coactosin-like protein Hominidae COTL1_HUMAN Q14019 16 kDa Coagulation factor XIII A Homo sapiens F13A_HUMAN P00488 83 kDa chain (+1) Coatomer subunit alpha Homo sapiens COPA_HUMAN P53621 138 kDa Coatomer subunit beta Homo sapiens COPB_HUMAN P53618 107 kDa Coatomer subunit beta Homo sapiens COPB2_HUMAN P35606 102 kDa Coatomer subunit gamma Homo sapiens B3KND4_HUMAN B3KND4 76 kDa (+2) Coatomer subunit gamma-1 Homininae COPG1_HUMAN Q9Y678 98 kDa Cofilin 1 (Non-muscle), Homo sapiens G3V1A4_HUMAN G3V1A4 17 kDa isoform CRA_a (+1) COL21A1 protein Homo sapiens B7ZLK3_HUMAN B7ZLK3 99 kDa (+2) Complement C1q Homo sapiens C1QB_HUMAN P02746 27 kDa subcomponent subunit B Complement C1q Homo sapiens C1QC_HUMAN P02747 26 kDa subcomponent subunit C Complement C1s Homo sapiens A6NG18_HUMAN A6NG18 76 kDa subcomponent heavy chain (+1) Complement C3 Homo sapiens CO3_HUMAN P01024 187 kDa Complement C5 Homo sapiens CO5_HUMAN P01031 188 kDa Complement component 4A Homo sapiens A7E2V2_HUMAN A7E2V2 193 kDa (Rodgers blood group) (+7) Complement component C7 Homo sapiens CO7_HUMAN P10643 94 kDa Complement component C8 Homo sapiens CO8G_HUMAN P07360 22 kDa gamma chain Complement component C9 Homo sapiens CO9_HUMAN P02748 63 kDa Complement factor B Homo sapiens B4E1Z4_HUMAN B4E1Z4 141 kDa Complement factor H Homo sapiens CFAH_HUMAN P08603 139 kDa Complement factor I Homo sapiens CFAI_HUMAN P05156 66 kDa (+2) Complement factor Homo sapiens B3KVK6_HUMAN B3KVK6 39 kDa properdin, isoform CRA_c (+1) COP9 constitutive Homo sapiens B3KST5_HUMAN B3KST5 40 kDa photomorphogenic homolog (+2) subunit 4 (Arabidopsis), isoform CRA_a Copine I Homo sapiens A6PVH9_HUMAN A6PVH9 53 kDa (+2) Creatine kinase B-type Homo sapiens E7EUJ8_HUMAN E7EUJ8 39 kDa (+1) Cullin-4B Homo sapiens CUL4B_HUMAN Q13620 104 kDa (+1) Cullin-associated NEDD8- Eutheria CAND1_HUMAN Q86VP6 136 kDa dissociated protein 1 Cyclin-dependent kinase 1 Homininae CDK1_HUMAN P06493 34 kDa Cyclin-dependent kinase 12 Hominidae CDK12_HUMAN Q9NYV4 164 kDa Cysteine and glycine-rich Homo sapiens B3KVC9_HUMAN B3KVC9 18 kDa protein 1 (+1) Cytochrome b-c1 complex Homo sapiens QCR2_HUMAN P22695 48 kDa subunit 2, mitochondrial Cytochrome c Hominoidea CYC_HUMAN P99999 12 kDa Cytochrome c oxidase Homo sapiens A0S0W7_HUMAN A0S0W7 26 kDa subunit 2 (+80) Cytoplasmic aconitate Homo sapiens ACOC_HUMAN P21399 98 kDa hydratase Cytoplasmic dynein 1 heavy Eutheria DYHC1_HUMAN Q14204 532 kDa chain 1 Death-inducer obliterator 1 Homo sapiens DIDO1_HUMAN Q9BTC0 244 kDa Delta(3,5)-Delta(2,4)- Homo sapiens ECH1_HUMAN Q13011 36 kDa dienoyl-CoA isomerase, mitochondrial Desmoglein-2 Homo sapiens DSG2_HUMAN Q14126 122 kDa Desmoplakin Homo sapiens DESP_HUMAN P15924 332 kDa Developmentally-regulated Eutheria DRG1_HUMAN Q9Y295 41 kDa GTP-binding protein 1 Dihydrolipoyl Homininae DLDH_HUMAN P09622 54 kDa dehydrogenase, mitochondrial Dihydrolipoyllysine-residue Homo sapiens ODP2_HUMAN P10515 69 kDa acetyltransferase component of pyruvate dehydrogenase complex, mitochondrial Dihydropyrimidinase-related Catarrhini DPYL2_HUMAN Q16555 62 kDa protein 2 Dipeptidyl peptidase 3 Homo sapiens DPP3_HUMAN Q9NY33 83 kDa DNA damage-binding protein Simiiformes DDB1_HUMAN Q16531 127 kDa 1 DNA replication licensing Hominidae MCM2_HUMAN P49736 102 kDa factor MCM2 DNA replication licensing Homininae MCM3_HUMAN P25205 91 kDa factor MCM3 DNA replication licensing Homo sapiens MCM4_HUMAN P33991 97 kDa factor MCM4 DNA replication licensing Homo sapiens MCM5_HUMAN P33992 82 kDa factor MCM5 DNA-(apurinic or Homo sapiens APEX1_HUMAN P27695 36 kDa apyrimidinic site) lyase DNA-binding protein A Homo sapiens DBPA_HUMAN P16989 40 kDa (+1) DNA-binding protein Ikaros Catarrhini IKZF1_HUMAN Q13422 58 kDa DNA-dependent protein Homo sapiens PRKDC_HUMAN P78527 469 kDa kinase catalytic subunit DnaJ homolog subfamily A Eutheria DNJA1_HUMAN P31689 45 kDa member 1 DnaJ homolog subfamily B Hominidae DNJB1_HUMAN P25685 38 kDa member 1 (+1) DnaJ homolog subfamily C Homo sapiens DJC13_HUMAN O75165 254 kDa member 13 Dolichyl- Homo sapiens RPN1_HUMAN P04843 69 kDa diphosphooligosaccharide-- (+1) protein glycosyltransferase subunit 1 Dolichyl- Homo sapiens RPN2_HUMAN P04844 69 kDa diphosphooligosaccharide-- protein glycosyltransferase subunit 2 Dopamine beta-hydroxylase Homo sapiens DOPO_HUMAN P09172 69 kDa Dopamine receptor Homo sapiens Q4W4Y1_HUMAN Q4W4Y1 96 kDa interacting protein 4 (+2) Double-stranded RNA- Homo sapiens DSRAD_HUMAN P55265 136 kDa specific adenosine deaminase (+1) DPYSL3 protein Homo sapiens Q6DEN2_HUMAN Q6DEN2 74 kDa Dual oxidase 2 Homo sapiens DUOX2_HUMAN Q9NRD8 175 kDa Dynactin subunit 2 Homo sapiens DCTN2_HUMAN Q13561 44 kDa Dynamin-1-like protein Catarrhini DNM1L_HUMAN O00429 82 kDa Dynein heavy chain 1, Homo sapiens DYH1_HUMAN Q9P2D7 494 kDa axonemal Dynein heavy chain 2, Homo sapiens DYH2_HUMAN Q9P225 508 kDa axonemal Dystonin Homo sapiens DYST_HUMAN Q03001 861 kDa E3 ubiquitm/ISG15 ligase Homo sapiens TRI25_HUMAN Q14258 71 kDa TRIM25 E3 ubiquitin-protein ligase Homo sapiens HUWE1_HUMAN Q7Z6Z7 482 kDa HUWE1 E3 ubiquitin-protein ligase Homo sapiens UBR4_HUMAN Q5T4S7 574 kDa UBR4 Early endosome antigen 1 Homo sapiens EEA1_HUMAN Q15075 162 kDa EF-hand domain-containing Homo sapiens EFHD2_HUMAN Q96C19 27 kDa protein D2 Electron transfer flavoprotein Homo sapiens ETFA_HUMAN P13804 35 kDa subunit alpha, mitochondrial Elongation factor 1-alpha 1 Eutheria EF1A1_HUMAN P68104 50 kDa (+1) Elongation factor 1-delta Homo sapiens EF1D_HUMAN P29692 31 kDa Elongation factor 1-gamma Homo sapiens EF1G_HUMAN P26641 50 kDa Elongation factor 2 Hominidae EF2_HUMAN P13639 95 kDa Elongation factor Tu, Homininae EFTU_HUMAN P49411 50 kDa mitochondrial Endoplasmic reticulum Homo sapiens ERAP1_HUMAN Q9NZ08 107 kDa aminopeptidase 1 Endoplasmin Homo sapiens ENPL_HUMAN P14625 92 kDa (+1) Enoyl-CoA hydratase, Homo sapiens ECHM_HUMAN P30084 31 kDa mitochondrial Ephrin type-A receptor 2 Homo sapiens EPHA2_HUMAN P29317 108 kDa ERBB2IP protein Homo sapiens Q1RMC9_HUMAN Q1RMC9 154 kDa (+2) Erlin-1 Homininae ERLN1_HUMAN O75477 39 kDa Erlin-2 Hominidae ERLN2_HUMAN O94905 38 kDa Eukaryotic initiation factor Eutheria IF4A1_HUMAN P60842 46 kDa 4A-I Eukaryotic translation Catarrhini IF2A_HUMAN P05198 36 kDa initiation factor 2 subunit 1 Eukaryotic translation Homo sapiens EIF3A_HUMAN Q14152 167 kDa initiation factor 3 subunit A (+1) Eukaryotic translation Homo sapiens EIF3B_HUMAN P55884 92 kDa initiation factor 3 subunit B Eukaryotic translation Eutheria EIF3M_HUMAN Q7L2H7 43 kDa initiation factor 3 subunit M Eukaryotic translation Homo sapiens IF4G1_HUMAN Q04637 175 kDa initiation factor 4 gamma 1 Eukaryotic translation Homininae IF4H_HUMAN Q15056 27 kDa initiation factor 4H Eukaryotic translation Homo sapiens IF5_HUMAN P55010 49 kDa initiation factor 5 (+1) Eukaryotic translation Tetrapoda IF5A1_HUMAN P63241 17 kDa initiation factor 5A-1 (+1) Eukaryotic translation Catarrhini IF6_HUMAN P56537 27 kDa initiation factor 6 Exportin-1 Simiiformes XPO1_HUMAN O14980 123 kDa Exportin-7 Homininae XPO7_HUMAN Q9UIA9 124 kDa Exportin-T Homininae XPOT_HUMAN O43592 110 kDa Extended synaptotagmin-1 Homo sapiens ESYT1_HUMAN Q9BSJ8 123 kDa Extended synaptotagmin-2 Homo sapiens ESYT2_HUMAN A0FGR8 102 kDa F-actin-capping protein Homininae CAZA1_HUMAN P52907 33 kDa subunit alpha-1 F-actin-capping protein Hominidae CAPZB_HUMAN P47756 31 kDa subunit beta Far upstream element- Homo sapiens FUBP2_HUMAN Q92945 73 kDa binding protein 2 Farnesyl pyrophosphate Homininae FPPS_HUMAN P14324 48 kDa synthase FAS-associated factor 2 Homo sapiens FAF2_HUMAN Q96CS3 53 kDa Fascin Homininae FSCN1_HUMAN Q16658 55 kDa Fatty acid synthase Homo sapiens FAS_HUMAN P49327 273 kDa Fermitin family homolog 3 Homininae URP2_HUMAN Q86UX7 76 kDa Fibrillin-1 Homo sapiens FBN1_HUMAN P35555 312 kDa Fibrinogen alpha chain Homo sapiens FIBA_HUMAN P02671 95 kDa Fibrinogen beta chain Homo sapiens FIBB_HUMAN P02675 56 kDa Fibrinogen gamma chain Homo sapiens FIBG_HUMAN P02679 52 kDa Fibronectin Homo sapiens FINC_HUMAN P02751 263 kDa Filamin B Homo sapiens B2ZZ83_HUMAN B2ZZ83 282 kDa (+1) Filamin-A Homo sapiens FLNA_HUMAN P21333 281 kDa (+1) Filamin-C Homo sapiens FLNC_HUMAN Q14315 291 kDa Flotillin-1 Homo sapiens FLOT1_HUMAN O75955 47 kDa (+1) Fructose-bisphosphate Hominoidea ALDOA_HUMAN P04075 39 kDa aldolase A Fructose-bisphosphate Homininae ALDOC_HUMAN P09972 39 kDa aldolase C Fumarate hydratase, Homo sapiens FUMH_HUMAN P07954 55 kDa mitochondrial G patch domain-containing Homo sapiens GPTC8_HUMAN Q9UKJ3 164 kDa protein 8 Galectin-1 Homininae LEG1_HUMAN P09382 15 kDa Gelsolin Homo sapiens GELS_HUMAN P06396 86 kDa Glucosamine 6-phosphate N- Eutheria GNA1_HUMAN Q96EK6 21 kDa acetyltransferase Glucosamine--fructose-6- Homininae GFPT1_HUMAN Q06210 79 kDa phosphate aminotransferase [isomerizing] 1 Glucose-6-phosphate 1- Homininae G6PD_HUMAN P11413 59 kDa dehydrogenase Glucose-6-phosphate Homo sapiens G6PI_HUMAN P06744 63 kDa isomerase Glucosidase 2 subunit beta Homo sapiens GLU2B_HUMAN P14314 59 kDa Glutamate dehydrogenase 1, Homo sapiens DHE3_HUMAN P00367 61 kDa mitochondrial Glutamate--cysteine ligase Homo sapiens GSH1_HUMAN P48506 73 kDa catalytic subunit Glutaminase kidney isoform, Homininae GLSK_HUMAN O94925 73 kDa mitochondrial Glutamine--tRNA ligase Homo sapiens SYQ_HUMAN P47897 88 kDa Glutathione S-transferase Homo sapiens GSTO1_HUMAN P78417 28 kDa omega-1 Glutathione S-transferase P Homo sapiens GSTP1_HUMAN P09211 23 kDa Glyceraldehyde-3-phosphate Homininae G3P_HUMAN P04406 36 kDa dehydrogenase Glycine--tRNA ligase Homo sapiens SYG_HUMAN P41250 83 kDa Glycogen phosphorylase, Homo sapiens PYGB_HUMAN P11216 97 kDa brain form Glycogen phosphorylase, Homininae PYGL_HUMAN P06737 97 kDa liver form Golgi apparatus protein 1 Homo sapiens GSLG1_HUMAN Q92896 135 kDa Guanine nucleotide-binding Tetrapoda GBLP_HUMAN P63244 35 kDa protein subunit beta-2-like 1 Haptoglobin Homo sapiens HPT_HUMAN P00738 45 kDa HEAT repeat-containing Homo sapiens HTR5A_HUMAN Q86XA9 222 kDa protein 5A Heat shock 70 kDa protein Catarrhini HSP71_HUMAN P08107 70 kDa 1A/1B Heat shock 70 kDa protein 4 Homo sapiens HSP74_HUMAN P34932 94 kDa Heat shock cognate 71 kDa Eutheria HSP7C_HUMAN P11142 71 kDa protein Heat shock protein 105 kDa Hominidae HS105_HUMAN Q92598 97 kDa Heat shock protein beta-1 Catarrhini HSPB1_HUMAN P04792 23 kDa Heat shock protein HSP 90- Simiiformes HS90A_HUMAN P07900 85 kDa alpha Heat shock protein HSP 90- Homo sapiens HS90B_HUMAN P08238 83 kDa beta Hemoglobin subunit alpha Hominidae HBA_HUMAN P69905 15 kDa Hemoglobin subunit beta Homininae HBB_HUMAN P68871 16 kDa Hemoglobin subunit delta Homo sapiens HBD_HUMAN P02042 16 kDa Hemoglobin subunit gamma-2 Homininae HBG2_HUMAN P69892 16 kDa Hemopexin Homo sapiens HEMO_HUMAN P02790 52 kDa Heparin cofactor 2 Homo sapiens HEP2_HUMAN P05546 57 kDa Hepatoma-derived growth Homo sapiens HDGF_HUMAN P51858 27 kDa factor Hepatoma-derived growth Homo sapiens HDGR2_HUMAN Q7Z4V5 74 kDa factor-related protein 2 Hepatopoietin PCn127 Homo sapiens Q1AHP8_HUMAN Q1AHP8 28 kDa (+5) Heterogeneous nuclear Homo sapiens ROAA_HUMAN Q99729 36 kDa ribonucleoprotein A/B Heterogeneous nuclear Homo sapiens ROA1_HUMAN P09651 39 kDa ribonucleoprotein A1 Heterogeneous nuclear Eutheria HNRH1_HUMAN P31943 49 kDa ribonucleoprotein H Heterogeneous nuclear Eutheria HNRPK_HUMAN P61978 51 kDa ribonucleoprotein K (+1) Heterogeneous nuclear Eutheria HNRPQ_HUMAN O60506 70 kDa ribonucleoprotein Q Heterogeneous nuclear Eutheria HNRPR_HUMAN O43390 71 kDa ribonucleoprotein R (+1) Heterogeneous nuclear Homo sapiens HNRPU_HUMAN Q00839 91 kDa ribonucleoprotein U Heterogeneous nuclear Eutheria ROA2_HUMAN P22626 37 kDa ribonucleoproteins A2/B1 Heterogeneous nuclear Catarrhini HNRPC_HUMAN P07910 34 kDa ribonucleoproteins C1/C2 Hippocalcin-like protein 1 Homo sapiens HPCL1_HUMAN P37235 22 kDa Histidine-rich glycoprotein Homo sapiens HRG_HUMAN P04196 60 kDa HMG box transcription factor Homo sapiens BBX_HUMAN Q8WY36 105 kDa BBX Hsp70-binding protein 1 Homo sapiens HPBP1_HUMAN Q9NZL4 39 kDa Hydroxymethylglutaryl-CoA Homo sapiens HMCS1_HUMAN Q01581 57 kDa synthase, cytoplasmic (+1) Hypoxanthine-guanine Catarrhini HPRT_HUMAN P00492 25 kDa phosphoribosyltransferase Hypoxia up-regulated protein Homo sapiens HYOU1_HUMAN Q9Y4L1 111 kDa 1 Ig alpha-1 chain C region Homo sapiens IGHA1_HUMAN P01876 38 kDa Ig gamma-2 chain C region Homo sapiens IGHG2_HUMAN P01859 36 kDa Ig gamma-4 chain C region Homo sapiens IGHG4_HUMAN P01861 36 kDa Ig heavy chain V-I region Homo sapiens HV102_HUMAN P01743 13 kDa HG3 Ig kappa chain V-I region Homo sapiens KV102_HUMAN P01594 12 kDa AU Ig kappa chain V-II region Homo sapiens KV204_HUMAN P01617 12 kDa TEW Ig kappa chain V-III region Homo sapiens KV304_HUMAN P01622 12 kDa Ti Ig mu chain C region Homo sapiens IGHM_HUMAN P01871 49 kDa IGH@ protein Homo sapiens Q6GMX6_HUMAN Q6GMX6 51 kDa IGK@ protein Homo sapiens Q6PIL8_HUMAN Q6PIL8 26 kDa IGK@ protein Homo sapiens Q6P5S8_HUMAN Q6P5S8 26 kDa IGL@ protein Homo sapiens Q567P1_HUMAN Q567P1 25 kDa Immunoglobulin J chain Homo sapiens IGJ_HUMAN P01591 18 kDa Importin subunit alpha-2 Homo sapiens IMA2_HUMAN P52292 58 kDa (+1) Importin subunit beta-1 Hominoidea IMB1_HUMAN Q14974 97 kDa Importin-4 Homo sapiens IPO4_HUMAN Q8TEX9 119 kDa Importin-5 Homo sapiens IPO5_HUMAN O00410 124 kDa Importin-7 Simiiformes IPO7_HUMAN O95373 120 kDa Inositol-3-phosphate synthase Homo sapiens INO1_HUMAN Q9NPH2 61 kDa 1 Insulin-like growth factor 2 Homininae IF2B2_HUMAN Q9Y6M1 66 kDa mRNA-binding protein 2 Insulin-like growth factor- Homo sapiens ALS_HUMAN P35858 66 kDa binding protein complex acid (+1) labile subunit Integrin beta-1 Homininae ITB1_HUMAN P05556 88 kDa Integrin beta-4 Homo sapiens ITB4_HUMAN P16144 202 kDa Inter-alpha (Globulin) Homo sapiens B2RMS9_HUMAN B2RMS9 103 kDa inhibitor H4 (Plasma (+2) Kallikrein-sensitive glycoprotein) Inter-alpha-trypsin inhibitor Homo sapiens ITIH1_HUMAN P19827 101 kDa heavy chain H1 Inter-alpha-trypsin inhibitor Homo sapiens ITIH2_HUMAN P19823 106 kDa heavy chain H2 (+1) Intercellular adhesion Homo sapiens ICAM1_HUMAN P05362 58 kDa molecule 1 Interleukin enhancer-binding Eutheria ILF2_HUMAN Q12905 43 kDa factor 2 Interleukin enhancer-binding Homo sapiens ILF3_HUMAN Q12906 95 kDa factor 3 Iron-responsive element- Homo sapiens IREB2_HUMAN P48200 105 kDa binding protein 2 Iron-sulfur protein NUBPL Homo sapiens NUBPL_HUMAN Q8TB37 34 kDa Isocitrate dehydrogenase Homo sapiens IDHC_HUMAN O75874 47 kDa [NADP] cytoplasmic Junction plakoglobin Homininae PLAK_HUMAN P14923 82 kDa Kinesin-1 heavy chain Homo sapiens KINH_HUMAN P33176 110 kDa Kinesin-associated protein 3 Homininae KIFA3_HUMAN Q92845 91 kDa Kininogen-1 Homo sapiens KNG1_HUMAN P01042 72 kDa (+1) Kynurenine/alpha- Catarrhini AADAT_HUMAN Q8N5Z0 47 kDa aminoadipate aminotransferase, mitochondrial Lactoylglutathione lyase Homo sapiens LGUL_HUMAN Q04760 21 kDa LanC-like protein 2 Homo sapiens LANC2_HUMAN Q9NS86 51 kDa Large neutral amino acids Homo sapiens LAT1_HUMAN Q01650 55 kDa transporter small subunit 1 (+1) Large proline-rich protein Homo sapiens BAG6_HUMAN P46379 119 kDa BAG6 Leucine-rich alpha-2- Homo sapiens A2GL_HUMAN P02750 38 kDa glycoprotein Leucine-rich PPR motif- Homo sapiens LPPRC_HUMAN P42704 158 kDa containing protein, mitochondrial Leucine-rich repeat Homo sapiens LRRF1_HUMAN Q32MZ4 89 kDa flightless-interacting protein 1 Leucine--tRNA ligase, Homo sapiens SYLC_HUMAN Q9P2J5 134 kDa cytoplasmic Leukotriene A-4 hydrolase Homininae LKHA4_HUMAN P09960 69 kDa Liprin-alpha-1 Homo sapiens LIPA1_HUMAN Q13136 136 kDa L-lactate dehydrogenase A Homo sapiens LDHA_HUMAN P00338 37 kDa chain L-lactate dehydrogenase B Catarrhini LDHB_HUMAN P07195 37 kDa chain Lysine--tRNA ligase Homo sapiens SYK_HUMAN Q15046 68 kDa Lysophosphatidylcholine Homo sapiens PCAT1_HUMAN Q8NF37 59 kDa acyltransferase 1 Macrophage mannose Homo sapiens MRC1_HUMAN P22897 166 kDa receptor 1 (+1) Macrophage-capping protein Homo sapiens CAPG_HUMAN P40121 38 kDa Major vault protein Homo sapiens MVP_HUMAN Q14764 99 kDa Malate dehydrogenase, Homo sapiens MDHC_HUMAN P40925 36 kDa cytoplasmic Malate dehydrogenase, Homo sapiens MDHM_HUMAN P40926 36 kDa mitochondrial (+1) Mannosyl-oligosaccharide Homo sapiens MOGS_HUMAN Q13724 92 kDa glucosidase (+1) Microsomal glutathione S- Homininae MGST1_HUMAN P10620 18 kDa transferase 1 Microtubule-actin cross- Homo sapiens MACF1_HUMAN Q9UPN3 838 kDa linking factor 1, isoforms 1/2/3/5 Microtubule-associated Homininae MAP1B_HUMAN P46821 271 kDa protein 1B Microtubule-associated Homo sapiens MAP4_HUMAN P27816 121 kDa protein 4 MKI67 FHA domain- Homo sapiens MK67I_HUMAN Q9BYG3 34 kDa interacting nucleolar phosphoprotein Moesin Catarrhini MOES_HUMAN P26038 68 kDa Monofunctional C1- Homo sapiens C1TM_HUMAN Q6UB35 106 kDa tetrahydrofolate synthase, mitochondrial Msx2-interacting protein Homo sapiens MINT_HUMAN Q96T58 402 kDa Multifunctional protein Homo sapiens PUR6_HUMAN P22234 47 kDa ADE2 Myb-binding protein 1A Homo sapiens MBB1A_HUMAN Q9BQG0 149 kDa Myoferlin Homo sapiens MYOF_HUMAN Q9NZM1 235 kDa Myosin-10 Homininae MYH10_HUMAN P35580 229 kDa Myosin-6 Homo sapiens MYH6_HUMAN P13533 224 kDa Myosin-9 Homo sapiens MYH9_HUMAN P35579 227 kDa N-acetylmuramoyl-L-alanine Homo sapiens PGRP2_HUMAN Q96PD5 62 kDa amidase NACHT, LRR and PYD Homo sapiens NALP2_HUMAN Q9NX02 121 kDa domains-containing protein 2 NAD(P)H dehydrogenase Homininae NQO1_HUMAN P15559 31 kDa [quinone] 1 NAD(P)H-hydrate epimerase Homo sapiens NNRE_HUMAN Q8NCW5 32 kDa NADH-cytochrome b5 Homo sapiens NB5R3_HUMAN P00387 34 kDa reductase 3 NADPH--cytochrome P450 Homo sapiens NCPR_HUMAN P16435 77 kDa reductase Nascent polypeptide- Theria NACA_HUMAN Q13765 23 kDa associated complex subunit alpha Nebulin Homo sapiens NEBU_HUMAN P20929 773 kDa Nesprin-2 Homo sapiens SYNE2_HUMAN Q8WXH0 796 kDa Neuroblast differentiation- Homo sapiens AHNK_HUMAN Q09666 629 kDa associated protein AHNAK Neurofibromin Catarrhini NF1_HUMAN P21359 319 kDa Neutral alpha-glucosidase Homo sapiens GANAB_HUMAN Q14697 107 kDa AB Niban-like protein 2 Homo sapiens NIBL2_HUMAN Q86XR2 77 kDa Nicotinamide Homininae NAMPT_HUMAN P43490 56 kDa phosphoribosyltransferase Nitrilase homolog 1 Homo sapiens NIT1_HUMAN Q86X76 36 kDa N-lysine methyltransferase Homo sapiens SETD6_HUMAN Q8TBK2 53 kDa SETD6 Nodal modulator 3 Homo sapiens NOMO3_HUMAN P69849 134 kDa (+3) Nuclear factor erythroid 2- Homo sapiens NF2L3_HUMAN Q9Y4A8 76 kDa related factor 3 (+1) Nuclear migration protein Homo sapiens NUDC_HUMAN Q9Y266 38 kDa nudC Nucleolar GTP-binding Homo sapiens NOG2_HUMAN Q13823 84 kDa protein 2 Nucleolar RNA helicase 2 Homo sapiens DDX21_HUMAN Q9NR30 87 kDa Nucleolin Homo sapiens NUCL_HUMAN P19338 77 kDa Nucleophosmin Homininae NPM_HUMAN P06748 33 kDa Nucleoside diphosphate Hominidae NDKA_HUMAN P15531 17 kDa kinase A Nucleosome assembly Homininae NP1L1_HUMAN P55209 45 kDa protein 1-like 1 Obg-like ATPase 1 Eutheria OLA1_HUMAN Q9NTK5 45 kDa Ornithine aminotransferase, Homininae OAT_HUMAN P04181 49 kDa mitochondrial Oxysterol-binding protein 1 Homo sapiens OSBP1_HUMAN P22059 89 kDa Pachytene checkpoint protein Homo sapiens PCH2_HUMAN Q15645 49 kDa 2 homolog Peptidyl-prolyl cis-trans Catarrhini Q567Q0_HUMAN Q567Q0 11 kDa isomerase A Peptidyl-prolyl cis-trans Catarrhini PPIB_HUMAN P23284 24 kDa isomerase B Peroxiredoxin-1 Homininae PRDX1_HUMAN Q06830 22 kDa Peroxiredoxin-2 Catarrhini PRDX2_HUMAN P32119 22 kDa Peroxiredoxin-5, Homo sapiens PRDX5_HUMAN P30044 22 kDa mitochondrial Peroxiredoxin-6 Hominidae PRDX6_HUMAN P30041 25 kDa Peroxisomal multifunctional Homo sapiens DHB4_HUMAN P51659 80 kDa enzyme type 2 Phosphatidylinositol-binding Homo sapiens PICAL_HUMAN Q13492 71 kDa clathrin assembly protein Phosphatidylinositol-glycan- Homo sapiens PHLD_HUMAN P80108 92 kDa specific phospholipase D Phosphoglucomutase-1 Homo sapiens PGM1_HUMAN P36871 61 kDa Phosphoglycerate kinase 1 Euarchontoglires PGK1_HUMAN P00558 45 kDa Phosphoglycerate mutase 1 Eutheria PGAM1_HUMAN P18669 29 kDa Phosphoribosylglycinamide Homo sapiens Q3B7A7_HUMAN Q3B7A7 108 kDa formyltransferase, (+1) phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase Phosphoserine Homo sapiens SERC_HUMAN Q9Y617 40 kDa aminotransferase PIG48 Homo sapiens Q2TU64_HUMAN Q2TU64 61 kDa Pigment epithelium-derived Homo sapiens PEDF_HUMAN P36955 46 kDa factor Plasma kallikrein Homo sapiens KLKB1_HUMAN P03952 71 kDa Plasma protease C1 inhibitor Homo sapiens IC1_HUMAN P05155 55 kDa Plasminogen Homo sapiens PLMN_HUMAN P00747 91 kDa Plasminogen activator Hominoidea PAIRB_HUMAN Q8NC51 45 kDa inhibitor 1 RNA-binding protein Platelet-activating factor Homininae PA1B3_HUMAN Q15102 26 kDa acetylhydrolase IB subunit gamma Plectin Homo sapiens PLEC_HUMAN Q15149 532 kDa Poly [ADP-ribose] Homo sapiens PARP1_HUMAN P09874 113 kDa polymerase 1 Poly(RC) binding protein 2 Euarchontoglires Q68Y55_HUMAN Q68Y55 35 kDa Poly(rC)-binding protein 1 Eutheria PCBP1_HUMAN Q15365 37 kDa Polyadenylate-binding Eutheria PABP1_HUMAN P11940 71 kDa protein 1 Polyadenylate-binding Homo sapiens PABP4_HUMAN Q13310 71 kDa protein 4 (+1) Polymerase I and transcript Homo sapiens PTRF_HUMAN Q6NZI2 43 kDa release factor Prelamin-A/C Homininae LMNA_HUMAN P02545 74 kDa (+3) Pre-mRNA-processing factor Homo sapiens PR40A_HUMAN O75400 109 kDa 40 homolog A Prenylcysteine oxidase 1 Homo sapiens PCYOX_HUMAN Q9UHG3 57 kDa Probable ATP-dependent Hominidae DDX17_HUMAN Q92841 80 kDa RNA helicase DDX17 Probable ATP-dependent Hominoidea DDX6_HUMAN P26196 54 kDa RNA helicase DDX6 Probable E3 ubiquitin-protein Homo sapiens HERC1_HUMAN Q15751 532 kDa ligase HERC1 Probable phospholipid- Homo sapiens AT10D_HUMAN Q9P241 160 kDa transporting ATPase VD Probable RNA-binding Homo sapiens RBM20_HUMAN Q5T481 134 kDa protein 20 Profilin-1 Catarrhini PROF1_HUMAN P07737 15 kDa Programmed cell death Homo sapiens PDCD4_HUMAN Q53EL6 52 kDa protein 4 Prohibitin Eutheria PHB_HUMAN P35232 30 kDa Prohibitin-2 Euarchontoglires PHB2_HUMAN Q99623 33 kDa Proliferating cell nuclear Homo sapiens Q6FI35_HUMAN Q6FI35 29 kDa antigen Proline-, glutamic acid- and Homo sapiens PELP1_HUMAN Q8IZL8 120 kDa leucine-rich protein 1 Prolyl 3-hydroxylase 1 Homo sapiens P3H1_HUMAN Q32P28 83 kDa Prolyl endopeptidase Homo sapiens PPCE_HUMAN P48147 81 kDa Proteasome activator Hominidae PSME1_HUMAN Q06323 29 kDa complex subunit 1 Proteasome activator Eutheria PSME3_HUMAN P61289 30 kDa complex subunit 3 Proteasome subunit alpha Eutheria PSA1_HUMAN P25786 30 kDa type-1 Proteasome subunit alpha Eutheria PSA3_HUMAN P25788 28 kDa type-3 (+1) Proteasome subunit alpha Eutheria PSA4_HUMAN P25789 29 kDa type-4 Proteasome subunit alpha Eutheria PSA5_HUMAN P28066 26 kDa type-5 (+1) Proteasome subunit alpha Eutheria PSA6_HUMAN P60900 27 kDa type-6 Proteasome subunit alpha Homo sapiens PSA7_HUMAN O14818 28 kDa type-7 Proteasome subunit beta Homo sapiens PSB3_HUMAN P49720 23 kDa type-3 Proteasome subunit beta Hominidae PSB5_HUMAN P28074 28 kDa type-5 Protein AHNAK2 Homo sapiens AHNK2_HUMAN Q8IVF2 617 kDa Protein AMBP Homo sapiens AMBP_HUMAN P02760 39 kDa Protein arginine N- Catarrhini ANM5_HUMAN O14744 73 kDa methyltransferase 5 Protein diaphanous homolog Homo sapiens DIAP1_HUMAN O60610 141 kDa 1 (+2) Protein disulfide-isomerase Homo sapiens PDIA1_HUMAN P07237 57 kDa Protein disulfide-isomerase Hominidae PDIA3_HUMAN P30101 57 kDa A3 Protein disulfide-isomerase Homo sapiens PDIA4_HUMAN P13667 73 kDa A4 Protein disulfide-isomerase Homo sapiens PDIA6_HUMAN Q15084 48 kDa A6 Protein DJ-1 Hominoidea PARK7_HUMAN Q99497 20 kDa Protein FAM49B Eutheria FA49B_HUMAN Q9NUQ9 37 kDa Protein flightless-1 homolog Homo sapiens FLII_HUMAN Q13045 145 kDa Protein kinase C inhibitor-2 Homo sapiens Q8WYJ5_HUMAN Q8WYJ5 14 kDa (+1) Protein kinase, cGMP- Theria Q5JP05_HUMAN Q5JP05 32 kDa dependent, type I Protein phosphatase 1G Homininae PPM1G_HUMAN O15355 59 kDa Protein S100-A10 Theria S10AA_HUMAN P60903 11 kDa Protein SEC13 homolog Homo sapiens SEC13_HUMAN P55735 36 kDa Protein SET Homininae SET_HUMAN Q01105 33 kDa Protein transport protein Homo sapiens SC24C_HUMAN P53992 118 kDa Sec24C Protein-glutamine gamma- Homo sapiens TGM2_HUMAN P21980 77 kDa glutamyltransferase 2 Puromycin-sensitive Homininae PSA_HUMAN P55786 103 kDa aminopeptidase Putative pre-mRNA-splicing Homininae DHX15_HUMAN O43143 91 kDa factor ATP-dependent RNA helicase DHX15 Putative RNA-binding Simiiformes LC7L2_HUMAN Q9Y383 47 kDa protein Luc7-like 2 PWWP domain-containing Homo sapiens MUML1_HUMAN Q5H9M0 79 kDa protein MUM1L1 Pyridoxal kinase Homo sapiens PDXK_HUMAN O00764 35 kDa Pyrroline-5-carboxylate Homo sapiens A6NFM2_HUMAN A6NFM2 33 kDa reductase (+3) Pyruvate kinase isozymes Homininae KPYM_HUMAN P14618 58 kDa M1/M2 Rab GDP dissociation Hominoidea GDIB_HUMAN P50395 51 kDa inhibitor beta (+1) RAB1B protein Homo sapiens Q6FIG4_HUMAN Q6FIG4 22 kDa (+1) Ran-specific GTPase- Hominidae RANG_HUMAN P43487 23 kDa activating protein Ras GTPase-activating Homo sapiens NGAP_HUMAN Q9UJF2 129 kDa protein nGAP Ras GTPase-activating Homo sapiens G3BP1_HUMAN Q13283 52 kDa protein-binding protein 1 (+2) Ras GTPase-activating-like Homo sapiens IQGA1_HUMAN P46940 189 kDa protein IQGAP1 Ras-related protein Rab-14 Euteleostomi RAB14_HUMAN P61106 24 kDa Ras-related protein Rab-21 Catarrhini RAB21_HUMAN Q9UL25 24 kDa Ras-related protein Rab-5C Catarrhini RAB5C_HUMAN P51148 23 kDa Ras-related protein Rab-7a Theria RAB7A_HUMAN P51149 23 kDa Receptor-type tyrosine- Homo sapiens PTPRS_HUMAN Q13332 217 kDa protein phosphatase S Replication factor C subunit Hominoidea RFC3_HUMAN P40938 41 kDa 3 Reticulon-4 Homo sapiens RTN4_HUMAN Q9NQC3 130 kDa Rho GTPase-activating Homo sapiens RHG32_HUMAN A7KAX9 231 kDa protein 32 Rho guanine nucleotide Homo sapiens ARHG1_HUMAN Q92888 102 kDa exchange factor 1 Ribonuclease inhibitor Homo sapiens RINI_HUMAN P13489 50 kDa Ribonucleoside-diphosphate Homo sapiens RIR2_HUMAN P31350 45 kDa reductase subunit M2 Ribosome biogenesis protein Homo sapiens BRX1_HUMAN Q8TDN6 41 kDa BRX1 homolog Ribosome-binding protein 1 Homo sapiens RRBP1_HUMAN Q9P2E9 152 kDa ROBO2 isoform a Homo sapiens Q19AB5_HUMAN Q19AB5 153 kDa (+1) RPL14 protein Homo sapiens Q6IPH7_HUMAN Q6IPH7 24 kDa RuvB-like 1 Eutheria RUVB1_HUMAN Q9Y265 50 kDa RuvB-like 2 Catarrhini RUVB2_HUMAN Q9Y230 51 kDa Sacsin Homo sapiens SACS_HUMAN Q9NZJ4 521 kDa Sarcoplasmic/endoplasmic Homo sapiens AT2A2_HUMAN P16615 115 kDa reticulum calcium ATPase 2 Sec1 family domain- Homo sapiens SCFD1_HUMAN Q8WVM8 72 kDa containing protein 1 SEC23-interacting protein Homo sapiens S23IP_HUMAN Q9Y6Y8 111 kDa Secretory carrier-associated Homininae SCAM3_HUMAN O14828 38 kDa membrane protein 3 Septin-2 Catarrhini SEPT2_HUMAN Q15019 41 kDa Sequestosome-1 Homo sapiens SQSTM_HUMAN Q13501 48 kDa Serine Homo sapiens GLYM_HUMAN P34897 56 kDa hydroxymethyltransferase, (+1) mitochondrial Serine palmitoyltransferase 2 Homo sapiens SPTC2_HUMAN O15270 63 kDa Serine/arginine-rich splicing Amniota SRSF3_HUMAN P84103 19 kDa factor 3 Serine/threonine-protein Homo sapiens NEK9_HUMAN Q8TD19 107 kDa kinase Nek9 Serine/threonine-protein Homo sapiens OXSR1_HUMAN O95747 58 kDa kinase OSR1 Serine/threonine-protein Homo sapiens PAK2_HUMAN Q13177 58 kDa kinase PAK 2 Serine/threonine-protein Simiiformes 2AAA_HUMAN P30153 65 kDa phosphatase 2A 65 kDa regulatory subunit A alpha isoform Serine/threonine-protein Homo sapiens PTPA_HUMAN Q15257 41 kDa phosphatase 2A activator Serine/threonine-protein Theria PP2AA_HUMAN P67775 36 kDa phosphatase 2A catalytic (+1) subunit alpha isoform Serine--tRNA ligase, Homo sapiens SYSC_HUMAN P49591 59 kDa cytoplasmic (+1) Serotransferrin Homo sapiens TRFE_HUMAN P02787 77 kDa (+1) Serpin B6 Homo sapiens SPB6_HUMAN P35237 43 kDa Serum albumin Homo sapiens ALBU_HUMAN P02768 69 kDa Serum albumin Bos taurus ALBU_BOVIN P02769 69 kDa Serum amyloid A-4 protein Homo sapiens SAA4_HUMAN P35542 15 kDa Serum amyloid P-component Homo sapiens SAMP_HUMAN P02743 25 kDa Serum Homo sapiens PON1_HUMAN P27169 40 kDa paraoxonase/arylesterase 1 SH2 domain-containing Homo sapiens SHE_HUMAN Q5VZ18 54 kDa adapter protein E SH3 domain-containing Homo sapiens SH3K1_HUMAN Q96B97 73 kDa kinase-binding protein 1 (+1) Sialic acid synthase Homininae SIAS_HUMAN Q9NR45 40 kDa Signal peptide, CUB and Homo sapiens SCUB2_HUMAN Q9NQ36 110 kDa EGF-like domain-containing protein 2 Signal recognition particle 54 Eutheria SRP54_HUMAN P61011 56 kDa kDa protein Signal recognition particle 72 Homo sapiens SRP72_HUMAN O76094 75 kDa kDa protein Small nuclear Eutheria RSMB_HUMAN P14678 25 kDa ribonucleoprotein-associated (+4) proteins B and B Sodium/potassium- Homo sapiens AT1A1_HUMAN P05023 113 kDa transporting ATPase subunit alpha-1 Solute carrier family 2, Homininae GTR1_HUMAN P11166 54 kDa facilitated glucose transporter (+1) member 1 Sorbitol dehydrogenase Homo sapiens DHSO_HUMAN Q00796 38 kDa Sorting nexin-6 Homo sapiens SNX6_HUMAN Q9UNH7 47 kDa SP-A receptor subunit SP- Homo sapiens Q5QD01_HUMAN Q5QD01 181 kDa R210 alphaS (+1) Spectrin alpha chain, brain Homo sapiens SPTA2_HUMAN Q13813 285 kDa Spectrin beta chain, brain 1 Homininae SPTB2_HUMAN Q01082 275 kDa Spectrin repeat containing, Homo sapiens Q5JV23_HUMAN Q5JV23 1005 kDa nuclear envelope 1 (+1) Sphingosine-1-phosphate Homo sapiens SGPL1_HUMAN O95470 64 kDa lyase 1 Spliceosome RNA helicase Theria DX39B_HUMAN Q13838 49 kDa DDX39B Splicing factor 3B subunit 3 Eutheria SF3B3_HUMAN Q15393 136 kDa Splicing factor, proline- and Eutheria SFPQ_HUMAN P23246 76 kDa glutamine-rich (+1) Staphylococcal nuclease Homo sapiens SND1_HUMAN Q7KZF4 102 kDa domain-containing protein 1 STIP1 protein Homo sapiens Q3ZCU9_HUMAN Q3ZCU9 68 kDa Stomatin-like protein 2 Hominidae STML2_HUMAN Q9UJZ1 39 kDa Stress-70 protein, Homo sapiens GRP75_HUMAN P38646 74 kDa mitochondrial Structural maintenance of Homo sapiens SMHD1_HUMAN A6NHR9 226 kDa chromosomes flexible hinge domain-containing protein 1 Superoxide dismutase [CuZn] Homininae SODC_HUMAN P00441 16 kDa Talin-1 Homo sapiens TLN1_HUMAN Q9Y490 270 kDa T-complex protein 1 subunit Catarrhini TCPA_HUMAN P17987 60 kDa alpha T-complex protein 1 subunit Catarrhini TCPB_HUMAN P78371 57 kDa beta T-complex protein 1 subunit Hominoidea TCPD_HUMAN P50991 58 kDa delta T-complex protein 1 subunit Catarrhini TCPE_HUMAN P48643 60 kDa epsilon T-complex protein 1 subunit Hominoidea TCPZ_HUMAN P40227 58 kDa zeta Testin Hominidae TES_HUMAN Q9UGI8 48 kDa Thioredoxin reductase 1, Homo sapiens TRXR1_HUMAN Q16881 71 kDa cytoplasmic Thioredoxin-dependent Homininae PRDX3_HUMAN P30048 28 kDa peroxide reductase, mitochondrial THO complex subunit 4 Homo sapiens THOC4_HUMAN Q86V81 27 kDa Threonine--tRNA ligase, Homo sapiens SYTC_HUMAN P26639 83 kDa cytoplasmic Tight junction protein ZO-2 Homo sapiens ZO2_HUMAN Q9UDY2 134 kDa Titin Homo sapiens TITIN_HUMAN Q8WZ42 3816 kDa Transcription elongation Homo sapiens ELOA1_HUMAN Q14241 90 kDa factor B polypeptide 3 Transcription factor p65 Homininae TF65_HUMAN Q04206 60 kDa Transcription intermediary Homininae TIF1B_HUMAN Q13263 89 kDa factor 1-beta Transferrin receptor protein 1 Homo sapiens TFR1_HUMAN P02786 85 kDa Transgelin-2 Catarrhini TAGL2_HUMAN P37802 22 kDa Transitional endoplasmic Euarchontoglires TERA_HUMAN P55072 89 kDa reticulum ATPase Transketolase Homo sapiens TKT_HUMAN P29401 68 kDa Translational activator GCN1 Homo sapiens GCN1L_HUMAN Q92616 293 kDa Translin Euarchontoglires TSN_HUMAN Q15631 26 kDa Translocon-associated Homo sapiens SSRA_HUMAN P43307 32 kDa protein subunit alpha Transmembrane emp24 Homo sapiens TMEDA_HUMAN P49755 25 kDa domain-containing protein 10 Transportin-1 Homininae TNPO1_HUMAN Q92973 102 kDa Trifunctional enzyme subunit Homo sapiens ECHA_HUMAN P40939 83 kDa alpha, mitochondrial Triosephosphate isomerase Homininae TPIS_HUMAN P60174 31 kDa tRNA (cytosine(34)-C(5))- Homo sapiens NSUN2_HUMAN Q08J23 86 kDa methyltransferase tRNA-splicing ligase RtcB Eutheria RTCB_HUMAN Q9Y3I0 55 kDa homolog Tropomodulin-3 Homo sapiens TMOD3_HUMAN Q9NYL9 40 kDa Tropomyosin 3 Eutheria Q5VU58_HUMAN Q5VU58 29 kDa Tryptophan--tRNA ligase, Hominidae SYWC_HUMAN P23381 53 kDa cytoplasmic Tubulin alpha-1C chain Hominidae TBA1C_HUMAN Q9BQE3 50 kDa Tubulin alpha-4A chain Eutheria TBA4A_HUMAN P68366 50 kDa Tubulin beta chain Amniota TBB5_HUMAN P07437 50 kDa Tubulin beta-4B chain Theria TBB4B_HUMAN P68371 50 kDa (+1) Tubulin beta-6 chain Hominoidea TBB6_HUMAN Q9BUF5 50 kDa Tyrosine-protein phosphatase Homo sapiens PTN13_HUMAN Q12923 277 kDa non-receptor type 13 U5 small nuclear Hominidae U520_HUMAN O75643 245 kDa ribonucleoprotein 200 kDa helicase Ubiquitin carboxyl-terminal Homininae UBP5_HUMAN P45974 96 kDa hydrolase 5 Ubiquitin carboxyl-terminal Homo sapiens UBP8_HUMAN P40818 128 kDa hydrolase 8 Ubiquitin carboxyl-terminal Hominidae UCHL1_HUMAN P09936 25 kDa hydrolase isozyme L1 Ubiquitin thioesterase Eutheria OTUB1_HUMAN Q96FW1 31 kDa OTUB1 Ubiquitin-60S ribosomal Tetrapoda RL40_HUMAN P62987 15 kDa protein L40 (+3) Ubiquitin-associated protein Homo sapiens UBP2L_HUMAN Q14157 115 kDa 2-like Ubiquitin-like modifier- Homo sapiens UBA1_HUMAN P22314 118 kDa activating enzyme 1 UDP-glucose 6- Hominidae UGDH_HUMAN O60701 55 kDa dehydrogenase UDP-glucose: glycoprotein Homo sapiens UGGG1_HUMAN Q9NYU2 177 kDa glucosyltransferase 1 UDP-N-acetylhexosamine Homo sapiens UAP1_HUMAN Q16222 59 kDa pyrophosphorylase UMP-CMP kinase Homo sapiens KCY_HUMAN P30085 22 kDa (+2) Unc-45 homolog A Homo sapiens A8K6F7_HUMAN A8K6F7 102 kDa (C. elegans), isoform CRA_a (+1) Unconventional myosin-Ic Homo sapiens MYO1C_HUMAN O00159 122 kDa Unconventional myosin-Ie Homo sapiens MYO1E_HUMAN Q12965 127 kDa Unconventional myosin-VI Homo sapiens MYO6_HUMAN Q9UM54 150 kDa Uridine 5-monophosphate Homo sapiens UMPS_HUMAN P11172 52 kDa synthase Uridine phosphorylase 1 Homininae UPP1_HUMAN Q16831 34 kDa UTP--glucose-1-phosphate Hominidae UGPA_HUMAN Q16851 57 kDa uridylyltransferase UV excision repair protein Homininae RD23B_HUMAN P54727 43 kDa RAD23 homolog B
Example 11Summary of the Methods of the Present Disclosure Versus Commercially Available Kits
[0169] As can be seen from the results above, the methods of the present disclosure provide a mechanism to isolate biologically relevant circulating cell free nucleic acids along with associated cellular components, such as lipids and polypeptides. Both the nucleic acid and cellular components can be used to determine the condition of a subject and to analyze a variety of biomarkers. Furthermore the methods of the present disclosure selectively isolate active genomic regions, selecting for the most relevant nucleic acid targets for analysis. In addition to increased purity and yield, the methods of the present disclosure also use significantly smaller volumes of sample starting material for the analysis. In summary, the methods of the present disclosure provide significant advantage over the methods known in the prior art. A comparison of the characteristic of the methods of the present disclosure versus the prior art is provided in Table 11.
TABLE-US-00011 Methods of the Prior Art Present Disclosure Main Principle Random, blinded Selective enrichment of isolation of nucleic acid lipid/polypeptide associated nucleic acid complexes (active genomic regions) Genomic Poor-Fair Excellent Representation of Active Gene (eg, oncogenes) Starting Large Volume Very Small Volume Material (eg, plasma) Yield Low High Functionality No Yes Studies ID Associated No Yes Biomarkers Sensitivity/ Low (solely depends on High Specificity extraction efficiency)