Mixed cell diagnostic systems for detection of respiratory, herpes and enteric viruses

09689018 ยท 2017-06-27

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention generally relates to the field of diagnostic microbiology, and, more particularly, to compositions and methods for detecting and differentiating one or more viruses or other intracellular parasites present in a specimen. The present invention also provides compositions and methods to evaluate the susceptibility of organisms to antimicrobial agents.

Claims

1. A composition comprising cells suitable for the detection of a respiratory virus, wherein the cells comprise mink lung cells, H292 cells and A549 cells.

2. The composition according to claim 1, wherein the mink lung cells are Mv1Lu cells.

3. The composition of claim 1, wherein the composition is suitable for detection of a parainfluenza virus, respiratory syncytial virus (RSV), adenovirus, influenza viruses, and cytomegalovirus (CMV).

4. The composition of claim 1, wherein the composition is suitable for detection of a herpes virus.

Description

DESCRIPTION OF THE INVENTION

(1) The present invention generally relates to the field of diagnostic microbiology, and more particularly, to compositions and methods for detecting and differentiating one or more viruses or other intracellular parasites present in a specimen. The present invention also provides compositions and methods to evaluate the susceptibility of organisms to antimicrobial agents.

(2) The present invention provides methods and compositions for the detection of several different viruses, as well as other intracellular organisms present in clinical and other specimens, in a single cell culture unit comprised of a mixture of cells. The mixture of cells is grown in a manner to co-exist as a monolayer of relatively equivalent ratio and demonstrating complementary susceptibilities to a wider range of viruses and/or other organisms than could be detected by each individual cell line. For example, the viral assays involve inoculating a cell mixture with a specimen suspected of containing a virus, allowing a sufficient period of time for the virus infectious cycle to proceed, followed by the detection and/or quantification of the number of virus-infected cells to determine the number of infectious virions in the specimen. This detection step may be accomplished using any number of available confirmation methods, including specific viral antigen detection using antigen-specific antibodies, nucleic acid probes, and reporter gene detection. The assay also provides reliable methods and compositions for the quantification of the number of infectious virions present in a sample. In addition, the methods and compositions of the present invention are sufficiently sensitive that the presence of a single virion in a specimen may be detected.

(3) The present invention also provides compositions comprising novel mixtures of various cell types traditionally used in single cell assays. In preferred embodiments, the cells are mixed to produce mixed monolayer cell cultures. One such mixed cell culture includes mink lung (e.g., Mv1Lu) cells co-cultivated with human mucoepidermoid cells (e.g., NCI-H292; also referred to as H292 cells). This cell mixture is susceptible to viruses such as influenza A, influenza B, RSV, parainfluenza types 1, 2, and 3, adenovirus, and CMV (i.e., the group of viruses most commonly associated with respiratory virus disease). In other mixed cultures, buffalo green monkey kidney cells (BGMK) are co-cultivated with NCI-H292 cells for the detection and identification of enteroviruses, such as poliovirus, echoviruses and Coxsackie virus (e.g., Coxsackie A and B viruses), and numbered EV strains. In addition to enteroviruses, it is contemplated that the present invention encompasses cell types that are susceptible to picornaviruses such as Hepatitis A.

(4) The present invention also provides compositions comprising novel mixtures of different cell types traditionally used in single cell assays that are co-cultivated with genetically engineered cells. In particularly preferred embodiments, the genetically engineered cell line is a DNA-transfected cell line that is susceptible to infection by a virus, the cell line having been stably transformed with a chimeric gene comprising a virus-inducible promoter and a gene coding for an enzyme, the expression of the enzyme being dependent upon the presence of the virus. Such genetically engineered cells are described, for example, in U.S. Pat. No. 5,418,132, herein incorporated by reference. In one preferred embodiment, a cell mixture includes human lung fibroblasts (e.g., MRC-5 cells) co-cultivated with a stable baby hamster kidney (BHK) cell line, the genome of which has been engineered to contain the E. coli lacZ gene behind (i.e., 3 to) an inducible HSV promoter, HSV-1 ICP6 promoter (BHK/ICP6LacZ-5 cells are available from the ATCC as CRL-12072). This cell mixture is susceptible to infection by CMV and HSV types 1 and 2.

(5) In yet another embodiment, the present invention provides compositions comprising novel mixtures of different types of genetically engineered cells. In particularly preferred embodiments, the genetically engineered cell line is a DNA-transfected cell line that is susceptible to infection by a virus, the cell line having been stably transformed with a chimeric gene comprising a virus-inducible promoter and a gene coding for an enzyme, the expression of the enzyme being dependent upon the presence of the virus. The second genetically engineered cell line is a DNA-transfected cell line susceptible to viral infection and stably transformed with a chimeric gene comprising a virus-inducible promoter and a gene encoding a second enzyme (i.e., an enzyme that is different from that associated with the first cell line) whose expression is dependent upon the presence of a second virus. In one preferred embodiment, a cell mixture is prepared in which engineered BHK cells (e.g., BHK/ICP6/LacZ-5 cells) are co-cultivated with a stable mink lung cell line (Mv1Lu), the genome of which has been engineered to contain an inducible CMV promoter (the CMV UL45 promoter). These cells are referred to as MLID5 cells and are disclosed in U.S. patent application Ser. No. 08/846,026, herein incorporated by reference. This cell mixture is susceptible to infection by CMV and HSV virus types 1 and 2 (HSV-1 and HSV-2), with CMV infecting the genetically engineered BHK cells, and HSV-1 and HSV-2 preferentially infecting the mink lung cells. In another embodiment, the present invention contemplates the use of genetically engineered cells (e.g., mink lung cells) in which the cell genome is engineered to contain the firefly luciferase gene behind (i.e., 3 to) an inducible CMV promoter; these cells are also described in U.S. patent application Ser. No. 08/846,026. However, it is not intended that the present invention be limited to any particular cell types or cell lines, nor is it intended that the present invention be limited to any particular combinations of cells. It is also not intended that the present invention be limited in terms of the genetically engineered cells.

(6) The following Table provides a matrix indicating the ability of various cells to form single, confluent monolayers, as well as co-cultivated confluent, mixed cell monolayers.

(7) TABLE-US-00001 TABLE 1 Cell Cultures MRC-5 CV-1 BGMK McCoy BHK* A549 HEp-2 Mv1Lu NCI-H292 1 2 3 4 5 6 7 8 9 MRC-5 A ++ + No + + + + + + CV-1 B ++ No + + + + + + BGMK C ++ + + + + + + McCoy D ++ + + Yes + + BHK* E ++ + + + + A549 F ++ + + + HEp-2 G ++ + + Mv1Lu H ++ + NCI- I ++ H292 ++ Denotes single cell types producing confluent monolayers + Denotes some degree of dimorphic, mixed monolayer Yes Denotes cell mixtures that appear very uniform, with an even distribution No Denotes cell mixtures that did not appear to work *Denotes genetically engineered ELVIS BHK cells.

(8) In yet another embodiment, the present invention provides kits for assaying samples for the presence of infectious viruses. In these kits, mixed cell cultures are provided which facilitate the detection and identification of particular virus groups (e.g., viruses associated with respiratory infections/diseases). In the kits, co-cultivated cells are supplied either frozen or dispensed (i.e., ready for use) in shell vials, tubes, or multiwell plates. These cells are susceptible to infection by the virus group of interest as indicated by the sample type. In preferred embodiments, the kits also include reagents necessary to detect expression of viral antigens or virus-induced reporter gene expression.

(9) One of the several advantages of the present invention is that it provides rapid and sensitive assay systems for the detection and identification of a single virus type from a multiplicity of possibilities, in a single mixed cell unit that is suitable for diagnostic assay. Thus, the present invention: eliminates the need for multiple cell lines cultured in individual containers; provides reliable results in 1-3 days following inoculation of the cell cultures (rather than 1-28 days); eliminates the necessity of working with primary cell cultures; provides an efficient screening method for grouping and preliminary identification of viruses; and provides assay systems that are highly specific for viruses capable of inducing reporter gene expression. Thus, the present invention clearly fulfills a need that has been heretofore unmet in the field of diagnostic virology.

(10) In a further embodiment, the invention provides a composition comprising a mixed cell culture comprising MDCK cells and one or more of A549 cells and H292 cells. These compositions are useful in detecting the presence of one or more of influenza viruses (such as influenza A and/or B), respiratory syncytial virus (RSV), adenovirus, parainfluenza 1 virus, parainfluenza 2 virus, parainfluenza 3 virus, and metapneumovirus. These methods are also useful in producing one or more of influenza viruses (such as influenza A and/or B), respiratory syncytial virus (RSV), adenovirus, parainfluenza 1 virus, parainfluenza 2 virus, parainfluenza 3 virus, and metapneumovirus.

(11) The term MDCK cells and Madin-Darby canine kidney cells refer to cells that were isolated as previously described (Madin & Darby (1958) Tech. Prog. Rep. No. 25, Appendix VIII, p. 276. Naval Biological Laboratory, California, and to cells that are established from these cells. MDCK cells are exemplified, but not limited to those deposited as ATCC accession number CCL-34. The term established from when made in reference to any cell disclosed herein (such as MDCK cell, A549 cell, H292 cell, etc.), refers to a cell that has been obtained (e.g., isolated, purified, etc.) from the parent cell using any manipulation. Suitable manipulations include without limitation, infection with virus, transfection with DNA sequences, treatment and/or mutagenesis using for example chemicals, radiation, etc., and selection (such as by serial culture) of any cell that is contained in cultured parent cells. For example, the invention includes within its scope cell lines that may be established from any cell disclosed herein (such as MDCK cell, A549 cell, H292 cell, etc.) by treatment with chemical compounds and electromagnetic radiation. Suitable chemical compounds include but are not limited to N-ethyl-N-nitrosurea (ENU), methylnitrosourea (MNU), procarbazine hydrochloride (PRC), triethylene melamine (TEM), acrylamide monomer (AA), chlorambucil (CHL), melphalan (MLP), cyclophosphamide (CPP), diethyl sulfate (DES), ethyl methane sulfonate (EMS), methyl methane sulfonate (MMS), 6-mercaptopurine (6 MP), mitomycin-C (MMC), procarbazine (PRC), N-methyl-N-nitro-N-nitrosoguanidine (MNNG), .sup.3H.sub.2O, and urethane (UR). Electromagnetic radiation encompasses for instance X-ray radiation, gamma-radiation, and ultraviolet light.

(12) Thus, reference to any virus or cell herein includes wild-type viruses and cells (i.e., a virus or cell whose genome has not been manipulated by man) and transgenic viruses and cells (i.e., a virus or cell that contains a heterologous nucleic acid sequence introduced into the virus or cell by means of molecular biological techniques). Transgenic viruses and cells may contain heterologous nucleotide sequences; such as reporter genes (such as e.g., the uid A gene, -glucuronidase gene, green fluorescent protein gene, E. coli -galactosidase (LacZ) gene, Halobacterium -galactosidase gene, E. coli luciferase gene, Neuropsora tyrosinase gene, Aequorin (jellyfish bioluminescence) gene, human placental alkaline phosphatase gene, and chloramphenicol acetyltransferase (CAT) gene); transcriptional and translational regulatory sequences; selectable marker proteins (e.g., proteins that confer drug resistance such as the bacterial aminoglycoside 3 phosphotransferase gene (also referred to as the neo gene), which confers resistance to the drug G418 in cells; the bacterial hygromycin G phosphotransferase (hyg) gene, which confers resistance to the antibiotic hygromycin; and the bacterial xanthine-guanine phosphoribosyl transferase gene (also referred to as the gpt gene), which confers the ability to grow in the presence of mycophenolic acid; the HSV-tk gene and the dt gene); probe genes (such as the staphylococcal protein A and its derivative ZZ, which binds to human polyclonal IgG; histidine tails, which bind to Ni.sup.2+; biotin, which binds to streptavidin; maltose-binding protein (MBP), which binds to amylase; and glutathione S-transferase, which binds to glutathione); and receptor genes.

(13) In one embodiment, equivalent cells within the scope of the invention include cells that are established from the exemplary MDCK cells deposited as ATCC accession CCL-34, and that have substantially the same sensitivity, increased sensitivity, or reduced sensitivity to one or more of influenza virus A and influenza virus B as the cell from which it is established. The term sensitivity and sensitive when made in reference to a cell is a relative term, which refers to the degree of permissiveness of the cell to a virus as compared to the degree of permissiveness of another cell to the same virus. For example, the term increased sensitivity to influenza virus, when used in reference to the sensitivity of a first cell relative to a second cell, refers to an increase in the quantity of influenza virus (e.g., protein, nucleic acid, and/or CPE) obtained from progeny virus produced following influenza virus infection of a first cell, as compared to the quantity of influenza virus (e.g., protein, influenza virus nucleic acid, and/or CPE) obtained from progeny virus produced following influenza virus infection of a second cell. In some embodiments, the increase is preferably at least a 5%, more preferably from 5% to 10,000%, more preferably from 5% to 1,000%, yet more preferably from 10% to 200%, and even more preferably from 10% to 100%. For example, if 34 samples containing influenza virus were tested for the presence of progeny virus, with 25 and 13 samples showing the presence of CPE using a first cell and second cell, respectively, then the sensitivity is 74% and 38% for the first cell and second cell, respectively. This reflects an increase of 90% in the sensitivity of the first cell as compared to the sensitivity of the second cell.

(14) In another embodiment, equivalent cells within the scope of the invention include cells that are established from the exemplary MDCK deposited as ATCC accession number CCL-34, and that have substantially the same sensitivity to influenza virus as the cell from which it is established. This may be advantageous where, for example, the parent cell is made transgenic for a reporter gene.

(15) In a further embodiment, equivalent cells within the scope of the invention include cells that are established from the exemplary MDCK deposited as ATCC accession number CCL-34, and that have increased sensitivity or decreased sensitivity to influenza virus as compared to cells from which they were established. This may be desirable where, for example, the parent cell is made transgenic for a receptor gene, which alters the level of binding of influenza B virus to the cell.

(16) The invention's methods that employ mixed cell cultures containing MDCK cells are useful for detecting influenza virus. The term detecting when in reference to detecting the presence of any virus in cells refers to determining the presence, using any method, of the virus inside the cells, on the cells, and/or in the medium with which the cells come into contact. These methods are exemplified by, but not limited to, the observation of cytopathic effect, detection of viral protein, such as by immunofluorescence and Northern blots, and detection of viral nucleic acid sequences, such as by PCR, reverse transcriptase PCR (RT-PCR), Southern blots and Northern blots.

(17) As used herein the term influenza virus refers to members of the orthomyxoviridae family of enveloped viruses with a segmented antisense RNA genome (Knipe and Howley (eds.) Fields Virology, 4th edition, Lippincott Williams and Wilkins, Philadelphia, Pa. [2001]). Two types of influenza virus (A and B) are human pathogens causing respiratory pathology.

(18) When A549 and/or H292 cells are in mixed cell culture with MDCK cells, the mixed cell cultures may also be used to detect and propagate other viruses than influenza virus, such as respiratory syncytial virus (RSV), adenovirus, parainfluenza 1 virus, parainfluenza 2 virus, parainfluenza 3 virus, and metapneumovirus.

(19) The terms respiratory syncytial virus and RSV refer to one or more members of the family Paramyxoviridae, subfamily pneumovirus, which are enveloped, single stranded antisense RNA viruses that infect the respiratory tract (Schmidt and Emmons (eds.) Diagnostic Procedures for Viral, Rickettsial and Chlamydial Infections, 6th edition, American Public Health Assoc. Inc., Washington, D.C. [1989]), There are two major strains of RSV represented by, but not limited to, Long (Group 1) ATCC VR-26, and 18537 (Group 2) ATCC VR-1401. The following five exemplary human RSV strains are available from ATCC: VR-1400, VR-1401, VR-1540, VR-26, and VR-955.

(20) As used herein, the term parainfluenza virus refers to certain members of the paramyxoviridae family of enveloped viruses with a single-stranded antisense RNA genome (Knipe and Howley (eds.) Fields Virology, 4th edition, Lippincott Williams and Wilkins, Philadelphia, Pa. [2001]). Four types of parainfluenza virus (1 to 4) are human respiratory pathogens. Prototype strains of the human paramyxoviruses parainfluenza types 1, 2, 3, 4A, 4B, and mumps, may be obtained from the reference virus collection of the Respiratory and Enteric Viruses Branch of the Center for Infectious Diseases, Centers for Disease Control (CDC), Atlanta, Ga. (see U.S. Pat. No. 5,262,359 to Hierholzer). These strains are also available from the ATCC, Rockville, Md., under accession numbers VR-94, VR-92, VR-93, VR-279, VR-579, and VR-106, respectively (see U.S. Pat. No. 5,262,359 to Hierholzer).

(21) As used herein, the term adenovirus refers to a double-stranded DNA adenovirus of animal origin, such as avian, bovine, ovine, murine, porcine, canine, simian, and human origin. Avian adenoviruses are exemplified by serotypes 1 to 10, which are available from the ATCC, such as, for example, the Phelps (ATCC VR-432), Fontes (ATCC VR-280), P7-A (ATCC VR-827), IBH-2A (ATCC VR-828), J2-A (ATCC VR-829), T8-A (ATCC VR-830), and K-11 (ATCC VR-921) strains, or else the strains designated as ATCC VR-831 to 835. Bovine adenoviruses are illustrated by those available from the ATCC (types 1 to 8) under reference numbers ATCC VR-313, 314, 639-642, 768 and 769. Ovine adenoviruses include the type 5 (ATCC VR-1343) or type 6 (ATCC VR-1340). Murine adenoviruses are exemplified by FL (ATCC VR-550) and E20308 (ATCC VR-528). Porcine adenovirus (5359) may also be used. Adenoviruses of canine origin include all the strains of the CAVI and CAV2 adenoviruses [for example, Manhattan strain or A26/61 (ATCC VR-800) strain]. Simian adenoviruses are also contemplated, and they include the adenoviruses with the ATCC reference numbers VR-591-594, 941-943, and 195-203. Human adenoviruses, of which there greater than fifty (50) serotypes are known in the art, are also contemplated, including the Ad2, Ad3, Ad4, Ad5, Ad7, Ad9, Ad12, Ad17, and Ad40 adenoviruses.

(22) The terms metapneumovirus and MPV refer to a negative-sense single stranded RNA virus belonging to the Paramyxoviridae family, subfamily Pneumovirinae, and genus Metapneumovirus. MPV includes mammalian MPV, which is exemplified by human, primate, horse, cow, sheep, pig, goat, dog, cat, avian and rodents MPV. Mammalian MPV is phylogenetically more closely related to particular virus isolates than to turkey rhinotracheitis virus, the etiological agent of avian rhinotracheitis, and is identified by its genomic organization (see, for example, U.S. patent application publication numbers 20030232326, 20040005544, 20040005545, and 20030232061, and published WO 02057302A2 and WO 03072719A2). The invention contemplates each of the variant MPV that are idnetified based on the relative homology of their genomic sequences to other viruses, as described in, for example, U.S. patent application publication numbers 20030232326, 20040005544, 20040005545, and 20030232061, and published WO 02057302A2 and WO 03072719A2.

(23) MPV may be detected by, for example: detecting cytopathic effect in the exemplary LLC-MK2 cells and HEp-2 cells (Chan et al. 2003 Emerging Infectious Diseases, 9:1058-1063; Setterquist et al., 19.sup.th Annual Clinical Virology Symposium, Clearwater Fla., Apr. 27-30, 2003); detecting MPV proteins using antibodies; and/or detecting MPV nucleic acid sequences (see, for example, U.S. patent application publication numbers 20030232326 and 20040005544). In one embodiment, MPV nucleic acid sequences may be detected in the absence of detectable CPE.

(24) The invention's data is the first demonstration of the use of MDCK in mixed cell culture (Examples 4-9), and is contrasted with Frank et al. (1979) Journal of Clinical Microbiology, 10(1):32-36 which disclosed using MDCK cells. The ability to grow MDCK in mixed cell culture with the exemplary cell lines of H292 and A549 was surprising in view of data herein (Example 1) which demonstrates the unpredictability of co-culturing two or more cell lines, as well as the unpredictability that once co-cultured, the cells will retain their biological activity in detecting and/or producing virus.

(25) One advantage of using MDCK cells in the invention's mixed cell cultures with A549 and/or H292 is that these cells are non-permissive to SARS-CoV infection as determined by CPE (Table 12 herein; see also Drosten, et al., 2003, N. Engl. J. Med. 348:1967-1976; Ksiazek, et al., 2003, N. Engl. J. Med. 348:1953-1966; Peiris, et al., 2003, Lancet 361:1319-1325). Thus, an advantage of using MDCK cells is that they permit detection of respiratory viruses (such as respiratory syncytial virus (RSV), adenovirus, parainfluenza 1 virus, parainfluenza 2 virus, parainfluenza 3 virus, and metapneumovims), while being nonpermissive, or having a low level of permissivity, to SARS-CoV (Table 12). Thus, mixed cell cultures containing MDCK are useful for increasing the safety of cell cultures that are used in screening clinical samples for respiratory pathogens other than SARS-coronavirus. This is particularly useful in small laboratories that detect respiratory viruses (such as respiratory syncytial virus (RSV), adenovirus, parainfluenza 1 virus, parainfluenza 2 virus, and parainfluenza 3 virus), because the use of mixed cell cultures containing MDCK by these laboratories would obviate the need to resort to containment approaches that would otherwise be required for cells producing infectious SARS-CoV.

(26) In particular, although both MDCK and Mv1Lu cells are susceptible to influenza B virus (Example 2), data herein shows, surprisingly, that MDCK has a substantially lower level of permissivity and/or susceptibility to SARS-CoV as compared to Mv1Lu (Table 12). The terms lower, smaller, reduced, decreased and grammatical equivalents, when used in reference to the level of permissivity and/or susceptibility to a virus of a first cell type relative to a second cell type, mean that the level of permissivity and/or susceptibility of a first cell type is lower than that of a second cell type. In preferred embodiments, the difference in permissivity and/or susceptibility is statistically significant, using any art-accepted statistical method of analysis. In one embodiment, the level of permissivity and/or susceptibility to the virus of the first sample is at least 10% lower than the level of permissivity and/or susceptibility of the second cell type. In some embodiments, the level of permissivity and/or susceptibility is at least 25% lower than, at least 50% lower than, at least 75% lower than, at least 85% lower than, at least 90% lower than, at least 95% lower than, and/or at least 99% lower than that of the second cell type. Data herein shows that, in one embodiment, the level of permissivity and/or susceptibility of MDCK cells to SARS-CoV is 0.004% the level of susceptibility of Mv1Lu cells (Table 12).

(27) The terms SARS coronavirus, SARS-CoV, and severe acute respiratory syndrome coronavirus are equivalent, and are used to refer to an RNA virus that is the causative agent of severe acute respiratory syndrome (Drosten, et al., 2003, supra; Fouchier, et al., 2003, supra; Ksiazek, et al., 2003, supra; Peiris, et al., 2003, supra; Poutanen, et al., 2003, supra). Exemplary strains of SARS coronavirus include, but are not limited to, Urbani, Tor2, CUHK-W1, Shanhgai LY, Shanghai QXC, ZJ-HZ01, TW1, HSR 1, WHU, TWY, TWS, TWK, TWJ, TWH, HKU-39849, FRA, TWC3, TWC2, TWC, ZMY 1, BJ03, ZJ01, CUHK-Su10, GZ50, SZ16, SZ3, CUHK-W1, Bj04, AS, Sin2774, GD01, Sin2500, Sin2677, Sin2679, Sin2748, ZJ-HZ01, and BJ01.

(28) However, coronaviruses can establish persistent infection in cells without inducing CPE, suggesting that CPE may not be an accurate indicator of infection (Chaloner, et al., 1981, Arch. Virol. 69:117-129). Data herein confirmed this surprising observation by demonstrating replication of SARS-CoV in the absence of CPE. For example, Example 12 shows replication of SARS-CoV, as detected by sgRNA and virus titers, in the absence of CPE. In particular, significant CPE was not observed in pRhMK, pCMK, R-mix (Mv1Lu and A549), Mv1Lu, HEK-293T, and Huh-7 cells at 5 days post infection, although virus titers as well as SARS-CoV sgRNA were actually increased within 24 hours post infection (Table 12).

(29) The terms subgenomic RNA and sgRNA are used interchangeably herein to refer to a nucleotide sequence comprising at least a portion of the leader sequence of SARS-CoV.

(30) The term leader sequence refers to a sequence of about 40 to about 150, about 50 to about 80, and or about 55 to about 75, nucleotides that is located at the 5 terminus of the genome. This sequence is juxtaposed to the 5 terminus of each subgenomic RNA by transcriptional mechanisms during synthesis. There is very strong sequence conservation of the leader sequence across the strains of SARS. In one embodiment, the leader sequence is exemplified by the sequence from nucleotide 1 to nucleotide 72 for SARS-CoV (Urbani) 5-atattaggtttttacctacccaggaaaagccaaccaacctcgatctcttgtagatctgttctctaaacgaac-3 (SEQ ID NO:1); 5-tattaggtttttacctacccaggaaaagccaaccaacctcgatctcttgtagatctgttctctaaacgaac-3 (SEQ ID NO:2) of gi|33304219|gb|AY351680.1| SARS coronavirus ZMY 1,5-taggttttacctacccaggaaaagccaaccaacctcgatctctgtagatctgttctctaaacgaac-3 (SEQ ID NO:3) of gi|31416305|gb|AY278490.3| SARS coronavirus BJ03, 5-ctacccaggaaaagccaaccaacctcgatctcttgtagatctgttctctaaacgaac-3 (SEQ ID NO:4) of gi|30421451|gb|AY282752.1| SARS coronavirus CUHK-su10, tacccaggaaaagccaaccaacctcgatctcettgtagatctgttactaaacgaac-3 (SEQ ID NO:5) of gi|31416306|gb|AY279354.2| SARS coronavirus BJ04, and 5-ccaggaaaagccaaccaacctcgatctcttgtagatctgttctctaaacgaac-3 (SEQ ID NO:6) of gi|30275666|gb|AY278488.2| SARS coronavirus BJ01.

EXPERIMENTAL

(31) The following examples are provided in order to demonstrate and further illustrate certain preferred embodiments and aspects of the present invention and are not to be construed as limiting the scope thereof.

(32) In the experimental disclosure which follows, the following abbreviations apply: eq (equivalents); M (Molar); M (micromolar); N (Normal); mol (moles); mmol (millimoles); mol (micromoles); mmol (nanomoles); g (grams); mg (milligrams); g (micrograms); ng (nanograms); l or L (liters); ml (milliliters); l (microliters); cm (centimeters); mm (millimeters); m (micrometers); nm (nanometers); g (times gravity); C. (degrees Centigrade); FBS (fetal bovine serum); PBS (phosphate buffered saline; HEPES (N-[2-hydroxyethyl]piperazine-N-[2-ethanesulfonic acid]); HBSS (Hank's Balanced Salt Solution); MEM (Minimal Essential Medium); EMEM (Eagle's Minimal Essential Medium); BBL (Becton Dickinson Microbiology Systems, Cockeysville, Md.); DIFCO (Difco Laboratories, Detroit, Mich.); U.S. Biochemical (U.S. Biochemical Corp., Cleveland, Ohio); Chemicon (Chemicon, Inc., Temecula, Calif.); Dako (Dako Corporation, Carpinteria, Calif.); Fisher (Fisher Scientific, Pittsburgh, Pa.); Sigma (Sigma Chemical Co., St. Louis, Mo.); ATCC (American Type Culture Collection, Rockville, Md.); Bartel's (Bartels, Issaquah, Wash.); and BioWhittaker (BioWhittaker, Walkersville, Md.).

(33) The cells used during the development of the present invention and described in the following Examples, were obtained from the ATCC, with the exception of BGMK and PRMK cells obtained from BioWhittaker, and MRC-5 cells obtained from both ATCC and BioWhittaker. The ATCC numbers of the cells are indicated in the following Table.

(34) TABLE-US-00002 TABLE 2 ATCC Cell Lines Cell Line ATCC Number BHK/ICP6LacZ-5 CCL-12072 A549 CCL-185 CV-1 CCL-70 HEp-2 CCL-23 hs27 CRL-1634 Mv1Lu CCL-64 McCoy CCL-1696 NCI-H292 CCL-1848 MRC-5 CCL-171 WI-38 CCL-75 Vero CCL-81 MDCK (NBL-2) CCL-34 BHK21 CCL-10 HEL299 CCL-137 HeLa CCL-2 Mv1Lu-hF PTA-4737

Example 1

Co-Cultivation of Cells

(35) In this Example, mixed cell cultures were established in which single, dimorphic cell sheets were produced at confluency.

(36) In these experiments, all of the cell lines were cultured to confluency in sterile polystyrene flasks in EMEM (Eagle's Minimal Essential Medium) with 25 mM HEPES, 7% fetal bovine serum (FBS), 2 mM L-glutamine, and penicillin/streptomycin (100 Units/100 g per ml of medium each).

(37) Cells to be cultured were harvested by first rinsing source cell monolayers with Hank's Balanced Salt Solution (HESS) without magnesium or calcium. Depending upon the cell line, the cells were dissociated by adding trypsin (0.125% in HESS, without calcium or magnesium) or trypsin-EDTA (0.25% in 1 mM EDTA in HESS, without calcium or magnesium), or directly to the cell monolayer, and incubating for approximately 5 minutes at ambient temperature. Ten volumes of cell culture medium was added to each trypsinized cell suspension and the cells were repeatedly pipetted in order to produce near-single cell suspensions (i.e., without cell aggregates). Each trypsinized cell suspension was diluted in an adequate volume of culture medium to produce an optical density of cell suspension suitable to produce a confluent monolayer of cells within 2-3 days of incubation in a 96-well microtiter plate. For single cell monolayers (i.e., one cell type per well), 0.2 ml of suspension was used to inoculate each well. For example, the final cell preparations ranged from a final optical density at 500 nm of 0.012 OD units/ml for CV-1 cells to 0.03 OD units/ml for HEp-2 cells.

(38) Cell mixture monolayers were produced by co-planting two distinct cell types at an equal volume of each diluted cell suspension (i.e., 0.1 ml of each cell type was used to inoculate each well of a 96-well microtiter plate). The cells were allowed to attach to the well surface by gravity for 30-60 minutes, and the inoculated microtiter plates were incubated for up to three days at 36 C. in 5% CO.sub.2 with 95% relative humidity.

(39) Periodically during incubation, single and mixed monolayers were checked for overall viability. The mixed cell culture monolayers were also checked for the ability of the cell lines to co-exist and develop as a single cell sheet (i.e., a single monolayer), with two distinct cell morphologies (i.e., dimorphic cell sheets), at an approximately equal density of each cell type. At confluency, the cells were treated with a methylene blue staining solution to fix the cells and stain them a light blue in order to provide contrast for visualization using light microscopy.

(40) Some of the mixed monolayers successfully grew as a mixed cell monolayer adhered to the well surfaces, exhibiting a smooth, evenly distributed monolayer. These mixed cultures were designated as morphologic category 1. In these cultures, each cell type could be easily distinguished and appeared to survive well in a mixed monolayer, giving the appearance of a single cell distribution. Mixed monolayers composed of HEp-2 and McCoy cells displayed this morphology.

(41) Some of the mixed monolayers successfully grew as a mixed monolayer adhered to the well surfaces, but exhibited two distinct morphologies at confluency. These mixed cultures were designated as morphologic category 2. In these cultures, separate, distinct patches of each cell line co-existed within the monolayer, giving the appearance of oil mixing with water. Although an understanding of the mechanism is not necessary in order to use the present invention, it is likely that this appearance is most likely the result of contact inhibition between two specific cell types. The relative sizes of the patches were found primarily to be a function of how evenly the cells were distributed at cell planting. The more even the cell distribution at planting, the patches or islands were smaller as the monolayer reached confluency. Examples of monolayers that produced this appearance were mink lung cells co-cultivated with NCI-H292 cells, mink lung cells co-cultivated by buffalo green monkey kidney (BGMK) cells, and human lung carcinoma A549 cells co-cultivated with NCI-H292 cells.

(42) However, some cells types could not produce a mixed cell monolayer, when mixed at relatively equal cell numbers at planting in the same culture medium. In some of these cultures, only one of the cell types was found to be viable (i.e., the culture was effectively a single cell type). Examples of mixed cell cultures that were found to be unsuitable for the production of mixed monolayers include human embryonic lung fibroblasts (MRC-5 cells) co-cultivated with BGMK cells. In this mixture, the MRC-5 cells become toxic and form aggregates of dead cells soon after planting. Thus, at confluency, the monolayer only contains one functional, viable cell type, the BGMK cells. Thus, this cell mixture was found to be unsuitable for producing mixed cell monolayers as the cells failed to form mixed cell monolayers of either a smooth or dimorphic morphologic type.

Example 2

Detection of Respiratory Viruses in Mixed Cell Cultures

(43) In this Example, mixed cell cultures were used to detect various respiratory viruses including Influenza A, RSV, adenoviruses, parainfluenza viruses, and Influenza B, present in clinical specimens. The mixed cells used in these experiments were Mv1Lu (mink lung cells) and NCI-H292 (human mucoepidermoid cells).

(44) Cell Lines

(45) Confluent T-225 flasks of Mv1Lu and H292 cells were prepared in EMEM with HEPES, 10% FBS, 2 mM L-glutamine, and 50 g/ml gentamicin. The cells were harvested by first rinsing them in 30 ml MSS without magnesium and calcium. The cells were then dissociated from the flask by brief exposure (i.e., until the cells lifted from the bottom of the flask) to 7 ml trypsin-EDTA solution as described in Example 1. Then, 30 ml media was added to the cells to prepare a cell suspension concentrate. The optical density of each cell suspension was determined at 500 nm, using 3 ml of cells. Typically, the OD reading was 0.2/ml for both the Mv1Lu and H292 cells. In addition to the Mv1Lu and H292 cells, rhesus monkey kidney cells (PRMK), A549 cells, and MDCK cells were used in the present Example. These additional cell lines were prepared in single cell cultures as known in the art.

(46) Mixed Cell Cultures

(47) When each cell suspension concentrate was determined to be 0.2 OD units/ml, 5.2 ml of the Mv1Lu, and 8.7 ml H292 cell suspensions were, added to 86.1 ml of culture medium, in order to provide an acceptable working ratio of each cell type (i.e., it was a preparation of diluted mixed cells). This ratio was devised in order to achieve a confluent monolayer, in which each cell type covered a substantially equivalent surface area within 1-3 days post-planting of the diluted mixed cells. Prior to dispensing, care was taken to prepare homogenous suspensions of diluted mixed cells. The mixed cells were dispensed at 0.75 ml per glass shell vial (i.e., glass vial containing a sterile glass coverslip). After planting, the vials were allowed to sit for 60 minutes at ambient temperature so that the cells could settle by gravity and produce a more optimum cell distribution of each cell type. The mixed cells were then incubated for 1-3 days at 36 C. in 5% CO.sub.2, at 95% relative humidity. Subsequently, the shell vials were stored at ambient temperature to maintain each cell type at substantively equivalent surface ratios for up to 10 days from achieving confluency.

(48) Samples and Processing

(49) Nasopharyngeal specimens submitted to a diagnostic virology laboratory were obtained from patients exhibiting influenza-like symptoms. The specimens were centrifuged to produce a cell pellet for direct antigen testing, and a specimen supernatant for inoculation of various cell cultures. The cell pellet was resuspended in phosphate buffer to prepare a cell suspension and 25 l portions of the cell suspension were spotted onto a glass slide and dried. Each spot of cells on the slide were then fixed with fixative (e.g., acetone), and incubated for 30 minutes with individual antibody solutions (Bartel's) capable of recognizing various respiratory viruses, including influenza A and RSV, as well as other respiratory viruses. A second antibody solution containing fluorescein (FITC) labelled goat anti-mouse antibodies and counterstain (Bartel's) was added to cover each cell spot on the slides, and incubated for an additional 30 minutes at 35-37 C. The counterstain in the FITC-goat anti-mouse antibody solution contains Evans Blue, which stains the cells and appears red under fluorescence. Slides prepared from the nasopharyngeal specimens were observed for positive (i.e., virus-infected), apple green staining fluorescent cells, using epifluorescence at 100-400 magnification.

(50) In addition, 0.2 ml aliquots of the specimen supernatant were inoculated onto various cell cultures prepared in shell vials containing glass coverslips. The cell cultures included primary rhesus monkey kidney cells (PRMK; ViroMed or BioWhittaker), Mv1Lu cells (Diagnostic Hybrids) HEp-2 cells (Diagnostic Hybrids), MDCK, A549, and H292 cells, as single cell monolayers, as well as mixed cell monolayers of Mv1Lu and H292 cells, produced as described above.

(51) Each inoculated shell vial was centrifuged for 60 minutes at 700g, and then incubated for 1-3 days at 36 C., in appropriate culture medium (e.g., EMEM containing 0.5 to 2% FBS, 2 mM L-glutamine, and penicillin/streptomycin [100 Units/100 g per ml of medium each]). After incubation, the culture medium was decanted, and the cells were fixed to the glass coverslip with a solution of acetone and methanol (50:50, v/v). An antibody solution (Chemicon or Bartel's) containing a pool of monoclonal antibodies, to multiple respiratory viruses, including Influenza A and RSV, as well as other respiratory viruses was added to cover each coverslip. The coverslips were then incubated for 30 minutes at 35-37 C. The antibody solution was then removed and the coverslips were rinsed with PBS. A second antibody solution containing fluorescein (FITC) labelled goat anti-mouse antibodies and counterstain (Bartel's) was added to cover each coverslip, and incubated for an additional 30 minutes at 35-37 C. The counterstain in the FITC-goat anti-mouse antibody solution contains Evans Blue, which stains the cells and appears red under fluorescence. Shell vial coverslips prepared from the nasopharyngeal specimens (i.e., inoculated cultures) were observed for positive (i.e., virus-infected), apple green staining, fluorescent cells, using epifluorescence at 100-400 magnification.

(52) Results

(53) Some specimens demonstrated a positive direct antigen reaction on the cell spot incubated with Influenza A monoclonal antibody. These specimens also demonstrated fluorescent staining on the single cell Mv1Lu coverslip and the Mv1Lu/H292 mixed cell coverslip, but no or very little fluorescence on the single cell H292 coverslip. The H292 cells are either not susceptible to this strain of Influenza A, or are significantly less susceptible, such that infection is not detectable. Additionally, in some cases (i.e., in specimens with low virus titers), the culture systems were more sensitive than the direct antigen detection method. Also, while the single PRMK cell cultures (i.e., the gold standard cells used to detect Influenza A) were positive for the presence of Influenza A, with many specimens, the numbers of infected cells and the total of number of positive specimens were lower, than those identified as positive by the mixed cell monolayers.

(54) In addition, both the MDCK and PRMK cells missed one low titer specimen positive for Influenza A by direct antigen testing (IFA), and one other specimen that was also positive for Influenza A by IFA, while the Mv1Lu cells detected the virus in all of the samples determined to be positive based on direct antigen detection (IFA).

(55) Some specimens demonstrated a positive direct antigen reaction on the cell spot incubated with RSV monoclonal antibody. These specimens also demonstrated fluorescent staining on the single cell H292 coverslip and the MV1Lu/H292 mixed cell coverslip, but no or very little fluorescence on the single cell MV1Lu coverslip. H292 cells are susceptible to RSV infection, while Mv1Lu cells are not susceptible (or are significantly less susceptible, such that infection is not detectable). In addition to the mixed cell cultures, HEp-2 cells (i.e., the gold standard cells used to detect RSV) were also observed for the presence of RSV; the performance of HEp-2 cells was generally less sensitive than that of the Mv1Lu and H292 mixed cell monolayers, or the H292 single cell monolayers. The results obtained from testing Influenza A in mink lung cells was very surprising, as the detection of Influenza A using these cells has previously not been described.

(56) Adenoviruses identified from five clinical specimens based on direct antigen testing (IFA) were detected in the H292 and cell culture mixes, while the PRMK cells missed two of the low titer specimens (i.e., there were two false negatives). Thus, H292 and the mixed cultures were more sensitive than PRMK for detection of adenoviruses. While the A549 cells may provide slightly more positive cells, the 292 cells, mixed cell cultures, and A549 cells detected an equal number of positive specimens.

(57) Parainfluenza viruses were also detected in the H292 and mixed cell cultures, while the PRMK cells missed one low titer specimen.

(58) These results clearly show that the mixed cell cultures were equal in sensitivity to the single cell (H292 and Mv1Lu) cultures. Thus, the mixed cells provide savings in material, time, space, and labor, while providing the same level of sensitivity in the detection of respiratory viruses as single cell cultures presently commonly used in diagnostic virology laboratories.

(59) Influenza B Specimens

(60) In addition to the samples discussed above, various dilutions of multiple Influenza B strains obtained from the ATCC were tested in MDCK, Mv1Lu, and PRMK cells. The following Table provides the results of these experiments. In this Table, MD refers to the Maryland strain, HK refers to the Hong Kong strain, TW refers to the Taiwan strain, and MA refers to the Massachusetts strain:

(61) TABLE-US-00003 TABLE 3 Comparison of Influenza B Virus Detection From Prototype Viruses by MDCK, ML, and PRMK Cells Influenza B Virus Virus Cell Line Strain Dilution MDCK Mv1Lu PRMK MD 10.sup.4 + + + 10.sup.5 + + + 10.sup.6 + HK 10.sup.4 + + + 10.sup.5 + + 10.sup.6 TW 10.sup.4 + + + 10.sup.5 + + + 10.sup.6 MA 10.sup.4 + + + 10.sup.5 + + + 10.sup.6 + + +

(62) These results indicate that Mv1Lu, MDCK, and PRMK are comparable for the detection of multiple Influenza B virus strains. Thus, these cell lines were identified as good candidates for mixed cell cultures, as well as single cell cultures for the identification of this virus.

Example 3

Detection of CMV in Mixed Cell Cultures

(63) In this Example, mixed cell cultures of Mv1Lu and NCI-H292 cells were used to detect the presence of human cytomegalovirus (HCMV).

(64) The Towne strain of HCMV (ATCC #VR977) was amplified in MRC-5 cells to a titer of greater than 10.sup.6/ml, and frozen at 85 C. in EMEM containing 10% FBS. Serial dilutions of HCMV were prepared and inoculated into single monolayers of mink lung (Mv1Lu) cells, MRC-5 cells, and mixed cell monolayers of Mv1Lu and H292 cells. Each infected cell culture system was centrifuged for 60 minutes at 700g, and then incubated for 24 hours at 36 C. in 5% CO.sub.2, in appropriate culture medium (e.g., EMEM containing 10% FBS). The culture medium was removed and the cells were fixed to the glass coverslip using a solution of 80% acetone in water. A sufficient amount of HCMV antibody solution (Chemicon) was added to cover each coverslip and incubated for 30 minutes at 35-37 C. The antibody solution was removed, and the coverslip was rinsed with PBS. A second antibody solution consisting of FITC-labelled goat anti-mouse antiserum was added to cover each coverslip and incubated an additional 30 minutes at 35-37 C. The specimens were then observed under epifluorescence at 100-400 magnification for positive (i.e., CMV-infected), nuclear staining, fluorescent cells.

(65) As described in previous Examples, the counterstain in the FITC-labelled goat anti-mouse antibody solution contains Evans Blue, which stains the cells and appears red, when excited by fluorescent light. Fluorescent, apple green nuclear stain was observed in the Mv1Lu single cell monolayer and in the mixed cell monolayers, but not in the H292 cells, as the Mv1Lu cells are susceptible to HCMV infection, while H292 cells are not (or the H292 cells are significantly less sensitive). The MRC-5 cells (i.e., the gold standard cells for detection of HCMV) performed about the same as the mixed cell monolayer, as these cultures had a similar number of infected cells as the cells in the mixed monolayer.

Example 4

Detection of Enteroviruses in Mixed Cell Cultures

(66) In this Example, mixed cell cultures were used to detect the enteroviruses, Coxsackie B virus and Echovirus. In these experiments, a mixed cell monolayer of BGMK and NCI-H292 cells were used.

(67) Confluent T-225 flasks of BGMK and H292 cells were prepared in EMEM with 25 mM HUES, 10% FBS, 2 mM L-glutamine, and 50 g/ml gentamicin. The cells were harvested by first rinsing in 30 ml HBSS without magnesium and calcium, and were then dissociated from the flasks by a brief treatment of 7 ml trypsin-EDTA solution (as described in Example 1). Then, an additional 30 ml of culture medium (EMEM with HEPES, 10% FBS, 2 mM L-glutamine, and 50 g/ml gentamicin) was added to the suspension to produce a cell suspension concentrate. The optical density at 500 nm was determined for each suspension, using 3 ml of cells. Typically, the OD reading was 0.2/ml for both the BGMK and H292 cell suspensions.

(68) Next, 3 ml of BGMK cell suspension and 8 ml of H292 cell suspension (both suspensions were at 0.2 OD units/ml) were added to 29 ml of the culture medium (25 mM HEPES, 10% FBS, 2 mM L-glutamine, and 50 g/ml gentamicin) to provide an acceptable working ratio of each cell type in a diluted mixed cell suspension. This ratio was intended to achieve a confluent monolayer consisting of each cell type covering substantially equivalent surface area within 1-3 days post-planting of the diluted mixed cells. Care was exercised to prepare a homogenous suspension of diluted mixed cells prior to dispensing 0.75 ml to each of 100 glass shell vials, each of which contained a sterile glass coverslip. The vials were allowed to sit for 60 minutes post-planting at ambient temperature to allow the cells to settle by gravity and produce a more optimum cell distribution. The vials were then were moved to an incubator for incubation at 36 C. for 1-3 days in 5% CO.sub.2, at 95% relative humidity.

(69) Stock virus suspensions and clinical specimens shown to contain Coxsackie B virus or echovirus were used to infect BGMK/H292 cell mixtures, as well as single cell monolayers of BGMK, H292, MRC-5, and PRMK cells. For clinical samples, throat swab, nasopharyngeal swab, sputum, stool, and rectal swabs were collected from patients, placed in viral transport medium, and filtered through 0.45 m filter to remove possible bacterial and fungal contaminants prior to inoculation of cell cultures. Cerebrospinal fluid (CSF) collected from patients was placed in viral transport medium, and used directly for inoculation of cells. For inoculation of shell vials, the media present in the vials were removed and fresh media added. Then, 0.2 ml of specimen was inoculated into each vial. The inoculated vials were centrifuged at 700g for 45-60 minutes at room temperature. Subsequently, the vials were incubated at 37 C. for 1-3 days, and viral presence was detected using immunofluorescent staining.

(70) For staining, the medium was removed from each vial and the cells were fixed on the coverslip with acetone. The coverslip was removed from each vial, and stained with 25 l primary antibody (mouse monoclonal antibody directed against enteroviruses [Dako]), for 30 minutes at 37 C. After washing with PBS, 251 of the FITC-conjugated anti-mouse Ig (Dako) was used as a secondary antibody for staining, and incubated at 37 C. for 30 minutes. After another wash, the coverslips were mounted on slides and observed under fluorescence. The presence of one or more specific fluorescent-stained cells on the coverslip was considered positive. As described in previous Examples, the counterstain in the FITC-labelled goat anti-mouse antibody solution contains Evans Blue, which stains the cells, and appears red upon exposure to fluorescent light. For Coxsackie B virus detection, fluorescent, apple green stain was observed in many of the BGMK cells in the BGMK single cell monolayer and in the mixed cell monolayers primarily in the BGMK cells, but not in as many H292 cells, as BGMK cells are more susceptible to Coxsackie B virus infection. For some types of Coxsackie B virus isolates, H292 Cells are not as susceptible (or the H292 cells are significantly less susceptible). The gold standard cell line (i.e., PRMK cells) did not exhibit the same number of infected cells as the mixed cell monolayers.

(71) For detection of echovirus, fluorescent, apple green stain was observed in many H292 cells in the H292 single cell monolayer and in the mixed cell monolayers, primarily in the H292 cells, but not in as many BGMK cells. H292 cells are more susceptible to echovirus infection, while BGMK cells are not as susceptible (or the BGMK cells are significantly less sensitive). The gold standard line (i.e., MRC-5 cells) performed, but did not appear to have as many infected cells as the mixed cell monolayers. In the case of the BGMK/H292 mixed cell monolayers infected with high titer samples of enteroviruses, cell-specific virus mediated cytopathic effect (CPE) was evident (i.e., the CPE was observed in BGMK cells when Coxsackie B virus was present at high titer, and CPE was observed in H292 cells when echovirus was present at high titer).

Example 5

Detection of Herpes Simplex Virus and HCMV in Mixed Cell Cultures

(72) In this Example; mixed cell cultures are used to detect herpes simplex virus (HSV) and HCMV, using a mixed cell monolayer of genetically engineered baby hamster kidney (BHK) cells (e.g., ATCC #CCL-12072) and Mv1Lu cells.

(73) The BHK and Mv1Lu cells are grown in flasks, trypsinized, and mixed as described in previous Examples, such that a suitable dilution of mixed cells is produced. These mixed cell dilutions are then used to inoculate sterile glass shell vials containing coverslips, as described above. The cells are then centrifuged and inoculated with virus or clinical samples, incubated, and fixed, as described above.

(74) HCMV is detected in the Mv1Lu cells, using antibody as described in Example 3 above, while HSV (HSV-1 and HSV-2) is identified using a -galactosidase staining kit (i.e., detecting the reporter gene induced by the virus infecting the genetically engineered BHK cells).

Example 6

Detection of Respiratory Viruses in Mixed Cell Cultures

(75) In this Example, mixed cell cultures are used to detect a panel of respiratory viruses. In these experiments, three cell types are combined to produce a mixed cell culture that is capable of detecting at least three viruses.

(76) First, A549, H292, and mink lung (e.g., Mv1Lu) cells are grown in flasks, trypsinized, and mixed as described in previous Examples, such that a suitable dilution of mixed cells is produced. In preferred embodiments, the cells are diluted such that the mixed cells in, culture will be in approximately the same proportions (i.e., 1:1:1). These mixed cell dilutions are then used to inoculate sterile glass shell vials containing coverslips, as described above. The cells are then centrifuged and inoculated with virus or clinical samples, incubated, and fixed, as described above.

(77) The viruses capable of infecting these cells are detected and identified using the methods described in Example 2, above. In these mixed cell cultures, the 292 cells are used to detect the presence of parainfluenza viruses and RSV, while the A549 cells are used to detect the presence of adenoviruses, and the mink lung cells are used to detect the presence of influenza viruses (e.g., Influenza A and B).

Example 7

Detection of HSV and Chlamydia in Mixed Cell Cultures

(78) In this Example, mixed cell cultures are provided which allow the detection of two organisms commonly associated with sexually transmitted diseases. In these experiments, mink lung cells (e.g., Mv1Lu) useful for the detection of HSV are mixed with McCoy cells useful for the detection of C. trachomatis.

(79) First, McCoy cells and mink lung (e.g., Mv1Lu) cells cells are grown in flasks, trypsinized, and mixed as described in previous Examples, such that a suitable dilution of mixed cells is produced. In preferred embodiments, the cells are diluted such that the mixed cells in culture will be in approximately the same proportions. These mixed cell dilutions are then used to inoculate sterile glass shell vials containing coverslips, as described above. The cells are then centrifuged and inoculated with samples (e.g., clinical samples), incubated, and fixed, as described above.

(80) The organisms capable of infecting these cells (e.g., HSV infects the mink lung cells, while C. trachomatis infects the McCoy cells) are detected and identified using the methods described in Example 2, above. As with the other mixed cell culture systems, the presence of virus and/or C. trachomatis may be detected by other methods, such as the observation of CPE, animal inoculation, etc. Thus, it is not intended that the mixed cell culture assay systems of this Example or any of the preceding examples be limited to any particular method of microorganism detection, identification, and/or quantitation.

Example 8

Evaluation of Single Cell Cultures and Mixed Cell Cultures for Detection of Respiratory Viruses

(81) This Example evaluated different cell lines individually and in mixed cell culture. The following cell lines were used in the exemplary shell vial with coverslip format: R-mix (i.e., Mv1Lu and A549): C961023; Mv1Lu: C581023; A549: C561023; canine kidney MDCK: C831022; NCI-H292: C591023; LLC-MK2; C861022; CV1; C521023; pRHMK: -CA-491016; MDCK/A549: C501022; MDCK/H292: C102303; Mv1Lu-hF Clones numbers 15B, 17, 18, 29, 30, 35, 38 all 10-23-03.

(82) The following reagents and virus strains were used: RM03T; Influenza A: WS, Port Chalmers, Victoria, and Mai; Influenza B; Taiwan and G1; RSV: 031203 and 042403; Adenovirus: #1 and #5; Parainfluenza 1; Parainfluenza 2; Parainfluenza 3; D.sup.3 Kit; 091603; and Solution 1: 011303D.

(83) Briefly, shell vials were all re-fed with 1 ml of RM03T. Virus dilutions were all in RM03T. Shell vials were inoculated in duplicate with dilutions of each of the 7 respiratory viruses, i.e., influenza A, influenza B, RSV, adenovirus, parainfluenza 1, parainfluenza 2, and parainfluenza 3. Shell vials were centrifuged for 1 hour at 700g then placed in a 35-37 C. incubator. 24 hours, 48 hours and 72 hours post inoculation, a set of shell vials were fixed and stained with Solution 1 and D.sup.3.

(84) The following is a key to the results shown in the following Tables 4-9: s=small. B=Bursts. =Approximately. TNTC=Too numerous to count. 1+=25% of Monolayer infected. 2+=50% of Monolayer infected. 3+=75% of Monolayer infected, 4+=100% of Monolayer infected. N/A=Not Available. F=Field (there are 44 fields per monolayer.)

(85) TABLE-US-00004 TABLE 4 24 Hour Post Inoculation Results Using Influenza A Virus, Influenza B Virus, RSV, and Adenovirus Influenza A: Port WS Victoria Chalmers Mai R-mix 99, 95 113, 127 197, 243 .sup.88, N/A Mv1Lu 105, 114 142, 150 ~5/F 169, 161 A549 N/A N/A N/A N/A MDCK 70 + ~8sB, 3sB + 71, 2sB + 68, 2sB + 90, 80 + 10sB 2sB + 69 2B + 88 3sB + 100 H292 12, 5 .sup.17, N/A 12, 38 N/A, 7 LLC-MK2 11, 7 18, 19 38, 28 5, 2 CV1 8, 7 23, 40 15, 12 N/A, 3 pRHMK ~15B + ~10 5B + 50, .sup.1+ 5bigB, 5B + 62 1bigB + 5 MDCK/A549 TNTC + 2B + 145, 3bigB + Bursts 4sB + 75, 1B + 162 77, N/A 1sB + 104 MDCK/H292 TNTC + 67, 73 1sB + 84, 1bigB + Bursts 3B + 101 3sB + 69, 1B + 3sB + 101 15B 121, 124 3sB + 167, ~300 ~300 6sB + 169 17 168 + 132, 133 ~200 5/F 2B, 150 18 113, 120 3sB + 241, 260 222, 200 166, 171 29 135, 152 109, 114 ~200 + ~4sB 5/F 30 109 + 133, 141 ~300 6/F 1B, 125 35 75, 97 137, 140 ~200 129, 170 38 136, 132 113, 126 ~300 5/F Influenza B: Taiwan G1 R-mix 4/F 9/F Mv1Lu 9/F 12/F A549 N/A N/A MDCK 14B + 4/F, 8B + 4/F 9B + 6/F, 16B + 6/F H292 5, 8 13, N/A LLC-MK2 54, 50 16, 10.sup. CV1 72, 80 45, N/A pRHMK 3B + 114, 2B + 128 39, 49.sup. MDCK/A549 2+ 2+ MDCK/H292 1+ 1+ 15B 11/F 10/F 17 10/F 15/F 18 12/F 12/F 29 9/F 9/F 30 10/F 9/F 35 7/F 8/F 38 9/F 10/F RSV: 031203 042403 R-mix 54, 47 13, 16 Mv1Lu 33, 27 3, 7 A549 34, 24 18, 23 MDCK 0, 0 0, 0 H292 23, 26 25, 22 LLC-MK2 30, 33 3, 6 CV1 20, 23 8, 9 pRHMK 0, 0 0, 0 MDCK/A549 23, 25 10, 13 MDCK/H292 28, 18 15, 19 15B 34, 38 N/A 17 43, 37 N/A 18 26, 30 N/A 29 18, 30 N/A 30 18, 24 N/A 35 21, 22 N/A 38 28, 40 N/A Adenovirus: Adenovirus #1 Adenovirus #5 R-mix 20/F ~300 A549 20/F 216, 220 H292 5/F 46, 57 LLC-MK2 0, 0 0, 0 CV1 0, 5 0, 0 pRHMK 15/F 116, 160 MDCK 0, 0 0, 0 MDCK/A549 5/F 139, 124 MDCK/H292 .sup.55, N/A 4, 6

(86) TABLE-US-00005 TABLE 5 24, 48 and 72 Hour Post Inoculation Results Using Parainfluenza 1 24 hour 48 hour 72 hour R-mix .sup.64, N/A 143, 160 134, 143 Mv1Lu 69, 73 118, 109 80, 88 A549 90, 194 111, 100 121, 110 MDCK 0, 0 0, 2 0, 0 H292 98, 111 158, 162 170, 159 LLC-MK2 88, 106 163, 158 121, 117 CV1 75, 66 68, 73 60, 72 pRHMK 25sB + 25, 6sB + 40 4+ .sup.4+ MDCK/A549 41, 50 62, 80 120, 122 MDCK/H292 38, 40 68, 75 68, 80 15B 49, 54 110, 90 ~100 17 58, 63 119, 50B + 100 ~120 18 66, 62 87, 95 ~100 29 69, 65 63, 66 ~70 30 23, 30 102, 115 ~100 35 47, 58 72, 75 ~75 38 50, 44 80, 85 ~80

(87) TABLE-US-00006 TABLE 6 24, 48 and 72 Hour Post Inoculation Results Using Parainfluenza 2 24 hour 48 hour 72 hour R-mix .sup.66, N/A 1+ 3+ Mv1Lu 6, 10 ~25.sup. ~20sB A459 210, 217 2+ 4+ MDCK 0, 0 0, 0 0, 0 H292 116, 106 2+ 4+ CV1 84, 94 1+ 4+ pRHMK 73, 80 2+ 4+ LLC-MK2 33, 29 ~15B + 30, N/A 1+ MDCK/A549 21, 28 ~75.sup. 1+ MDCK/H292 15, 24 ~50.sup. 1+

(88) TABLE-US-00007 TABLE 7 24, 48 and 72 Hour Post Inoculation Results Using Parainfluenza 3 24 hour 48 hour 72 hour R-mix 5/F TNTC 4+ Mv1Lu 3/F ~50BB ~50BB A459 1+ 4+ 4+ MDCK 0, 0 ~25.sup. 3/F H292 4/F TNTC 4+ CV1 1+ 4+ 4+ pRHMK 1+ 4+ 4+ LLC-MK2 4/F TNTC 4+ MDCK/A549 ~50.sup. 1+ 4+ MDCK/H292 ~50.sup. 1+ 4+

(89) TABLE-US-00008 TABLE 8 48 Hour Post Inoculation Results Using Influenza A, Influenza B, RSV, and Adenovirus Influenza A: Port WS Victoria Chalmers Mai R-mix 79, 70 66, 72 128, 120 92, 67 Mv1Lu 60, 49 131, 127 94, 82 97, 94 A549 N/A N/A N/A N/A MDCK 4+ 2+ 2sB + 50, 47 1+ H292 8, 11 9, 13 2, 2 7, 10 LLC-MK2 19, 25 1sB + 27, 31 55, 47 15, 10 CV1 8, 21 24, 28 60, 48 6, 9 pRHMK 3+ 4+ 4+ 4+ MDCK/A549 4+ 4+, 2+ 1+ 2+, 3+ MDCK/H292 4+ 1bigB, 2+ 1B + 30, 2+ 13B + ~100, 4+ 15B 77, 81 6sB + 75, 1+ 140, 160 100, 119 17 67, 65 76, 80 104, 113 124, 130 18 51, 61 66, 3sB + 100 133, 118 110, 105 29 76, 60 2sB + 85, 91 143, 160 139, 115 30 86, 70 .sup.56, 6B 150, 140 177, 160 35 32, 40 43, 1sB + 52 87, 80 90, 83 38 74, 1+ 4sB + 81, 4sB + 100, 118, 108 2sB + 88 6sB + ~100 Influenza B: Taiwan G1 R-mix 61, 64 120, 115 Mv1Lu 45, 65 120, 110 A549 N/A N/A MDCK 4+ 4+ H292 1, 0 2, 2 LLC-MK2 34, 33 11, 16 CV1 23, 24 17, 19 pRHMK ~10big B 35, 2big B MDCK/A549 4+ 4+ MDCK/H292. 3+ 4+ 15B 100, N/A 147, 152 17 80, 83 153, 149 18 102, N/A 136, 141 29 71, 73 74, 70 30 83, 96 100, 94 35 60, 53 108, 95 38 70, 65 77, 72 RSV: 031203 042403 R-mix 60, 70 32, 39 Mv1Lu 53, 50 2, 9 A549 44, 43 23, 28 MDCK 0, 0 0, 0 H292 40, 37 33, 54 LLC-MK2 28, 35 13, 13 CV1 26, 18 8, 7 pRHMK 0, 0 0, 0 MDCK/A549 22, 6 12, 15 MDCK/H292 19, 24 18, 18 15B 39, 42 N/A 17 68, 70 N/A 18 54, 57 N/A 29 38, 50 N/A 30 32, 31 N/A 35 50, 32 N/A 38 50, 66 N/A Adenovirus: Adenovirus #1 Adenovirus #5 R-mix 3+ 3+ A549 3+ 3+ H292 3+ 2+ LLC-MK2 8/F 4/F CV1 70, 62 35, 40 pRHMK 2+ 1+ MDCK 2, 0 1, 0 MDCK/A549 1+ 1+ MDCK/H292 1+ 1+

(90) TABLE-US-00009 TABLE 9 72 Hour Post Inoculation Results Using Influenza A, Influenza B, RSV, and Adenovirus Influenza A: Port WS Victoria Chalmers Mai R-mix <25 ~25 ~50 1sB + ~30 Mv1Lu <10 ~25 ~25 ~25 A549 N/A N/A N/A N/A MDCK 4+ 2+, 4+ 1+, ~50 3+, 2+ H292 <5 <10 <5 <10 LLC-MK2 <5 <25 <5 <10 CV1 <5 <25 ~10 <10 pRHMK 4+ 4+ 4+ 4+ MDCK/A549 4+ 1+, 4+ 4+ 4+ MDCK/H292 4+ ~20B, 4+ 1+, 4+ 4+ 15B ~25 12sB, ~25 ~25 ~25 17 ~25 <5 ~25 ~25 18 <10 3B + 50, ~25 <25 ~50 29 ~10 ~15sB, ~25 <25 ~25 30 <10 <10 <25 ~50 35 <10 <25 <5 ~25 38 ~2sB + ~50 50, 25 ~25 ~50 Influenza B: Taiwan G1 R-mix 8, 17 ~30 Mv1Lu 0, 0 <5 A549 N/A N/A MDCK 4+ 4+ H292 <5 <5 LLC-MK2 7, 10 5, 7 CV1 <5 <5 pRHMK 4+ <5, 4+ MDCK/A549 4+ 4+ MDCK/H292 4+ 4+ 15B 0, 0 <5 17 <5 <5 18 0, 0 <5 29 0, <5 <5 30 0, <5 <5 35 <5 <5 38 <5 <5 RSV: 031203 042403 R-mix 59, 50 24, 27 Mv1Lu 45, 52 7, 20 A549 60, 56 24, 36 MDCK 0, 0 0, 0 H292 26, 30 .sup.50, N/A LLC-MK2 31, 28 8, N/A CV1 25, 31 13, 19 pRHMK 2, 1 3, 5 MDCK/A549 13, 16 17, 19 MDCK/H292 21, 30 12, 16 15B 39, 45 N/A 17 38, 42 N/A 18 40, 47 N/A 29 30, 35 N/A 30 34, 30 N/A 35 39, 35 N/A 38 40, 43 N/A Adenovirus: Adenovirus #1 Adenovirus #5 R-mix 3+ 4+ A549 4+ 4+ H292 2+ 2+ LLC-MK2 1+ 1+ CV1 4/F 4/F pRHMK 2+ 2+ MDCK 0, 0 0, 0 MDCK/A549 2+ 2+ MDCK/H292 1+ 1+

(91) The above data show that the mixed cell cultures of MDCK+A549 and MDCK+H292 showed comparable sensitivity to R-mix, i.e., Mv1Lu and A549 cells with respect to detecting the seven exemplary respiratory viruses: respiratory syncytial virus (RSV), adenovirus, parainfluenza 1 virus, parainfluenza 2 virus and parainfluenza 3 virus. In one embodiment, mixtures of MDCK with one or more of A549 and H292 cells may preferably be used at 24 hours in culture since, by 48 and 72 hours, the MDCK almost completely outgrew the other cell lines.

Example 9

Comparison of MDCK and Mv1Lu Cells Inoculated with Influenza A and B

(92) This example was carried out to determine the ability of MDCK and Mv1Lu cells to propagate strains of Influenza A and B. Cultures were tested using duplicate monolayers at 24; 48 and 72 hours post inoculation. Where virus is replicating, more positive cells (such as those detected by fluorescence) were expected by the inventors to be observed at the 48 and 72 hour time points compared to the zero time point of inoculation.

(93) The following exemplary cells and viruses were used: MDCK lot C830807; Mv1Lu lot C580807R; RM03T lot 070903E; ELVIS Solution 1 lot 061203 (Diagnostic Hybrids, Inc., Ohio, USA); Influenza A and Influenza B components from D.sup.3 Kit lot 011303; ELVIS Mounting Fluid lot 011603A (Diagnostic Hybrids, Inc., Ohio, USA).

(94) Briefly, cell cultures of MDCK and Mv1Lu shell vials with coverslips were used. All cultures were re-fed with 1 ml of RM03T. Virus stocks were rapidly thawed in a 35-37 C. bath and diluted to a working stock in RM03T. Each culture was inoculated in duplicate with 2001 of each working virus stock. All cultures were centrifuged at 700g for 1 hour. All cultures were placed in a 35-37 C. incubator. A set of each was processed according to the D.sup.3 Kit product insert at 24, 48 and 72 hours post inoculation.

(95) TABLE-US-00010 TABLE 10 Comparison of MDCK and Mv1Lu cells Using Influenza A and Influenza B MDCK Mv1Lu Virus/strain/lot # Day 1 Day 2 Day 3 Day 1 Day 2 Day 3 Flu A: Denver: 156, 129 + ~15/F + 4+ CPE 179, 164 110, 115 ~25 112701N 1B 5BB Flu A: Aichi: 189, 206 + 100, 80 ~100 + 1B ~7/F ~6/F ~60 112701K 1B Flu A: PR: 114 + 5B, ~1+ CPE ~50 147, 158 50, 42 ~4 111201D 118 + 4B Flu A: Victoria: 121 + 2B, 1+ CPE ~30 + ~5B 171, 208 1+ CPE 1+ CPE 121800 106 Flu A: WS: 118 + 1BB, 3+ CPE 4+ CPE 87, 122 1+ CPE 3+ CPE 111201E 120 + 7B Flu A: 59, 68 ~5 + 1B ~100 + 105, 98 ~60 ~100 + Portchalmers: ~3B ~2B 112701 Flu A: MaI: 106 + 1B, ~50 + 4+ CPE 176, 175 ~100 ~100 112701L 118 + 3B ~6B Flu A: HongKong: 112 + 1B, ~50 + 2B ~100 160, 170 ~100 + ~100 112701M 85 + 1B ~10B Flu A: NJ: 102699 134 + 2B, 2+ CPE 4+ CPE 225, 190 ~85 ~75 113 + 3B Flu B: GL: 112701S ~5/F + 1B 3+ CPE 4+ CPE ~10/F ~50 ~50 Flu B: Taiwan: ~5/F + 3+ CPE 4+ CPE ~8/F ~50 ~10 112701R ~1B/F Flu B: HongKong: 81, 82 ~10 ~100 125, 140 ~10 ~40 020402B Flu B: Mass.: 52, 60 ~20 ~20 199, 216 ~30 ~20 112701Q Flu B: Maryland: ~75B + tntc S 3+ CPE 4+ CPE ~20/F ~50 ~100 + 112701P 1B Flu B: Russia: ~8/F + 2+ CPE 4+ CPE ~10/F ~40 ~20 112701FF ~20B 123 = number of single fluorescent cells. B = Burst of fluorescent cells. Usually 100 or more together. BB = Big Burst. Usually described by percentage of monolayer covered. S = Single cells. ~ = approximately. Usually used as an average of both monolayers. + = and. Unless used before CPE. (See CPE below). 5/F = 5 single cells per field. There are 44 fields per coverslip. tntc = Too numerous to count. CPE = cytopathic effect. This ranges from 1+ to 4+ with 1 = 25%, 2 = 50%, 3 = 75% and 4 = 100% of cells infected. Bold = increasing titer. (virus replication) Italic = decreasing titer. (no virus replication)

(96) In the above experiments, 11/15 virus strains were propagated in the MDCK cell line. Influenza A: Aichi and Flu B: Mass, had lower, titers on days 2 and 3. Influenza A Hong Kong and Influenza A Port Chalmers did not have any significant change in virus titer from 1 to 3 days of culture. The data shows that 2/15 virus strains were propagated in the Mv1Lu cell line. They were Influenza A: Victoria and Influenza A: WS. 11/15 virus stocks cultured in the Mv1Lu lost titer after 24 hours. 2 virus strains remained the same titer over the 3 days in the Mv1Lu cell line. The day 1 results showed the Mv1Lu cells to be slightly more sensitive than MDCKs as measured by the number of positive individual cells, however, the MDCKs were the only cell line to show bursting at 24 hours. Based on this data, there is no significant difference on day 1 initial titer between the Mv1Lu and MDCK cell lines. Surprisingly, MDCK cells detect and produce influenza A and B at higher levels than the Mv1Lu cells.

(97) Thus, the use of MDCK in single cell culture and in mixed cell culture with one or more of H292 and A549 is useful for identifying low levels of influenza A virus and influenza B virus at the exemplary times of 48 and 72 hours post-inoculation, as well as for producing influenza A virus and influenza B virus.

Example 10

Materials and Methods

(98) The following is a brief description of the exemplary materials and methods used in the subsequent Examples.

(99) A. Virus

(100) A seed stock of SARS-CoV Urbani that was passaged twice in Vero E6 cells provided by the Centers for Disease Control and Prevention, Atlanta, Ga. This virus was amplified by two passages in Vero E6 cells to establish a high titer stock (passage 4) that was utilized for all experiments. SARS-CoV was titered in Vero E6 cells by TCID.sub.50, Briefly, cells were plated in 96-well plates (Falcon, Becton Dickson) at a density of 410.sup.5 cells/well in 150 l of medium, Virus was serially diluted by half logs from 10.sup.0-10.sup.7 in culture medium containing 2% antibiotic-antimycotic (Invitrogen Corporation, Carlsbad, Calif.), 100 l of each dilution was added per well and cells were incubated 3-4 days at 37 C.

(101) B. Cell Line

(102) The following Table lists exemplary cell lines that were used and/or equivalent cells that may be used in the invention's methods, and that are publically available (e.g., from the American Type Culture Collection (ATCC), Rockville, Md., and Diagnostic Hybrids, Inc. (DHI), Athens, Ohio; Cell Bank, Ministry of Health and Welfare, Japan):

(103) TABLE-US-00011 TABLE 11 Exemplary Cells Useful In The Invention Cells Sources Vero E6 ATCC # CRL-1586, DHI # 67-0102 MRC-5 ATCC # CCL-171, DHI # 51-0102 BHK-21 ATCC # CCL-10, DHI # 89-0102 MDCK ATCC # CCL-34, DHI # 83-0102 HRT-18 (HCT-18) ATCC # CCL-244 Mv1Lu ATCC # CCL-64, DHI # 58-0102 CMT-93 ATCC # CCL-223 AK-D ATCC # CCL-150 A549 ATCC # CCL-185, DHI # 56-0102 HEL DHI # 88-0102 pRHMK DHI # 49-T025, DHI # 49-0102 pCMK DHI # 47-T025, DHI # 47-0102 L2 ATCC # CCL-149 R-Mix DHI # 96-T025 HEK-293T ATCC # CRL-1573; CRL- 11264, CRL-11270; Pear, et al., PNAS USA, Vol 90, pp 8392-8396 September 1993; DuBridge et. al., Mol. Cell. Biol. Vol 7, pp 379-387, 1987; University Dr. Yoshi Kawaoka, Univ. Wisconsin, Madison. Huh-7 (JTC-39) CellBank #JCRB0403
R-Mix (R-Mix FRESHCELLS, Diagnostic Hybrids, Inc., Ohio) is a mixed monolayer of mink lung cells (strain Mv1Lu) and human Adenocarcinoma cells (strain A549). the hAPN expression construct used to create BHK21/hAPN and CMT-93/hAPN was previously described (Wentworth, et al., 2001). Further description of Huh-7 cells is in Nakabayashi et al., Cancer Res., 42: 3858-3863, 1982; Nakabayashi et al., Gann, 75: 151-158, 1984; and Nakabayashi et al., Cancer Res., 45:6379-6383, 1985.

(104) Vero E6, 293T, L2, AK-D, A549, pCMK, pRhMK, Mv1Lu, CMT-93, and R-mix were maintained in Dulbecco's modified Eagle Medium (DMEM) (Invitrogen Corp.) supplemented with 10% fetal bovine serum (FBS) (Hyclone, Logan, Utah) and 2% antibiotic-antimycotic MDCK cells were maintained in DMEM high glucose (Invitrogen Corp.) supplemented with 5% FBS and 2% antibiotic-antimycotic. HEL cells were maintained in Modified Eagle's Medium (MEM) supplemented with 10% FBS and 2% antibiotic-antimycotic. HRT-18 cells were maintained in RPMI 1640 (Invitrogen Corp.) supplemented with 10% horse serum (Hyclone), 1 mM MEM sodium pyruvate (Invitrogen Corp.) and 2% antibiotic-antimycotic. Huh-7 cells were maintained in DMEM supplemented with 20% FBS and 2% antibiotic-antimycotic. MRC-5 cells were maintained in MEM supplemented with 10% FBS, 1 mM sodium pyruvate, 0.1 mM MEM nonessential amino acids (Invitrogen Corp.) and 2% antibiotic-antimycotic. BHK-21 cells were maintained in DMEM supplemented with 10% FBS and 5% tris phosphate buffer (Invitrogen Corp.).

(105) C. PCR Assay

(106) G3PDH, genomic. SARS-CoV RNA (gRNA) and subgenomic RNA (sgRNA) were detected using multiplex one-step RT-PCR. Oligonucleotide primers used to amplify the different targets were as follows: G3P-279 (sense) 5 CATCACCATCTTCCAGGAGC-3 (SEQ ID NO:7) binds at nt 279-299; G3P-1069R (antisense) 5-CTTACTCCTTGGAGGCCATG-3 (SEQ ID NO:8) binds at nt 1069-1049; SARS-21,263 (sense) 5-TGCTAACTACATTTTCTGGAGG-3 (SEQ ID NO:9) binds at nt 21,263-21,284 of SARS-Urbani; SARS-21,593R (antisense) 5-AGTATGTTGAGTGTAATTAGGAG-3 (SEQ ID NO:10) binds at nt 21,593-21,571 of SARS-Urbani; and SARS-1 (sense) 5-ATATTAGGTTTTTACCTACCCAGG-3 (SEQ ID NO:11) binds at nt 1-24 of SARS-Urbani, Amplification was carried out using the Qiagen OneStep RT-PCR kit (Qiagen) according to the manufacturer's protocol. Briefly, each reaction consisted of 2 g of total RNA isolated using TRIZOL Reagent (Invitrogen), 400 M dNTPs, 200 nM of each G3PDH primer, 400 nM SARS-1, 400 nM SARS-21,263, 600 nM SARS-21,593R and 2 l Qiagen enzyme mix. The cycling parameters were: 50 C. for 30 min, 95 C. for 15 min, 35 cycles of 94 C. for 30 s, 57-58 C. for 30 s, 72 C. for 1 min, followed by 10 min at 72 C. in an Eppendorf Mastercycler gradient (eppendorf). Amplification products were analyzed by electrophoresis through a 1.5% agarose gel and visualized by ethidium bromide staining. All primers were synthesized by the Molecular Genetics Core (David Axelrod Institute, Wadsworth Center, Albany, N.Y.).

(107) D. Cell Infection

(108) Cells seeded at a density of 210.sup.6 in T25 flasks (Falcon, Becton Dickson) were inoculated with virus at an MOI of 0.001 in a final volume of 1, ml and were incubated 1 h at 37 C. Virus was removed and 5 ml fresh medium added to each flask. Cells were maintained at 37 C. throughout the experiment. At 1, 24 and 48 h post-inoculation (p.i.), cells were observed for CPE, supernatants were collected for subsequent titration and total RNA was extracted using TRIZOL Reagent (Invitrogen Corp.). RNA was quantitated by spectrophotometer (Eppendorf).

Example 11

Exemplary Multiplex RT-PCR Assay for the Detection of SARS-CoV Replication

(109) A RT-PCR assay for the detection of SARS-CoV replication was developed. Replication of corona- and arteri-virus RNA occurs through discontinuous synthesis, thought to occur during negative strand synthesis, generating 3 co-terminal nested subgenomic RNAs (sgRNA). The inventors identified targets within the genome for amplification. Oligonucleotide RT-PCR primers were designed that amplify genomic SARS-CoV RNA (gRNA) or the sgRNA that is specific to the leader-body junction. Because genomic RNA is present in input virus, the inventors probed for sgRNA, which is indicative of virus entry and/or replication Genomic RNA was detected by amplifying a region between the 1b coding region of the polymerase gene and the sequence encoding the Spike (S) glycoprotein. Subgenomic RNA was detected using a primer specific to the leader sequence in conjunction with the reverse primer in S that was used for the gRNA detection. G3PDH primers, designed to amplify G3PDH from multiple species, served as a positive control for RNA integrity and cDNA production.

(110) To evaluate the RT-PCR assay, Vero E6 cells were inoculated with serial dilutions of SARS-CoV ranging from an MOI of 10.sup.0 to 10.sup.8 TCID.sub.50/cell. Total RNA was extracted at 1 and 24 h post-inoculation (p.i.). At 1 hr p.i. gRNA was detected in cells inoculated with virus at an MOI of 10.sup.0 to 10.sup.2, as indicated by a band at 300 bp (FIG. 1). Subgenomic RNA was not detected (180 bp). However, at 24 hr p.i. both gRNA and sgRNA, 300 bp and 180 bp respectively, were detected in cells inoculated with an MOI of 10.sup.0 to 10.sup.5. The sgRNA amplicon was confirmed to correspond to the S leader-body junction sgRNA by sequence analysis (Thiel, et al., 2003, J. Gen. Virol. 84:2305-2315). Genomic RNA was visible at 24 hr p.i. in cells inoculated with an MOI of 10.sup.7, however this was not seen, in repeated experiments. The decrease in amplified G3PDH (800 bp), as seen in lanes 1-6 at 24 hr p.i., was consistent between repeated experiments. The decrease in G3PDH may be a result of the RT-PCR conditions, which were optimized to favor amplification of SARS-CoV gRNA and sgRNA. Individual amplicon were amplified by PCR of cDNAs from the same samples and G3PDH was consistently detected. Additionally, the decrease in G3PDH may be due to cell death, which is seen in Vero E6 cells. G3PDH was included as a control for template concentration and RNA integrity, and was always detected in the absence of viral RNA.

(111) This data demonstrates that the exemplary multiplex RT-PCR assays is sensitive for detection of SARS-CoV infection.

Example 12

Cytophathic Effect does not Always Correlate with SARS-CoV Infection

(112) This example shows replication of SARS-CoV, as detected by sgRNA and virus titers, in the absence of CPE. In particulare, significant CPE was not observed in pRhMK, pCMK, R-mix (Mv1Lu and A549), Mv1Lu, HEK-293T, and Huh-7 cells at 5 days post infection, although virus titers as well as SARS-CoV sgRNA were actually increased within 24 hours post infection (Table 12).

(113) TABLE-US-00012 TABLE 12 Susceptibility Of Cells To Sars-Coronavirus SARS- Cell Species of Origin CoV sgRNA CPE Titer.sup.a VeroE6 African green monkey + + 2.4 10.sup.7 pRhMK Rhesus macaque + 5.6 10.sup.5 PCMK Cynomolgous + 7.8 10.sup.4 macaque R-Mix Mink and Human + 7.8 10.sup.3 A549 Human .sup.<1.sup.b Mv1Lu Mink + 2.5 10.sup.4 HEL Human <1 MRC-5 Human <1 MDCK Canine <1 AK-D Feline ND.sup.c L2 Murine ND HRT-18 Human ND CEF Chicken ND HEK-293T Human + 5.6 10.sup.3 Huh-7 Human + 1.3 10.sup.5 CMT-93 Murine ND CMT-93/hAPN Murine ND BHK-21 Syrian hamster <1 BHK-21/hAPN Syrian hamster ND .sup.aTiter = TCID.sub.50/ml at 48 hr post-inoculation. .sup.bBelow the limit of detection .sup.cTiter not determined.

Example 13

Testing Influenza Virus Susceptibility of Human Lung Cell Lines

(114) Although primary monkey kidney cells are the gold standard for influenza isolation, there are many drawbacks to their use, such as indigenous viruses; and long quarantine periods. The mixed cell systems described herein has been developed to isolate all of the viruses that infect primary monkey kidney cells (pRHMK), such as respiratory viruses, herpes viruses and enteric viruses, while overcoming the problems typically associated with primary monkey kidney cells. This example describes the selection of a continuous human lung cell suitable for use in the mixed cell cultures of the present invention.

(115) Briefly, seven human lung epithelial cells were purchased from ATCC: HTB-53 (A-427), HTB-54 (Calu-1), HTB-55 (Calu-3), HTB-56 (Calu-6), HTB-57 (SK-LU-1), HTB-58 (SK-MES-1), and HTB-59 (SW 900). These cells were cultured in 24 well cluster plates in plating medium supplemented with 10% FBS, and 1% Pen-Strep solution. When monolayers of each cell line became confluent, the plating medium was removed, and replaced with RM03 medium without serum. The cells were then inoculated with several different strains of influenza A virus: (A/Port Chalmers (H3N2), A/Victoria (H3N2), A/PR(H1N1), A/Malaysia (H1N1); and several different strains of influenza B virus: (B/Massachusetts, B/Maryland, B/Taiwan and B/Hong Kong). The target input for each virus was an MOI of 0.001. The infected cells were placed in a humidified 35-37 C., 5% CO.sub.2 incubator. A sample of medium was removed from each monolayer on a daily basis for 6 days, and assayed for hemagglutination, (HA). The HA assay was performed by diluting the original sample 1:8 with phosphate buffer saline (PBS), followed by 2 fold dilutions in PBS until a 1:256 dilution was reached. An equal volume of washed 1% guinea pig red blood cells (RBC) were added to each tube, mixed gently and then incubated at room temperature for 1 hr. The monolayers were recorded as positive when the RBC were forming a circular sheet at the bottom of the round-bottom tube and negatives showed a drop of RBC at the very bottom of the tube. The highest titers showing evidence of infection are shown in Tables 13 and 14. On day 6, 200 l of washed 1% RBC was added to the each of the cell monolayers and incubated at room temperature for 1 hr for hemadsorption, (HAD). The cell monolayers were shaken gently to disassociate the loose RBC that did not adsorb onto the monolayer. The contents were then gently poured out for observation under the inverted microscope. Positive monolayers had clumps of RBC tightly adsorbed to them, while negative monolayers did not.

(116) TABLE-US-00013 TABLE 13 Infection of Human Lung Epithelial Cells With Influenza A Viruses A/Port A/Vic A/PR A/Mala (H3N2) (H3N2) (H1N1) (H1N1) Cell Line HA HAD HA HAD HA HAD HA HAD Calu-3 1:256 ++++ 1:256 ++++ 1:256 ++++ 1:256 ++++ SK-LU-1 <1:8 <1:8 <1:8 <1:8 Calu-1 <1:8 + <1:8 <1:8 <1:8 + Calu-6 <1:8 <1:8 <1:8 <1:8 SW 900 <1:8 <1:8 <1:8 <1:8 SK-MES-1 <1:8 <1:8 <1:8 <1:8 A-427 <1:8 <1:8 <1:8 <1:8

(117) TABLE-US-00014 TABLE 14 Infection of Human Lung Epithelial Cells With Influenza B Viruses B/Mass B/MD B/Tai B/HK Cell Line HA HAD HA HAD HA HAD HA HAD Calu-3 1:64 ++++ 1:64 ++++ 1:32 ++ 1:32 ++ SK-LU-1 <1:8 <1:8 ++ <1:8 <1:8 Calu-1 <1:8 <1:8 + <1:8 + <1:8 + Calu-6 <1:8 <1:8 <1:8 <1:8 SW 900 <1:8 <1:8 + <1:8 <1:8 SK-MES-1 <1:8 <1:8 + <1:8 <1:8 A-427 <1:8 <1:8 <1:8 <1:8

(118) The numbers in Tables 13 and 14 refer to the dilution that was HA positive, with <1:8 indicating that the culture was negative at the initial 1:8 dilution. These results demonstrate that only Calu-3 cells were able to support replication of influenza A and B viruses for production of high virus yields. The HAD results are as follows: + indicates that approximately 25% of the monolayer adsorbed RBC, ++ indicates that 50% of the monolayer adsorbed RBC, +++ indicates that 75% of the monolayer adsorbed RBC, and ++++ indicates that nearly 100% of monolayer adsorbed RBC. Surprisingly, Calu-3 appears to be a unique in its permissivity of influenza A and B virus replication. In contrast, the other human lung epithelial cell lines tested performed poorly or did not support any measurable influenza A and/or B virus replication.

Example 14

Mixed Cell Cultures Comprising Calu-3 Cells for Detection and Amplification of Respiratory Viruses

(119) As described in Example 13 above, Calu-3 cells are a continuous human lung adenocarcinoma epithelial cell line that was chosen from a panel of 7 human lung cell lines for its ability to detect and amplify both influenza A and influenza B virus. A549 cells are continuous human lung carcinoma cells that have been shown to be suitable for isolation of adenoviruses, herpes viruses and enteric viruses. The A549 cell line is used in the R-Mix, R-Mix Too and Super E-Mix Mixed Culture Systems available for Diagnostic Hybrids (Athens, Ohio).

(120) Mixed cell cultures were produced by co-plating the Calu-3 and A549 individual cell cultures at a ratio of 6.5:1 in shell vials with coverslips and in 16 mm glass round tubes. The mixture of these two cell lines produced an evenly distributed monolayer with two distinct morphologies at points of confluency. Confluent T-225 flasks of Calu-3 cells were prepared in Opti-Mem Medium, with 10% FBS, 4 mM L-glutamine and 1% Pen-Strep solution. Confluent T-225 flasks of A549 cells were prepared in EMEM with HEPES, 10% FBS, 2 mM L-glutamine and 50 g/ml gentamicin. Both cell lines were harvested by first rinsing them in 30 ml HESS without magnesium and calcium. The cells were then dissociated from the flasks by exposure to 7 ml trypsin-EDTA solution. A549 cells require only 5-10 minutes of contact with the trypsin solution at room temperature to become detached, while Calu-3 cells require 20-30 minutes of contact with the trypsin solution at 37 C. to become detached. About 23 mls of the cells respective culture media, was added to each flask after the cells were visibly detached from the plastic. The cell suspensions were then pipetted several times to form a homogenous suspension. Following a standard procedure for counting cells using a hemocytometer, the concentration in cells/ml for each cell line was determined. Based on their concentrations, about 100,000 Calu-3 cells and 15,000 A549 cells were added to 50 mls of Opti-Mem medium, supplemented with 4% FBS, 4 mM L-glutamine and 1% pen-strep solution. This ratio gives an approximate 60%:40% ratio of Calu-3:A549 cells when the monolayer reaches confluency after 6-7 days incubation when plated in shell vials with coverslips at 1 ml/vial. For 16 mm glass round tubes, the same plate density was used, except the tubes were seeded with 2 mls/tube instead of 1 ml. This also gave a confluent monolayer in 6-7 days. Neither culture format required 5% CO.sub.2 or 95% humidity since they are both closed, air-tight systems. However, if multiwell cluster plate formats are used, the cultures are incubated in a humidified, 5% CO.sub.2 incubator. Monolayers of Calu-3/A549 and pRHMK cells in shell vials with coverslips, (from DHI), were refed with 1 ml of RM03, (Opti-Mem with Pen-Strep solution), without serum. The frozen original clinical specimens (these specimens were determined to be positive by antigen assay with fluorescent antibody staining) in M4 transport medium were inoculated onto both cell monolayers. Shell vials were centrifuged at 700g for 1 hr and then incubated at 35 C. for 3 days. The monolayers infected with Influenza A and B, and Parainfluenza 1, 2 and 3 were tested for hemadsorption, (HAD), by adding Guinea pig RBC to those vials and incubating them at 4 C. for 30 minutes to allow the red blood cells to stick to the infected cells. After HAD for each monolayer was assessed, the RBC were removed and cell monolayers fixed with 80% acetone and stained with DHI D.sup.3 monoclonal antibodies specific for the virus that was inoculated into each monolayer.

(121) As shown in Table 15, the Calu-3/A549 mixed cell cultures detected one more low positive Flu A sample and showed more positive HAD and positive stained cells than pRHMK cells. The results are comparable for the 3 high positive Flu B samples. Only one sample of Parainfluenza 2 was detected by both cell monolayers and both cells have similar levels of positively stained cells. All three samples of Parainfluenza 3 were detected by both cell monolayers but pRHMK cells showed a slightly higher level of positively stained cells, Calu-3/A549 cells detected all three positive adenovirus samples while pRHMK cells only detected two positives indicating that the mixed cells might be more sensitive than the pRHMK cells for adenovirus detection. Calu-3/A549 cells detected two out of three RSV samples, although the number of positively stained cells was low. In contrast, none of the three RSV viruses could be detected with the pRHMK cells. Thus, Calu-3/A549 cells are comparable or more sensitive than pRHMK cells for detection of all respiratory viruses tested, with the exception of Parainfluenza 3 virus.

(122) TABLE-US-00015 TABLE 15 Comparison of Calu-3/A549 Mixed Cell Cultures and pRHMK Cells For Respiratory Virus Detection Virus Calu-3/A549 pRHMK Sample HAD FA stain HAD FA stain Flu A 1 + 244 2 + 2+ + + 3 3+ 3+ + + Flu B 1 2+ 4+ 2+ 4+ 2 3+ 4+ 3+ 4+ 3 3+ 4+ 3+ 4+ Para2 1 + 4+ + 4+ 2 3 Para3 1 + 3+ + 4+ 2 + 2+ + 4+ 3 + 3+ + 4+ Adeno 1 n/a 4+ n/a 3+ 2 n/a 3+ n/a 2+ 3 n/a 4+ n/a RSV 1 n/a + n/a 2 n/a 7 n/a 3 n/a n/a

(123) Calu-3 shell vials with coverslips and MDCK shell vials with coverslips were refed with (1 ml/vial of RM03). Multiple strains of influenza A virus (A/Vict, A/Aichi, A/Port, A/Denver, A/HK, A/PR, A/WS, and A/Mala,) and influenza B virus (B/Mass, B/MD and B/Tai) were inoculated at an MOI of 0.001 in the designated shell vials of each cell line and centrifuged for 1 hr at 700g. A sample of supernatant was collected daily from each vial and inoculated into a corresponding Mink Lung shell vial. The Mink Lung vials were then centrifuged for 1 hr at 700g, then incubated overnight (16-18 hours), at 35 C. Monolayers were then fixed with 80% acetone and stained with the appropriate DHI D.sup.3 Flu A or B monoclonal antibody. Virus yield from the Calu-3 and MDCK cells was determined by the number of positive fluorescence cells in each of the Mink Lung cultures.

(124) The highest titers reached are shown in Table 16. For most of the viruses tested, Calu-3 cells produced more virus (higher yield) than the MDCK cells, with the exception of Influenza B/Taiw in which Calu-3 cells yielded a 3 to 4 fold lower titer than the MDCK cells. These results indicate that Calu-3 cells are a superior cell line for influenza virus amplification.

(125) TABLE-US-00016 TABLE 16 Comparison Of Calu-3 And MDCK Cells For Influenza A and B Virus Amplification virus strain MDCK Calu-3 B/Mass 7 10.sup.8 .sup.9 10.sup.8 B/MD 1 10.sup.8 1.8 10.sup.8 B/Tai 2 10.sup.8 .sup.6 10.sup.7 A/Vict (H3N2) 1.3 10.sup.8 .sup.9 10.sup.8 A/Port (H3N2) 1.1 10.sup.8 2.7 10.sup.9 A/Aichi (H3N2) 7.8 10.sup.6 .sup.5 10.sup.8 A/Den (H3N2) 9 10.sup.7 1.6 10.sup.8 A/HK (H3N2) 1.2 10.sup.6 4.8 10.sup.9 A/PR (H1N1) 2 10.sup.8 .sup.2 10.sup.9 A/WS (H1N1) 9.7 10.sup.8 1.4 10.sup.9 A/Mala (H1N1) 3 10.sup.8 9.9 10.sup.9

Example 15

Mixed Cell Cultures Comprising Calu-3 Cells for Detection and Amplification of Herpes Viruses

(126) Using the ELVIS HSV detection system from Diagnostic Hybrids, the supernatant from infected Calu-3/A549 and pRHMK 16 mm glass round tube cultures was tested at 24, 48 and 72 hours post inoculation. At each time point, 200 l of supernatant was removed from duplicate tubes and centrifuged onto ELVIS shell vials with coverslips. ELVIS cultures were incubated for 18 hrs before processing using ELVIS Solutions 1 and 2 as directed by the manufacturer.

(127) Results shown in Table 17 are as follows: single numbers represent individual infected (blue stained) cells, while 1+=25%, 2+=50%, 3+=75% and 4+=100% represent percentages of ELVIS monolayer infected. Each value is an average of duplicate ELVIS shell vials. Thus, Calu-3/A549 mixed cells cultures are also suitable for detection and amplification of HSV types 1 and 2. Moreover, the Calu-3/A549 mixed cell cultures more rapidly amplified HSV, and yielded a higher HSV titer than did the pRHMK cultures.

(128) TABLE-US-00017 TABLE 17 Comparison of Calu-3/A549 Mixed Cell Cultures and pRHMK Cells For HSV Detection And/Or Amplification virus Calu-3/A549 mix pRHMK HSV-1 Day 1 233 35 HSV-1 Day 2 4+ 4+ HSV-1 Day 3 4+ 4+ HSV-2 Day 1 7 0.5 HSV-2 Day 2 1+ 350 HSV-2 Day 3 2+ 1+

Example 16

Mixed Cell Cultures Comprising Calu-3 Cells for Detection and Amplification of Enteric Viruses

(129) Monolayers of Calu-3/A549 mixed cell cultures and pRHMK cells in 24-well plates were refed with MEM containing 0.1% FBS. The frozen enterovirus prototypes obtained from ATCC (virus titer was undetermined) were arbitrarily diluted 1:1000 in medium and inoculated onto both monolayers. Culture plates were incubated at 35 C. for 3 days and the development of cytopathic effect (CPE) was observed and recorded daily.

(130) In Table 18, B1 to B6 refer to Coxsackie B viruses, 68 to 71 refer to enteroviruses, and E1 to E29 refer to echoviruses. Results are shown as follows: indicates no CPE, + indicates 25%, ++ indicates 50%, +++ indicates 75% and ++++ indicates 100% CPE. As described herein, the Calu-3/A549 mixed cell cultures are able to support replication of most enteroviruses as well if not better than pRHMK cells, although enterovirus 71 was not detected by either cell preparation (indicative of very low or no live virus in the sample). Of the viruses tested, B4, 70 and E2 were detected later in Calu-3/A549 mixed cells than in pRHMK cells, and enterovirus 69 and E21 were detected by Calu-3/A549 mixed cells but not pRHMK cells. Importantly, on day 1 the mixed cells detected more viruses than did the pRhMK cells, indicating that the Calu-3/A549 mixed cells are more sensitive for early detection, which is important for diagnosis of patient samples, Likewise, the Calu-3/A549 mixed cells showed more extensive CPE than the pRHMK cells in most of the virus samples. Thus, the Calu-3/A549 mixed cell cultures described herein are able to support the propagation of a wide variety of enteroviruses, clearly demonstrating that these mixed cells are suitable for use in clinical diagnostic applications.

(131) TABLE-US-00018 TABLE 18 Comparison of Calu-3/A549 Mixed Cell Cultures and pRHMK Cells For Enteric Virus Detection Sample RhMK Calu-3/A549 (virus) Day 1 Day 2 Day 3 Day 1 Day 2 Day 3 B1 + ++ + ++++ ++++ B2 + + ++ + ++++ ++++ B3 + ++ ++ + ++++ ++++ B4 + + + B6 + + + ++ ++++ 68 + + 69 ++ +++ 70 + ++ + 71 E1 + +++ + +++ ++++ E2 + + + E3 + + + +++ E6 ++ ++ ++ ++++ E7 + + + ++++ ++++ E8 + ++ ++++ E9 + + + + E11 + + + +++ ++++ E12 + +++ + ++ E13 + + ++ ++++ E19 + ++ + +++ ++++ E21 + ++++ E24 + + ++ ++++ E25 + + + ++++ E29 + ++ + ++

(132) All publications and patents mentioned in the above specification are herein incorporated by reference. Various modifications and variations of the described method and system of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention which are obvious to those skilled in diagnostic microbiology and virology, cell culture, and/or related fields are intended to be within the scope of the following claims. From the above, it is clear that the present invention provides many advantages over presently used methods in diagnostic microbiology.