DIGITAL BIOMOLECULES DETECTION AND/OR QUANTIFICATION USING ISOTHERMAL AMPLIFICATION

Abstract

The present invention relates to a digital method for detecting and/or quantifying at least one target biomolecules in a sample, said biomolecules being selected from DNA, RNA, and proteins based on isothermal amplification. The present invention further relates to different applications of the digital method and to a kit.

Claims

1. A digital method for detecting and/or quantifying at least one target biomolecule in a sample comprising the following steps: a) mixing said sample with a mixture including a buffer, enzymes, a first oligonucleotide which is an amplification oligonucleotide, a second oligonucleotide which is a leak absorption oligonucleotide, and a third oligonucleotide which is a target-specific conversion oligonucleotide; b) partitioning the mixture obtained in step a) into several compartments so that a fraction of the compartments does not contain the target biomolecule; c) converting the target biomolecule into a signal; d) amplifying the signal, and e) detecting and/or measuring said signal in each compartment.

2. The digital method of claim 1, wherein the target biomolecule is a nucleic acid or protein.

3. The method according to claim 2, wherein the target biomolecule is a nucleic acid selected from the group consisting of DNA, cDNA, RNA, mRNA, and micro RNA.

4. The method according to claim 1, wherein the enzymes used in step a) are selected from the group consisting of polymerase, nicking enzyme or restriction enzyme, and exonuclease.

5. The method according to claim 1, wherein the first oligonucleotide includes a partial repeat structure containing a nicking enzyme recognition site, and the second oligonucleotide is able to bind, extend, deactivate, and slowly release the products of polymerization along the first oligonucleotide, thereby inducing a threshold effect.

6. The method of claim 1, further comprising adding a fourth oligonucleotide which is a reporting probe.

7. The method of claim 1, further comprising adding a fifth oligonucleotide which is a cross inhibiting oligonucleotide for detecting and/or quantifying two or more biomolecules.

8. The method according to claim 1, wherein the mixture obtained in step a) is partitioned in step b) into droplets.

9. The method according to claim 8, wherein the size of droplet is between 0.001 and 100 pL.

10. The method according of claim 1, wherein said signal is labelled.

11. The method according to claim 1, wherein the step d) of detecting and/or measuring said signal comprises detecting and/or counting the compartments emitted a fluorescence.

12. The method according to claim 11, wherein for measuring the absolute concentration of the target biomolecule in the tested biological sample, the compartments receiving the fluorescent signal and the non-fluorescent compartments are counted and their ratio is calculated.

13. The method according to claim 1, wherein the target biomolecule is used as a biomarker.

14. An in vitro method for diagnosis of a disease selected from the group comprising cancer, neuronal diseases, cardiovascular diseases, inflammatory diseases, autoimmune diseases, diseases due to a viral or bacterial infection, skin diseases, skeletal muscle diseases, dental diseases, and prenatal diseases comprising the use of the method according to claim 1.

15. An in vitro method for agro diagnosis of a disease selected from the group comprising: diseases caused by biotic stress, or diseases caused by abiotic stress, said method comprising the use of the digital method according to claim 1.

16. A kit for detecting and/or quantifying at least one target biomolecule comprising: a) a mixture of enzymes, selected from the group consisting of polymerase, nicking enzyme or restriction enzymes and exonuclease; b) a mixture of oligonucleotides comprising a first oligonucleotide which is an amplification oligonucleotide, a second oligonucleotide which is a leak absorption oligonucleotide, and a third oligonucleotide which is a target-specific conversion oligonucleotide and optionally a fourth oligonucleotide which is a reporting probe, and c) a partitioning agent.

17. The method according to claim 1, wherein the converted signal in step c) is a DNA single strand.

18. The method according to claim 6, wherein the reporting probe is a fluorescent probe.

19. The method according to claim 8, wherein the droplets are water-in-oil emulsion droplets.

20. The in vitro method according to claim 15, wherein: the diseases caused by biotic stress have an infectious and/or parasitic origin, or the diseases caused by abiotic stress are caused by nutritional deficiencies and/or unfavorable environment.

Description

FIGURES

[0191] FIG. 1: Microfluidic chip design (scale bar represents 100 μm).

[0192] FIG. 2: Droplets analysis. a) water-in-oil droplets were sandwiched between two hydrophobic glass slides and imaged with an epifluorescence microscope. b) Atto633 fluorescence channel. c) bright field channel, d) brightfield channel defocused by a 10 μm offset. With this setting, the droplet outlines are reinforced and facilitate the droplets segmentation. e) The brightfield image (d) is binarized and f) all droplets are segmented using the morphological component command. g) The droplets are filtered according to their size and their circularity. h) The fluorescence of each droplet is extracted from a disk of radius r (with 3<r<6 pixels) and center xy (xy corresponding to the centroid of the selected component). i) The positive droplets correspond to the ones with a fluorescence exceeding a set threshold (here, threshold=7). Knowing the droplet volume, the concentration is calculated back from the Poisson law.

[0193] FIG. 3: Molecular program dedicated to the detection of microRNA. a) a 4-template DNA circuit encodes the connectivity of the molecular program, whose reactions are catalyzed by a set of enzymes (polymerase, exonucleases, endonuclease): the conversion template (cT) converts the target microRNA to a universal trigger sequence; the autocatalytic template (aT) exponentially amplifies the trigger sequence; to avoid nonspecific amplification (in absence of the microRNA), the pseudotemplate (pT) drives the deactivation of the triggers synthesized from leaky reactions; the reporting template (rT) uses the trigger sequences to generate a fluorescence signal. b) Real-time monitoring of the amplification reaction in presence of an increasing concentration of Let-7a. c) Correlation between the amplification time (Cq) and the concentration of Let-7a. Errors bars were calculated from three independent duplicate experiments.

[0194] FIG. 4: Detailed chemical reaction network of the molecular program for the detection of microRNA shown on FIG. 3.

[0195] FIG. 5: Bulk detection of Let-7a with a) the full molecular program, b) the molecular program without the converter template or c) without the pseudotemplate (pT). The amplification reaction is monitored in real-time and the amplification time (Cq) are plotted as a function of the Let-7a concentration.

[0196] FIG. 6: Droplet digital detection of microRNA. a) The sample is mixed with the molecular program and partitioned into millions monodisperse droplets resulting in the random distribution of the microRNA targets throughout the compartments. After incubation, the droplets are imaged by fluorescence microscopy. The droplets having received at least one target exhibit a positive fluorescence signal (1), while the others remain negative (0). b) Fluorescence snapshot of emulsified sample spiked with an increasing concentration of Let-7a after amplification. c) Analysis of 30000 droplets. d) Plot of the linear relationship between the expected (conc. th.) and the experimentally measured (conc. meas.) target concentration. e) Assaying others microRNA by adapting the converter template. f) Invention method specificity evaluated from the cross reactivity of Let7a over Let7c (1 mismatch) and Let7b (2 mismatches).

[0197] FIG. 7: Effect of the pseudotemplate and Nb.BsmI concentrations on the detection of Let7a. Samples containing a defined concentration of pT (from 0 to 15 nM) and Nb.BsmI (from 0.1 to 0.4 u/μL) are spiked with 0 or 1 pM Let-7a and the amplification reaction was monitored in real-time. a) Cq are plotted as a function of the pT and Nb.BsmI concentrations. MDS is plotted as a function of b) the pseudotemplate concentration and c) the Nb.BsmI concentration.

[0198] FIG. 8: Optimization of the Nt.BstNBI concentration. Samples spiked with 0 or 1 pM of Let7a are incubated in presence of a varying concentration of Nt.BstNBI. The Cq are plotted as a function of the Nt.BstNBI concentration.

[0199] FIG. 9: Molecular program to reduce false-positive droplets rate. Target-free samples with a varying concentration of pseudotemplate (pT) are partitioned into droplets. The fluorescence of the emulsions is monitored in real-time.

[0200] FIG. 10: Elimination of nonspecific amplification reaction. The molecular program with 0 or 15 nM of pT is spiked with 0 or 1 pM of synthetic Let-7a before partitioning. The droplets are incubated at 50° C. and the bulk fluorescence (emulsion-averaged) continuously monitored (solid lines). The incubation is stopped at different time points and the droplets imaged by fluorescence microscopy to extract the percentage of positive compartments (diamonds).

[0201] FIG. 11: microRNA detection from biological samples. a) Let7a detection from H1975 cell line. b) Let7a and mir-39ce detection from human colon total RNA.

[0202] FIG. 12: Effect of Klenow(exo-) on the detection of Let7a microRNA. a) Real-time amplification reaction in presence of 0 or 10 pM of Let7a and a varying concentration of Klenow(exo-). b) Amplification time (Cq) as a function of the concentration of Klenow(exo-). c) Experimental conditions.

[0203] FIG. 13: Digital detection of Let7a using a mixture of Klenow(exo-) and Vent(exo-). a) Measured concentration as a function of spike-in-expected concentration. b) Experimental conditions. Mix A (containing the enzymes) and mix B (containing the templates) are mixed on chip using a 3-inlet flow focusing device. Droplets are incubated at 50° C. for 200 minutes.

[0204] FIG. 14: Detection of cel-miR39 in plasma sample. Human blood samples were collected from healthy donors and plasma was obtained by centrifugation. 0 or 1 pM of cel-miR39 is spiked in an amplification mixture supplemented with 5% plasma (v/v) and RNAse inhibitor. The measured concentrations reported on the plot indicate the full recovery of the exogenous microRNA in 5% plasma.

[0205] FIG. 15: Conversion module designs and bulk detection of enzymatic activities (standard deviation calculated for at least three independent data points). a) Nt.BstNBI, b) RNAseH2. c) APE-endonuclease 1 (APE-1). d) Uracil DNA glycosylase (UDG). e) Alkyl adenine glycosylase (AAG). f) BsmAI restriction enzyme. g) Poly(A) polymerase (PAP). h) T4 DNA ligase. i) T4 Polynucleotide Kinase (T4 PNK).

[0206] FIG. 16: Digital detection of enzymes. a) Microscopy snapshots of 2D droplet arrays for 6 different concentration of Nt.BstNBI enzyme. b) Measured concentration (fM) as a function of the spiked-in concentration (u/mL) for different enzymes. The linear relationship demonstrates the absolute quantitativity provided by the digital readout. Error bars correspond to the 95% confidence interval on the measurement.

[0207] FIG. 17: Comparison of the digital assay quantification of Nt.BstNBI for small (0.95 pL) and big (7.2 pL) droplets. The concentrations computed in both experiments were consistent. Error bars correspond to the 95% confidence interval on the measurement.

[0208] FIG. 18: Tetrastable system built from two cross-inhibitory bistable switches. (a) Schematic of the tetrastable DNA circuit. Two microRNA sensing circuits (cT, aT, pT and rT) are interconnected by killer template αkβ and βkα, which repress unwanted cross activation. (b) Detailed mechanism of the five kinds of template (pol.=Vent(exo-), nick1=Nt.BstNBI, nick2=Nb.BsmI, RE=BsmI, exo=ttRecJ). Conversion templates (cT) convert the complementary microRNA target to a signal strand (α or β). Autocataytic tem-plates (aT) exponentially amplify the signal strands. Pseudotemplates, by deactivating a fraction of signal strands, suppress background amplification stemming from biochemical noise. Reporting templates (rT) transduce the molecular signal (α or β) to a detectable fluorescence signal (green=Oregon green fluorophore, red=Atto633 fluorophore). From the α or β strands, killer templates (kT) produce pT of the opposite switch, mitigating unspecific crosstalk. All produced strands are continuously degraded by the exo-nuclease to maintain the system dynamic. Only one half of the tetrastable circuit is represented here, the second half being obtained by substituting a by B and conversely.

[0209] FIG. 19: Killer templates efficiency. (a) The α switch, triggered by 10 pM if mir39, is connected to the killer template αkβ producing pTβ of different lengths (with a deactivating tail ranging from 0 to 5 adenylate moieties). (b) Fluorescence of the β switch (t=1000 min) as a function of the concentration of kT.

[0210] FIG. 20: Extended data from FIG. 19 (a) Amplification curves for different concentrations of αkβ producing pTβ of different lengths. (b) Cq plotted as the function of the αkβ concentration

[0211] FIG. 21: Determination of the kT concentration to suppress cross activation between the α and β switches. (a) A and B circuits are triggered with 0 or 10 pM of mir92a and let7a respectively in presence of an increasing concentration of αkβ and βkα. (b) Amplification time (Cq) of the α and β switches. (c) Color-coded representation of the Cq as a function of the concentration of kT. The dashed blue frames represent the concentration of kT for which the system reaches tetra-stability. (d) Amplification curves of the mir39/mir7 duplex assay (0 or 10 pM each target). (e) Measured Cq for 7 different duplex assays. The left inset represents the average Cq and standard deviation for the 7 assays

[0212] FIG. 22: Principle of the digital duplex assay. (a) Droplets were generated out of 4 samples (0 pM mir39/0 pM let7a, 3 pM mir39/0 pM let7a, 0 pM mir39/3 pM let7a, 3 pM mir39/3 pM let7a) with a microfluidic chip, and the emulsions were analyzed by microscopy. (b) 2D histograms of the probes' fluorescence (α switch=green fluorescence—mir39, β switch=red fluorescence—let7a). Vertical and horizontal dashed lines indicate the positive threshold for the α and β switch respectively (c) Histograms of the measured versus expected target concentrations. (d) Digital duplex assays of various samples. of different compositions (microRNA target and concentrations).

[0213] FIG. 23: In-solution singleplex versus duplex assay. (a) Amplification curves of α (top) and β (bottom) bistable circuits incubated separately with the amplification mix and 0 or 3 pM of let7a and mir39 targets (singleplex assay). (b) Amplification curve of α and β switches embedded in the full tetrastable circuit (duplex assay). (c) Amplification time measured for a duplicate experiment. From these data, it was concluded that the killer templates have little effect on the amplification time in these conditions.

[0214] FIG. 24: Limit of the blank singleplex versus duplex assay. 4 samples are assembled as follow: sample A=a circuit only, 0 pM target, sample B=β circuit only, 0 pM target, sample C=α and β circuit, 0 pM target, sample D=α and β circuit, 1 pM target mir39 and let7e. (a) Amplification curves of the 4 samples in solution. (b) Composite image of a portion of the microfluidics chamber (brightfield, green and red fluorescence). (c) 2D histograms of the droplets fluorescence (α switch=green fluorescence, β switch=red fluorescence). (d) Percentage of positive droplets. The percentage of false positive droplets is qualitatively similar whether the assay is performed in singleplex or duplex (false positive α=1.1% singleplex and 1.1% in duplex, false positive α=0.25% singleplex and 0.28% in duplex).

EXAMPLES

[0215] The below Examples aim to demonstrate that the present invention allow high sensitivity molecule detection by digitalizing an analog method of isothermal nucleic acid amplification.

Example 1: Detection of microRNA by the Digital Method of the Invention

[0216] Methods and Materials

[0217] Chemicals: Oligonucleotides (templates and synthetic microRNA) were purchased from Biomers (Germany). The sequences were purified by HPLC and checked by matrix-assisted laser desorption/ionization mass spectrometry. Templates were designed according to the rules described by Montagne et al. (Montagne et al, 2011 and Montagne et al., 2016). The autocatalytic template (aT), pseudotemplate (pT) and reporting template (rT) are protected from the degradation by the exonuclease by 5′ phosphorothioate backbone modifications. A 3′ blocking moiety (phosphate group for aT, pT, cT and quencher for rT) is used to avoid nonspecific polymerization. Table 2 below recapitulates all the sequences used throughout the invention.

TABLE-US-00003 TABLE 2 Oligonucleotides sequences used throughout the invention. “*” denotes phosphorothioate backbone modification. “p” denotes 3+-phosphate modification. Upper and lower cases represent 2′-deoxyribonucleotide and ribonucleotide, respectively. Trigger seq or trigger sequence relates to the sequence amplified by the autocatalytic template. The sequences SEQ ID NO: 61 to 66 are also cited as sequences 54 to 59 in table 1. SEQ ID No ID Sequence Function 60 α CATTCTGGACTG Trigger seq 61 αtoα C*A*G*T*CCAGAATGCAGTCCAGAA p aT 62 pTα T*T*T*T*TCAGTCCAGAATG p pT 63 rTα Atto633 *A*T*TCTGAATGCAGTCCAGAAT BHQ2 rT 64 Let7atoα TGCAGTCCAGAAGTTTGACTCAAACTATACAACCTACTACCTCA p cT 65 Let7ctoα TGCAGTCCAGAAGTTTGACTCAAACCATACAACCTACTACCTCA p cT 66 mir39toα TGCAGTCCAGAAGTTTGACTCACAAGCTGATTTACACCC p cT 67 Let-7a ugagguaguagguuguauaguu microRNA 68 Let-7b ugagguaguagguugugugguu microRNA 69 Let-7c ugagguaguagguuguaugguu microRNA 70 mir39-ce ucaccggguguaaaucagcuug microRNA 71 Expar- AACTATACAACCTACTACCTCAAACAGACTCAAACTATACAACCTA DNA Let7a CTACCTCAA 72 mir92a AGG UUG GGA UCG GUU GCA AUG CU microRNA

[0218] Nb.BsmI and Nt.BstNBI nicking enzymes, Vent(exo-) DNA polymerase and BSA were purchased from New England Biolabs (NEB). A 10-fold dilution of Nt.BstNBI was prepared by dissolving the stock enzyme in Diluent A (NEB) supplemented with 0.1% Triton X-100. The exonuclease ttRecJ was home-brewed expressed and purified by chromatography according to the protocol published by Yamagata (Yamagata et al., 2001). The enzyme is stored at 1.53 NM in Diluent A+0.1% Triton X-100. All the proteins were stored at −20° C.

[0219] Cell Culture. Human non-small cell lung cancer cell line, H1975, and colorectal cancer cell line, HCT116, cells were utilized for miRNA extraction. HCT116 cells were cultured in DMEM/F12 media supplemented with 10% FCS, 100 units/mL penicillin G, and 100 Ng/mL streptomycin. H1975 cells were cultured in a RPMI 1640 medium supplemented with 10% (v/v) FBS, 100 units/mL penicillin and 100 Ng/mL streptomycin. Cells were grown in a 5% CO.sub.2 incubator at 37° C.

[0220] microRNA extraction: Human colon total RNA (Thermofisher Scientific) was aliquoted at 13 Ng/mL and stored at −20° C. before use. For cellular extraction, microRNAs were extracted from around 1×10.sup.6 cells using TaqMan® miRNA ABC Purification Kit (Applied Biosystems) following the kit instructions. Briefly, cells were resuspended in 50 μL of 1×PBS, and mixed with 150 μL Lysis Buffer. After the cell lysis step, 2 μL of 1 nM external control cel-miR-39-3p oligonucleotides (Biomers) is spiked into the prepared sample and vortexed, to evaluate the extraction efficiency. The target microRNA is captured using magnetic Human Panel beads and eluted in 100 μL of elution buffer.

[0221] Reaction mixture assembly: All reaction mixtures were assembled at 4° C. in 200 μL PCR tubes: the templates are mixed with the reaction buffer (20 mM Tris HCL pH 7.9, 10 mM (NH.sub.4).sub.2SO.sub.4, 40 mM KCL, 10 mM MgSO.sub.4, 50 μM each dNTP, 0.1% (w/v) Synperonic F 104, 2 μM netropsin, all purchased from Sigma Aldrich) and the BSA (200 μg/mL). After homogenization, the enzymes are added (300 u/mL Nb.BsmI, 10 u/mL Nt.BstNBI, 80 u/mL Vent(exo-), 23 nM ttRecJ). Each sample was spiked with the microRNA target, serially diluted in 1× Tris-EDTA buffer (Sigma Aldrich) using low-binding DNA tips (Eppendorf). The samples (bulk or emulsion) were incubated at 50° C. in a qPCR thermocycler (CFX96 Touch, Biorad) and the fluorescence was recorded in real-time. For bulk experiments, the time traces were normalized and the Cq (amplification starting times) determined as 10% of the maximum fluorescence signal.

[0222] Droplets generation: a 2-inlet (one for the oil, one for the aqueous sample) flow focusing microfluidic mold was prepared with standard soft lithography techniques using SU-8 photoresist (MicroChem Corp., MA, USA) patterned on a 4-inch silicon wafer. A 10:1 mixture of Sylgard 184 PDMS resin (40 g)/crosslinker (4 g) (Dow Corning, MI, USA) is poured on the mold, degassed under vacuum and baked for 2 hours at 70° C. After curing, the PDMS was peeled off from the wafer and the inlets and outlet holes of 1.5 mm diameter were punched with a biopsy punch (Integra Miltex, PA, USA). The PDMS layer was bound onto a 1 mm thick glass slide (Paul Marienfeld GmbH & Co. K.G., Germany) immediately after oxygen plasma treatment. Finally, the chip underwent a second baking at 200° C. for 5 hours to make the channels hydrophobic (Kaneda et al., 2012). The microfluidic chip details are presented in FIG. 1. The aqueous sample phase and the continuous phase composed of fluorinated oil (Novec-7500, 3M) containing 1% (w/w) fluorosurfactant (RAN Biotechnologies, MA, USA) were mixed on chip using a pressure pump controller MFCS-EZ (Fluigent, France) and 200 μm diameter PTFE tubing (C.I.L., France) to generate 0.5 pL droplets by hydrodynamic flow focusing.

[0223] Droplets imaging: After incubation, the droplets were imaged by fluorescence microscopy. The bottom slide (76×52×1 mm glass slide) was spin-coated with 200 μL Cytop CTL-809M (Asahi Glass) and dried at 180° C. for 2 hours. The emulsion was sandwiched with a 0.17 mm thick coverslip treated with Aquapel. 10 μm polystyrene particles (Polysciences, Inc., PA, USA) were used as spacer to sustain the top slide and avoid the compression of the emulsion. The imaging chamber was finally sealed with an epoxy glue (Sader) and images were acquired using an epifluorescence microscope Nikon Eclipse Ti equipped with a motorized XY stage (Nikon), a camera Nikon DS-Qi2, an apochromatic 10× (N.A. 0.45) (Nikon) and a CoolLed pE-4000 illumination source. Composite images were generated with the open source ImageJ software. Quantitative data were extracted from the microscopy images using the Mathematica software (Wolfram), following the procedure detailed in FIG. 2.

[0224] Results

[0225] Analog Amplification Method According to the International Application WO2017140815

[0226] The inventors of the present invention previously developed a versatile molecular programming language named PEN-DNA toolbox (Polymerase Exonuclease Nickase-Dynamic Network Assembly) (Montagne et al., 2011 and Baccouche et l., 2014). The topology of the network is defined by a set of short oligonucleotides (templates). The network is interpreted by a mixture of enzymes (polymerase, exonuclease and nickase), which process the information fluxes by producing and degrading DNA strands, which in turn activate or inhibit other nodes of the network.

[0227] Using this set of reaction modules, the inventors previously designed a generic molecular program dedicated to the detection of microRNA. FIG. 3 presents the connectivity of the circuit: the universal signal amplification part corresponds to a bistable node composed of two templates: an autocatalytic template (aT), composed of a dual-repeat sequence catalyzing the exponential replication of a 12-mer oligonucleotide; a pseudo-template (pT) that absorbs the leak products stemming from nonspecific reaction on the autocatalytic template and therefore avoid background amplification. A converter template (cT) is connected upstream to the aT: upon binding of the target to the input part of the cT, the latter catalyzes the production of an output strand, which in turn triggers the autocatalytic reaction on the aT. Downstream to the aT, a reporting template (rT) captures the amplified signal strands to produce a fluorescence signal. The detailed reaction network is presented in FIG. 4.

[0228] FIG. 5b-c show the evaluation of the sensitivity of this approach for the bulk detection of Let-7a. The 4 templates are mixed together with the enzymatic processor and spiked with a concentration of synthetic target Let-7a ranging from 0 to 1 nM. The fluorescence of the rT is monitored in real-time with a PCR thermocycler set at a constant temperature of 50° C. The negative control (no target) does not produce a positive signal for more than 20 hours. The sensitivity of the assay is around 1 fM and the dynamic range in bulk ranges from 1 fM to 100 pM, i.e. 6 orders of magnitude. In absence of the pT (FIG. 5b), the sensitivity is negatively affected with a limit of detection of 1 pM (estimated from 3 standard deviation from the mean amplification time of the negative control). These results demonstrate the importance of this active leak-absorption mechanism for controlling the amplification threshold and thus eliminating background amplification. In absence of the cT (FIG. 5c), the amplification reaction is not observed, demonstrating the specificity of the molecular program for the targeted microRNA.

[0229] Digitalization of the Analog Amplification Method

[0230] To convert the analog signal to a digital readout, the inventors move on to evaluate the possibility to detect single molecules compartmentalized in droplets. The molecular program spiked with a known concentration of Let-7a was partitioned in picoliter-sized water-in-oil droplets using a flow focusing microfluidic junction. The monodisperse emulsion was incubated at 50° C. and the reaction stopped after the target-containing droplets amplified. Finally, the droplets were imaged by fluorescence microscopy and the concentration recalculated from the Poisson law.

[0231] FIG. 6 shows the microscopy snapshots of the emulsions after incubation for 200 minutes. It is observed a linear correlation between the spiked miRNA concentration and the concentration measured according to the Poisson law. The calculated limit of detection is 2.1 fM.

[0232] The modular approach of the current system enables to repurpose the molecular program by redesigning only the converter template (FIG. 6d) to hybridize to any target of interest, without affecting the quantification, which depends on a universal signal amplification machinery.

[0233] A major concern related to the quantification of microRNA is the high sequence homology in between the microRNA targets. The inventors thus evaluated the specificity of the current detection method over the Let-7 family. FIG. 4e shows a very good discrimination between the Let-7a sequence and analogs containing a single (Let-7c) or dual (Let-7b) mismatched bases.

[0234] Effect of the Pseudotemplate (pT) and the Nuclease Concentration

[0235] The inventor also assayed the effect of the pseudotemplate (pT) and the nuclease concentration (Nb.BsmI).

[0236] For that samples containing a defined concentration of pT (from 0 to 15 nM) and Nb.BsmI (from 0.1 to 0.4 u/μL) are spiked with 0 or 1 pM Let-7a and the amplification reaction was monitored in real-time. The Cq are plotted as a function of the pT and Nb.BsmI concentrations (FIG. 7a). A microRNA detection score (MDS) is calculated for each set of concentration according to the following equation. MDS=100(Cq.sub.NC/Cq.sub.1 pM−1)/Cq.sub.1 pM. The MDS is meant to reflect both the time window between the amplification times of the NC and 1 pM and the speed of the target-triggered reaction. The MDS is plotted as a function of the pseudotemplate concentration (FIG. 7b) and the Nb.BsmI concentration (FIG. 7c).

[0237] FIG. 7 shows that both parameters delay the amplification reaction: the pseudotemplate plays the role of an active sink that degrades part of the produced triggers. Nb.BsmI is known to be inhibited by its own product (the nicked, un-melted duplex), which probably slows down the reaction by preventing the release of the trigger after cutting the duplex. It is to note that increasing the pseudotemplate concentration positively affects the detection score, by delaying preferentially the negative control (NC) amplification and affects to a lesser extent the target-triggered amplification. On the other hand, Nb.BsmI affects the amplification time, irrespective from the target concentration and thus negatively affect the detection score. This observation demonstrates the importance of the active degradation mechanism provided by the pseudotemplate to reduce/abolish background amplification even when the amplification method is digitalized.

[0238] The inventors also investigated the optimal concentration of nuclease Nt.BstNBI. For that, the samples spiked with 0 or 1 pM of Let7a are incubated in presence of a varying concentration of Nt.BstNBI. The Cq are plotted as a function of the Nt.BstNBI concentration. FIG. 8 shows that it exists an optimal concentration of the endonuclease Nt.BstNBI around 0.01 u/μL.

Comparative Example

[0239] Most isothermal nucleic acid amplification techniques cannot be transposed to a digital format. This is generally attributed to nonspecific reactions, which eventually trigger the amplification in all compartments, irrespective of the presence of the target as described in Zhang et al. (Zang et al., 2015). Relying on an end-point analysis, it becomes crucial to have a time window large enough to discriminate the target-containing droplets (exhibiting a positive signal) from the target-free droplets. FIG. 9 shows that in absence of pT and target, all the droplets turn on in less than an hour. This result affects considerably the time-window required to separate the two populations and is consistent with a previously described EXPAR system described by Zhang et al. (Zhang et al., 2015).

[0240] By increasing the pT concentration and thus raising the amplification threshold, the self-start is delayed until being completely cancelled at 15 nM of pT. FIG. 10 compares the time window for the detection of 1 pM of Let-7a with 0 or 15 nM of pT. In absence of the pT, it is nearly impossible to distinguished between the target-containing sample and the negative control. However, the absorption of the leak responsible for false positive droplets guarantees the stabilization of the off-state for more than 16 hours, without hampering the amplification of target-containing droplets. Thanks to the complete background elimination, the method of the present invention displays an unrivaled robustness with respect to incubation time and shows a theoretically infinite time window.

[0241] Moreover, compared to other digital amplification method previously implemented (Zhang et al., 2015, Cohen et al., 2016 and Tian et al., 2016), the selectivity of the method of the present invention is estimated to be superior to 97%.

[0242] Detection of Endogenous microRNA from Human Cells by the Method of the Invention

[0243] The success of microRNA-based diagnostic as a routine biomedical procedure depends on the robustness and reproducibility of the microRNA quantification. The inventors thus evaluated the possibility to detect endogenous microRNA from human cells.

[0244] microRNAs were extracted from the cell line H1975 (adenocarcinoma) and Let-7a was quantified by the method of the invention, with a varying concentration of the RNA extract. The measured Let-7a concentration from sample containing 1% and 10% of RNA extract are 90 fM and 1 pM respectively (FIG. 11a).

[0245] Additionally, the inventors quantified Let-7a from human colon total RNA: FIG. 11b shows the linear relationship between the total RNA concentration (ranging from 0 to 4 μg/mL) and the measured Let-7a concentration. As a negative control experiment, mir-39ce, absent from human genome, was not detected in these samples. Overall, this demonstrates the accuracy of the method of the invention and its robustness in high complex background samples.

Example 2: Use of Klenow(3′→5′ Exo-) DNA Polymerase to Accelerate microRNA-Triggered Amplification

[0246] In order to accelerate microRNA targeted amplification, the inventors investigated the effect of adding another DNA polymerase which is Klenow(exo-). An amplification mixture (containing Vent(exo-) polymerase), spiked with 0 or 10 pM of Let7a microRNA target, is supplemented with a varying concentration of Klenow(exo-). FIG. 12 shows that in absence of Klenow(exo-) polymerase the specific amplification occurs in about 100 minutes, while the negative control does not amplify within 1000 minutes. Interestingly, the specific amplification is brought down to 20 minutes with 16 u/mL of Klenow(exo-), while the negative control is not affected. Above this concentration, the inventors observed undesirable self-amplification of the negative control samples in less than 40 minutes. Altogether, these results suggest that the addition of an optimal concentration of Klenow(exo-) in addition to Vent(exo-) is beneficial for accelerating the amplification reaction because Klenow(exo-) initiates efficiently the extension of the RNA primer.

[0247] The inventors then investigated the use of a mixture of DNA polymerases for the droplet digital detection of microRNA. Since Klenow(exo-) possesses a non-negligible activity at room temperature, oligonucleotides (templates) and enzymes were assembled separately (mix A and mix B) and mixed on chip just before the droplet partitioning using a 3-inlet microfluidic device (one inlet for the continuous phase and 2 inlets for both parts of the amplification mixes A and B). This prevents the reaction from starting prior to target encapsulation. The measured concentrations are consistent with spike-in concentration of each sample, demonstrating the accurate digital quantification of the target microRNA with this polymerase mixture (FIG. 13).

Example 3: Detection of microRNA Directly from Plasma Samples

[0248] The inventors also assessed the detection of microRNA in plasma samples using the digital detection method of the invention.

[0249] Human blood samples were collected from healthy donors (HIV, HBV, and HCV negative) into 10 mL blood collection tubes (Streck tubes supplied by Biopredic International). Plasma was obtained by centrifugation for 10 min at 2000×g at 4° C. followed by centrifugation for 15 min at 2000×g at 4° C. Plasma was aliquoted in clean polypropylene tubes using a Pasteur pipette, and stored at −80° C. until use. 0 or 1 pM of cel-miR39 (microRNA sequence from C. Elegans.) is spiked in an amplification mixture supplemented with 5% plasma (v/v) and RNAse inhibitor, murine at 1 u/μL. The measured concentrations reported on the plot indicate the full recovery of the exogenous microRNA in 5% plasma. The results show on FIG. 14 thus demonstrates the quantitative measurement of microRNA concentration in crude plasma samples.

Example 4: Detection of Enzymes by Using the Digital Method of the Invention

[0250] Oligonucleotides were obtained from Biomers or Eurofins (Table 3). Nicking enzymes nt.BstNBI (R0607), Nb.BsmI (R0706), DNA polymerase Vent(exo-) (M0257), Klenow(exo-) polymerase, restriction enzyme BsmAI (R0529), AP-endonuclease APE-1 (M0282), Uracil DNA glycosylase UDG (M0280), Alkyl Adenine glycosylase hAAG (M0313), poly(A) polymerase (M0276), T4 DNA ligase (M0202), T4 polynucleotide kinase PNK (M0201) were purchased from New England Biolabs. RNAse H2 enzyme (11-03-02-02) was purchased from Integrated DNA technologies. The exonuclease ttRecJ was home purified according to previously reported procedure (8). All oligonucleotides and proteins were stored at −20° C.

TABLE-US-00004 TABLE 3 Sequences used in this study.“*” denotes phosphorothioate backbone modification. “p” denotes phosphate modification. Upper and lower cases represent 2′-deoxyribonucleotide and ribonucleotide, respectively. “F” denotes an analog of abasic site, a tetrahydrofuran group. “I” stands for deoxyinosine. BHQ2 stands for Black Hole Quencher 2 and is used as a quencher of the Cy5 fluorophore. SEQ ID NO: Name Sequences Function 73 CBo12-2P53 C*T*G*GGaGAATGCTGGGATGAA aT 74 pTBoT5S3P T*T*T*TT CTGGGATGAATG pT 75 rTBo-2BsmICy5 Cy5 *C*T*TCATGAATGCTGGGATGAAG BHQ2 rT 76 NBItoBo-2+2P TG-CTGGGATGAAGTTTGACTCACATTGCTTCA TTT cT TGAAGCAATGTGAGTCAAACTTCTGGACTGTT 77 nbitoBo-2+2(rG) TGCTGGGATGAAGTTTGACTCACATTGCTTCAGC-TTT- cT GCTGAAGCAATgTGAGA 78 nbitoBo-2+2AP TGCTGGGATGAAGTTTGACTCACATTGCTTCA TTT cT TGAAGCAATGTGAGFCAAACTTTTT 79 nbitoBo- TGCTGGGATGAAGTTTGACTCACATTGCTTCA TTT cT 2+2UDG (2) TGAAGCAAUGUGAGTTTTT 80 Aagtodna-top GTAGGTTG TIAATGATGTAGAATGAGT cT 81 Aagtodnabot ACTCATTCTACATCATTTACAACCTAC cT 82 dnatoBo-2+2P TG-CTGGGATGAAGTTTG ACT CAA -ACT ATA CAA cT CCT ACT ACC TCA 83 nitoBo- ATGCCTAATGTCTCA cT 2+2BsmAI+9  TGCTGGGATGAAGTTTGACTCACATTGCTTCA TTT TGAAGCAATGT GAGTCAAAC 84 Prec-rna ugagguaguagguuguauaguu cT 85 polyAtoBo-2+2P TGCTGGGATGAAGTTTG ACT CA cT TTTTTTTTTTTTTTTTTTTTTTTTT 86 ligltoBo-2+2 TGCTGGGATGAAG cT 87 lig2P p CTTGACTCACATTGCTTCATTTTTTGAAGCAATGTG cT 88 lig3P p AGTCAAGCTTCATCTTT cT 89 lig2noP CTTGACTCACATTGCTTCATTTTTTGAAGCAATGTG cT 90 lig3noP AGTCAAGCTTCATCTTT cT

[0251] Reaction assembly: All reactions were assembled at 4° C. in 200 μL PCR tubes. Templates and enzymes (Table 4) were mixed with the reaction buffer (20 mM Tris HCL pH 7.9, 10 mM (NH.sub.4).sub.2SO.sub.4, 40 mM KCL, 10 mM MgSO.sub.4, 50 μM each dNTP, 0.1% (w/v) Synperonic F 104, 2 μM netropsin, all purchased from Sigma Aldrich) and BSA (200 μg/mL). Samples were spiked with 10% v/v of various concentration of the targeted enzyme serially diluted in 200 μL PCR tubes with 1× of reaction buffer supplemented with BSA (200 μg/mL). Following an optional preincubation step, sample are incubated at 48° C. in CFX96 touch thermocycler instrument. Detailed experimental conditions are presented in Table 4.

TABLE-US-00005 TABLE 4 Experimental conditions for the detection of the different assessed enzymes. T4 DNA ntBstNBI RNAseH2 APE-1 UDG AAG BsmAI PAP ligase T4 PNK aTα 50 nM pTα 6 nM 8 nM 7 nM 7 nM 7 nM 16 nM 8 nM 6 nM 7.5 nM rTα-Cy5 30 nM cT nbitoBo- nbitoBo- nbitoBo- nbitoBo- Aagtolet7atop/ nbitoBo- Prec-rna/ lig1toBo- lig1toBo- 2 + 2 2 + 2(rG) 2 + 2AP 2 + 2UDG(2) Aagtolet7abot/ 2 + 2bsmAI + 9 polyAtoBo- 2 + 2/ 2 + 2/ 8 nM 200 pM 50 pM 100 pM Let7atoBo- 50 pM 2 + 2P lig2P/ lig2noP/ 2 + 2P 10/1 nM lig3P lig3noP 1/5/1 nM 33 nM 10 nM each each Nb.Bsml .sup. 300 u/mL Vent(exo-)  .sup. 70 u/mL ttRecJ 13 nM Nt.BstNBI 10 u/ml APE-1 2 u/mL T4 DNA ligase 16 u/ml Klenow (exo-) 2.5 u/mL ATP 1 mM 200 μM preincubation none none none 32° C. 1 h 31° C. 3 h none 31° C. 1 h 4° C. 12 h 25° C. 6 h

[0252] Digital Assay: In the case of digital assays, enzymes (mix A) and templates (mix B) were mixed in two separate tubes in reaction buffer 1× to prevent the reaction to start prior to the encapsulation of single enzymes in water-in-oil droplets. For increasing the assay throughput, the inventors resorted to a serial emulsification strategy previously reported (Menezes et al., 2019): mix A, containing varying concentration of the target enzymes, are barcoded with different combinations of three fluorescently Labeled dextrans (dextran Texas Red 70,000 MW, dextran Alexa Fluor 488 3,000 MW and, dextran Cascade Blue 10,000 MW Lysine fixable (ThermoFisher Scientific)). Mix A (Loaded into the pressurized sample changer) and mix B were blend and serially emulsified on chip using a 3-inlet flow-focusing microfluidic PDMS chip. The continuous phase is composed of fluorinated oil (Novec-7500, 3M) containing 1% (w/w) fluorosurfactant (RAN Biotechnologies, MA, USA). The microfluidic mold was prepared with standard soft Lithography techniques using SU-8 photoresist (MicroChem Corp., MA, USA) patterned on a 4-inch silicon wafer and manually aligned using a MJB4 mask aligner (SUSS Microtec). A 10:1 mixture of Sylgard 184 PDMS resin (40 g)/crosslinker (4 g) (Dow Corning, MI, USA) was poured on the mold, degassed under vacuum and baked for 2 hours at 70° C. After curing, the PDMS was peeled off from the wafer and the inlets and outlet holes of 1.5 mm diameter were punched with a biopsy punch (Integra Miltex, PA, USA). The PDMS layer was bound onto a 1 mm thick glass slide (Paul Marienfeld GmbH &t Co. K.G., Germany) immediately after oxygen plasma treatment. Finally, the chip underwent a second baking at 200° C. for 5 hours to make the channels hydrophobic.

[0253] Droplet imaging and analysis: Droplets were analyzed by transmission and epifluorescent microscopy. A 70×50×1 mm glass slide (Paul Marienfeld, GmbH &t Co. K.G., Germany) was made hydrophobic by pouring 3 mL Novec 1720 (3M) and baked for 1 minute at 100° C. on a heating plate. 10 μm polystyrene beads (Polysciences, Inc., PA, USA), used as hard spheres spacers, were spotted on the glass slide and left for evaporation at 100° C. The emulsion was deposited on the glass slide and covered with a 22×22 mm coverslip (VWR) treated with Novec 1720. Chambers were sealed with an epoxy glue (Sader) and images were acquired using an epifluorescence microscope Nikon Eclipse Ti equipped with a motorized XY stage (Nikon), a camera Nikon DS-Qi2 and a CoolLed pE-4000 illumination source and an apochromatic 20× (N.A. 0.75, WD 1.0) objective. False-color images were generated with the open source ImageJ software.

[0254] Images were analyzed using Mathematica software (Wolfram) using the fluorescent barcodes to sort the different sample populations. The number of negative and positive droplets for each sample allows to compute the target enzyme concentration dictated by Poisson statistics.

[0255] Results

[0256] Proof of Principle with the Nicking Enzyme Nt.BstNBI

[0257] The isothermal signal amplification system used here is based on three encoding deoxyribo-oligonucleotides: the first one is an autocatalytic template (seq. Cbo12-2PS3 SEQ ID NO:73), dual-repeat sequence that catalyzes the exponential replication of the trigger strand using a DNA polymerase (Vent(exo-)) and a nicking enzyme (Nb.BsmI); the second pseudotemplate module (seq. pTBoT5PS3 SEQ ID NO:74) deactivates a fraction of the trigger strands and behaves as a catalytic drain to avoid nonspecific, target-independent amplification caused by leaky reactions; the third reporting module (seq: rTBo-2BsmICy5 SEQ ID NO:75), a profluorescent hairpin-shaped probe, hybridizes to the trigger that, upon polymerization, generates a fluorescence signal. Together, these enzymatic and nucleic components create a bistable molecular circuit that can be used in a variety of ultrasensitive biosensing applications.

[0258] As a proof of principle, the inventors designed a first sensing module (seq: nbitoBo-2+2 SEQ ID NO:76) to connect the activity of nicking enzyme Nt.BstNBI, to the bistable amplification switch (FIG. 15a). The hairpin-shaped template includes a 5′ output site complementary to the trigger strand, just upstream to the nicking recognition and cutting site. The 3′ extremity is self-complementary, priming the extension by the polymerase along the template. In its double-stranded form, the duplex can be nicked by the Nt.BstNBI, releasing the trigger. Catalytic cycles of polymerization/nicking lead to the linear production of the trigger strand that, after exceeding a concentration threshold set by the pseudotemplate, initiates the amplification. The inventors monitored the reaction in real-time in the presence of an increasing concentration of Nt.BstNBI. As expected, the higher the concentration, the faster trigger are produced and therefore, the sooner the amplification. The sensitivity of this approach in bulk is about 5 mu/ml (milliunits per milliliter), which is 3 orders of magnitudes lower than using traditional cleavage assays of profluorescent probes.

[0259] Versatility Demonstrated Over 9 Enzymes

[0260] Based on these results, the inventors designed a variety of sensing strategies for the ultrasensitive detection of other DNA-related enzymes. A reaction cascade linking the enzymatic activity of interest to the generation of specific trigger strands is designed. The detection of nucleases was based on blocking the trigger production under constitutive presence of Nt.BstNBI. RNAseH (RNAseH2) and AP-endonuclease (APE-1) were detected by introducing in the stem structure of the sensing template a ribonucleotide and an abasic site (AP), respectively (FIGS. 15a and b, seq: nbitoBo-2+2(rG) SEQ ID NO: 77 and nbitoBo-2+2AP SEQ ID NO: 78). In these designs the polymerization of the unprocessed substrate with a protruding 3′ polythimidylate extension was blocked. The processing of these substrates by the corresponding enzyme induces the endonucleolytic cleavage of the stem, restoring the production of triggers by polymerization/nicking cycles. Uracil DNA glycosylase (UDG) was detected by substituting the AP-site by a deoxyribouridine moiety (seq: nbitoBo-2+2UDG(2) SEQ ID NO: 79), adding one more step to the enzymatic cascade (FIG. 15c). Excision of the uracil base by the glycosylase introduces an abasic site that is further incised by APE-1, eventually reactivating the production of triggers.

[0261] The inventors tested a different strategy for the detection of another monofunctional DNA N-glycosylase, Alkyl Adenine Glycosylase (AAG, FIG. 15d). An inosine residue (hypoxanthine nucleobase, Hx) is incorporated in a short double-stranded oligonucleotide (seq: Aagtorna-top/Aagtorna-bot, SEQ ID NO:80/SEQ ID NO: 81). Upon excision by AAG, the AP-site is incised by APE-1. The 5′ part of the nicked strand can dissociate and bind to the input part of a second NBI-dependent template, whose output is the trigger strand (seq: dnatoBo-2+2P SEQ ID NO: 82).

[0262] The detection of restriction enzymes was achieved by appending the recognition site to the 5′ part of the sensing template (FIG. 15e). In absence of the target enzymes, futile cycles of polymerization/nicking generate unproductive triggers with a 3′ extension (which includes the restriction site). In presence of the target enzyme, the double-stranded restriction site is cleaved, releasing the extension from the sensing template, which in turn produces triggers.

[0263] Polymerase with specific activities, such as poly(A) polymerase (PAP), catalyzing the addition of a polyadenine tail to the 3′ extremity of RNA strands can also be detected using this approach (FIG. 15f). Following polyadenylation of an RNA strand (seq: rna SEQ ID NO: 84), the poly(A) tail binds to a poly(T) input site of the sensing template (seq: polyAtoBo-2+2P SEQ ID NO:85), which in turn outputs the trigger.

[0264] The inventors also adapted this strategy to the detection of DNA ligase (FIG. 15d). The sensing module are composed of three templates: a hairpin-shaped template (seq: lig2P SEQ ID NO: 87) modified with a 5′ phosphate moiety; a linear template whose 5′ side is complementary to the activator sequence (seq: lig1toBo SEQ ID NO:86); a splint strand which partially hybridizes to both other strands (seq: lig3P SEQ ID NO:88). The resulting triplex includes a nick, which can be sealed by the T4 DNA ligase fueled with ATP. As a consequence, the splint strand is strand-displaced by the DNA polymerase, restoring a functional source of activator strands. The detection of polynucleotide kinase (T4 PNK) was made possible using a non-phosphorylated version of hairpin-shaped template (seq: lig2noP SEQ ID NO: 89). Following its phosphorylation, required for ligation, the T4 DNA ligase can seal the nick, rescuing the production of activator strands.

[0265] The inventors performed the detection of each enzyme separately in bulk solution using the cognate design. FIG. 15 shows the amplification time (Cq) extracted from the fluorescence time trace recorded in real-time. For each enzyme the inventors observed an inverted relationship between Cq and the concentrations of the target enzyme, down to the μU to mU/mL concentration range. This demonstrate the specific and sensitive detection of enzyme activities using a versatile DNA amplification mechanism.

[0266] Digital Counting of Single Enzymes

[0267] To further demonstrate the sensitivity of this approach, the inventors performed a digital counting of single enzymes isolated in microfluidic droplets. As for bulk assays, the proof of principle was realized with the Nt.BstNBI detection circuit. Two series of samples spiked with different concentrations of NBI were prepared and individually emulsified in picoliter-size droplets (−0.95 pL) using a flow-focusing microfluidic chip. Droplets were incubated at 48° C. for 3 h and analyzed by fluorescence microscopy (FIG. 16a). FIG. 16b (top, left panel) shows the linear correlation between the spiked NBI concentration and the measured concentration computed from the Poisson law (R.sup.2>0.99). FIG. 16b presents the results of digital droplet assays for other enzymes including RNAseH2, APE-1, UDG, BsmAI, PAP, T4 DNA ligase and T4 PNK. Similarly, the proportionality between the spike-in concentrations and the measured concentrations proves the success of this approach for digital counting of these enzymes.

[0268] The digital detection of Nt.BstNBI was performed using larger droplets (7.2 pL) (FIG. 17). In comparison with the smaller droplets, very similar concentrations were computed. The proportionality between the spiked concentration and the measured concentration of target, together with the consistent results obtained for different droplet sizes unambiguously demonstrate the direct absolute quantification of active enzymes.

Example 5: Multiplex Detection of microRNA

[0269] Material: HPLC-purified oligonucleotides were purchased from Biomers or Eurofins and resuspended at 100 μM in 1× Tris-EDTA pH 7.5 for long-term storage. Templates were designed according to the protocol described in Example 1 above. Template sequences aT, pT, rT and kT were protected against the 5′->3′ exonuclease activity of ttRecJ by the addition of three 5′ phosphorothioate backbone modifications. Templates aT, pT, cT and kT were blocked for unwanted polymerization by the addition of a 3′ phosphate moiety. aT were designed to hybridize only to the last 10 bases of corresponding input (α or β) in order to favorize the deactivation by pT of signal strands produced by leaky reactions. kT present the same shortened input binding site in order to reduce the competitive binding of signal strands. This prevents the nonspecific activation of kT prior to target-triggered amplification. Table 5 recapitulates all sequences used throughout this assay (SEQ ID NO: 104, 106, 108 and 109 are also cited as SEQ ID NO: 54, 55, 56 and 57 respectively).

TABLE-US-00006 TABLE 5 Sequences used in multiplex assay SEQ ID NO Name Sequence Function 101 α CATTCAGGATCG trigger 102 β CATTCTGGACTG trigger 103 aTα C*G*A*TCCTGAATG-CGATCCTGAA p aT 104 aTβ* C*A*G*TCCAGAATG-CAGTCCAGAA p aT 105 pTα T*T*T*TTCGATCCTGAATG p pT 106 pTβ T*T*T*TTCAGTCCAGAATG p pT 107 rTα OregonGreen488 *A*T*TCAGAATGCGATCCTGAAT BMNQ535 rT 108 rTβ Atto633 *A*T*TCTGAATGCAGTCCAGAATBHQ2 rT 109 let7atoβ TGCAGTCCAGAA-GTTTGACTCAAACTATACAACCTACTACCTCA cT 110 let7etoβ TGCAGTCCAGAA-GTTTGACTCAAACTATACAACCTCCTACCTCA cT 111 mir7toβ TGCAGTCCAGAA- cT 112 mir92atoα TGCGATCCTGAA-GTTTGACTCAAGCATTGCAACCGATCCCAACC cT 113 mir39atoα TGCGATCCTGAA-GTTTGACTCACAAGCTGATTTACACCC p cT 91 αkβ C*A*T*TCTGGACTGAAAA-CAATGACTCGATCCTGAA p kT 92 βkα C*A*T*TCAGGATCGAAAA-CAATGACTCAGTCCAGAA p kT 93 αkβA0O C*A*T*TCTGGACTG-CAATGACTCGATCCTGAA p kT 95 αkβA1 C*A*T*TCTGGACTGT-CAATGACTCGATCCTGAA p kT 96 αkβA2 C*A*T*TCTGGACTGTT-CAATGACTCGATCCTGAA p kT 97 αkβA3 C*A*T*TCTGGACTGTTT-CAATGACTCGATCCTGAA p kT 98 αkβA4 C*A*T*TCTGGACTGTTTT-CAATGACTCGATCCTGAA p kT 99 αkβA5 C*A*T*TCTGGACTGTTTTT-CAATGACTCGATCCTGAA p kT 67 Let7a ugagguaguagguuguauaguu microRNA 114 1et7e ugagguaggagguuguauaguu microRNA 70 mir39-ce ucaccggguguaaaucagcuug microRNA 72 mir92a agguugggaucgguugcaaugcu microRNA 115 mir7 uggaagacuagugauuuuguuguu microRNA

[0270] The nicking enzymes Nb.BsmI and Nt.bstNBI, the restriction enzyme BsmI, the DNA polymerase Vent(exo-), BSA and dNTP were obtained from New England Biolabs (NEB). Thermus thermophilus RecJ exonu-clease was produced in-house following a previously published protocol (Yamagata et al. Nucleic Acids Res. 2001, 29 (22), 4617-4624). Sodium chloride, potassium chloride, magnesium sulfate, ammonium sulfate, Trizma hydrochloride, netropsin, synperonic F104 were purchased from Merck (Sigma-Aldrich).

[0271] Reaction mixtures assembly: All reaction mixtures were assembled at 4° C. in 200 μL PCR tubes. Template and enzymes were first mixed with the reaction buffer (20 mM Tris-HCL, pH 8.9, 10 mM (NH4)2SO4, 40 mM KCL, 10 mM MgSO4, 50 μM each dNTP, 0.1% (w/v) synperonic F104, 2 μM netropsin and 200 mg/mL BSA). Optimized template concentrations were as follow: aTα=50 nM, aTβ, 50 nM, pTα=15 nM, pTβ=11 nM, rTα=40 nM, rTβ=40 nM, cT (each)=0.5 nM, αkβ=1 nM and βkα=2.5 nM. Enzyme concentrations were Nb.BsmI=300 u/mL, Nt.BstNBI=10 u/mL, Vent(exo-)=60 u/mL, BsmI=60 u/mL, ttRecJ=23 nM. After homogenization, samples were spiked with microRNA solution, serially diluted in 1× Tris-EDTA buffer using low-binding DNA tips (Eppendorf). Samples (bulk or emulsion) were incubated at 50° C. in a qPCR machine CFX96 touch (Bio-Rad).

[0272] Microfluidic droplet generation: A 2-inlet flow focusing device was prepared using standard soft-lithography techniques. Briefly, the microfluidic mold was obtained by coating a 4-inch silicon wafer with SU-8 photoresist (Micro-Chem Corp.) reticulated upon UV exposure. Following careful cleaning of the mold with isopropanol, a 10:1 mixture of Sylgard 184 PDMS resin (40 g)/curing agent (4 g) (Dow Corning) was poured onto the mold, degassed under vacuum and baked for 2 hours at 70° C. The PDMS slab was piled off the mold and inlets and outlets were punched with a 1.5 mm diameter biopsy puncher (Integra Miltex). The PDMS slab was bound on a 1 mm thick glass slide (Paul Marienfeld GmbH &±Co) immediately following oxygen plasma activation. The chip underwent a baking for 5 hours at 200° C. to make the channel hydrophobic. Monodisperse water-in-oil droplets were generated by mixing the aqueous samples and the continuous phase (fluorinated oil Novec 7500, 3M+1% (w/w) fluosurf, Emulseo) on chip using a pressure pump controller MFCS-EZ (Fluigent) and 200 μm inner diameter PTFE tubing (C.I.L.).

[0273] Droplet imaging and analysis: Following incubation, emulsions were imaged by microscopy. A monolayer of droplets was sandwiched between two glass slides (1 mm thick bottom slide, Paul Marienfeld GmbH &t Co, 0.17 mm thick top slide, VWR) spaced with 10 μm polystyrene particles (Polysciences, Inc.) to avoid droplet compression. The chamber was sealed with epoxy glue (Sader). Images were acquired on an epifluorescence microscope Eclipse Ti equipped with a motorized XY stage (Nikon), a camera Nikon DS-Qi2, an apochromatic 10× objective (N.A. 0.45, Nikon) and a CoolLed pE-400 illumination source. Composite images were generated with the open source software ImageJ. Droplets were analyzed using the Mathematica software (Wolfram), following the reported procedure described in the above examples. The concentration of microRNA is computed with the formula:

[00001]$\begin{array}{cc}\left[\mathrm{mir}1\right]=\frac{-\ln \left(1-F_g\right)}{N_A.Math.V}\mathrm{and}\left[\mathrm{mir}2\right]=\frac{-\ln \left(1-F_r\right)}{N_A.Math.V}& \end{array}$

where F.sub.g and F.sub.r are the fraction of green and red positive droplets respectively, NA is the Avogadro number and V the volume of the droplets.

[0274] Results

[0275] Killer Templates Counter Switch Cross Activation

[0276] The inventors converted the two parallel bistable switches into a tetrastable biochemical circuit. The rationale is that each of the four alternative states can then be attributed to the four possible chemical “states” associated with the presence/absence of each target (0:0, 0:1, 1:0, and 1:1), allowing appropriate classification in each case. To that goal, the inventors designed cross inhibitory templates (killer templates, kT), which connect the two switches bidirectionally (FIG. 18). Upon activation by their cognate input (α or β), the kT produces a pseudotemplate for the opposite switch, thereby acting as a cross inhibitor of amplification. For the system to admit four states, the inhibitors need to be strong enough to stabilize the state 1:0 and 0:1 (where only one of the two switches is ON), but not too strong to allow the existence of the state 1:1 (where both switches are ON). Accordingly, the inventors evaluated the effect of the length of the endogenous pT—determined by the length of the deactivating 5′ tail on the strength of the killer template. FIG. 19 shows the amplification reaction of a simple β switch in presence of the α switch triggered with 5 nM of cel-mir-39 and an increasing concentration of αkβ producing various pTβ. The system is set in such a way that, in absence of αkβ, the β switch turned on spontaneously in about 100 minutes (FIG. 20).

[0277] When increasing the concentration of kT, the inventors observed as expected a growing delay before amplification. Additionally, it is clear that αkβ producing shorter pT, are stronger inhibitors: less than 100 pM of kT αkβA1 (meaning that the resulting pTβ will add only one thymidine nucleo-tide on the 3′ end of the α strand) are required to completely prevent the amplification of the α switch, whereas 100 fold more are needed to observe the same effect with αkβA4 (FIG. 18c). Interestingly, no inhibition was observed in the range of tested concentration for αkβA5. Similarly, the αkβA0 (producing a complementary strand from α with no catalytic extension activity) has no effect on the amplification of the β switch, confirming the catalytic mechanism of the pseudotemplate.

[0278] Following these measurements, the inventors opted for kT producing pT with a 4-nucleotide extension, for which the inhibition strength can be easily adjusted by tuning the concentration.

[0279] Next, the inventors evaluated the potential of the kT to suppress cross-reactivity between a and β switches, while retaining sensitivity for their cognate target. The two microRNA sensing circuits are spiked with 0 or 10 pM of mir92a (α switch) and let7a (β switch) in presence of various concentrations of both αkβ and βkα (FIG. 21). FIGS. 21b and c show the amplification time of both switches. In these experimental conditions, tetrastability is achieved for 2.5-10 nM of βkα and 0.63-1.3 nM of αkβ: in this concentration range of kT, the absence of target results in the absence of amplification (Cq>1000 min, state 0:0); when only one microRNA target is present, only the corresponding switch amplified a fluorescent signal (Cq−200 min, states 1:0 and 0:1); finally, when both microRNAs are injected, the two switches turned on (state 1:1).

[0280] The inventor tested the generalization of this strategy for the detection of other microRNAs. The modular design of this programmable DNA circuit allows in principle the detection of any nucleic acid strand (RNA or DNA) with a known 3′-hydroxyl terminus, by adapting only the converter template's input domain. The rest of the duplex circuit (i.e. both aT, pT, rT and kT) sequences and concentrations remain untouched. For these experiments, the inventors used five microRNAs: has-mir-92a-5p, cel-mir-39, hsa-mir-7-5p, hsa-let-7a-5p and hsa-let-7e-5p (respectively abbreviated mir92a, mir39, mir7, let7a and let7e). FIG. 21e depicts the amplification time (Cq) for seven different duplex experiments in solution for the detection of 0 or 10 pM of microRNA targets. As expected, the system behaves as a tetra-stable biochemical circuit in each case Importantly, the amplification time for each switch is independent of the target sequence (Cqα=178±44 min, Cqβ=149±19 min). Consequently, this confirms that the cross-inhibitory circuit suppresses unwanted cross-reactivity, while enabling programmable target detection.

[0281] Duplex Digital Detection of microRNAs.

[0282] The inventors finally transposed this multiplex assay to a digital readout using droplet microfluidics (FIG. 22. The sample mixture is partitioned into thousands of picolitre-size droplets using a flow-focusing microfluidic device. As a result, target microRNAs are randomly distributed into water-in-oil droplets, with occupancy following a Poissonian distribution. After incubation which allows the droplet fluorescence to turn either green, red or orange depending on their initial content, the droplets are imaged by epifluorescence microscopy. Knowing the droplet size and the fraction of positive droplets in each color, the concentration of the two microRNAs in the original sample was computed. The inventors demonstrated that the tetrastable circuit does not influence the detection (FIG. 23) and the limit of the blank in comparison to singleplex assay (FIG. 24). For better demonstration, the inventors prepared 4 samples spiked with 0 or 3 pM of microRNA mir39 (α switch) and let7a (β switch). Each sample is barcoded with a combination of two fluorescent dextran barcodes and serially emulsified using a homemade sample changer. After incubation, the droplets are imaged by fluorescence microscopy (FIG. 22b-d). While a few false positive events were recorded, an accurate quantification of the two microRNAs within 12%±6% errors (which could be partially due to concentration uncertainties from the serial dilution of the targets) was achieved. To assess the reproducibility of the technique, the inventors repeated this experiment for samples of different compositions (various concentrations of various microRNAs. For the 15 samples, the inventors observed a good correlation between the expected concentration of the spike-in microRNAs and the measured concentration (FIG. 22 d). Finally, the inventors also verified that the fraction of double positive droplets (both green and red droplets) corresponds to the fraction expected from the Poisson distribution of the two targets (F.sub.o=F.sub.g.F.sub.r, where F.sub.o, F.sub.g and F.sub.r are the fractions of orange, green and red droplets).

CONCLUSION

[0283] The inventors previously demonstrated that the MP-based isothermal amplification strategy has the potential to completely abolish background amplification. In the present invention, they leverage this feature to convert the analog readout (real-time fluorescence monitoring) to a digital format (end-point compartments analysis). The method of the present invention thus allows the sensitive, specific and quantitative measurement of target biomolecules, particularly of enzymes and nucleic acids, more particularly of microRNA. Based on a one-step procedure, it reduces the sample manipulation and therefore the risk of carry-over contamination. The contamination issue is even more reduced by the fact that the system relies on a signal amplification mechanism rather than target sequence replication.

[0284] The versatile DNA-based circuit can be repurposed for any biomolecules of interest, by designing the corresponding conversion template. With respect to microRNA, it should be noted that all other circuits parts are common for all microRNA, thus eliminating the need for primers and probe design and reducing the assay cost.

[0285] Moreover, the above results demonstrate that the DNA circuit architecture can be adapted for detecting enzymes, particularly DNA-related enzymes with a wide range of activities (nucleases, DNA N-glycosylases, polymerases, ligases and kinases). The sensitivity of the present method allows for the direct digital counting of individual enzymes isolated in picoliter-size compartment. Said method can also be used for the quantification of active enzymes following the purification process and to determine the effect of physical (temperature) or chemical treatment on the enzymatic activity at the single-enzyme level.

[0286] The above examples also demonstrate that the method of the invention may be adapted for multiplex in a detection at more sensitive manner.

BIBLIOGRAPHICAL REFERENCES

[0287] A. Schamberger and T. I. Orban, “3′ IsomiR Species and DNA Contamination Influence Reliable Quantification of MicroRNAs by Stem-Loop Quantitative PCR,” PLOS ONE, vol. 9, no. 8, p. e106315, August 2014. [0288] Aslanzadeh, “Preventing PCR Amplification Carryover Contamination in a Clinical Laboratory,” Ann. Clin. Lab. Sci., vol. 34, no. 4, pp. 389-396, January 2004. [0289] A. Yamagata, R. Masui, Y. Kakuta, S. Kuramitsu, and K. Fukuyama, “Overexpression, purification and characterization of RecJ protein from Thermus thermophilus HB8 and its core domain,” Nucleic Acids Res., vol. 29, no. 22, pp. 4617-4624, November 2001. [0290] Brouzes et al. “Droplet microfluidic technology for single-cell high-throughput screening”, PNAS 2009 [0291] Campomenosi, P. et al. A comparison between quantitative PCR and droplet digital PCR technologies for circulating microRNA quantification in human lung cancer. BMC Biotechnol. 16, 60 (2016). [0292] C. A. Raabe, T.-H. Tang, J. Brosius, and T. S. Rozhdestvensky, “Biases in small RNA deep sequencing data,” Nucleic Acids Res., vol. 42, no. 3, pp. 1414-1426, February 2014. [0293] Genot et al, “High-resolution mapping of bifurcations in nonlinear biochemical circuits”, Nat. Chem. 2016. [0294] Huggett et al. BMC Res Notes 2008 [0295] H. Jia, Z. Li, C. Liu, and Y. Cheng, “Ultrasensitive Detection of microRNAs by Exponential Isothermal Amplification,” Angew. Chem. Int. Ed., vol. 49, no. 32, pp. 5498-5501, July 2010. [0296] K. L. Opel, D. Chung, and B. R. McCord, “A Study of PCR Inhibition Mechanisms Using Real Time PCR” J. Forensic Sci., vol. 55, no. 1, pp. 25-33, 2010. [0297] K. Montagne, R. Plasson, Y. Sakai, T. Fujii, and Y. Rondelez, “Programming an in vitro DNA oscillator using a molecular networking strategy,” Mol. Syst. Biol., vol. 7, p. 466, February 2011. [0298] K. Montagne, G. Gines, T. Fujii, and Y. Rondelez, “Boosting functionality of synthetic DNA circuits with tailored deactivation,” Nat. Commun., vol. 7, p. 13474, November 2016. [0299] K. Zhang et al., “Digital quantification of miRNA directly in plasma using integrated comprehensive droplet digital detection,” Lab. Chip, September 2015. [0300] Menezes R, Dramé-Maigné A, Taly V, Rondelez Y, Gines G. Streamlined digital bioassays with a 3D printed sample changer. Analyst. 2019 Nov. 21 [cited 2019 Dec. 12]; Available from: https://pubs.rsc.org/en/content/articelanding/2020/an/c9an01744e [0301] L. Cohen, M. R. Hartman, A. Amardey-Wellington, and D. R. Walt, “Digital direct detection of microRNAs using single molecule arrays,” Nucleic Acids Res., vol. 45, no. 14, pp. e137-e137, August 2017. [0302] S. Kaneda, K. Ono, T. Fukuba, T. Nojima, T. Yamamoto, and T. Fujii, “Modification of the glass surface property in PDMS-glass hybrid microfluidic devices,” Anal. Sci. Int. J. Jpn. Soc. Anal. Chem., vol. 28, no. 1, pp. 39-44, 2012. [0303] Y. Zhao, F. Chen, Q. Li, L. Wang, and C. Fan, “Isothermal Amplification of Nucleic Acids,” Chem. Rev., vol. 115, no. 22, pp. 12491-12545, November 2015.