AUTOMATED METHOD FOR PREPARING RETINAL PIGMENT EPITHELIUM CELLS
20220333065 · 2022-10-20
Inventors
- Christelle MONVILLE (CHAMPIGNY SUR MARNE, FR)
- Florian REGENT (LE HEZO, FR)
- Lise MORIZUR (PONTAULT-COMBAULT, FR)
- Karim BEN M'BAREK (CRETEIL, FR)
Cpc classification
C12N2501/16
CHEMISTRY; METALLURGY
C12N2506/45
CHEMISTRY; METALLURGY
C12N5/062
CHEMISTRY; METALLURGY
A61K35/545
HUMAN NECESSITIES
C12N2501/155
CHEMISTRY; METALLURGY
International classification
Abstract
Disclosed are methods for preparing retinal pigment epithelium (RPE) cells from pluripotent stem cells (PSCs). More particularly, it represents an automated method that combines in a sequential manner three differentiating agents to direct the differentiation of human PSCs into RPE cells.
Claims
1. An automated method for promoting directed differentiation of human pluripotent stem cells into retinal pigment epithelium (RPE) cells, wherein the method comprises the sequential steps of: (a) culturing human pluripotent stem cells in a medium supplemented with at least one Nicotinamide (NA) mimetic compound to generate differentiating cells; (b) culturing said differentiating cells obtained in step a) in a medium supplemented with at least one member of transforming growth factor β (TGF β) superfamily to further differentiating said differentiating cells (c) culturing said further differentiating cells obtained in step b) in a medium supplemented with at least one activator of the Wnt canonical pathway to induce said further differentiating cells to differentiate into RPE cells.
2. The automated method of claim 1, wherein culturing said human pluripotent stem cells in a medium supplemented with at least one Nicotinamide (NA) mimetic compound is effected for at least 3 days.
3. The automated method of claim 1, wherein the Nicotinamide (NA) mimetic compound is Nicotimamide.
4. The automated method of claim 1, wherein culturing said differentiating cells obtained in step a) in a medium supplemented with at least one member of transforming growth factor β (TGF β) superfamily is effected for at least 3 days.
5. The automated method of claim 1, wherein the at least one member of transforming growth factor β (TGF β) superfamily is selected from the group consisting of the transforming growth factor-like (TGF-like) group with the TGFβ subfamily, Activin, Nodal and some growth and differentiation factors (GDF), the bone morphogenetic protein like (BMP-like) group with the BMP, GDF and antiMullerian hormone (AMH).
6. The automated method of claim 1, wherein the medium in step (b) is substantially or completely free of the at least one Nicotinamide (NA) mimetic compound used in step a).
7. The automated method of claim 1, wherein culturing said further differentiating cells obtained in step b) in a medium supplemented with at least one activator of the Wnt canonical pathway is effected for at least 20 to 50 days.
8. The automated method of claim 1, wherein the at least one activator of the Wnt canonical pathway is a GSK-3 inhibitor selected from the group consisting of 3F8, 1-Azakenpaullone, 10Z-Humenialdisine, Alsterpaullone, Al 070722, AR-A014418, AZD1080, AZD2858, Bikinin, BIO, Cazpaullone, CT98014, CT98023, CT99021 (Chir99021), Chir98014, Dibromocantharelline, GSKJ2, HMK-32, Hymenialdesine, Indirubin, Indirubin-3′-omime, IM-12, KenpauUone, L803, L803-mts, Lithium carbonate, LY2090314, Manzamine A, Meridianin, NCS693868, NP031115, Palinurine, SB216763, SB415286, TCS21311, TC-G-24, TCS2002, TDZD-8, Tideglusib, Tricantine and TWS119.
9. The automated method of claim 1, wherein the medium in step (c) is substantially or completely free of the at least one Nicotinamide (NA) mimetic compound and the at least one member of transforming growth factor β (TGF β) superfamily respectively used in steps a) and b).
10. The automated method of claim 1, wherein the method comprises or consists in the sequential steps of: (a) culturing human pluripotent stem cells in a medium supplemented with Nicotinamide to generate differentiating cells; (b) culturing said differentiating cells obtained in step a) in a medium supplemented with Activin A to further differentiating said differentiating cells; (c) culturing said further differentiating cells obtained in step b) in a medium supplemented with CHIR99021 to induce said further differentiating cells to differentiate into RPE cells.
11. The automated method of claim 1, wherein the method further comprises the step of: (d) treating the population of cells obtained in step c) to remove the non-adherent cells.
12. The automated method of claim 11, wherein the step d) is a two-step dissociation procedure comprising or consisting in washing and treating the cells enzymatically.
13. The automated method of claim 1, wherein the method further comprises the step of (e) expanding the cells obtained in step d) over at least two passages.
14. The automated method of claim 13, wherein the passages comprises (i) dissociating the RPE cells and/or the differentiating cells in a first vessel to form a suspension; (ii) transferring the RPE cells and/or the differentiating cells to at least two further culture vessels; and (iii) culturing the RPE cells and/or the differentiating cells until the RPE cells and/or the differentiating cells are 50 to 100% confluent, wherein the passages does not comprise a centrifugation step.
15. The automated method of claim 1, wherein the method is carried out with an apparatus for large-scale automated production of cells comprising: a) robotic means for handling culture vessels; b) means for inoculating cells into a culture; c) means for changing or adding medium to a culture; and d) programmable control means; wherein the apparatus is adapted to the phase of directed differentiation of hPSCs toward RPE cells and the phase of passage the cells when they reach a predetermined percentage confluence.
16. The automated method of claim 1, wherein culturing said human pluripotent stem cells in a medium supplemented with at least one Nicotinamide (NA) mimetic compound is effected for 3 to 10 days.
17. The automated method of claim 1, wherein culturing said human pluripotent stem cells in a medium supplemented with at least one Nicotinamide (NA) mimetic compound is effected for 7 days.
18. The automated method of claim 1, wherein culturing said differentiating cells obtained in step a) in a medium supplemented with at least one member of transforming growth factor β (TGF β) superfamily is effected for 3 to 10 days.
19. The automated method of claim 1, wherein culturing said differentiating cells obtained in step a) in a medium supplemented with at least one member of transforming growth factor β (TGF β) superfamily is effected for 7 days.
20. The automated method of claim 2, wherein the Nicotinamide (NA) mimetic compound is Nicotimamide.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0176]
[0177] Relative gene expressions were quantified by RT-qPCR and normalized to mRNA expression at day 0 (n=3, mean±SD). Control condition corresponds to RPE 20% KSR medium.
[0178]
[0179]
[0180]
[0181]
[0182]
[0183]
EXAMPLES
[0184] Methods
[0185] Manual hESCs Culture and RPE Cell Differentiation
[0186] Clinical-grade hESC line RC-0913, was used and cultured in feeder free conditions using mTeSR™ Medium (StemCell technologies) and hESC qualified Matrigel (Corning). Cells were banked at passage 36 and used for RPE differentiation between passage 38 and 45. Cells were plated at 5×10.sup.4 cells per cm.sup.2 and grown until they reached 80 percent of confluence before switching to a differentiation medium composed of Dulbecco's modified Eagle's medium (high glucose, Thermo Fisher Scientific) supplemented with 50 μM β-mercaptoethanol, 1× minimum essential medium-nonessential amino acids (Thermo Fisher Scientific) and 20% (D0-D42) or 4% (after passage 1) of knockout serum replacement (KSR, Thermo Fisher Scientific). During all the differentiation process the medium was changed every 2/3 days.
[0187] hESC-RPE cells were obtained by spontaneous differentiation of hESCs. Briefly, hESCs were grown to confluence and switched to a bFGF deprived culture medium. Pigmented patches were then dissected under a stereomicroscope with a fine 15 ophthalmic knife and plated onto culture dishes coated with hESC qualified Matrigel (corning).
[0188] For the referred “directed differentiation” protocol, 10 mM Nicotinamide (Sigma), 100 ng/ml Activin A
[0189] (Peprotech) and 3 μM CHIR99021 (Tocris) were added sequentially to the basal differentiation medium at specific time points (
[0190] Characterization of Differentiated RPEs
[0191] Quantitative Real-Time Polymerase Chain Reaction
[0192] Total RNAs were extracted using RNAeasy Plus Mini kit (Qiagen) and cDNA synthesized using SuperScript III (Invitrogen). Quantitative real-time RT-PCR was performed using a Quant Studio 12K flex (Applied Biosystems) with HiGreen qPCR Master Mix (Thermo Fisher Scientific). Primer sequences are listed in Table 1. Experiments were performed with at least three technical replicates per plate and expression levels were normalized to 18S. Relative expression compared to hESCs gene expression levels were determined by calculating the 2-ΔΔCt.
TABLE-US-00001 TABLE 1 List of quantitative reverse transcriptase poly- merase chain reaction (qRT PCR) primers. Gene SEQUENCE 18S FRW GAGGATGAGGTGGAACGTGT REV TCTTCAGTCGCTCCAGGTCT NANOG FRW CAAAGGCAAACAACCCACTT REV TCTGCTGGAGGCTGAGGTAT RAX FRW GGCAAGGTCAACCTACCAGAG REV CATGGAGGACACTTCCAGCTT SIX3 FRW CCTCCCACTTCTTGTTGCCA REV CGCTACTCGCCAGAAGTATGG PAX6 FRW GCCAGCAACACACCTAGTCA REV TGTGAGGGCTGTGTCTGTTC VSX2 FRW CTGCCGGAAGACAGGATACA REV TAGAGCCCATACTCCGCCA MITF FRW CCGGGTGCAGAATTGTAACT REV GGACAATTTTGGCATTTTGG RPE65 FRW AGCACTGAGTTGAGCAAGCA REV GGCCTGTCTCACAGAGGAAG CRALBP FRW CACGCTGCCCAAGTATGATG REV CCAGGACAGTTGAGGAGAGG TYROSYNASE FRW GTGTAGCCTTCTTCCAACTCAG REV GTTCCTCATTACCAAATAGCATCC BEST1 FRW GTCAGAGGCTCCTCCTTCCT REV TCTGCTCCACCAGTGTTCTG LUM FRW CTTCAATCAGATAGCCAGACTGC REV AGCCAGTTCGTTGTGAGATAAAC FN1 FRW GGAAAGTGTCCCTATCTCTGATACC REV AATGTTGGTGAATCGCAGGT
[0193] Immunostaining
[0194] hESC-RPE cells were grown on Matrigel-coated 96 or 24-well plates. Adherent cells were fixed in 4% PFA for 10 min at room temperature (RT) and rinsed 3 times with PBS. After 30 min in blocking solution (10% FBS in 0.1% Triton PBS) at RT, cells were incubated with primary antibodies overnight at 4° C. (Antibodies are listed in Table 2). After 3 washes in PBS, appropriate Alexa Fluor-conjugated secondary antibodies (Invitrogen) were added at 1:500 for 1 h at RT in presence of DAPI (Invitrogen).
TABLE-US-00002 TABLE 2 List of primary antibodies. Antibody Host Company Reference Dilution Application PAX6 Rabbit Biolegend PRB-278P 1/500 Immunofluorescence MITF Mouse Dako M3621 1/250 Immunofluorescence VSX2 Goat Santa Cruz sc-21690 1/250 Immunofluorescence Biotechnology TYRP1 Mouse LifeSpan MS-771-P1 1/500-1/100 Flow cytometry BioSciences EZRIN Mouse Sigma E8897 1/250 Immunofluorescence ZO-1 Rabbit Invitrogen 402300 1/500 Immunofluorescence BEST Mouse Abcam ab2182 1/250 Immunofluorescence MERTK Rabbit Abcam Y323 1/500 Immunofluorescence NANOG Rabbit Abcam ab80892 1/500 Immunofluorescence OCT 3/4 Goat Santa Cruz sc-5279 1/500 Immunofluorescence Biotechnology SSEA4 Mouse R&D systems FAB1435A 1/100 Flow cytometry TRA1-60 Mouse Santa Cruz sc-21705 1/500 Immunofluorescence Biotechnology TRA1-81 Mouse Santa Cruz sc-21706 1/500 Immunofluorescence Biotechnology TRA1-81 Mouse eBioscience 12-8883-82 1/100 Flow cytometry
[0195] Image Acquisition and Analysis
[0196] Images were acquired with an Axio observer Z1 microscope (Zeiss) with a Hamamatsu ORCA-flash 4.0 camera and a spinning disk unit (Yokogawa CSU-X1-A1N-E; Camera evolve, EMCCD 512) with Metamorph software or with a LSM-800 confocal microscope (Zeiss) with Zen software. Images were exported, analyzed and processed with Fiji software. For zx images, xy stacks (0.33 μm z step size) covering cell width were resliced in zx. The quantification of pigmented areas was performed after manual delimitation of culture dish areas using Fiji software. Pictures were then binarized to 8-bit images using a fixed intensity threshold and the black area fraction was measured (not herein shown).
[0197] Flow Cytometry
[0198] Cells were detached from culture plates, fixed in 4% PFA for 10 min at RT and permeabilized with PBS containing 0.1% Triton for 30 min before labeling with TYRP1 antibody for 1 hr at RT. Labeling of the cell surface markers TRA-1-81 and SSEA4 was performed on freshly dissociated cells for 15 min at 4° C. Cells were then incubated with fluorochrome-conjugated primary antibody for 30 min at RT and rinsed twice with PBS. The antibodies used and their working dilutions are listed in Supplementary Table 2. Cells were analyzed using a cell MACSquant analyzer (MiltenyiBiotec). Gates were drawn according to fluorescence minus one (FMO) controls or on samples labeled with isotype control antibodies. Data were analyzed using Flowio software (Tree Star, Ashland, OR).
[0199] Phagocytosis Assay
[0200] hESC-RPE cells were exposed for 24 hours to purified FITC-labeled photoreceptor outer segments of pig (gift from Dr. E. Nandrot). After washing with PBS, cells were fixed in cold methanol and labelled with DAPI. Images were taken with LSM-800 confocal microscope (Zeiss). hESCs derived RPE cells were also exposed to pHrodo Green Zymosan Bioparticles (Thermo Fisher Scientific) overnight at 37° C. These particles are pH-sensitive and become fluorescent after cell entry and phagosome formation. As a negative control, phagocytosis assays were performed at 4° C. to block the phagocytic process. Plates were then read using a microplate reader (Clariostar-BMG LABTECH) and values were normalized to DAPI intensities.
[0201] VEGF Quantification by ELISA Assay
[0202] VEGF measurements were done in triplicate using the human VEGF Quantikine ELISA kit (R&D System) according to manufacturer instruction.
[0203] Statistical Analysis
[0204] All experiments were performed in triplicate. Summary statistical analyses were performed in XLSTAT software. Comparisons between experiments were performed using the unpaired t-test and statistical significance was established as *p<0.05, **p<0.01.
[0205] Results
[0206] Sequential Use of Nicotinamide, Activin a and Chir99021 Improves RPE Differentiation by Recapitulating the Main Steps of Retinal Development
[0207] In an effort to simplify previous directed differentiation protocols for automation, it was evaluated whether the simple use of Nicotinamide, Activin A and Chir99021 in a sequential manner (referred as “directed protocol”) improves RPE cell differentiation of adherent hESCs enough to bypass manual enrichment. The efficiency of the “directed protocol” was compared with the one of the classical spontaneous differentiation.
[0208] It was checked whether the sequential use of NIC, Activin A and Chir99021 could recapitulate the main steps of retinal development by evaluating the expression of markers of the early eye field stage, optic vesicle stage and immature RPE cells at different time points during the differentiation (
[0209] Consecutive treatment with Activin A from day 7 to day 14 significantly increased the expression at mRNA levels of two transcription factors involved in optic vesicle patterning, the visual system homeobox 2 gene (VSX2, also named CHX10) and the melanocyte inducing transcription factor (MITF), when compared to the spontaneous differentiation (
[0210] Finally, activation of the canonical WNT signaling pathway by CHIR99021 treatment from day 14 to day 35-42 induced RPE commitment as seen by the acute decreased expression of VSX2 mRNA levels (
[0211] The efficiency of RPE cell induction after 6 weeks of differentiation was determined. A large majority of the culture dish with cells exposed to the directed protocol (72.96%±1.94% of the culture area, n=3) was covered by pigmented cells on day 42. By contrast, only isolated patches of pigmentation were visible with the spontaneous protocol (3.481%±1.12% of the growth area, p<0.01). Importantly, the vast majority of cells obtained after 42 days of differentiation with the directed protocol co-expressed PAX6 and MITF (82.2%%±3.2%, n=3), two markers of RPE cells.
[0212] Taken together these results indicate that the sequential use of Nicotinamide, Activin A and Chir99021 recapitulates the main steps of retinal development and efficiently directs the differentiation of hPSCs into a highly-enriched RPE population within 42 days compared to the spontaneous differentiation. Thus, cell differentiated through the directed protocol could be amplified directly while a prior manual selection of RPE clusters is required for the spontaneous protocol.
[0213] On day 42, cells were incubated with TrypLE Reagent (Thermo Fisher Scientific) for 10 minutes to remove cell contaminants, then washed with PBS and re-incubated with TrypLE Reagent for 35 minutes to allow RPE dissociation. Cells were then seeded at a final dilution of 1/5 in dishes coated with hESC qualified Matrigel (Corning).
[0214] Mature hESC-RPE cells were dissociated and cryopreserved in liquid nitrogen vapors with CryoStor CS10 medium (StemCell technologies) at passage 1 or 2.
[0215] Automated RPE Differentiation Process
[0216] The CompacT SelecT® (Sartorius) is a fully automated cell culture platform which allows the expansion and differentiation of large batches of adherent cells in a controlled environment (
[0217] The directed protocol allows obtaining a pure population of hESC-RPE cells without manual enrichment and is amenable to automation of the differentiation.
[0218] Using the “directed differentiation” protocol, a fully automated process was setted up by performing media changes and enzymatic passaging using the CompacT SelecT® automation platform. This automated cell culture platform is composed of an incubator, bar-coded flasks for cell process tracking, multiple connected pumps to dispense culture media, a six-axis anthropomorphic robotic arm and a live-cell imaging system (Incucyte) (
[0219] Automation starts from the seeding of hPSCs onto 75 cm2 flasks. Then, cell proliferation and differentiation initiation by medium switching were performed in the robot until day 42. At this stage, hESC-RPE cells form a cohesive epithelium in culture that requires long incubation times with dissociation reagents to trigger cell detachment for further replating and amplification. In order to eliminate a maximum of cell contaminants it was taken advantage of this characteristic by performing a differential dissociation treatment with TrypLE® (
[0220] One was able to remove the vast majority of unpigmented cells that have lower adherence to the flask than RPE cells on day 42 by applying a first short incubation of 10 minutes with TrypLE® Express followed by a rinse.
[0221] A second enzyme incubation of 35 minutes then enabled the detachment and dissociation of RPE cells.
[0222] As the automated system does not include any centrifuge, it was not possible to eliminate the TrypLE used to dissociate RPE cells. Thus, it was assessed if the final 5% of TrypLE® remaining in the medium after passaging did not affect the re-adherence and the growth of the cells. No difference between cells replated in presence of 5% of TrypLE® or after a centrifugation step was observed (data not shown). It was also checked that the presence of diluted TrypLE® did not affect RPE identity and once again no difference was detected in RPE gene expression between enzymatic passaging with or without centrifugation (data not shown).
[0223] After 2 automatized passages, 94.7%±0.2% (n=3) of cells co-expressed the two transcription factors PAX6 and MITF indicating a homogenous population of hESC-RPE cells comparable with the one obtained after manual enrichment13. The gene expression of late RPE markers such as RPE65 and CRALBP was also detected by RTqPCR at a level similar to the cells obtained with the manual spontaneous differentiation protocol (
[0224] All together these data demonstrate that we were able to obtain pure bona fide hESC-RPE cells in an automated system with a quality similar to the cells obtained through the widely used spontaneous differentiation method.
[0225] hESC-RPE cells obtained by an automated differentiation are mature and functional.
[0226] Important issues concerning cells differentiated from hPSCs are their maturity and functionality. As an indicator of epithelial maturity, the apico-basal polarization of specific RPE markers was evaluated. As expected, hESC-RPE cells homogeneously expressed the microvilli protein EZRIN (95.0%±2.8%, n=3), the tight junction marker Zonula Occludens-1 (Z0-1, 99.3%±0.4%, n=3) and the MER proto-oncogene tyrosine kinase receptor (MERTK, 97.1%±1.1%, n=3) at their apical membrane while the calcium activated chloride channel, BESTROPHIN (BEST, 89.4%±3.9%, n=3) was localized at the baso-lateral compartment.
[0227] One of the most important functions of RPE cells is the phagocytosis of the outer segments shed by the photoreceptors. To determine whether the cells differentiated according to this directed protocol on the automated cell culture platform were functional, we assessed their ability to phagocyte pig fluorescein isothiocyanate (FITC)—labeled photoreceptor outer segments and quantified the fluorescence signal of pH sensitive particles that become fluorescent after cell entry and phagosome formation. hESC-RPE cells were able to phagocyte FITC-labeled photoreceptor outer segments as shown by the cytoplasmic localization of the FITC signal under the apical limit Ezrin positive. hESC-RPE cells incubated with pH-sensitive particles at 37° C. had a fluorescence intensity 22.2 fold higher compared to cells incubated at 4° C., a temperature that inhibits the phagocytic process. Another indicator of RPE functionality is the ability to secrete a wide range of growth factors including the vascular endothelial growth factor (VEGF). The secretion of VEGF was quantified after several culture weeks and a progressive increased of VEGF secretion starting from 2 weeks of culture was observed.
[0228] All these results indicate that RPE cells differentiated from hPSCs using a fully automated protocol are functional in vitro. hESC-RPE cells differentiated through automation can be amplified until passage 3 to produce large cell banks.
[0229] Previous studies showed that hESC-RPE cells had a limited amplification potential before they undergo an epithelial-mesenchymal transition (EMT). In line with these studies, hESC-RPE cells obtained with an automated process adopted a mesenchymal phenotype starting from passage 4 despite the maintenance of the gene expression of the RPE markers MITF and BEST (
[0230] This suggests an EMT transition of hESC-RPE cells, which however maintain an RPE identity. Consequently, it was decided to bank these cells at passage 2 using an automated cell banking system (Fill-it, Sartorius) to obtain bona fide hESC-RPE cells at passage 3 after thawing.
CONCLUSION
[0231] It was demonstrated in this application that most of these cytokines and supplements were not essential to trigger an efficient and pure RPE cell differentiation. Indeed, the use of only 3 compounds (Nicotinamide, Activin A and CHIR99021) in a sequential manner allowed obtaining a pure population of RPE cells without 3-dimensional culture and manual dissection of pigmented foci during the differentiation process. This optimized differentiation is thus amenable to automation.
[0232] Using the automated differentiation process described in this application, it is possible to produce about 16 billion of hESC-RPE cells at passage 2 per batch. A bank of this size is much larger than those previously described that range from 0.05 to 0.8×10.sup.9 cells, and could be produced by a single operator supervising the robot. Moreover, the use of HYPERflask® (Corning) with a growth area of 1720 cm.sup.2 (compared to 75 cm2 flask used in this study) could even dramatically increase the number of cells produced per batch. Another way to increase the size of the bank would be to delay the EMT. Indeed, the number of passages without EMT might be extended as previously described by the addition of a ROCK inhibitor in the culture medium.
[0233] hPSC-RPE cells have been already grafted in AMD patients either as a cell suspension or a polarized epithelium resting on a synthetic basement membrane. The use of cell suspension formulation considerably simplifies the logistical and surgical procedures but several studies made in animal models, suggest that the survival of the RPE cells and the visual benefits for the animal are improved when the cells are grafted as an epithelial tissue rather than a cell suspension. In human, these two approaches have shown both satisfactory safety results and promising efficacy results, even if the extent and the causes of visual improvement in transplant recipients remain ambiguous. Nevertheless, considering that 1×10.sup.5 hESC-RPE cells are currently used to graft a human eye with the both methods, the automated process presented here should allow to produce enough cells to treat several thousands of patients with retinal degeneration even if some steps of the production, such as the simultaneous banking of a huge numbers of cryovials, remains challenging.
[0234] In conclusion, following the previously published amplification of hPSCs using CompacT SelecT® automate, a fully automated RPE cell differentiation process from the hPSCs thawing to the banking of differentiated cells was described. Such automated process is a step towards the scale up and the industrialization of RPE differentiation that will be necessary to treat large numbers of patients. Finally, any differentiation protocol that doesn't require 3D culture or manual selection could theoretically be adapted to this automated culture system opening new perspectives concerning the scale up and the industrialization of the production of many cell types differentiated from hPSCs
[0235] This protocol recapitulates the main steps of retinal development and is sufficient to obtain a pure population of RPE cells without manual enrichment. A culture robot was programmed to automate this protocol in order to upscale the production process. 16 billion of mature and functional RPE cells could now be produced within 12 weeks with only one round of production. Such efficient and reproducible automated protocol should be useful for the treatment of the millions of patients affected by RPE associated retinal degeneration. The automated culture system for preparing RPE cells is expected to be qualified for clinical cell productions in accordance with Good Manufacturing Practices (GMP) (e.g., the preparations are GMP-compliant) and/or current Good Tissue Practices (GTP) (e.g., the preparations may be GTP-compliant).