NAT10 MODULATORS FOR TREATING OR PREVENTING LAMINOPATHIES, AGING AND CANCER
20170174644 · 2017-06-22
Assignee
- Cambridge Enterprise Limited (Cambridge, GB)
- The Centre National De La Recherche Scientifique (Paris, FR)
Inventors
- Delphine Laurence Daniele Larrieu (Cambridge, GB)
- Raphaël Joël Rodriguez (Vers-Pont-du-Gard, FR)
- Sébastien Frédéric Stéphane Britton (Ramonville-Saint-Agne, FR)
- Stephen Philip Jackson (Cambridge, GB)
Cpc classification
A61K45/06
HUMAN NECESSITIES
A61P43/00
HUMAN NECESSITIES
C07D277/60
CHEMISTRY; METALLURGY
A61P1/16
HUMAN NECESSITIES
A61K31/549
HUMAN NECESSITIES
International classification
A61K31/549
HUMAN NECESSITIES
Abstract
The invention relates to compounds in the treatment or prevention of disorders associated with Lamin A and/or Lamin C depletion or LMNA mutations, such as laminopathy, premature ageing disorders, normal ageing and cancer (such as a cancer characterised by low levels of LMNA expression).
Claims
1. A method of treating or preventing laminopathy, premature ageing disorders, normal ageing or cancer (such as a cancer characterised by low levels of LMNA expression) in a human in need thereof comprising administering to said human a therapeutically effective amount of a compound of formula (I): ##STR00035## wherein: each of W, Y and Z represent CH or one of W, Y and Z represents nitrogen and the other two groups represent CH; Ring A represents: ##STR00036## X represents S, O or NR.sup.a; R.sup.a represents hydrogen, hydroxyl, O, C.sub.1-6 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, halogen, haloC.sub.1-6alkyl, C.sub.1-6 alkoxy or haloC.sub.1-6 alkoxy; R.sup.5 represents hydrogen, hydroxyl, C.sub.1-6 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, halogen, haloC.sub.1-6alkyl, C.sub.1-6 alkoxy, haloC.sub.1-6 alkoxy, COH, COOH, COOC.sub.1-6alkyl, cyano, NH.sub.2 or NO.sub.2; n represents an integer selected from 0 to 5; each R.sup.1 independently represents C.sub.1-6 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, halogen, haloC.sub.1-6alkyl, C.sub.1-6 alkoxy, haloC.sub.1-6 alkoxy, cyano, hydroxyl, COH, COOH, COOC.sub.1-6alkyl, NH.sub.2 or NO.sub.2; R.sup.2 represents hydrogen, C.sub.1-6 alkyl, C.sub.2-6 alkenyl or C.sub.2-6 alkynyl; R.sup.3 is an NR.sup.4 group; R.sup.4 represents C(R.sup.4a)(R.sup.4b), C.sub.3-8 cycloalkyl or C.sub.3-8 cycloalkenyl wherein said cycloalkyl is optionally substituted by C.sub.1-6 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, halogen, haloC.sub.1-6alkyl, C.sub.1-6 alkoxy, haloC.sub.1-6 alkoxy, cyano, hydroxyl, COH, COOH, COOC.sub.1-6alkyl, NH.sub.2 or NO.sub.2; R.sup.4a and R.sup.4b are independently selected from hydrogen and C.sub.1-6 alkyl; or a pharmaceutically acceptable salt or solvate thereof.
2. The method of claim 1, wherein Ring A represents formula (i).
3. The method of claim 1, wherein X represents S or O.
4. The method of claim 1, wherein R.sup.5 represents hydrogen or halogen (i.e. bromo).
5. The method of claim 1, wherein n represents an integer from 1 to 2.
6. The method of claim 1, wherein R.sup.1 represents halogen (such as chloro or bromo), C.sub.1-6alkoxy (such as methoxy), cyano, hydroxyl, COOH, NO.sub.2, haloC.sub.1-6alkyl (such as trifluoromethyl) or haloC.sub.1-6alkoxy (such as trifluoromethoxy).
7. The method of claim 6, wherein R.sup.1 represents halogen (such as chloro or bromo), cyano, NO.sub.2 or haloC.sub.1-6alkyl (such as trifluoromethyl), such as cyano or trifluoromethyl.
8. The method of claim 1, wherein R.sup.1 is in the meta (3) and/or para (4) position or the para (4) position.
9. The method of claim 1, wherein R.sup.2 represents hydrogen or C.sub.2-6alkynyl or hydrogen.
10. (canceled)
11. The method of claim 1, wherein R.sup.4 represents C.sub.3-8 cycloalkyl; or cyclopentyl; or unsubstituted cyclopentyl.
12. The method of claim 1, wherein each of W, Y and Z represent CH.
13. The method of claim 1, wherein the compound is selected from Compounds 1 to 8, 10, 11 and 13 to 21 or an alternative pharmaceutically acceptable salt, solvate, free acid preparation or free base preparation thereof.
14. (canceled)
15. The method of claim 1, wherein the laminopathy is selected from: Hutchinson-Gilford progeria syndrome (HGPS); Atypical Werner syndrome; Barraquer-Simons syndrome; Buschke-Ollendorff syndrome; Cardiomyopathy; Charcot-Marie-Tooth disease; Emery-Dreifuss muscular dystrophy (X-linked, autosomal dominant or autosomal recessive); Familial partial lipodystrophy of the Dunnigan type (FPLD); Greenberg dysplasia; Leukodystrophy, demyelinating, adult-onset, autosomal dominant (ADLD); Limb-girdle muscular dystrophy type 1B (LGMD1B); Lipoatrophy with diabetes, hepatic steatosis, hypertrophic cardiomyopathy, and leukomelanodermic papules (LDHCP); Mandibuloacral dysplasia with type A lipodystrophy (MADA); Mandibuloacral dysplasia with type B lipodystrophy (MADB); Pelger-Huet anomaly (PHA); Pelizaeus-Merzbacher disease and Restrictive Dermopathy (RD).
16. The method of claim 15, wherein the laminopathy is selected from: Hutchinson-Gilford progeria syndrome (HGPS), Emery-Dreifuss muscular dystrophy and Atypical Werner syndrome.
17. The method of claim 1, wherein the compound of formula (I) is administered in combination with one or more further active ingredients.
18. A method of treating or preventing laminopathy, premature ageing disorders, normal ageing or cancer (such as a cancer characterised by low levels of LMNA expression) in a human in need thereof comprising administering to said human a therapeutically effective amount of azo pharmaceutical composition comprising: (a) a compound, or a pharmaceutically acceptable salt thereof, according to claim 1; and (b) a pharmaceutically acceptable excipient.
19. A compound of formula (I) selected from: Compound 3, Compound 8, Compound 11, Compounds 13-17 and Compounds 19-21; and salts or solvates of any one thereof.
20. A process for preparing a compound of formula (I) of claim 1 which comprises: (a) when A represents (i), reacting a compound of formula (II) ##STR00037## wherein R.sup.1 and n are as defined in claim 1 and L.sup.1 represents a suitable leaving group, such as chlorine or bromine; with a compound of formula (III): ##STR00038## wherein R.sup.2 and R.sup.3 are as defined in claim 1; (b) deprotection of a protected derivative of a compound of formula (I); and/or (c) interconversion of a compound of formula (I) or protected derivative thereof to a further compound of formula (I) or protected derivative thereof; and (d) optional formation of a pharmaceutically acceptable salt of a compound of formula (I).
21. (canceled)
22. (canceled)
23. A method according to claim 1 for treating cancer (such as a cancer characterised by low levels of LMNA expression) in a human in need thereof.
24. (canceled)
25. (canceled)
Description
BRIEF DESCRIPTION OF THE FIGURES
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
DETAILED DESCRIPTION OF THE INVENTION
[0047] According to one particular aspect of the invention which may be mentioned, there is provided a compound of formula (I):
##STR00003##
[0048] wherein:
[0049] each of W, Y and Z represent CH or one of W, Y and Z represents nitrogen and the other two groups represent CH;
[0050] Ring A represents:
##STR00004##
[0051] X represents S, O or NR.sup.a;
[0052] R.sup.a represents hydrogen, hydroxyl, O, C.sub.1-6 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, halogen, haloC.sub.1-6alkyl, C.sub.1-6 alkoxy or haloC.sub.1-6 alkoxy;
[0053] R.sup.5 represents hydrogen, hydroxyl, C.sub.1-6 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, halogen, haloC.sub.1-6alkyl, C.sub.1-6 alkoxy, haloC.sub.1-6 alkoxy, COH, COOH, COOC.sub.1-6alkyl, cyano, NH.sub.2 or NO.sub.2;
[0054] n represents an integer selected from 0 to 5;
[0055] each R.sup.1 independently represents C.sub.1-6 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, halogen, haloC.sub.1-6alkyl, C.sub.1-6 alkoxy, haloC.sub.1-6 alkoxy, cyano, hydroxyl, COH, COOH, COOC.sub.1-6alkyl, NH.sub.2 or NO.sub.2;
[0056] R.sup.2 represents hydrogen, C.sub.1-6 alkyl, C.sub.2-6 alkenyl or C.sub.2-6 alkynyl;
[0057] R.sup.3 is selected from either hydrogen or an NR.sup.4 group, such that when Ring A represents formula (i) or (iii), R.sup.3 represents NR.sup.4, and when Ring A represents formula (ii), R.sup.3 represents hydrogen;
[0058] R.sup.4 represents C(R.sup.4a)(R.sup.4b), C.sub.3-8 cycloalkyl or benzyl wherein said cycloalkyl or benzyl is optionally substituted by C.sub.1-6 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, halogen, haloC.sub.1-6alkyl, C.sub.1-6 alkoxy, haloC.sub.1-6 alkoxy, cyano, hydroxyl, COH, COOH, COOC.sub.1-6alkyl, NH.sub.2 or NO.sub.2;
[0059] R.sup.4a and R.sup.4b are independently selected from hydrogen, C.sub.1-6 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, halogen, haloC.sub.1-6alkyl, C.sub.1-6 alkoxy, haloC.sub.1-6 alkoxy, cyano, hydroxyl, COH, COOH, COOC.sub.1-6alkyl, NH.sub.2, NO.sub.2, C.sub.3-8 cycloalkyl or benzyl wherein said cycloalkyl or benzyl is optionally substituted by C.sub.1-6 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, halogen, haloC.sub.1-6alkyl, C.sub.1-6 alkoxy, haloC.sub.1-6 alkoxy, cyano, hydroxyl, COH, COOH, COOC.sub.1-6alkyl, NH.sub.2 or NO.sub.2;
[0060] or a pharmaceutically acceptable salt or solvate thereof, for use in the treatment or prevention of laminopathy, premature ageing disorders, normal ageing or cancer.
[0061] The term halo or halogen as used herein refers to fluorine, chlorine, bromine or iodine.
[0062] The term cyano as used herein refers to a group where a carbon atom is triple-bonded to a nitrogen atom (i.e. CN).
[0063] The term hydroxyl as used herein refers to a group where an oxygen atom is bonded to a hydrogen atom.
[0064] The term C.sub.1-6alkyl as used herein as a group or part of a group refers to a linear or branched saturated hydrocarbon group containing from 1 to 6 carbon atoms. Examples of such groups include methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert butyl, n-pentyl, isopentyl, neopentyl or hexyl and the like.
[0065] The term C.sub.2-6alkenyl as used herein as a group or part of a group refers to a linear or branched hydrocarbon group containing from 2 to 6 carbon atoms and containing a carbon carbon double bond.
[0066] The term C.sub.2-6alkynyl as used herein as a group or part of a group refers to a linear or branched hydrocarbon group having from 2 to 6 carbon atoms and containing a carbon carbon triple bond.
[0067] The term C.sub.1-6alkoxy as used herein as a group or part of a group refers to an OC.sub.1-6alkyl group wherein C.sub.1-6alkyl is as defined herein. Examples of such groups include methoxy, ethoxy, propoxy, butoxy, and the like.
[0068] The term haloC.sub.1-6alkyl as used herein as a group or part of a group refers to a C.sub.1-6 alkyl group as defined herein wherein one or more than one hydrogen atom is replaced with a halogen. The term haloC.sub.1-6alkyl therefore includes monohaloC.sub.1-6alkyl and also polyhaloC.sub.1-6alkyl. There may be one, two, three or more hydrogen atoms replaced with a halogen, so the haloC.sub.1-6alkyl may have one, two, three or more halogens. Examples of such groups include fluoroethyl, fluoromethyl, trifluoromethyl or trifluoroethyl and the like.
[0069] The term haloC.sub.1-6alkoxy as used herein as a group or part of a group refers to a OC.sub.1-6alkyl group as defined herein wherein one or more than one hydrogen atom is replaced with a halogen. The term haloC.sub.1-6alkoxy therefore includes monohaloC.sub.1-6alkoxy, and also polyhaloC.sub.1-6alkoxy. There may be one, two, three or more hydrogen atoms replaced with a halogen, so the haloC.sub.1-6alkoxy may have one, two, three or more halogens. Examples of such groups include fluoroethyloxy, difluoromethoxy or trifluoromethoxy and the like.
[0070] The term C.sub.3-8 cycloalkyl as used herein as a group or part of a group refers to a saturated hydrocarbon ring containing from 3 to 8 carbon atoms. Examples of such groups include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl and the like.
[0071] The term benzyl as used herein as a group or part of a group refers to a benzene ring attached to a CH.sub.2 group.
[0072] For the avoidance of doubt, unless otherwise indicated, the term substituted means substituted by one or more defined groups. In the case where groups may be selected from a number of alternative groups, the selected groups may be the same or different.
[0073] For the avoidance of doubt, the term independently means that where more than one substituent is selected from a number of possible substituents, those substituents may be the same or different.
[0074] In one embodiment, each of W, Y and Z represent CH.
[0075] In one embodiment, Ring A represents formula (i) or (ii). In a further embodiment, Ring A represents formula (i). In an alternative embodiment, Ring A represents formula (ii). In a yet further alternative embodiment, Ring A represents formula (iii).
[0076] In one embodiment, X represents S or O. In a further embodiment, X represents S (i.e. a thiazole ring). In an alternative embodiment, X represents O (i.e. an oxazole ring).
[0077] In one embodiment, R.sup.5 represents hydrogen or halogen (such as bromo). In a further embodiment, R.sup.5 represents hydrogen.
[0078] In one embodiment, n represents an integer from 0 to 3. In one embodiment, n represents an integer from 1 to 2. In a further embodiment, n represents 1. In an alternative embodiment, n represents 2.
[0079] In one embodiment, R.sup.1 represents cyano, hydroxyl, halogen (such as chloro or bromo), C.sub.1-6alkoxy (such as methoxy), COOH, NO.sub.2, haloC.sub.1-6alkyl (such as trifluoromethyl) or haloC.sub.1-6alkoxy (such as trifluoromethoxy). In a further embodiment, R.sup.1 represents cyano, hydroxyl, halogen (such as chloro or bromo), C.sub.1-6alkoxy (such as methoxy), COOH or NO.sub.2. In a yet further embodiment, R.sup.1 represents cyano, halogen (such as chloro or bromo) or NO.sub.2, such as cyano or halogen. In a yet further embodiment, R.sup.1 represents cyano. In a yet further alternative embodiment, R.sup.1 represents halogen, such as chloro. In a yet further alternative embodiment, R.sup.1 represents haloC.sub.1-6alkyl, such as trifluoromethyl.
[0080] It will be understood by persons skilled in the art that the R.sup.1 group may be attached in the para, ortho or meta positions on the phenyl ring of formula (I). In one embodiment, R.sup.1 is in the 2, 3, or 4 position (i.e. ortho, meta or para position), in particular the meta (3) and/or para (4) position. In a further embodiment, R.sup.1 is in the meta (3) position, for example when R.sup.1 is halogen or cyano, in particular halogen. In an alternative embodiment, R.sup.1 is in the para (4) position, for example when R.sup.1 is cyano, chloro or trifluoromethyl.
[0081] In one embodiment, n represents 1 and said R.sup.1 group is present on the 3 or 4 position on the phenyl ring of formula (I).
[0082] In one embodiment, n represents 1 and R.sup.1 represents cyano, hydroxyl, halogen (such as chloro or bromo), C.sub.1-6alkoxy (such as methoxy), COOH, NO.sub.2 or haloC.sub.1-6 alkyl (such as trifluoromethyl). In a further embodiment, n represents 1 and R.sup.1 represents cyano, hydroxyl, halogen (such as chloro or bromo), C.sub.1-6alkoxy (such as methoxy), COOH or NO.sub.2.
[0083] In one embodiment, n represents 2 and said R.sup.1 group is present on the 2 and 4 or 3 and 4 or 2 and 3 positions on the phenyl ring of formula (I), such as the 2 and 4 or 3 and 4 positions.
[0084] In one embodiment, n represents 2 and both R.sup.1 groups represent chloro (i.e. 3,4-dichloro) or R.sup.1 represents C.sub.1-6alkoxy (e.g. methoxy) and hydroxyl (i.e. 2-hydroxy-4-methoxy).
[0085] In an alternative embodiment, n represents 2 and both R.sup.1 groups represent hydroxy (i.e. 3,4-dihydroxy).
[0086] In one embodiment, R.sup.2 represents hydrogen or C.sub.2-6alkynyl (such as ethynyl). In a further embodiment, R.sup.2 represents hydrogen. In a further alternative embodiment, R.sup.2 represents ethynyl.
[0087] In one embodiment, R.sup.3 represents NR.sup.4.
[0088] In one embodiment, R.sup.4 represents C(R.sup.4a)(R.sup.4b) (such as C(Me).sub.2), unsubstituted C.sub.3-8 cycloalkyl, unsubstituted C.sub.3-8 cycloalkenyl or unsubstituted benzyl. In a further embodiment, R.sup.4 represents unsubstituted C.sub.3-8 cycloalkyl or unsubstituted benzyl.
[0089] In one embodiment, R.sup.4 represents C.sub.3-8 cycloalkyl, such as cyclopentyl or cyclohexyl (such as unsubstituted cyclopentyl or unsubstituted cyclohexyl). In a further embodiment, R.sup.4 represents C.sub.3-8 cycloalkyl, such as cyclopentyl (such as unsubstituted cyclopentyl).
[0090] In an alternative embodiment, R.sup.4 represents C.sub.3-8 cycloalkenyl, such as cyclopentenyl or cyclohexenyl (such as unsubstituted cyclopentenyl or unsubstituted cyclohexenyl).
[0091] In one embodiment, R.sup.4 is optionally substituted by 1 or 2 groups, selected from C.sub.1-6 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, halogen, haloC.sub.1-6alkyl, C.sub.1-6 alkoxy, haloC.sub.1-6 alkoxy or hydroxyl.
[0092] In one embodiment, the compound of formula (I) is selected from Compounds 1 to 21 or an alternative pharmaceutically acceptable salt, solvate, free acid preparation or free base preparation thereof. In a further embodiment, the compound of formula (I) is selected from Compounds 1 to 12 or an alternative pharmaceutically acceptable salt, solvate, free acid preparation or free base preparation thereof. In a yet further embodiment, the compound of formula (I) is selected from Compounds 1 to 11, such as Compounds 1 to 8, or an alternative pharmaceutically acceptable salt, solvate, free acid preparation or free base preparation thereof. In a yet further embodiment, the compound of formula (I) is selected from Compounds 1 to 3 or an alternative pharmaceutically acceptable salt, solvate, free acid preparation or free base preparation thereof.
[0093] In an alternative embodiment, the compound of formula (I) is a compound selected from: Compounds 1, 3, 4, 5, 6, 7 and 8, such as Compound 3 or 8 or an alternative pharmaceutically acceptable salt, solvate, free acid preparation or free base preparation thereof.
[0094] In one embodiment, the compound of formula (I) is 4-(4-cyanophenyl)-2-(2-cyclopentylidenehydrazinyl)thiazole (Compound 1) or a pharmaceutically acceptable salt, solvate, free acid preparation or free base preparation thereof.
[0095] In an alternative embodiment, the compound of formula (I) is 4-(4-chlorophenyl)-2-(2-cyclopentylidenehydrazinyl)thiazole or a pharmaceutically acceptable salt, solvate, free acid preparation or free base preparation thereof, such as the hydrochloride salt.
[0096] In an alternative embodiment, the compound of formula (I) is 4-(4-chlorophenyl)-2-(2-cyclopentylidene-1-(prop-2-yn-1-yl)hydrazinyl)thiazole (Compound 3) or a pharmaceutically acceptable salt, solvate, free acid preparation or free base preparation thereof.
[0097] In an alternative embodiment, the compound of formula (I) is 4-(4-trifluoromethylphenyl)-2-(2-cyclopentylidenehydrazinyl)thiazole (Compound 13) or a pharmaceutically acceptable salt, solvate, free acid preparation or free base preparation thereof, such as the hydrobromide salt.
[0098] According to a further aspect of the invention, there is provided a compound of formula (I).sup.a:
##STR00005##
[0099] wherein R.sup.1, R.sup.2, R.sup.3, R.sup.5, X and n are as defined hereinbefore, for use in the treatment or prevention of laminopathy, premature ageing disorders, normal ageing or cancer.
[0100] According to a further aspect of the invention, there is provided a compound of formula (I)b:
##STR00006##
[0101] wherein R.sup.1, R.sup.2, R.sup.3, R.sup.5 and n are as defined hereinbefore, for use in the treatment or prevention of laminopathy, premature ageing disorders, normal ageing or cancer.
[0102] According to a further aspect of the invention, there is provided a compound of formula (I).sup.c:
##STR00007##
[0103] wherein R.sup.1, R.sup.2 and n are as defined hereinbefore, for use in the treatment or prevention of laminopathy, premature ageing disorders, normal ageing or cancer.
[0104] According to a further aspect of the invention, there is provided a compound of formula (I).sup.d:
##STR00008##
[0105] wherein R.sup.1 and n are as defined hereinbefore, for use in the treatment or prevention of laminopathy, premature ageing disorders, normal ageing or cancer.
[0106] Certain compounds of formula (I) are novel, thus according to a further aspect of the invention, there is provided a compound of formula (I) selected from:
[0107] Compound 3, Compound 8, Compound 11, Compounds 13-17 and Compounds 19-21; and salts and solvates of any one thereof.
[0108] In one embodiment, the compound is selected from Compound 3 or 8.
[0109] NAT10 Inhibition
[0110] More generally, it will be understood that the inventors have discovered a novel link between NAT10 inhibition and improving nuclear architecture and chromatin organisation in Lamin A/C depleted cells or cells with LMNA mutations. Therefore, in a further aspect of the invention, there is provided a NAT10 inhibitor for use in the treatment or prevention of laminopathy, premature ageing disorders, normal ageing and cancer (such as a cancer characterised by low levels of LMNA expression), in particular, laminopathy and premature ageing disorders.
[0111] N-acetyltransferase 10, also referred to as NAT10 (or initially as hALP), is a N-acetyltransferase enzyme that is highly conserved from bacteria to human (see
[0112] The inventors have identified small molecule inhibitors of NAT10 which result in nuclear morphology rescue via reorganization of the microtubule network. Thus, the identified small molecule inhibitors of NAT10 disclosed herein provide new opportunities to study laminopathy-associated processes with valuable spatial and temporal resolution, and can be used to alleviate laminopathies or diseases which cause premature ageing.
[0113] It will be apparent to persons skilled in the art that inhibition may occur either by binding to NAT10 directly or indirectly.
[0114] Methods of Screening
[0115] According to a further aspect of the invention, a method of screening for substances capable of inhibiting NAT10 activity is provided, as are NAT10 inhibitors and their use in therapy.
[0116] In light of the fact that the inventors have described a link between NAT10 inhibition and the treatment or prevention of laminopathy, premature ageing disorders, normal ageing or cancer, there is also provided a method of screening for a candidate drug substance intended to prevent or treat or prevent laminopathy, premature ageing disorders, normal ageing or cancer in a subject which comprises identifying a test substance capable of inhibiting NAT10 activity by measuring the effects of said test substance on NAT10 activity.
[0117] In one embodiment, the method of screening comprises:
[0118] a. contacting Lamin A and/or Lamin C depleted cells with a test substance;
[0119] b. measuring the level of NAT10 activity after a set period; and
[0120] c. comparing the level of NAT10 activity measured to that observed when no test substance is added.
[0121] In one embodiment, the method of screening is performed in vitro.
[0122] In one embodiment, the Lamin A and/or Lamin C depleted cells are obtained by using small interfering RNA (siRNA) to interfere with the expression of the LMNA gene. In a further embodiment, the Lamin A and/or Lamin C depleted cells are obtained by using siRNA duplexes of SEQ ID NOs: 1 and 2.
[0123] It will be appreciated by the person skilled in the art that the methods of screening provide concrete guidance for the identification of compounds capable of inhibiting NAT10 activity and rescuing nuclear shape defects.
[0124] Preparation of Compounds
[0125] In the present context, the term pharmaceutically acceptable salt is intended to indicate salts which are not harmful to the patient. Such salts include pharmaceutically acceptable acid addition salts, pharmaceutically acceptable metal salts and pharmaceutically acceptable alkaline addition salts. Acid addition salts include salts of inorganic acids as well as organic acids.
[0126] A reference to a compound of formula (I) and sub-groups thereof also includes ionic forms, salts, solvates, isomers (including geometric and stereochemical isomers), tautomers, N-oxides, esters, prodrugs, isotopes and protected forms thereof, for example, as discussed below; preferably, the salts or tautomers or isomers or N-oxides or solvates thereof; and more preferably, the salts or tautomers or N-oxides or solvates thereof, even more preferably the salts or tautomers or solvates thereof. Hereinafter, compounds and their ionic forms, salts, solvates, isomers (including geometric and stereochemical isomers), tautomers, N-oxides, esters, prodrugs, isotopes and protected forms thereof as defined in any aspect of the invention (except intermediate compounds in chemical processes) are referred to as compounds of the invention.
[0127] The compounds described herein include their use in the form of any and all stereoisomers (e.g. diastereoisomers and enantiomers as appropriate). For example, chiral compounds are claimed or claimed to be used as single enantiomers or mixtures of enantiomers (e.g. a racemic mixture).
[0128] Many compounds of formula (I) can exist in the form of salts, for example acid addition salts or, in certain cases salts of organic and inorganic bases such as carboxylate, sulfonate and phosphate salts. All such salts are within the scope of this invention, and references to compounds of formula (I) include the salt forms of the compounds.
[0129] The salts of the present invention can be synthesized from the parent compound that contains a basic or acidic moiety by conventional chemical methods such as methods described in Pharmaceutical Salts: Properties, Selection, and Use, P. Heinrich Stahl (Editor), Camille G. Wermuth (Editor), ISBN: 3-90639-026-8, Hardcover, 388 pages, August 2002. Generally, such salts can be prepared by reacting the free acid or base forms of these compounds with the appropriate base or acid in water or in an organic solvent, or in a mixture of the two; generally, nonaqueous media such as ether, ethyl acetate, ethanol, isopropanol, or acetonitrile are used.
[0130] Acid addition salts (mono- or di-salts) may be formed with a wide variety of acids, both inorganic and organic. Examples of acid addition salts include mono- or di-salts formed with an acid selected from the group consisting of acetic, 2,2-dichloroacetic, adipic, alginic, ascorbic (e.g. L-ascorbic), L-aspartic, benzenesulfonic, benzoic, 4-acetamidobenzoic, butanoic, (+) camphoric, camphor-sulfonic, (+)-(1S)-camphor-10-sulfonic, capric, caproic, caprylic, cinnamic, citric, cyclamic, dodecylsulfuric, ethane-1,2-disulfonic, ethanesulfonic, 2-hydroxyethanesulfonic, formic, fumaric, galactaric, gentisic, glucoheptonic, D-gluconic, glucuronic (e.g. D-glucuronic), glutamic (e.g. L-glutamic), -oxoglutaric, glycolic, hippuric, hydrohalic acids (e.g. hydrobromic, hydrochloric, hydriodic), isethionic, lactic (e.g. (+)-L-lactic, ()-DL-lactic), lactobionic, maleic, malic, ()-L-malic, malonic, ()-DL-mandelic, methanesulfonic, naphthalene-2-sulfonic, naphthalene-1,5-disulfonic, 1-hydroxy-2-naphthoic, nicotinic, nitric, oleic, orotic, oxalic, palmitic, pamoic, phosphoric, propionic, pyruvic, L-pyroglutamic, salicylic, 4-amino-salicylic, sebacic, stearic, succinic, sulfuric, tannic, (+)-L-tartaric, thiocyanic, p-toluenesulfonic, undecylenic and valeric acids, as well as acylated amino acids and cation exchange resins.
[0131] One particular group of salts consists of salts formed from acetic, hydrochloric, hydriodic, phosphoric, nitric, sulfuric, citric, lactic, succinic, maleic, malic, isethionic, fumaric, benzenesulfonic, toluenesulfonic, methanesulfonic (mesylate), ethanesulfonic, naphthalenesulfonic, valeric, acetic, propanoic, butanoic, malonic, glucuronic and lactobionic acids. One particular salt is the hydrochloride salt. Another particular salt is the hydrogensulfate salt, also known as a hemisulfate salt
[0132] Where the compounds of formula (I) contain an amine function, these may form quaternary ammonium salts, for example by reaction with an alkylating agent according to methods well known to the skilled person. Such quaternary ammonium compounds are within the scope of formula (I).
[0133] It will be understood that the compounds of the invention may exist as mono- or di-salts.
[0134] The salt forms of the compounds of the invention are typically pharmaceutically acceptable salts, and examples of pharmaceutically acceptable salts are discussed in Berge et al., 1977, Pharmaceutically Acceptable Salts, J. Pharm. Sci., Vol. 66, pp. 1-19. However, salts that are not pharmaceutically acceptable may also be prepared as intermediate forms which may then be converted into pharmaceutically acceptable salts. Such non-pharmaceutically acceptable salts forms, which may be useful, for example, in the purification or separation of the compounds of the invention, also form part of the invention.
[0135] Those skilled in the art of organic chemistry will appreciate that many organic compounds can form complexes with solvents in which they are reacted or from which they are precipitated or crystallized. These complexes are known as solvates. For example, a complex with water is known as a hydrate. Pharmaceutically acceptable solvates of the compound of the invention are within the scope of the invention. In one embodiment, the pharmaceutically acceptable solvates of the compounds of the invention include hydrates thereof.
[0136] It will be appreciated by those skilled in the art that certain protected derivatives of compounds of formula (I), which may be made prior to a final deprotection stage, may not possess pharmacological activity as such, but may, in certain instances, be administered orally or parenterally and thereafter metabolised in the body to form compounds of the invention which are pharmacologically active. Such derivatives may therefore be described as prodrugs. All such prodrugs of compounds of the invention are included within the scope of the invention. Examples of pro-drug functionality suitable for the compounds of the present invention are described in Drugs of Today, Volume 19, Number 9, 1983, pp 499-538 and in Topics in Chemistry, Chapter 31, pp 306-316 and in Design of Prodrugs by H. Bundgaard, Elsevier, 1985, Chapter 1 (the disclosures in which documents are incorporated herein by reference). It will further be appreciated by those skilled in the art, that certain moieties, known to those skilled in the art as pro-moieties, for example as described by H. Bundgaard in Design of Prodrugs (the disclosure in which document is incorporated herein by reference) may be placed on appropriate functionalities when such functionalities are present within compounds of the invention.
[0137] Also included within the scope of the compound and various salts of the invention are polymorphs thereof.
[0138] Compounds of formula (I) may exist in a number of different geometric isomeric, and tautomeric forms and references to compounds of formula (I) include all such forms.
[0139] The present invention includes all pharmaceutically acceptable isotopically-labelled compounds of the invention, i.e. compounds of formula (I), wherein one or more atoms are replaced by atoms having the same atomic number, but an atomic mass or mass number different from the atomic mass or mass number usually found in nature.
[0140] Examples of isotopes suitable for inclusion in the compounds of the invention comprise isotopes of hydrogen, such as .sup.2H (D) and .sup.3H (T), carbon, such as .sup.11C, .sup.13C and .sup.14C, chlorine, such as .sup.36Cl, fluorine, such as .sup.18F, iodine, such as .sup.123I, .sup.125I and .sup.131I, nitrogen, such as .sup.13N and .sup.15N, oxygen, such as .sup.15O, .sup.17O and .sup.18O, phosphorus, such as .sup.32P, and sulfur, such as .sup.35S.
[0141] Certain isotopically-labelled compounds of formula (I), for example, those incorporating a radioactive isotope, are useful in drug and/or substrate tissue distribution studies. The compounds of formula (I) can also have valuable diagnostic properties in that they can be used for detecting or identifying the formation of a complex between a labelled compound and other molecules, peptides, proteins, enzymes or receptors. The detecting or identifying methods can use compounds that are labelled with labelling agents such as radioisotopes, enzymes, fluorescent substances, luminous substances (for example, luminol, luminol derivatives, luciferin, aequorin and luciferase), etc. The radioactive isotopes tritium, i.e. .sup.3H (T), and carbon-14, i.e. .sup.14C, are particularly useful for this purpose in view of their ease of incorporation and ready means of detection.
[0142] Substitution with heavier isotopes such as deuterium, i.e. .sup.2H (D), may afford certain therapeutic advantages resulting from greater metabolic stability, for example, increased in vivo half-life or reduced dosage requirements, and hence may be preferred in some circumstances.
[0143] Substitution with positron emitting isotopes, such as .sup.11C, .sup.18F, .sup.15O and .sup.13N, can be useful in Positron Emission Topography (PET) studies for examining target occupancy.
[0144] Isotopically-labeled compounds of formula (I) can generally be prepared by conventional techniques known to those skilled in the art or by processes analogous to those described in the accompanying Examples and Preparations using appropriate isotopically-labeled reagents in place of the non-labeled reagent previously employed.
[0145] Processes for Preparing Compounds
[0146] According to a further aspect of the invention there is provided a process for preparing a compound of formula (I) as herein defined which comprises:
[0147] (a) when A represents (i), reacting a compound of formula (II)
##STR00009##
[0148] wherein W, Y, Z, R.sup.1 and n are as defined hereinbefore and L.sup.1 represents a suitable leaving group, such as chlorine or bromine; with a compound of formula (III):
##STR00010##
[0149] wherein R.sup.2 and R.sup.3 are as defined hereinbefore;
[0150] (b) deprotection of a protected derivative of a compound of formula (I); and/or
[0151] (c) interconversion of a compound of formula (I) or protected derivative thereof to a further compound of formula (I) or protected derivative thereof; and
[0152] (d) optional formation of a pharmaceutically acceptable salt of a compound of formula (I).
[0153] Process (a) typically comprises reacting a compound of formula (II) with a compound of formula (III) in the presence of a suitable solvent, such as isopropanol at a suitable temperature, such as room temperature for between 6 and 24 hours. It will be appreciated by the skilled person that preparation of compounds of formula (I) wherein A represents (ii) and (iii) may be made in an analogous manner to the procedure described in process (a).
[0154] It will be appreciated by those skilled in organic synthesis that two or more chemical steps in the schemes above may be run sequentially without isolation of intermediate materials.
[0155] Process (b) typically comprises any suitable deprotection reaction, the conditions of which will depend upon the nature of the protecting group. When the protecting group represents tBoc, such a deprotection reaction will typically comprise the use of a suitable acid in a suitable solvent. For example, the acid may suitably comprise trifluoroacetic acid or hydrogen chloride and the solvent may suitably comprise dichloromethane ethyl acetate, 1,4-dioxane, methanol or water. Optionally a mixture of solvents may be used, for example aqueous methanol or ethyl acetate/1,4-dioxane.
[0156] It will be appreciated that, when the protecting group represents tBoc, deprotection using a suitable acid as described above may generate a compound of formula (I) as a pharmaceutically acceptable salt, which may be isolated directly. Alternatively, the compound of formula (I) may be isolated as the free base using methods well known in the art and thereafter optionally converted to a pharmaceutically acceptable salt according to process (d).
[0157] A hydroxy group may be protected, for example, as an ether (OR) or an ester (OC(O)R), for example, as: a t-butyl ether; a tetrahydropyranyl (THP) ether; a benzyl, benzhydryl (diphenylmethyl), or trityl (triphenylmethyl) ether; a trimethylsilyl or t-butyldimethylsilyl ether; or an acetyl ester (OC(O)CH.sub.3).
[0158] An aldehyde or ketone group may be protected, for example, as an acetal (RCH(OR).sub.2) or ketal (R.sub.2C(OR).sub.2), respectively, in which the carbonyl group (>CO) is treated with, for example, a primary alcohol. The aldehyde or ketone group is readily regenerated by hydrolysis using a large excess of water in the presence of acid.
[0159] An amine group may be protected, for example, as an amide (NRCOR) or a carbamate (NRCOOR), for example, as: a methyl amide (NHCOCH.sub.3); a benzyl carbamate (NHCOOCH.sub.2C.sub.6H.sub.5, NH-Cbz or NHZ); as a t-butyl carbamate (NHCOOC(CH.sub.3).sub.3, NH-Boc); a 2-biphenyl-2-propyl carbamate (NHCOOC(CH.sub.3).sub.2C.sub.6H.sub.4C.sub.6H.sub.5, NH-Boc), as a 9-fluorenylmethyl carbamate (NHFmoc), as a 6-nitroveratryl carbamate (NHNvoc), as a 2-trimethylsilylethyl carbamate (NH-Teoc), as a 2,2,2-trichloroethyl carbamate (NH-Troc), as an allyl carbamate (NH-Alloc), or as a 2(-phenylsulphonyl)ethyl carbamate (NHPsec).
[0160] Other protecting groups for amines, such as cyclic amines and heterocyclic NH groups, include toluenesulphonyl (tosyl) and methanesulphonyl (mesyl) groups, benzyl groups such as a para-methoxybenzyl (PMB) group and tetrahydropyranyl (THP) groups.
[0161] Process (c) typically comprises interconversion procedures known by one skilled in the art. For example, in compounds of formula (I), a first substituent may be converted by methods known by one skilled in the art into a second, alternative substituent. A wide range of well known functional group interconversions are known by a person skilled in the art for converting a precursor compound to a compound of formula I and are described in Advanced Organic Chemistry by Jerry March, 4.sup.th Edition, John Wiley & Sons, 1992. For example possible metal catalysed functionalisations such as using organo-tin reagents (the Stille reaction), Grignard reagents and reactions with nitrogen nucleophiles are described in Palladium Reagents and Catalysts [Jiro Tsuji, Wiley, ISBN 0-470-85032-9] and Handbook of OrganoPalladium Chemistry for Organic Synthesis [Volume 1, Edited by Ei-ichi Negishi, Wiley, ISBN 0-471-31506-0].
[0162] Process (d) may be carried out by treatment of a compound of formula (I) in the free base form, dissolved in a suitable solvent, with a stoichiometric amount or an excess of a pharmaceutically acceptable organic or inorganic acid, then isolation of the resulting salt by methods well known in the art, e.g. evaporation of solvent or crystallisation.
[0163] If appropriate, the reactions previously described in processes (a), (b) and (c) are followed or preceded by one or more reactions known to the skilled of the art and are performed in an appropriate order to achieve the requisite substitutions on R.sup.1, R.sup.2, R.sup.3, R.sup.4 and R.sup.5 defined above to afford other compounds of formula (I). Non-limiting examples of such reactions whose conditions can be found in the literature include: [0164] protection of reactive functions, [0165] deprotection of reactive functions, [0166] halogenation, [0167] dehalogenation, [0168] dealkylation, [0169] alkylation and arylation of amine, aniline, alcohol and phenol, [0170] Mitsunobu reaction on hydroxyl groups, [0171] cycloaddition reactions on appropriate groups, [0172] reduction of nitro, esters, cyano, aldehydes, [0173] transition metal-catalyzed coupling reactions, [0174] acylation, [0175] sulfonylation/introduction of sulfonyl groups, [0176] saponification/hydrolysis of ester groups, [0177] amidification or transesterification of ester groups, [0178] esterification or amidification of carboxylic groups, [0179] halogen exchange, [0180] nucleophilic substitution with amine, thiol or alcohol, [0181] reductive amination, [0182] oxime formation on carbonyl and hydroxylamine groups, [0183] S-oxidation, [0184] N-oxidation, [0185] salification.
[0186] Compounds of formula (II) may be prepared from compounds of formula (IV) in accordance with the following Scheme 1:
##STR00011##
[0187] wherein W, Y, Z, R.sup.1, n and L.sup.1 are as defined hereinbefore.
[0188] Step (i) typically comprises the use of suitable reagents, such as 1.1 eq NXS, 1.5 eq pTSA and MeCN followed by heating to reflux for 2 to 24 hours.
[0189] It will be appreciated by the skilled person that compounds of formula (III) are either known or may be prepared from known materials in accordance with known procedures. For example, compounds of formula (V) where R.sup.2 represents hydrogen and R.sup.3 represents N=cyclopropyl may be prepared in accordance with the following Scheme 2:
##STR00012##
[0190] Step (i) typically comprises reacting compounds of formula (V) and (VI) in a suitable solvent such as isopropanol followed by heating to reflux for 16 hours.
[0191] The required intermediates, for example compounds of formula (IV), (V) and (VI) are either commercially available, known in the literature, prepared by methods analogous to those in the literature or prepared by methods analogous to those described in the example experimental procedures below.
[0192] Methods of Treatment
[0193] As discussed hereinabove, it is believed that compounds of the invention may be useful in the treatment or prevention of disorders associated with Lamin A and/or Lamin C depletion or LMNA mutations, such as laminopathy, premature ageing disorders, normal ageing and cancer, in particular, laminopathy and premature ageing disorders.
[0194] Therefore, according to a further aspect of the invention, there is provided compounds of the invention for use as a medicament, preferably a human medicament.
[0195] According to a further aspect the invention provides the use of compounds of the invention in the manufacture of a medicament for treating or preventing laminopathy, premature ageing disorders, normal ageing or cancer, in particular laminopathy or premature ageing.
[0196] According to a further aspect of the invention there is provided a method of treating or preventing laminopathy, premature ageing disorders, normal ageing or cancer in a human in need thereof comprising administering to said human a therapeutically effective amount of a compound as defined herein.
[0197] References herein to laminopathy refer to a group of genetic disorders which are caused by mutations in genes encoding proteins of the nuclear lamina, e.g.
[0198] Lamin A/C depletion and/or defects in the LMNA gene. Laminopathies comprise dystrophic and progeric (i.e. premature ageing) diseases.
[0199] Examples of laminopathies include, but are not limited to: Atypical Werner syndrome; Barraquer-Simons syndrome; Buschke-Ollendorff syndrome;
[0200] Cardiomyopathy; Charcot-Marie-Tooth disease; Emery-Dreifuss muscular dystrophy (X-linked (EDMD), autosomal dominant (EDMD2) or autosomal recessive (EDMD3)); Familial partial lipodystrophy of the Dunnigan type (FPLD); Greenberg dysplasia; Hutchinson-Gilford progeria syndrome (HGPS); Leukodystrophy, demyelinating, adult-onset, autosomal dominant (ADLD); Limb-girdle muscular dystrophy type 1B (LGMD1B); Lipoatrophy with diabetes, hepatic steatosis, hypertrophic cardiomyopathy, and leukomelanodermic papules (LDHCP); Mandibuloacral dysplasia with type A lipodystrophy (MADA); Mandibuloacral dysplasia with type B lipodystrophy (MADB); Pelger-Huet anomaly (PHA); Pelizaeus-Merzbacher disease; or Restrictive Dermopathy (RD).
[0201] References herein to premature ageing refer to a disorder that causes accelerated ageing in an individual. Such disorders may be referred to as progeric disorders and include: Hutchinson-Gilford progeria syndrome (HGPS); Werner syndrome; Bloom syndrome; Rothmund-Thomson syndrome; Cockayne syndrome; or Xeroderma pigmentosum.
[0202] LMNA down-regulation has also been reported in several types of cancer (see Zink et al. (2004) Nat. Rev.; Wu et al. (2009) J. Exp. Clin. Cancer Res.). The complete loss of Lamin A expression that is observed in some cancers suggests that lamins may act as tumour suppressors (J. L. Broers, et al., Am J Pathol 1993, S. F. Moss, et al., Gut 1999, R. S. Venables, et al., Br J Cancer 2001). Importantly, downregulation of Lamin A/C expression is correlated with cancer aggressiveness and poor prognosis (E. J. Belt, et al., European journal of cancer 2011, N. D. Willis, et al., PLoS One 2008, N. D. Willis, et al., Biochem Soc Trans 2008). Loss of a functional lamina at the inner nuclear membrane seems to contribute to misshapen nuclei of cancer cells. Moreover, decreased Lamin A/C expression is associated with softer nuclei that can squeeze more easily into small blood vessels, that could contribute to increase the invasive potential of these cancer cells. Therefore, since the compounds of the invention are able to improve nuclear shape of Lamin A/C depleted cells, it will be understood that the compounds of the invention may also be used to treat these cancers. Indeed, higher doses of the compounds reduce cancer cells invasion and migration as well as cell proliferation, in particular in cancer cells expressing low levels of Lamin A/C.
[0203] Examples of types of cancer which may be treated by the compounds described herein include, but are not limited to, breast, bowel, bladder, bone, brain, cervical, colon, endometrial, oesophageal, kidney, liver, lung, ovarian, pancreatic, prostate, skin, stomach, testicular, thyroid or uterine cancer, leukemia, lymphoma, myeloma or melanoma. Cancer stem cells might also be targeted by the compounds.
[0204] The term medicament as used herein refers to a pharmaceutical formulation that is of use in treating, curing or improving a disease or in treating, ameliorating or alleviating the symptoms of a disease. A pharmaceutical formulation comprises a pharmacologically active ingredient in a form not harmful to the subject it is being administered to and additional constituents designed to stabilise the active ingredient and affect its absorption into the circulation or target tissue. In one embodiment, the medicament described herein is a human medicament.
[0205] It will be appreciated that references herein to treatment extend to prophylaxis, prevention of recurrence and suppression or amelioration of symptoms (whether mild, moderate or severe) as well as the treatment of established conditions.
[0206] Pharmaceutical Compositions
[0207] According to a further aspect, the invention provides a pharmaceutical composition comprising a compound of the invention, in association with one or more pharmaceutically acceptable carrier(s), diluents(s) and/or excipient(s) for use in the treatment or prevention of laminopathy, premature ageing disorders, normal ageing or cancer. The carrier, diluent and/or excipient must be acceptable in the sense of being compatible with the other ingredients of the composition and not deleterious to the recipient thereof.
[0208] The compounds of the invention may also be used in combination with one or more further active ingredients. The invention thus provides, in a further aspect, a combination comprising a compound of the invention or a pharmaceutically acceptable derivative thereof together with one or more further active ingredients.
[0209] When a compound of the invention or a pharmaceutically acceptable derivative thereof is used in combination with one or more further active ingredients against the same disease state the dose of each compound may differ from that when the compound is used alone. Appropriate doses will be readily appreciated by those skilled in the art. It will be appreciated that the amount of a compound of the invention required for use in treatment will vary with the nature of the condition being treated and the age and the condition of the patient and will be ultimately at the discretion of the attendant physician or veterinarian.
[0210] The one or more further active ingredients can be active ingredients for the treatment or prevention of laminopathy, premature ageing disorders, normal ageing or cancer. Suitable non limiting examples of such active ingredients include: pravastatin, zoledronic acid, rapamycin, farnesyl-transferase inhibitors such as lonafarnib, etc.
[0211] The combinations referred to above may conveniently be presented for use in the form of a pharmaceutical formulation and thus pharmaceutical formulations comprising a combination as defined above together with a pharmaceutically acceptable carrier or excipient comprise a further aspect of the invention. The individual components of such combinations may be administered either sequentially or simultaneously in separate or combined pharmaceutical formulations by any convenient route.
[0212] When administration is sequential, either the compound of the invention or the one or more further active ingredients may be administered first. When administration is simultaneous, the combination may be administered either in the same or different pharmaceutical composition.
[0213] When combined in the same formulation it will be appreciated that the two compounds must be stable and compatible with each other and the other components of the formulation. When formulated separately they may be provided in any convenient formulation, conveniently in such manner as are known for such compounds in the art.
[0214] Administration
[0215] The compound of the invention may be administered as the raw chemical but the active ingredient is preferably presented as a pharmaceutical formulation.
[0216] The compounds of the invention may be administered in conventional dosage forms prepared by combining a compound of the invention with standard pharmaceutical carriers or diluents according to conventional procedures well known in the art. These procedures may involve mixing, granulating and compressing or dissolving the ingredients as appropriate to the desired preparation.
[0217] The pharmaceutical compositions of the invention may be formulated for administration by any route, and include those in a form adapted for oral, topical or parenteral administration to mammals including humans.
[0218] The compositions may be in the form of tablets, capsules, powders, granules, lozenges, creams or liquid preparations, such as oral or sterile parenteral solutions or suspensions.
[0219] The topical formulations of the present invention may be presented as, for instance, ointments, creams or lotions, eye ointments and eye or ear drops, impregnated dressings and aerosols, and may contain appropriate conventional additives such as preservatives, solvents to assist drug penetration and emollients in ointments and creams.
[0220] The formulations may also contain compatible conventional carriers, such as cream or ointment bases and ethanol or oleyl alcohol for lotions. Such carriers may be present as from about 1% up to about 98% of the formulation. More usually they will form up to about 80% of the formulation.
[0221] Tablets and capsules for oral administration may be in unit dose presentation form, and may contain conventional excipients such as binding agents, for example syrup, acacia, gelatine, sorbitol, tragacanth, or polyvinylpyrrolidone; fillers, for example lactose, sugar, maize-starch, calcium phosphate, sorbitol or glycine; tabletting lubricants, for example magnesium stearate, talc, polyethylene glycol or silica; disintegrants, for example potato starch; or acceptable wetting agents such as sodium lauryl sulphate. The tablets may be coated according to methods well known in normal pharmaceutical practice. Oral liquid preparations may be in the form of, for example, aqueous or oily suspensions, solutions, emulsions, syrups or elixirs, or may be presented as a dry product for reconstitution with water or other suitable vehicle before use. Such liquid preparations may contain conventional additives, such as suspending agents, for example sorbitol, methyl cellulose, glucose syrup, gelatine, hydroxyethyl cellulose, carboxymethyl cellulose, aluminium stearate gel or hydrogenated edible fats, emulsifying agents, for example lecithin, sorbitan monooleate, or acacia; non-aqueous vehicles (which may include edible oils), for example almond oil, oily esters such as glycerine, propylene glycol, or ethyl alcohol; preservatives, for example methyl or propyl p-hydroxybenzoate or sorbic acid, and, if desired, conventional flavouring or colouring agents.
[0222] Suppositories will contain conventional suppository bases, e.g. cocoa-butter or other glyceride.
[0223] For parenteral administration, fluid unit dosage forms are prepared utilising the compound and a sterile vehicle, water being preferred. The compound, depending on the vehicle and concentration used, can be either suspended or dissolved in the vehicle. In preparing solutions the compound can be dissolved in water for injection and filter-sterilised before filling into a suitable vial or ampoule and sealing.
[0224] Advantageously, agents such as a local anaesthetic, preservative and buffering agents can be dissolved in the vehicle. To enhance the stability, the composition can be frozen after filling into the vial and the water removed under vacuum. The dry lyophilised powder is then sealed in the vial and an accompanying vial of water for injection may be supplied to reconstitute the liquid prior to use. Parenteral suspensions are prepared in substantially the same manner except that the compound is suspended in the vehicle instead of being dissolved and sterilisation cannot be accomplished by filtration. The compound can be sterilised by exposure to ethylene oxide before suspending in the sterile vehicle. Advantageously, a surfactant or wetting agent is included in the composition to facilitate uniform distribution of the compound.
[0225] The compositions may contain from 0.1% by weight, for example from 10-60% by weight, of the active material, depending on the method of administration. Where the compositions comprise dosage units, each unit will for example contain from 5-1000 mg of the active ingredient. The dosage as employed for adult human treatment may range from 10 to 3000 mg per day depending on the route and frequency of administration. For oral administration a typical dose may be in the range of 50 to 1500 mg per day, for example 120 to 1000 mg per day.
[0226] It will be recognised by one of skill in the art that the optimal quantity and spacing of individual dosages of a compound of the invention will be determined by the nature and extent of the condition being treated, the form, route and site of administration, and the particular mammal being treated, and that such optimums can be determined by conventional techniques. It will also be appreciated by one of skill in the art that the optimal course of treatment, i.e., the number of doses of a compound of the invention given per day for a defined number of days, can be ascertained by those skilled in the art using conventional course of treatment determination tests.
[0227] All publications, including, but not limited to, patents and patent applications cited in this specification, are herein incorporated by reference as if each individual publication were specifically and individually indicated to be incorporated by reference herein as though fully set forth.
EXAMPLES
[0228] The invention is illustrated by the Examples described below.
[0229] In the procedures that follow, after each starting material, reference to a Description or Example by number is typically provided. This is provided merely for assistance to the skilled chemist. The starting material may not necessarily have been prepared from the batch referred to.
[0230] Where reference is made to the use of a similar procedure, as will be appreciated by those skilled in the art, such a procedure may involve minor variation, for example reaction temperature, reagent/solvent amount, reaction time, work-up conditions or chromatographic purification conditions.
[0231] All solvents and reagents were purified using standard techniques or used as supplied from commercial sources (Sigma-Aldrich). NMR spectra were acquired on a Bruker 500 MHz instrument using deuterated solvents at 300 K. Notation for the .sup.1H NMR spectral splitting patterns includes: singlet (s), doublet (d), triplet (t), broad (br) and multiplet/overlapping peaks (m). Signals are quoted as values in ppm and coupling constants (J) are quoted in Hertz. Mass spectra were recorded on a Micromass Q-Tof (ESI) spectrometer.
[0232] General Procedure
[0233] The appropriate ketone or aldehyde was dissolved in isopropanol at a final concentration of 0.5 M and refluxed for 24 hours in the presence of an equimolar amount of thiosemicarbazide. The corresponding thiosemicarbazones were isolated by filtration and recrystallized from hot ethanol. Equimolar amounts of thiosemicarbazones and the desired haloketones were stirred at room temperature in isopropanol overnight at a final concentration of 0.2 M. The resulting products were recrystallized from hot ethanol several times to yield pure products and were used without further purification.
Compound 1
4-(4-Cyanophenyl)-2-(2-cyclopentylidenehydrazinyl)thiazole (Remodelin)
[0234] ##STR00013##
[0235] 2-Cyclopentylidenehydrazine-1-carbothioamide (which may be prepared as described in Scheme 2 hereinbefore) (1 g, 4.46 mmol) and 2-bromo-4-cyanoacetophenone (which may be prepared as described in Scheme 1 hereinbefore) (700 mg, 4.45 mmol) were stirred overnight in 12 ml of isopropanol at room temperature. The precipitate was filtered and recrystallized from hot ethanol to yield the hydrobromide salt of the desired compound (559 mg, 1.98 mmol, 45%) as light yellow needles. This was resuspended in DMSO at a concentration of 10 mg/mL for use in cellular assays. .sup.1H NMR (500 MHz, CDCl.sub.3): 12.11 (br s), 7.84 (d, J=9.0 Hz, 2H), 7.81 (d, J=9.0 Hz, 2H), 6.84 (s, 1H), 2.61 (t, J=9.0 Hz, 2H), 2.51 (t, J=9.0 Hz, 2H), 1.94-1.80 (m, 4H); .sup.13C NMR (125 MHz, CDCl.sub.3): 173.8, 169.5, 138.8, 133.5, 131.3, 126.3, 118.0, 114.1, 103.8, 33.7, 31.2, 25.2, 25.0; HRMS (m/z): [M].sup.+ calcd. for C.sub.15H.sub.15N.sub.4S, 283.1009; found, 283.1017.
Compound 2
4-(4-Chlorophenyl)-2-(2-cyclopentylidenehydrazinyl)thiazole hydrochloride salt
[0236] ##STR00014##
[0237] Thiosemicarbazide (20 g, 220 mmol) and cyclopentanone (19.43 ml, 220 mmol) were refluxed in 500 ml of isopropanol for 24 hours. The precipitate was filtered and recrystallized from hot ethanol to provide the corresponding thiosemicarbazone (2-cyclopentylidenehydrazine-1-carbothioamide) as pale yellow crystals. 2-cyclopentylidenehydrazine-1-carbothioamide (10 g, 63 mmol) and 2,4-dichloroacetophenone (12 g, 63 mmol) were stirred overnight in 300 ml of isopropanol at room temperature. The precipitate was filtered and recrystallized from hot ethanol to yield the hydrochloride salt of the desired compound (16 g, 48 mmol, 77%) as light yellow needles. This was resuspended in DMSO at a concentration of 10 mg/mL for use in cellular assays. Spectral data were in agreement with those previously described in the literature (F. Chimenti et al., (2009) J. Med. Chem. 52, 530).
Compound 3
4-(4-Chlorophenyl)-2-(2-cyclopentylidene-1-(prop-2-yn-1-yl)hydrazinyl)thiazole
[0238] ##STR00015##
[0239] To a solution of Compound 2 (1 g, 3 mmol) in freshly distilled DMF (75 ml) was added K.sub.2CO.sub.3 (1.375 g, 10 mmol), triethylamine (1.4 ml, 10 mmol) and propargyl bromide (1.2 ml, 5 mmol, 80 wt. % in toluene). The solution turned purple after 12 hours at room temperature. Propargyl bromide (1.2 ml) was added and the reaction mixture was stirred for another 12 hours. The solvent was then evaporated under reduced pressure and the crude residue dissolved in CH.sub.2Cl.sub.2, washed several times with saturated solutions of NH.sub.4Cl and NaCl and dried over MgSO.sub.4. The solvent was evaporated under reduced pressure and the desired product (0.35 g, 1 mmol, 34%) was obtained as a brown oil after regular column chromatography. TLC (Hexane:CH.sub.2Cl.sub.2, 80:20): R.sub.f=0.25; .sup.1H NMR (500 MHz, CDCl.sub.3): 7.78 (d, J=8.0 Hz, 2H), 7.32 (d, J=8.0 Hz, 2H), 6.86 (s, 1H), 4.65 (s, 2H), 2.64-2.55 (m, 4H), 2.22 (s, 1H), 1.86-1.82 (m, 4H); .sup.13C NMR (125 MHz, CDCl.sub.3): 184.9, 171.8, 150.6, 133.4, 133.3, 128.6 (2C), 127.3 (2C), 105.2, 78.3, 72.5, 42.7, 33.8, 31.5, 24.9, 24.4; HRMS (m/z): [M].sup.+ calcd. for C.sub.17H.sub.16ClN.sub.3S, 329.0758; found, 329.0747.
[0240] It will be understood that Compounds 4-12 may be made in an analogous manner to Compounds 1 to 3, as described above:
TABLE-US-00001 Compound Structure 2-(2-Cyclopentylidenehydrazinyl)-4- (3,4-dichlorophenyl)thiazole (Compound 4)
Compound 13
4-(4-Trifluoromethylphenyl)-2-(2-cyclopentylidenehydrazinyl)thiazole hydrobromide salt
[0241] ##STR00025##
[0242] 2-Cyclopentylidenehydrazine-1-carbothioamide (3.0 g, 18.7 mmol) and 2-bromo-4-(trifluoromethyl)acetophenone (5.0 g, 18.7 mmol) were stirred in isopropanol (150 mL) at r.t. for 24 h. The precipitate was filtered and recrystallized three times from hot ethanol to yield the hydrobromide salt of the title compound as bright yellow needles (1.5 g, 3.7 mmol, 20%). 1H NMR (300 MHz, CDCl3) 11.12 (br s, 2H), 7.80 (d, J=8.5 Hz, 2H), 7.65 (d, J=8.5 Hz, 2H), 6.87 (s, 1H), 2.53 (t, J=7.0 Hz, 2H), 2.47 (t, J=7.0 Hz, 2H), 1.93-1.75 (m, 4H). 13C NMR (75 MHz, CDCl3) 171.9, 169.4, 140.3, 131.8 (q, J=32.0 Hz), 131.6, 126.5 (br q, J=3.5 Hz, 2C), 126.1 (2C), 123.7 (q, J=274.0 Hz), 103.5, 33.5, 30.6, 25.1, 24.9. HRMS (m/z): [M+H]+calcd. for C15H15F3N3S, 326.0933; found, 326.0950.
[0243] It will be understood that Compounds 14-21 may be made in an analogous manner to Compounds 1 to 3 and 13, as described above:
TABLE-US-00002 Compound Number Structure Compound 14
EXPERIMENTAL DATA
[0244] Material and Methods
[0245] Cell Culture and Transfections
[0246] U2OS and SaOS-2 osteosarcoma cells, HeLa cervical cancer cells, A431 melanoma cells, NCI-SNU5 gastric cancer cells, MRC-5 lung fibroblast cells and Werner syndrome patient-derived SV40 fibroblast cells were grown in Dulbecco's modified Eagle medium (DMEM, Sigma-Aldrich) supplemented with 10% fetal bovine serum (BioSera), 2 mM L-glutamine, 100 U per ml penicillin, 100 g ml.sup.1 streptomycin. Normal skin primary fibroblasts GM03440 and Hutchinson Gilford Progeria Syndrome (HGPS) skin primary fibroblasts AG11498 and AG06297 were purchased from Coriell Cell Repositories and used between passage number 9-12 and 20-23 respectively. Cells were grown in DMEM supplemented as above. RPE-1 retinal pigment epithelial cells were grown in DMEM and Ham F12 mix medium supplemented as above and buffered with sodium bicarbonate. HMV-II melanoma cell line, 22RV1 prostate carcinoma cells, NCI-H82 and NCI-H69 lung carcinoma cells, and NCI-N87 gastric cancer cell lines were grown in RPMI-1640 medium (Sigma-Aldrich) supplemented as above. Stably transfected U2OS cells were maintained in standard medium containing 1 mg ml.sup.1 G418 (Invitrogen). The siRNA duplexes were obtained from Life Sciences: Lamin A/C stealth RNAi: CCAUGAAGGAGGAACUGGACUUCCA (SEQ ID NO: 1) and GCGUGAGGAGUUUAAGGAGCUGAAA (SEQ ID NO: 2), NAT10 stealth RNAi: GAGCAUGGACCUCUCUGAAUACAUA (SEQ ID NO: 3), and as control siRNA, stealth RNAi negative control duplexes were used. Plasmid DNA and siRNA transfections were carried out using Lipofectamine 2000 and Lipofectamine RNAiMax (Life Sciences) respectively, following the manufacturer's instructions. Cells were analysed 48 to 72 hours after transfection.
[0247] Drug Treatments
[0248] The following KAT and KDAC inhibitors were used in the nuclear shape rescue screen, incubating cells with the molecules for 16 hours: trichostatin A (1 M), sodium butyrate (5 mM), tubacin (10 M), SAHA (5 M), curcumin (10 M), garcinol (50 M), anacardic acid (1 M), MB-3 (5 M), 4-(4-chlorophenyl)-2-(2-cyclopentylidenehydrazinyl)thiazole (Compound 2) (50 M), 4-(4-chlorophenyl)-2-(2-cyclopentylidene-1-(prop-2-yn-1-yl)hydrazinyl)thiazole (Compound 3) (50 M) and cyclopentylidene-[4-(4-cyanophenyl)thiazol-2-yl)hydrazine (Compound 1) (Remodelin) (10 to 50 M). For HGPS cellular fitness assays, Remodelin was incubated at 1 M for 1 to 10 days, renewing the medium every 3 days. For long-term senescence assay, cells were kept and passaged in medium containing 1 M Remodelin or DMSO only for 12 population doublings. Senescence was assessed after 8 days of Remodelin treatment when cells were at Population Doubling 12, and then after several weeks of Remodelin treatment, when cells reached Population Doubling 24 using the Senescence -Galactosidase Staining Kit #9860 from Cell Signaling. Nocodazole, colchicine and latrunculin A (Sigma-Aldrich) were used at 200 ng/ml, 1 g/ml and 1 M respectively. Aphidicolin (Sigma-Aldrich) was used at 5 g/ml for 16 h. Farnesyltransferase inhibitor FTI-277 was purchased from Tocris Bioscience and used at 5 M. ATMi (KU55933) and ATRi (ATR-45) were obtained from Tocris Bioscience and from the Ohio State University respectively and used at 10 M and 500 nM. Pifithrin alpha (Sigma-Aldrich) was used at 10 M.
[0249] Live Imaging of GFP-H2B Cells
[0250] U2OS cells were transfected with siLMNA for 48 hours before addition of (Compound 2) at 50 M. Pictures were acquired every 15 minutes for 16 hours in z-stack of 0.2 m interval with a Deltavision PersonalDV (Applied Precision, 512512 CoolSNAP HQ2 camera) equipped with a 100 UPlanSApo/1.40 oil objective (Olympus) and controlled with SoftWoRx software (Applied Precision). Movies were then assembled from pictures with ImageJ software.
[0251] Flow Cytometry
[0252] 10 M EdU was incubated for 2 hours when indicated. Cells were fixed in 4% paraformaldehyde (Sigma-Aldrich). EdU was fluorescently labeled using the Click-iT EdU Flow Cytometry Assay Kit (Life Sciences). DNA was stained with 50 mg ml.sup.1 propidium iodide (Sigma-Aldrich) in phosphate buffer solution (PBS) containing 0.1% Triton-X-100 and 0.5 mg ml.sup.1 DNase free RNase A (Sigma-Aldrich). Samples were processed on a FACSCalibur flow cytometer equipped with CellQuest software (Becton Dickinson). Results were analysed using FlowJo software (TreeStar).
[0253] Nuclear Circularity and Nuclear Area Quantification
[0254] CellProfiler software was used to quantify nuclear circularity and nuclear area from DAPI staining pictures, using the object size shape measurement. The AreaShape measurement allowed the calculation of the Form Factor index (4nArea/Perimeter.sup.2) corresponding to circularity (a Form Factor of 1 reflecting a perfect circle), as well as the calculation of nuclear Area.
[0255] Proliferation Assay
[0256] HGPS cells were plated at the same number in 24 well dishes. Next day, Remodelin (1 M) or small molecule Compound 2 (1 to 10 M), were added to the wells and plates were transferred into an IncuCyte microscope (Essen BioScience). Phase contrast pictures were acquired every 2 hours over several days. Percentage of cell confluence was calculated by the Cell Player integrated software (Essen BioScience) and analysed with GraphPad Prism software.
[0257] Protein Purification from Human Cells
[0258] HEK293 cells were transiently transfected with NAT10 constructs and harvested after 48 hours in PBS. Cells were lysed for 5 minutes at room temperature in IP lysis buffer (20 mM Tris pH 7.5, 40 mM NaCl, 2 mM MgCl.sub.2, 0.5% NP-40) freshly supplemented with 50 U/ml benzonase and EDTA-free protease inhibitor cocktail (Roche). After this initial lysis step, NaCl concentration was adjusted to 450 mM and samples were incubated at 4 C. with rotation. Lysates were clarified by centrifugation (13,200 rpm, 20 minutes at 4 C.), and after recovery NaCl concentration was equilibrated to 150 mM. Lysates were used for immunoprecipitation reaction in IP buffer (25 mM Tris pH 7.5, 150 mM NaCl, 1.5 mM DTT, 10% glycerol, 0.5% NP-40) supplemented with protease inhibitors. Target proteins were captured with anti-FLAG antibody (M2, Sigma-Aldrich) coupled to protein A/G-Dynabeads (Life Sciences). Complexes were washed with IP buffer containing incrementally increasing amounts of NaCl (250 mM, 500 mM, and 1M). Following this, the immuno-complexes were washed in TBS containing gradually decreasing amounts on NaCl (1M, 500 mM, 250 mM, and 150 mM). At this point, elution was carried out using excess triple-Flag peptide (Sigma Aldrich). Eluted proteins were loaded on a gel and the purification was verified by Silver Staining (SilverQuest kit, Life Sciences).
[0259] Analysis of Soluble or Polymerised Tubulin
[0260] U2OS cells pre-treated with 5 M Remodelin for 16 hours or with 10 M nocodazole for 8 hours, were lysed in MT Stabilization Buffer (MSB) (85 mM PIPES [pH 6.9], 1 mM EGTA, 1 mM MgCl.sub.2, 2M glycerol, 0.5% Triton with 4 g/ml Taxol). Lysates were kept at 4 C. for 2 minutes and then centrifuged for 10 minutes at 13,000 rpm. Supernatants, representing the soluble fraction of proteins, were transferred to new tubes, and Laemmli buffer was added. Pellets, representing the polymerized fraction of proteins, were washed once in MSB without Triton, and then resuspended in Laemmli buffer. Equal amounts of lysate were loaded on a gradient gel.
[0261] Microtubules Regrowth Assay
[0262] 48 hours after siRNA transfections, microtubules were depolymerized by cold treatment at 4 C. for 1 hour in cells pre-treated or not with 5 to 10 M Remodelin for 16 hours. Cold medium was replaced by pre-warmed medium and cells were incubated at 37 C. for 5 or 15 minutes to allow microtubules nucleation and anchorage respectively. Cells were fixed in PFA and stained with anti -Tubulin antibody as described in the immunofluorescence procedure.
[0263] Immunoblotting
[0264] Total cell extracts were prepared by scraping cells in SDS lysis buffer (4% SDS, 20% glycerol, and 120 mM Tris-HCl, pH 6.8), boiling for 5 minutes at 95 C., followed by 10 strokes through a 25-gauge needle. Before loading, lysates were diluted with a solution of 0.01% bromophenol blue and 200 mM DTT and boiled for 5 minutes at 95 C. Proteins were resolved by SDS-PAGE on 4-12% gradient gels (NUPAGE, Life Sciences) and transferred onto nitrocellulose membrane (Protran; Whatman). Secondary antibodies coupled to IRDye fluorophores were from LI-COR Biosciences. Detection and quantification was performed with an imager (Odyssey; LI-COR Biosciences).
[0265] Immunofluorescence
[0266] Cells were washed with PBS and fixed for 20 minutes with 2% PFA in PBS. Cells were permeabilised for 5 minutes with PBS/0.2% Triton X-100, and blocked with PBS/0.2% Tween 20 (PBS-T) containing 5% BSA. Coverslips were incubated for 1 hour with primary antibodies and for 30 minutes with appropriate secondary antibodies coupled to Alexa Fluor 488 or 594 fluorophores (Life Technologies), before being incubated with 2 g/ml DAPI. Pictures were acquired with a FluoView 1000 confocal microscope (Olympus). For high resolution imaging, z-stacks were acquired with a Deltavision PersonalDV (Applied Precision, 10241024 CoolSNAP HQ2 camera, z-stack of 0.2 m interval) or with a Deltavision OMX V3 in conventional mode (Applied Precision, 512512 Cascade II cameras (Photometrics), z-stack of 0.125 m interval) both equipped with a 100 UPlanSApo/1.40 oil objective (Olympus) and controlled with SoftWoRx software (Applied Precision). Deconvolutions were then performed with SoftWoRx (Applied Precision) in conservative mode. The different channels were acquired sequentially.
[0267] Fluorescent Labelling of Clickable Molecules
[0268] Cells were pre-incubated with clickable molecules Compound 3 or Reference Compound A (1-Chloro-4-ethynilbenzene, purchased from Sigma-Aldrich) for 2 hours before being fixed and permeabilised as described above. Click reaction was prepared using Invitrogen Click-iT reagents with Alexa fluor 488 Azide and incubated with fixed cells for 1 hour in the dark. In case of co-labelling with another protein, the click reaction was performed before the antibody incubations.
[0269] Antibodies
[0270] The antibodies used in this study are:
TABLE-US-00003 Abcam antibodies: Lamin A/C ab40567 HMG1 ab18256 H2AX total ab11175 Histone H3 ab1791 -actin ab8226 ATM (phospho S1981) ab81292 SUN1 ab124770 anti-Giantin ab24586 -tubulin T9026 H3K9me3 ab8898 Sigma-Aldrich antibodies: -tubulin FITC F2168 FLAG F3165 Santa Cruz antibodies: Lamin A/C sc-6215 p53 (DO-1) sc-126 p21 sc-397 Cell Signaling antibodies: H2AX 2577 p-Rb (Ser 807/811) 9308 Rb 9309 p-p53 (Ser15) 9284 Others: H2AX 05-636 Millipore NAT10 13365-1-AP ProteinTech
[0271] Micrococcal Nuclease Digestion Sensitivity Assay
[0272] 110.sup.6 cells were trypsinized, harvested, and washed once with 1 ml of 1RSB buffer (10 mM Tris, pH 7.6, 15 mM NaCl, and 1.5 mM MgCl.sub.2). After centrifugation (3.00g), the cell pellet was resuspended in 1 ml of 1RSB buffer with 1% Triton-X 100 and homogenized by five strokes with a loose-fitting glass pestle to release nuclei. Nuclei were collected by centrifugation (13,000g) and washed twice with 1 ml of buffer A (15 mM Tris, pH 7.5, 15 mM NaCl, 60 mM KCl, 0.34 M sucrose, 0.5 mM spermidine, 0.15 mM spermine, 0.25 mM PMSF, and 0.1% -mercaptoethanol). Nuclei were resuspended in
[0273] Buffer A and aliquoted into 100 l aliquots. 1.2 l of 0.1 M CaCl.sub.2 was added to each aliquot and nuclei were digested by addition of 0.25 l of 200 U/ml MNase (Sigma-Aldrich) and incubated at 30 C. Each aliquot was put back on ice at different time points and digestion was immediately stopped by addition of 3 l EDTA. DNA was purified using the Qiagen PCR purification kit and 1500 ng of DNA was analysed on a 1.5% agarose gel. Digestion profiles were analysed using ImageJ and values were adjusted relative to the global intensity of each lane to compensate for DNA loading variations.
[0274] Lysine Acetyltransferase (KAT) Assay
[0275] The KAT assay was performed using the Fluorescent HAT Assay kit (Active Motif) using NAT10 purified from HEK293 cells and 5 g of purified MAP enriched porcine tubulin (Tebu-bio) as a substrate. Remodelin and clickable molecule 2 were used at 50 M.
[0276] Circular Dichroism (CD) Spectroscopy CD experiments were performed using a Chirascan Circular Dichroism Spectrophotometer (Applied Photophysics, UK). 200 l of purified FLAG-NAT10 at a final concentration of 10 M in TBS 0.1% NP-40 (Sigma-Aldrich) was placed in a quartz cuvette with an optical path length of 1 mm, transferred to the spectrophotometer. CD scans were recorded at 25 C. over the wavelength range of 180 to 350 nm with a 1 second response time, 1 nm pitch and 1.5-nm bandwidth. Compound 2 solubilized in DMSO was added and the solution was incubated for 5 minutes before recording scans. CD spectra were buffer subtracted, zero corrected at 300 nm and normalized (Molar ellipticity e is quoted in 10.sup.5 deg cm.sup.2 dmol.sup.1).
[0277] DNA Manipulations
[0278] All DNA constructs were validated to be mutation-free by DNA sequencing. A list of DNA oligonucleotides used in this study is provided below. pICE-FLAG was generated by cloning annealed primers FLAG-S and FLAG-AS into HindIII- and BamHI-digested pICE, a new synthetic plasmid conferring puromycin-resistance to mammalian cells (Britton S, Coates J, Jackson SP. J Cell Biol. 2013). To generate NAT10 cDNA resistant to NAT10 siRNA, NAT10 cDNA was amplified from IMAGE clone 5166101 (Source Bioscience) using primer pairs NAT10-F and NAT10-siR-R, or NAT10-siR-F and NAT10-R. The resulting PCR products were fused together by PCR using primers NAT10-F and NAT10-R. The resulting PCR product was digested with BamHI and MluI and cloned into pICE-FLAG digested with the same restriction enzymes. To generate pICE-FLAG-NAT10-G641E, the G641E mutation was introduced into pICE-FLAg-NAT10 using QuickChange Site-Directed Mutagenesis kit (Agilent Technologies), according to the manufacturer's instructions and using primers NAT10-G641E-F and NAT10-G641E-R.
TABLE-US-00004 TABLE1 ListofDNAoligonucleotides SEQ ID Name Sequence5 to3 NO. FLAG-S AGCTTGCGGCCGCCGCCACCATGGATTACAAGG 4 ATGACGACGATAAGG FLAG-AS GATCCCTTATCGTCGTCATCCTTGTAATCCATGGT 5 GGCGGCGGCCGCA NAT10-F GCCGGATCCATGCATCGGAAAAAGGTGGATAAC 6 CG NAT10-R CGGACGCGTCTATTTCTTCCGCTTCAGTTTCATAT 7 C NAT10- CTGAAATCAATGGATTTGAGTGAATATATTATCC 8 siR-F GTGGGGACGATGAAGAGTGG NAT10- GGATAATATATTCACTCAAATCCATTGATTTCAGC 9 siR-R TTCCCTACTTCCTTCTTGTG NAT10- CAAGGGATGGGCTATGAGAGCCGTGCTCTGCAG 10 G641E-F NAT10- CTGCAGAGCACGGCTCTCATAGCCCATCCCTTG 11 G641E-R
[0279] Small Molecules for Protein Pull-Down Assays
[0280] Biotinylated derivative was synthesized from Compound 3 (biotinylated Compound 3) using commercially available O-(2-aminoethyl)-O-(2-azidoethyl)heptaethylene glycol and (+)-biotin N-hydroxysuccinimide. Further biotinylated derivatives of Compound 3 (PEG4 biotinylated Compound 3) and control Reference Compound A (PEG4 biotinylated Compound A) were generated in situ by addition of PEG4 carboxamide-6-azidohexanyl biotin (Life Sciences) and click reagents in cell extracts.
[0281] Biotinylated Small Molecule Pull-Downs
[0282] Cells were harvested in PBS and lysed in RIPA buffer supplemented with 1 mM PMSF and protease inhibitors (Roche) for 30 minutes at 4 C. with rotation. The supernatants were collected by centrifugation at 16,000g for 10 minutes. Supernatants were then incubated with 40 M of biotinylated small molecule (biotinylated Compound 3) or for the competition experiment with 200 M of (Compound 2) and 40 M of (biotinylated Compound 3) for 2 hours. Streptavidin coated magnetic beads (Dynabeads M-280 Streptavidin, Life Sciences) were washed 3 times with binding buffer (25 mM Tris.HCl, 150 mM NaCl, 0.1% Triton) and incubated with supernatants for 1 hour at 4 C. with rotation. The magnetic beads were washed 3 times with the binding buffer followed by boiling in Laemmli buffer for 5 minutes to elute the proteins. Samples were then loaded on 4-12% gradient gels (NUPAGE, Life Sciences), analyzed by silver staining (SilverQuest staining kit, Life Sciences) and specific bands were cut and analysed by LC-MS/MS.
##STR00034##
[0283] Clickable Small Molecule Pull-Downs
[0284] PEG4 biotinylated Compound 3 was synthesized from Compounds 2, commercially available O-(2-aminoethyl)-O-(2-azidoethyl)heptaethylene glycol and (+)-biotin N-hydroxysuccinimide, prior to being incubated with cell extracts (used in pull-down and mass spectrometry analyses).
[0285] Biotinylated Compound 3 and PEG4 biotinylated Compound A were generated in situ from Compounds 2 and 3, pre-incubated in live cells for 2 h prior to adding commercially available PEG4 carboxamide-6-azidohexanyl biotin and click reagents in cell extracts (used in click-pull-down and western blotting validation).
[0286] Click reaction reagents were added to the cell lysates as follows: 10 M biotin azide (PEG4 carboxamide-6-Azidohexanyl Biotin, Life Sciences), 10 mM sodium ascorbate (Sigma-Aldrich), 2 mM CuSO.sub.4 (Life Sciences). Click reactions were incubated in the dark for 1 hour at 4 C. with rotation. Streptavidin beads were then incubated for 1 hour and samples were eluted and loaded on a gel as described above, before immunoblotting.
[0287] Results
Example 1: Nuclear Shape Rescue by a KAT Inhibitor
[0288] Because lamin proteins act as a scaffold to maintain nuclear architecture and to anchor chromatin at the nuclear periphery (J. Gotzmann, R. Foisner (1999) Crit. Rev. Eukaryot. Gene Expr. 9, 257), small-interfering RNA (siRNA) mediated depletion of Lamin A/C (siLMNA) causes nuclear shape defects in various human cell lines (
Example 2: Protein Target Identification by Chemical Labelling of Compound 2
[0289] To identify putative biological targets of molecule Compound 2 and elucidate the mechanisms by which it improves nuclear morphology, a molecular-based strategy was established involving cellular functionalization of the molecule by means of click chemistry to retrieve and validate drug-associated protein complexes. To this end, an alkyne group was strategically introduced onto the hydrazone moiety of Compound 2, thereby producing clickable analogue Compound 3 (
[0290] Strikingly, N-acetyltransferase 10 (NAT10) was the only KAT protein identified by the above procedures (see Table 2), thus being the only likely relevant target of Compound 2.
TABLE-US-00005 TABLE 2 Biotin analogue of Compound 2 pulls-down the acetyl-transferase protein NAT10. Specific protein hits retrieved by small molecule biotinylated Compound 3 and identified by liquid chromatography- tandem mass spectrometry (LC-MS/MS). Peptide Hits Protein Name Cytoskeleton A2BDB0 21 Gamma-actin P15924 2 Desmoplakin P21333 8 Filamin-A Q14315 7 Filamin-C P35527 6 Keratin, type I Q5R844 3 Myosin light polypeptide 6 P48681 2 Nestin A6QQJ3 2 Peripherin Q15149 46 Plectin O94915 4 Protein furry homolog- like Q54HF0 4 Putative actin-25 Q9NYL9 3 Tropomodulin-3 P23729 2 Type III intermediate filament O43795 15 Unconventional myosin- Ib O00159 21 Unconventional myosin- Ic O94832 3 Unconventional myosin- Id P08670 52 Vimentin RNA/Nucleolus Q3SZ63 2 Nucleolar protein 56 A4FUD3 3 116 kDa U5 small nuclear ribonucleoprotein component Q1HR24 3 40S ribosomal protein S14 Q76I82 3 40S ribosomal protein S15a Q3T0X6 3 40S ribosomal protein S16 Q6Q311 3 40S ribosomal protein S25 Q4R5I3 2 60S ribosomal protein L22 Q3T057 3 60S ribosomal protein L23 Q3T0D5 2 60S ribosomal protein L30 Q3T171 3 60S ribosomal protein L36 Q02878 5 60S ribosomal protein L6 Q99020 2 Heterogeneous nuclear ribonucleoprotein A/B A5A6H4 3 Heterogeneous nuclear ribonucleoprotein A1 Q6URK4 5 Heterogeneous nuclear ribonucleoprotein A3 Q5RA82 2 Heterogeneous nuclear ribonucleoprotein C Q14103 3 Heterogeneous nuclear ribonucleoprotein D0 Q4R4M6 6 Heterogeneous nuclear ribonucleoprotein K Q8VEK3 8 Heterogeneous nuclear ribonucleoprotein U Q2HJ60 8 Heterogeneous nuclear ribonucleoproteins A2/B1 Q9H0A0 8 N-acetyltransferase 10 Q9NR30 5 Nucleolar RNA helicase 2 Q3T160 2 Nucleophosmin Q08E38 2 Pre-mRNA-processing factor 19 A1A5S1 3 Pre-mRNA-processing factor 6 Q5RAS1 3 pre-rRNA processing protein FTSJ3 Q4R6M5 16 Probable ATP-dependent RNA helicase DDX5 Q9D903 2 Probable rRNA- processing protein EBP2 Q28009 5 RNA-binding protein FUS Q9UKM9 8 RNA-binding protein Raly O75691 41 Small subunit processome component 20 homolog Chromatin Q91ZW3 2 SWI/SNF-related matrix- associated actin- dependent regulator of chromatin subfamily A member 5 Q9QZQ8 3 Core histone macro- H2A.1 Q8CCK0 2 Core histone macro- H2A.2 Q6URC2 3 High mobility group protein HMG-I/HMG-Y P0C0S8 3 Histone H2A type 1 A9UMV8 3 Histone H2A.J P02272 3 Histone H2A.V Q2M2T1 4 Histone H2B type 1-K P18437 2 Non-histone chromosomal protein HMG-17 Nuclear Envelope Q5SRE5 4 Nucleoporin NUP188 homolog P20700 5 Lamin-B1 Q03252 22 Lamin-B2 Trafficking Q6P5F9 4 Exportin-1 Q9EPL8 2 Importin-7 Other P46940 2 Ras GTPase-activating- like protein IQGAP1 Q86VI3 4 Ras GTPase-activating- like protein IQGAP3
[0291] Further highlighting its potential as a biologically relevant target of Compound 2, it was noted that NAT10 had previously been linked with the SUN1 nuclear envelope protein (Y. H. Chi et al. (2007) J. Bio. Chem. 282, 27447), whose depletion was recently shown to rescue nuclear shape in LMNA depleted cells (C. Y. Chen et al. (2012) Cell 149, 565), and that the KAT activity of NAT10 has been demonstrated towards microtubule and histone substrates (Shen et al. (2009) Exp. Cell Res. 315, 1653). To validate the interaction between NAT10 and Compound 2, cells were pre-incubated with the clickable bioactive analogue Compound 3 or non-bioactive control Reference Compound A to allow their binding to protein targets in live cells. Next, the molecules were functionalized by addition of a biotin-containing linker, then streptavidin beads were used to retrieve bound proteins. This analysis revealed that Compound 3 but not Reference Compound A specifically retrieved NAT10 (
[0292] To assess whether the interaction between Compound 2 and NAT10 was direct, NAT10 purified from human HEK293 cells (
Example 3: NAT10 Inhibition Mediates Nuclear Shape Rescue
[0293] The above studies suggested that Remodelin and related compounds might reverse nuclear shape of Lamin A/C depleted cells through NAT10 targeting. To explore this idea, NAT10 and Lamin A/C was co-depleted in human U2OS cells (
[0294] To explore the function of NAT10 KAT activity in controlling nuclear shape, stable cell lines expressing siRNA-resistant NAT10 WT or G641E constructs were generated. Given the correct expression and subcellular localization of both proteins (
Example 4: Remodelin Targets NAT10 to Improve Fitness of HGPS Cells
[0295] Having found that Remodelin rescues nuclear shape defects of Lamin A/C depleted cells, its effects on nuclear shape of LMNA mutated cells was investigated by using two primary fibroblast cell lines derived from HGPS patients (AG11498 and AG06267) carrying the heterozygous dominant point mutation LMNA c.1824C>T, p.G608G. On account of this mutation, HGPS cells express a permanently farnesylated, truncated form of Lamin A called Progerin, which accumulates with cell passage number at the nuclear rim. This leads to nuclear membrane folding and nuclear blebbing (
[0296] Farnesyltransferase inhibitors (FTIs) have been used in HGPS cells to prevent the toxic accumulation of farnesylated Progerin at the nuclear membrane. Indeed, non-farnesylated Progerin is relocalized away from the nuclear envelope and, as a result, nuclear blebbing is reduced (B. C. Capell et al. (2005) PNAS 102, 12879). To determine whether Remodelin leads to farnesyltransferase inhibition, Lamin A processing was examined by western blotting (
[0297] While nuclear shape improvement is not always associated with overall amelioration of HGPS cell phenotypes (M. X. Ibrahim et al. (2013) Science 340, 1330), the inventors found that Remodelin improved global HGPS-cell fitness as observed by decreased steady-state levels of H2AX and autophosphorylated ATM (markers of unrepaired DNA double-strand breaks) and decreased DNA damage signaling (
Example 5: NAT10 Inhibition Reorganizes Microtubules to Restore Nuclear Shape
[0298] NAT10 localizes mainly in the nucleolus, a nuclear compartment whose role in maintaining global nuclear organization and nuclear shape has been demonstrated by studies showing that depleting the nucleolar proteins nucleophosmin (NPM1), fibrillarin or SENPS leads to changes in nuclear shape (M. A. Amin et al. (2007) Biochem. Biophys. Res. Commun. 360, 320; A. Di Bacco et al. (2006) Mol. Cell Biol. 26, 4489; M. A. Amin et al. (2008) Biochem. J. 415, 345). In the case of NPM1, this has been established to occur through changes in microtubule stability (G. Wang et al. (2010) J. Biol. Chem. 285, 19060), which then impact on the nucleus via connections between the cytoskeleton and the nuclear envelope. Because of this and since tubulin is a known NAT10 substrate, the microtubule network of cells was examined by immunofluorescence and observed a striking reorganization upon Remodelin treatment. Moreover, by using the cell complementation system, it was established that equivalent microtubule reorganization was triggered by NAT10 depletion or by mutational inactivation of the NAT10 catalytic domain (
[0299] To gain insight into how NAT10 modifies microtubule organization, microtubule dynamics were analysed by performing regrowth assays after cold-induced depolymerization and release into warm medium. While initial microtubule regrowth (the nucleation phase) appeared normal after NAT10 inhibition in siLMNA cells (
Example 6: Analysis of Structure Requirements for Nuclear Shape Rescue
[0300] Lamin A/C was depleted by siRNA in U2OS cells (siLMNA) to induce misshapen nuclei. Cells were then treated for 16 h with various analogues of Compound 2 and nuclear shape rescue was analysed by DAPI staining. The results are shown in
Example 7: Compound 2 Inhibits the Growth of A431 Melanoma Cell Line in a Dose-Dependent Manner
[0301] A431 cells expressing a low level of Lamin A protein (see
Example 8: Lamin A/C Knock-Out U2OS Cells are More Sensitive to Compound 2 and Analogues than Wild Type Cells
[0302] LMNA knock out (KO) U2OS cell line was engineered using CripR/Cas9 technology. The sensitivity of LMNA KO cells to Compound 2 was compared to cells expressing wild type LMNA (LMNA WT). Cell growth was monitored automatically over time using an IncuCyte ZOOM. The results are shown in
Example 9: Compound 2 Inhibits Global Protein Translation Specifically in LMNA KO Cells
[0303] U2OS cells expressing wild type or KO LMNA were treated with Compound 2 for 24 h and incubated for 1 h with the clickable methionine analogue HPG to measure global protein translation. HPG was then clicked with an Alexa fluor 488 and global fluorescence intensity was quantified by FACS on 10 000 cells. The graphs in
Example 10: Depletion of NAT10 Leads to Similar Inhibition of Proliferation, Migration and Invasion than Treatment with Compound 2
[0304] NAT10 was depleted by siRNA in U2OS cells (siNAT10) and cells were then treated with Compound 2 for 16 h before being seeded on matrigel for migration/invasion assays. In parallel, cells from the same plates were seeded separately to assess cell proliferation. The results are shown in
Example 11: Assessment of Compound 2 In Vivo Toxicity and In Vitro Specificity
[0305] Compound 2 was administered to mice orally with the indicated daily dose, for 14 days and the results are shown in
[0306] Lower panel of
Example 12: Effect of Compound 2 Treatment on a Mouse Model of Hutchinson Gilford Progeria Syndrome
[0307] Left panel of
Example 13: Molecular Effects of Compound 2 In Vivo
[0308] Tissues from wild type mice or Lmna.sup.G609G/G609G mice treated with Compound 2 were harvested and proteins were extracted and loaded on a western blot which is shown in
Example 14: Assessment of Acetyl Tubulin as a Potential Biomarker for NAT10 Inhibition
[0309] As Tubulin is a direct substrate of NAT10, Tubulin acetylation levels in cells derived from HGPS patients (left and bottom panel of
Example 15: Engineering a Lmna.SUP.G609G/G609G./NAT10.SUP.+/ Mouse for Genetic Validation
[0310] Top left panel of
Example 16: Microarray Analysis Shows Specificity of Compound 2 Towards Gene Expression Regulation in HGPS Cells
[0311] Normal fibroblasts or HGPS fibroblasts were kept in culture for 12 population doublings with chronic treatment of 1 M Compound 2 (top panels of
[0312] In conclusion, the present inventors have identified and characterized the small molecule Remodelin as a new agent that improves nuclear shape and fitness of both progeric and Lamin A/C depleted cells. To their knowledge, Remodelin is the first molecule that also reduces the steady state level of H2AX in HGPS cells, which is believed to contribute to their premature ageing phenotype.
[0313] Importantly, by using an unbiased in vivo and in vitro click-chemistry based approach, NAT10 was identified as the cellular target of Remodelin responsible for nuclear morphology rescue, via reorganization of the microtubule network. Thus, small molecule inhibitors of NAT10 provide new opportunities to study laminopathy-associated processes with valuable spatial and temporal resolution (T. U. Mayer et al. (1999) Science 286, 971), and might in due course yield new classes of drugs for alleviating dystrophic and premature ageing diseases.
[0314] Throughout the specification and the claims which follow, unless the context requires otherwise, the word comprise, and variations such as comprises and comprising, will be understood to imply the inclusion of a stated integer, step, group of integers or group of steps but not to the exclusion of any other integer, step, group of integers or group of steps.
[0315] The application of which this description and claims forms part may be used as a basis for priority in respect of any subsequent application. The claims of such subsequent application may be directed to any feature or combination of features described herein. They may take the form of product, composition, process, or use claims and may include, by way of example and without limitation, the following claims: