A NUCLEIC ACID DELIVERY VECTOR COMPRISING A CIRCULAR SINGLE STRANDED POLYNUCLEOTIDE

Abstract

The invention relates to a delivery vector for the delivery of a single-stranded nucleic acid. Said vector is a closed circular polynucleotide comprised of at least three sections, two of which have sufficient complementarity to form a duplex, and an intervening sequence containing the single-stranded nucleic acid to be delivered. Said duplex includes a recognition sequence for a targeted nuclease such that under appropriate conditions the single-stranded nucleic acid is released.

Claims

1. A nucleic acid delivery vector comprising a circular single stranded polynucleotide said vector comprising: (a) a duplex formed from a first section and a third section of said polynucleotide, said sections including sequences which are complementary; (b) a loop formed from a second section, said section separating the first and third sections; wherein said duplex includes a recognition sequence for a targeted nuclease.

2. The nucleic acid delivery vector of claim 1 wherein said vector delivers a linear single stranded nucleic acid, wherein said single stranded nucleic acid is present within the second section.

3. The nucleic acid delivery vector of claim 2 wherein the linear single stranded nucleic acid may be any one or more of: a nucleic acid enzyme, an aptamer, a donor template, an mRNA, a functional RNA, or an antisense nucleic acid.

4. The nucleic acid delivery vector of claim 2 or 3 wherein the linear single stranded nucleic acid has a free 5′ and 3′ end once released from the delivery vector.

5. The nucleic acid delivery vector of claim 1 wherein said vector is a closed circular polynucleotide, optionally a closed DNA or closed RNA.

6. The nucleic acid delivery vector of any previous claim wherein said nuclease is a guided nuclease, optionally a nuclease associated with gene editing, preferably Cas9.

7. The nucleic acid delivery vector of any one of claims 1 to 5 wherein the nuclease binds to the recognition sequence without a guide.

8. The nucleic acid delivery vector of any previous claim wherein said vector is for use in a cell.

9. A method of providing a linear single stranded nucleic acid to a cell, comprising the use of a delivery vector as claimed in any one of claims 1 to 8.

10. A method of providing a linear single stranded donor template to a cell for genome editing, comprising the use of a delivery vector as described in any one of claims 1 to 8, preferably wherein said linear single stranded nucleic acid is a donor template.

11. A method as claimed in claim 10 wherein said nuclease is a guided nuclease, optionally Cas9 or a variant thereof.

Description

FIGURES

[0094] FIG. 1A is a depiction of an exemplary delivery vector of the present invention. Shown are the first and third sections (1 and 3) forming a duplex, with a recognition sequence for a nuclease depicted (4). The second section (2), herein representing a donor template for gene editing, can include homology arms (5a and 5b) and a target sequence (6).

[0095] FIG. 1B is a representation of the same delivery vector as FIG. 1A whereas the nuclease has cleaved at the target site, and the single stranded nucleic acid is released (10). It can be seen here that fragments of the first and third sections (7a and 7b) remain in the single stranded nucleic acid. These may or may not be present, depending on the nature of the nuclease and the way in which the duplex is designed.

[0096] FIG. 2 is a representation of the recruitment of a nuclease, such as Cas9 (12), to the duplex (4) using a guide sequence (gRNA in this case—11). Shown are the two cleavage sites (13a and 13b), one for each strand of the duplex.

[0097] FIG. 3 is a simplified representation of gene editing using the single stranded nucleic acid released from the delivery vector of the invention, labelled as FIG. 1A. Gene editing in this instance is via HDR. The homology arms (5a and 5b) play an important role in aligning the insert (6) for inclusion into the genome (20) which has already had a DSB introduced. The genome with the inserted sequence is also shown (21).

[0098] FIG. 4 shows a photograph of a gel prepared according to Example 1; split into three sections. Gel electrophoresis is the standard lab procedure for separating nucleic acids by size (e.g., length in base pairs) for visualization and purification. Electrophoresis uses an electrical field to move the negatively charged nucleic acids through an agarose gel matrix toward a positive electrode. Shorter DNA fragments migrate through the gel more quickly than longer ones. Thus, you can determine the approximate length of a DNA fragment by running it on an agarose gel alongside a DNA ladder (a collection of DNA fragments of known lengths). However, circular nucleic acids run differently in a gel. In section 1 the preparation of the delivery vector of the invention is applied to the gel. The delivery vector is highlighted with an arrow. The other nucleic acids present in the preparation are raw materials or side products. Section 2 includes a marker ladder (M) and depicts the application of the preparation applied in Section 1 when treated with an exonuclease—the delivery vector is immune since there are no free ends, but other fragments are degraded. The delivery vector here was designed to include a duplex to which a guide RNA would recruit Cas9. Section 3 includes a marker ladder (M).

[0099] The lane marked 3 relates to the preparation once the guide RNA and Cas9 has been introduced. The arrow here indicates the single stranded nucleic acid has been released by the action of Cas9, and thus the circular structure has been opened.

[0100] FIG. 5 is a delivery vector map showing the oligonucleotide for the vector created and used in Example 2. Shown are the sequences for the GFP gRNA and PAM, GFP to BFP single stranded oligonucleotide and the various restriction sites. The oligonucleotide is 254 base pairs in length. It can be seen that the gRNA and PAM sequences are present in the sense and antisense arrangements to allow loopback and annealing. The hairpin sequence is also shown.

[0101] FIG. 6 is the data generated from Example 2. HEK293T-EGFP cells expressing Cas9 are losing EGFP. Histograms showing GFP signal as percentage of maximum counted events as measured by flow cytometry in cells transfected with either high (450 ng) or low (45 ng) BFP delivery vector (“mbDNA”) at indicated time-points post-transfection. Dotted line indicates threshold for GFP-positive signal. Percentage of GFP-negative events in each sample are quoted. These are plots of GFP expression versus percentage of maximum count. Three sets of data are presented, the first column being the data for High BFP delivery vector (mbDNA), the middle column for low BFP delivery vector (mbDNA) and the last column for no Cas9. Results are shown for 2, 3, 5, 6 and 10 days post transfection.

[0102] FIG. 7 is the data generated from Example 2. The delivery vector (mbDNA) causes Cas9-mediated EGFP to BFP conversion in HEK293T-EGFP cells. Mean blue fluorescence of lysed cells is measured at indicated time-points post-transfection, and are plotted as raw intensities (Non-normalised) or relative to the no mbDNA control (Normalised). Data for two biological replicates are shown. Results are shown for 2, 3, 5, and 6 days post transfection).

[0103] The invention will now be demonstrated in the following examples, which are not limiting of the scope of the invention:

EXAMPLES

Example 1

[0104] Demonstration of Processability by Cas9

[0105] An example of the delivery vector of the invention was designed to include a duplex to which a guide RNA would recruit Cas9. The vector was produced in house as ssDNA, and ligated to seal it into the conformation depicted in FIG. 1A. A sample (sample 1) was taken. The vector was then incubated with 10 units of T5 exonuclease (NEB) at 37° C. for 3 hours. Another sample (sample 2) was taken.

[0106] A guide RNA was designed to target the duplex region of the vector and ordered, along with purified Cas9 protein, from GenScript. The sgRNA was annealed: 19.5 μl H.sub.2O, 3 μl Cas9 reaction buffer @10×, 7.5 μl sgRNA @100 μM was combined and heated to 75° C. then left to cool to room temperature. Ribonucleoprotein was then prepared according to GenScript's direction; 0.3 μl annealed sgRNA, 0.5 μl Cas9 protein, 4 μl Cas9 reaction buffer @10×, 27.2 μl H.sub.2O were combined and incubated at 37° C. for 10 minutes.

[0107] 900 ng of the vector DNA was then added, the volume brought to 40 μl with H.sub.2O, and the reaction incubated at 37° C. for 3 hours. A final sample was taken (sample 3).

[0108] Samples 1, 2 and 3 were loaded on a 0.8% agarose TBE gel (FIG. 4: Section1: Sample 1, Section 2: Sample 2 and Section 3: Sample 3) stained with SafeView. A marker, GeneRuler 1 kb+ DNA ladder (ThermoFisher) was also loaded and the gel run to resolve the bands.

[0109] Sample 1 showed bands consistent with closed vector (indicated by the arrow on FIG. 4, section 1, and side products (unclosed vector; smaller products of the construction reaction). Sample 2 showed a strong band for the closed vector, indicating its resistance to the exonuclease, while the open vector and side product bands were reduced to a smear at the bottom of the gel. Sample 3 showed the band of the vector being successfully cleaved by Cas9—the open linear portion can now run faster and further on the gel compared to when constrained in the uncut circular form (shown with an arrow on FIG. 4, section 3).

[0110] Sequences:

[0111] In the delivery vector, the target site for the nuclease and the PAM sequence in the duplex is:

TABLE-US-00001 (SEQ ID No. 1) GTCACCAATCCTGTCCCTAGTGG

[0112] The sgRNA guide sequence is:

TABLE-US-00002 (SEQ ID No. 2) gucaccaauccugucccuagGUUUUAGAGCUAGAAAUAGCAAGUUAAAAU AAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU 

Example 2

[0113] Nucleic Acid Vector Preparation

[0114] Sequences:

[0115] In the delivery vector, the target site for the nuclease and the PAM sequence in the duplex is:

TABLE-US-00003 (SEQ ID No. 3) GCTGAAGCACTGCACGCCGTAGG

[0116] In the delivery vector, the sequence for the HDR template (with edited bases in lowercase and underlined) is:

TABLE-US-00004 (SEQ ID NO. 4) ACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCAC CCTCGTGACCACCCTGAgCcACGGgGTGCAGTGCTTCAGCCGCTACCCCG ACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCC

[0117] The sequence of EGFP on the genome (with bases to be edited in lowercase and underlined) is:

TABLE-US-00005 (SEQ ID NO. 5) ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGT CGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGG GCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACC ACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGAcCtA CGGcGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACT TCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTC TTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGG CGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGG ACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAAC GTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAA GATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACC AGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCAC TACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGA TCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCA TGGACGAGCTGTACAAGTAG

[0118] The sgRNA guide sequence is:

TABLE-US-00006 (SEQ ID No. 6) gcugaagcacugcacgccguGUUUUAGAGCUAGAAAUAGCAAGUUAAAAU AAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC 
SEQ ID No. 7 is the sequence of the Cas9/sgRNA plasmid (not shown here).

[0119] The delivery vector as depicted in FIG. 5 with a stem designed to target EGFP (EGFP is green fluorescent protein, derived from Aequorea victoria) and edit it to BFP (blue fluorescent protein) (“BFP mbDNA”) and a control vector oligonucleotide lacking the target sequence were ordered from Biolegio (Nijmegen, the Netherlands). The oligonucleotides were allowed to loopback and anneal to form a ‘lasso’-like structure in the following reaction: [0120] 8 μl oligo (100 μM) (7.5 μg/μl) [0121] 9μl ddH.sub.2O [0122] Incubated for 10 minutes at 98° C., and then cooled at a rate of 0.06° C. per second to 16° C.

[0123] The annealed oligonucleotide was ligated to seal the nick in the vector backbone: [0124] 17 μl annealed vector [0125] 2 μl N buffer (10×) [0126] 300 mM Tris pH 8.9 [0127] 300 mM (NH.sub.4).sub.2SO.sub.4 [0128] 5 mM MgSO.sub.4 [0129] 2 μl ATP (10 mM) (NEB, Ipswich, US) [0130] 1 μl T4 DNA ligase (400,000 U/ml) (NEB, Ipswich, US) [0131] Incubated for 7 hours at 16° C.

[0132] To remove any non-ligated single-stranded DNA, the reactions were subjected to digestion with T5 exonuclease: [0133] 20 μl ligated vector [0134] 2 μl N buffer (10×—as above) [0135] 2 μl T5 exonuclease (10,000 U/ml) (NEB, Ipswich, US) [0136] 16 μl ddH.sub.2O [0137] Incubated for 12 hours at 37° C.

[0138] Annealed, ligated and T5-digested vectors were column purified using a PCR purification kit (Macherey-Nagel, Dueren, Germany).

[0139] Demonstrating Cas9 Gene Editing Ability

[0140] A HEK293T cell line stably expressing a single copy of EGFP (HEK293T-EGFP) was acquired (kind gift from Astrid Glaser). Conversion of EGFP to a blue fluorescent variant (BFP) by way of Cas9-mediated gene editing has previously been demonstrated in this cell line using single stranded oligo DNA nucleotides (ssODN) as the template (Glaser et al, Molecular Therapy, Nucleic Acids, 5(7), e334, incorporated here by reference).

[0141] DNA was delivered into either HEK293T or HEK293T-EGFP cells seeded in 6-well plates and grown in 1.5 ml complete medium (DMEM+10% FBS+2 mM glutamine) via chemical transfection using PElpro (Polyplus-Transfection®) following the manufacturer's instructions. 1.13 μg of total DNA and 3.39 μl of PElpro per transfection in a total volume of 200 μl serum-free DMEM (4.5 g/I glucose) were used. 100 ng of TIVA-pUC EF1α-Scarlet-I plasmid DNA per reaction was used to monitor transfection efficiency. In Cas9 reactions, 250 ng of Cas9+sgRNA plasmid was added. Either 450 ng (high) or 45 ng (low) of BFP or control mbDNA were used (as indicated in figures). The reactions were brought up to 1.13 μg of DNA using a blank plasmid. All transfections were performed in duplicate.

[0142] Cells were grown for indicated time periods before they were harvested via trypsinisation. Transfection efficiency (% red fluorescence) and loss of GFP intensity over time was monitored on a CytoFLEX flow cytometer (Beckman Coulter, High Wycombe, UK). Cells were lysed with RIPA buffer to release their protein contents. Relative blue fluorescence intensity of lysed cells (protein) across samples was measured using a Spark® microplate reader (Tecan, Männedorf, Switzerland) with excitation at 360 nm and emission at 465 nm.

[0143] Results:

[0144] HEK293T-EGFP cells transfected with Cas9+sgRNA plasmid and BFP mbDNA (delivery vector) showed a gradual reduction of EGFP over the course of 6 days following transfection. On day 6, between 35% and 50% of cells had stopped expressing EGFP (FIG. 6) demonstrating the gene targeting ability of Cas9 in our system. Cells transfected with a high amount (450 ng) of BFP delivery vector lost EGFP at a slower rate compared to cells with a low amount (45 ng) of BFP delivery vector. This reduced rate of gene editing can be explained by the slightly reduced efficiency of the high mbDNA transfections (approximately 70% of cells with high BFP/control vector showed Scarlet-I expression 48 h post-transfection, compared to approximately 80% for low/no vector). No further loss of EGFP was evident past day 6, as shown by data from day 10 post-transfection (HEK293T-EGFP cells expressing Cas9 are losing EGFP). Histograms showing GFP signal as percentage of maximum counted events as measured by flow cytometry in cells transfected with either high (450 ng) or low (45 ng) BFP delivery vector at indicated timepoints post-transfection. Dotted line indicates threshold for GFP-positive signal.

[0145] Percentage of GFP-negative events in each sample are quoted (FIG. 6), suggesting that no Cas9 activity is detectable beyond day 6. In contrast, cells not expressing Cas9 exhibited no reduction in EGFP, validating that EGFP loss is Cas9-mediated.

[0146] As used “mbDNA” is the vector, and it is indicated whether this is includes the delivery of BFP or is the control (no BFP).

[0147] Successful homology-directed recombination (HDR) gene editing events were identified by measuring blue fluorescence protein (BFP) intensity in lysates from cells on days 2-6 following introduction of BFP delivery vector and control vector. As soon as day 2 post-transfection, cells with BFP, but not control vector, showed a 1.3-fold increase in BFP signal relative to the no vector control (FIG. 7). On day 5, BFP intensity from cells with high BFP vector was 2-fold higher compared to control and by day 6, the same relative levels of BFP were detectable in both cells with low and high BFP vector (FIG. 7). Importantly, increased BFP signal cannot be explained by interference from the EGFP signal, as cells without Cas9 (No Cas9)—and therefore expressing more functional EGFP—have a lower BFP signal compared to Cas9-transfected cells (FIG. 7).

[0148] Altogether, our data demonstrates that BFP delivery vector according to the present invention is cleavable by Cas9 in vivo and can release a viable transgene that can be used as an HDR template in Cas9-mediated gene editing.