METHOD FOR DETERMINING THE RISK OF OCCURRENCE OF A HEALTHCARE-ASSOCIATED INFECTION IN A PATIENT

Abstract

An in vitro or ex vivo method for determining the risk of occurrence of a healthcare-associated infection in a patient, including a step of measuring the expression of CX3CR1, in a biological sample of said patient.

Claims

1. An in vitro or ex vivo method for determining the risk of occurrence of a healthcare-associated infection in a patient, comprising a step of measuring the expression of CX3CR1, in a biological sample from said patient.

2. The method according to claim 1, wherein the patient is a patient within a healthcare facility and the method allows determining the risk of occurrence of a nosocomial infection in said patient.

3. The method according to claim 1, wherein the patient is a patient within a hospital.

4. The method according to claim 1, wherein it allows determining the risk of occurrence of a healthcare-associated infection in the patient within 15 days from the immuno-inflammatory attack and/or within 7 days following the day when the biological sample collection has been performed.

5. The method according to claim 1, wherein the biological sample is a blood sample.

6. The method according to claim 1, wherein the biological sample is a whole blood sample.

7. The method according to claim 1, wherein it further comprises a step of measuring, in the biological sample of the patient, the expression of another gene, selected from the list consisting of: ADGRE3, BTLA, CD3D, CD74, CD274, CTLA4, HP, ICOS, IFNG, IL1RN, IL6, IL7R, IL10, IL15, MDC1, PDCD1, S100A9, TDRD9 and ZAP70.

8. The method according to claim 1, wherein the expression is measured at the mRNA or protein level.

9. The method according to claim 1, wherein the expression is measured at the mRNA level.

10. The method according to claim 1, wherein the expression is measured by RT-PCR.

11. The method according to claim 1, wherein the expression is measured by sequencing.

12. The method according to claim 1, wherein the expression is measured by hybridization.

13. The method according to claim 9, wherein the expression is normalized with respect to the expression of one or several housekeeping genes.

14. A kit comprising means for amplifying and/or means for detecting the expression of CX3CR1 and of another gene, selected from the list consisting of ADGRE3, BTLA, CD3D, CD74, CD274, CTLA4, HP, IFNG, IL1RN, IL6, IL7R, IL10, MDC1, PDCD1, S100A9, TDRD9 and ZAP70; wherein all of the amplification and/or detection means of said kit allow the detection and/or amplification of at most 100 biomarkers in total.

15. (canceled)

Description

EXAMPLE 1: THE MEASUREMENT OF THE EXPRESSION OF CX3CR1 ALLOWS PREDICTING THE RISK OF OCCURRENCE OF A HEALTHCARE-ASSOCIATED INFECTION IN A PATIENT

[0037] Materials and Methods

[0038] A prospective, longitudinal and monocentric observational clinical study has been carried out at the Edouard Herriot Hospital (Lyon, France). The design of this clinical study has been published in Rol et al. (2017), BMJ Open 7(6): e015734. The clinical study was approved by the National Agency for the Safety of Medicines and Health Products (ANSM) in November 2015 and the South-East II Personal Protection Committee in December 2015. Amendments to the protocol were made in July 2016, then in January 2017. In brief, a total of 377 patients, in a septic state (n=35) or in septic shock (n=72), suffering from severe burns (n=24), severe trauma (n=137) or hospitalized in a resuscitation unit or intensive care unit after major surgery (n=109), and 175 healthy volunteers have been included between December 2015 and March 2018. [0039] Patients in septic state/in septic shock: according to the first clinical protocol, only patients in septic shock have been included, on the basis of a suspicion of an infectious focus, a start of treatment with catecholamines within 48 hours following admission to the resuscitation unit and of treatment with catecholamines (noradrenaline)>0.25 μg/kg/min for at least 2 hours. Then, the eligibility criteria were modified in August 2016, following the publication of a new definition of septic shock, Sepsis 3 (Singer et al. (2016), JAMA 315(8):801-810). The patients in septic shock have therefore been included on the basis of a suspicion of an infectious focus, a start of treatment with catecholamines within 48 hours following admission to resuscitation unit and of vasopressor therapy necessary to maintain blood pressure 65 mm Hg and lactate concentration >2 mmol/L (18 mg/dL), despite the correction of hypovolaemia. In 2017, the possibility was added to include patients in a sepsis state (according to the Sepsis 3 definition), namely the suspicion of an infectious focus and the increase in the SOFA score 2 points compared to the basic SOFA within 48 hours following admission to the resuscitation unit. For this population, day 1 corresponds to the day of diagnosis of sepsis or septic shock; [0040] Severe trauma: in the first protocol, only patients with severe trauma have been included (Injury Severity Score (ISS) 25). In August 2016, the possibility was added to also include less severe injuries (16<ISS<24). For this population, day 1 corresponds to the day of admission to the resuscitation unit or intensive care unit (trauma day); [0041] Major surgery: in the first protocol, only esogastrectomy, Bricker-type bladder resection, cephalic pancreaticoduodenectomy and surgery of the abdominal aorta by laparotomy have been considered. Other types of surgery with a high risk of complication were added in January 2017: (total or caudal) pancreatectomy, neuroendocrine tumors, hepatectomy (on the right side), extended colectomy (laparotomy), abdoperineal resection, nephrectomy (laparotomy, PKD), ilio-femoral bypass (Scarpa). For this population, day 1 corresponds to the day of surgery; [0042] Severe burns: the patients have been selected on the basis of a total surface area of burns greater than 30%. For this population, day 1 corresponds to the day of admission to the resuscitation unit or intensive care unit (˜day of the burn).

[0043] The exclusion criteria have mainly related to factors that could have impacted the immune status and biased the results (for example: severe neutropenia, corticosteroid treatments, onco-haematological pathology, etc.). Each event leading to a suspected healthcare-associated infection occurring in the hospital before day 30 has been independently reviewed by three physicians not involved in the recruitment of the patients. Twenty-six percent of the patients have developed at least one healthcare-associated infection before day 30 or before leaving the hospital.

[0044] Blood samples have been collected in PAXgene® tubes (ref. 762165, PreAnalytiX GmbH Hombrechtikon Switzerland), once for the healthy volunteers, and several times for the patients, i.e. 3-4 times the first week (on days 1 or 2: D1/2, on days 3 or 4: D3/4 and on days 5, 6 or 7: D5/7), then 3 times later on (around D14, D28 and D60).

[0045] The expression level of CX3CR1 has been measured in these samples by RT-qPCR. RNA has been extracted from whole blood samples using the Maxwell HT Simply RNA kit (ref. AX2420, Promega) and the EVO automated platform (TECAN), following the kit supplier's instructions. Then, 10 ng of total RNA has been reverse-transcribed into complementary DNA (cDNA), using the Fluidigm Reverse transcription master mix (ref. PN100-6472 A1, Fluidigm), following the supplier's instructions. The expression of CX3CR1 has then been quantified by qPCR, using Fluidigm's Biomark HD real-time PCR system.

[0046] First, a cDNA-preamplification step has been performed according to the supplier's recommendations using the PreAmp master mix (Ref. PN100-5876 B1, Fluidigm). Then, a 1/5 dilution of the preamplified cDNAs has been made and the qPCRs have been performed on fluidics integrated circuits 192.24 (Ref. PN100-6170 C1), as recommended by the supplier. The references of the probes and primers used for the qPCR are presented in Table 2.

[0047] The threshold cycles (or Ct) have then been determined. The normalization of the expression of CX3CR1 in CNRQ (Calibrated Normalized Relative Quantity) has been carried out using the geometric mean of the Ct of 3 housekeeping genes (DECR1, HPRT1, PPIB) and a calibrator (corresponding to a mixture of treated samples ex vivo by LPS (immune system stimulating agent) (50%) and untreated samples ex vivo (50%), from healthy volunteers/individuals) in each fluidics integrated circuit 192.24, as described in Hellemans et al. (2007), Genome biology 8(2):R19.

TABLE-US-00002 TABLE 2 Probes and primers used for qPCR Biomarker Reference of the supplier of (gene) Type the used probes and primers CX3CR1 Gene of interest Hs04971470_s1 (ThermoFisher) DECR1 Gene of interest Hs00154728_m1 (ThermoFisher) HPRT1 Gene of interest Hs99999909_m1 (ThermoFisher) PPIB Gene of interest Hs01018503_m1 (ThermoFisher)

[0048] Regarding the data analysis, the associations between the expression of CX3CR1, measured at different time points during the first week, and the occurrence of a healthcare-associated infection before day 30 from inclusion in the study have been assessed. The results have been calculated in the form of Hazard Ratios expressed as inter-quartile distance with the associated 95% confidence interval (HR IQR). Then, univariate logistic regressions have been implemented to predict the risk of occurrence of a healthcare-associated infection before day 15. The power of the values predicted by the logistic regression to discriminate between healthcare-associated infection and absence of a healthcare-associated infection has been quantified by the area under the curve (AUC) of the ROC (Receiver Operating Characteristic) curve, and 95% confidence intervals have been estimated.

[0049] Then, the association between the expression of CX3CR1 and the occurrence of a healthcare-associated infection has been assessed for different time intervals from the occurrence of the infection (i.e. time period between the sample collection and the 1st occurrence of the infection). The considered different time periods have been: a healthcare-associated infection within 4 days and within 7 days after the sample collection, regardless of when the sample has been collected. For each patient who has developed a healthcare-associated infection, the considered sample corresponds to the closest sample collection before the occurrence of the first episode of a healthcare-associated infection.

[0050] For the patients who have not developed a healthcare-associated infection (i.e. control patients), a matching method has been used to select, for each case, a control patient with the same sample collection day, and close SOFA and Charlson scores. Finally, a unique control has been selected for each unique case. Univariate logistic regressions have been implemented. The power of the values predicted by logistic regression to discriminate between healthcare-associated infection and absence of a healthcare-associated infection has been quantified by the area under the curve (AUC) of the ROC curve, and 95% confidence intervals have been estimated.

[0051] Results

[0052] A decrease in the expression of CX3CR1 at the mRNA level, measured at D3/4 or D5/7 from the inclusion in the cohort, is associated with a higher risk of occurrence of a healthcare-associated infection before D30 (D3/4: HR IQR=0.54 [0.39-0.74], p=0.0001; D5/7: HR IQR=0.57 [0.42-0.79], p=0.0006) in the overall population of the patients. This association has always been significant, for the two measurement times of the expression of CX3CR1, after adjustment with the SOFA and Charlson scores (D3/4: HR IQR=0.61 [0.44-0.85], p=0.003; D5/7: HR IQR=0.65 [0.46-0.91], p=0.01).

[0053] Moreover, the prediction models have shown that the expression of CX3CR1 at the mRNA level, measured on D3/4 or on D5/7 from the inclusion in the cohort, have allowed the occurrence of a healthcare-associated infection before day 15 from the inclusion in the cohort (Table 3).

TABLE-US-00003 TABLE 3 Performance (AUC and 95% confidence interval, CI) of the measurement of the expression of CX3CR1, measured on D 3/4 or on D 5/7 from the inclusion in the cohort, for the prediction of occurrence of a healthcare-associated infection before day 15 from the inclusion in the cohort. Day of the collection of the sample AUC (CI) D 3/4 0.677 (0.571-0.783) D 5/7 0.758 (0.655-0.86)

[0054] The prediction models have also shown that the expression of CX3CR1 at the mRNA level, measured on D3/4 or on D5/7, has allowed predicting the occurrence of a healthcare-associated infection within 4 days or within 7 days following the collection of the sample (Table 4).

TABLE-US-00004 TABLE 4 Performance (AUC and 95% confidence interval, CI) of the measurement of the expression of CX3CR1, for the prediction of the occurrence of a healthcare-associated infection within 4 days or within 7 days following the sample collection. Time interval between the collection of the sample and the possible occurrence of the first healthcare- associated infection AUC (CI) 4 days 0.642 (0.542-0.742) 7 days 0.657 (0.567-0.746)

[0055] Thus, the obtained results show that the measurement of the expression of CX3CR1 alone allows predicting the occurrence of healthcare-associated infection(s) within 15 days from the immuno-inflammatory attack, within 4 days following the collection of the sample or within 7 days of the collection of the sample.

EXAMPLE 2: THE MEASUREMENT OF THE EXPRESSION OF CX3CR1 AND OF ANOTHER GENE ALLOWS IMPROVING THE PREDICTIVE PERFORMANCE OF THE RISK OF OCCURRENCE OF A HEALTHCARE-ASSOCIATED INFECTION

[0056] Materials and Methods

[0057] The Materials and Methods are identical to those of Example 1, except that 1) the cDNA preamplification step has been carried out with another PreAmp master mix reference (Ref. PN100-5875 C1, Fluidigm) for certain genes (BTLA and IL15, as well as the reference genes which have been measured with the 2 references) and followed by an additional step of treatment with exonuclease I (ref. PN100-5875 C1, Fluidigm), and that in addition for these genes, the amplification step has been carried out with another type of fluidics integrated circuits 192.24 (Ref. PN100-7222 C1), as recommended by the supplier, and 2) that herein, multivariate logistic regressions (combination of the measurement of the expression of CX3CR1 and of another gene, selected from the list consisting of: BTLA, CD3D, CD74, CD274, CTLA4, HP, ICOS, IFNG, IL1 RN, IL7R, IL10, IL15, PDCD1 and S100A9) have been performed.

[0058] Thus, the expression of the genes of interest (with the exception of BTLA and IL15) has been measured in TaqMan chemistry, with a normalization using the expression of the reference genes also measured in TaqMan chemistry (ThermoFisher reference, including two primers and a probe). The expression of the BTLA and IL15 genes has been measured using SYBR Green chemistry, with normalization using the expression of the reference genes also measured using SYBR Green chemistry (Integrated DNA Technologies reference, including two primers). In addition to the probes and primers already presented in Table 2 (for CX3CR1 and the reference genes in TaqMan chemistry), the additional probes and primers used in this example are presented in Table 5 (for the other genes of interest and the reference genes in SYBR Green chemistry).

TABLE-US-00005 TABLE 5 Additional probes and primers used for qPCR Supplier's reference or sequences Biomarker corresponding to the used probes (gene) Type and primers BTLA Gene of interest Hs.PT.58.14525368 (Integrated DNA Technologies) CD3D Gene of interest Hs00174158_m1 (ThermoFisher) CD74 Gene of interest Hs00959493_g1 (ThermoFisher) CD274 Gene of interest Hs01125301_m1 (ThermoFisher) CTLA4 Gene of interest Hs00175480_m1 (ThermoFisher) HP Gene of interest Hs00605928_g1 (ThermoFisher) ICOS Gene of interest Hs04261471_m1 (ThermoFisher) IFNG Gene of interest Hs00174143_m1 (ThermoFisher) IL1RN Gene of interest Hs00893626_m1 (ThermoFisher) IL7R Gene of interest primer (forward) : CTCTGTCGCTCTGTTGGTC primer (reverse) : TCCAGAGTCTTCTTATGATCG Probe: CTATCGTATGGCCCAGTCTCC IL10 Gene of interest Hs00961620_g1 (ThermoFisher) Gene of interest Hs.PT.58.21299580 (Integrated DNA IL15 Technologies) PDCD1 Gene of interest Hs01550088_m1 (ThermoFisher) S100A9 Gene of interest Hs00610058_m1 (ThermoFisher) DECR1 Gene of interest Hs.PT.58.19871222 (Integrated DNA Technologies) HPRT1 Gene of interest Hs.PT.58v.45621572 (Integrated DNA Technologies) PPIB Gene of interest Hs.PT.58v.45621572 (Integrated DNA Technologies)

[0059] Results

[0060] The measurement of the expression of one of these other genes of interest, in addition to the measurement of the expression of CX3CR1, allows improving the predictive performance of the risk of occurrence of a healthcare-associated infection, whether before day 15 from the inclusion in the cohort (Table 6) or within 4 days or within 7 days following the collection of the sample (Table 7).

TABLE-US-00006 TABLE 6 Performance (AUC and 95% confidence interval, CI) of the measurement of the expression of CX3CR1, in combination with another biomarker (multivariate analysis), measured on D 3/4 or on D 5/7 from the inclusion in the cohort, for the prediction of the occurrence of a healthcare-associated infection before day 15 from the inclusion in the cohort. Day of collection of the sample Biomarkers AUC (CI) D 3/4 CX3CR1 + BTLA 0.681 (0.576-0.785) D 3/4 CX3CR1 + ICOS 0.681 (0.578-0.784) D 3/4 CX3CR1 + IFNG 0.683 (0.58-0.787) D 3/4 CX3CR1 + IL15 0.684 (0.582-0.785) D 3/4 CX3CR1 + PDCD1 0.693 (0.587-0.799) D 3/4 CX3CR1 + HP 0.693 (0.589-0.797) D 3/4 CX3CR1 + CD74 0.694 (0.591-0.797) D 3/4 CX3CR1 + IL10 0.725 (0.625-0.825) D 3/4 CX3CR1 + S100A9 0.729 (0.615-0.844) D 5/7 CX3CR1 + IFNG 0.759 (0.655-0.862) D 5/7 CX3CR1 + CD274 0.761 (0.66-0.863) D 5/7 CX3CR1 + PDCD1 0.763 (0.667-0.86) D 5/7 CX3CR1 + CTLA4 0.778 (0.674-0.883) D 5/7 CX3CR1 + HP 0.784 (0.69-0.878) D 5/7 CX3CR1 + CD74 0.8 (0.708-0.892) D 5/7 CX3CR1 + ICOS 0.802 (0.707-0.897) D 5/7 CX3CR1 + CD3D 0.802 (0.708-0.896) D 5/7 CX3CR1 + BTLA 0.803 (0.701-0.905) D 5/7 CX3CR1 + S100A9 0.803 (0.702-0.904) D 5/7 CX3CR1 + IL7R 0.803 (0.718-0.888) D 5/7 CX3CR1 + IL1RN 0.819 (0.726-0.911) D 5/7 CX3CR1 + IL10 0.852 (0.775-0.928)

TABLE-US-00007 TABLE 7 Performance (AUC and 95% confidence interval, CI) of the measurement of the expression of CX3CR1, in combination with another biomarker (multivariate analysis), for the prediction of the occurrence of a healthcare-associated infection within 4 days or within 7 days following the sample collection. Time interval between the collection of the sample and the possible occurrence of the first healthcare- associated infection Biomarkers AUC (CI) 4 days CX3CR1 + CD3D 0.648 (0.549-0.747) 4 days CX3CR1 + IL15 0.653 (0.545-0.761) 4 days CX3CR1 + ICOS 0.654 (0.555-0.752) 4 days CX3CR1 + S100A9 0.661 (0.563-0.759) 4 days CX3CR1 + CD74 0.663 (0.566-0.761) 4 days CX3CR1 + IFNG 0.671 (0.572-0.771) 4 days CX3CR1 + BTLA 0.679 (0.582-0.776) 4 days CX3CR1 + HP 0.704 (0.61-0.798) 7 days CX3CR1 + CD274 0.664 (0.573-0.754) 7 days CX3CR1 + CD3D 0.667 (0.579-0.756) 7 days CX3CR1 + IL15 0.668 (0.573-0.762) 7 days CX3CR1 + IL10 0.668 (0.576-0.76) 7 days CX3CR1 + IL7R 0.668 (0.579-0.756) 7 days CX3CR1 + IL1RN 0.671 (0.581-0.762) 7 days CX3CR1 + CTLA4 0.671 (0.582-0.759) 7 days CX3CR1 + IFNG 0.676 (0.586-0.765) 7 days CX3CR1 + ICOS 0.686 (0.599-0.773) 7 days CX3CR1 + BTLA 0.692 (0.605-0.779) 7 days CX3CR1 + CD74 0.694 (0.608-0.78) 7 days CX3CR1 + S100A9 0.699 (0.614-0.785) 7 days CX3CR1 + HP 0.707 (0.622-0.792)