Reverse genetics of negative-strand RNA viruses in yeast

09682136 · 2017-06-20

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to a methodology for the generation of infectious ribonucleoparticles (RNPs) of negative-strand RNA viruses, and in particular of non-segmented negative-strand RNA viruses in yeast, especially in budding yeast. Accordingly, the patent application relates to a recombinant yeast strain suitable for the rescue of infectious non-segmented negative-strand RNA virus particles or infectious virus-like particles. The invention also relates to the use of the recombinant yeast to prepare vaccine seed and to the use of the produced RNPs or RNPs-like to prepare vaccine formulations. It also concerns the use of the recombinant yeast for the screening of libraries of DNA.

Claims

1. A recombinant yeast strain which expresses infectious non-segmented negative-strand RNA virus Ribonucleocapsids (RNPs) or infectious RNPs-like, wherein the yeast is transformed with the following expression vectors: (i) a first plasmid genome vector comprising, as an insert operatively linked with expression control sequences functional in yeast, a cloned DNA molecule which comprises a cDNA encoding the (+) strand full-length sequence (antigenome) of said non-segmented negative-strand RNA virus and wherein said cDNA is flanked, in the cloned DNA molecule, by autocatalytic ribozyme sequences enabling the recovery of mRNA transcripts and of antigenomic RNAs of said non-segmented negative strand or derivatives thereof; (ii) a second plasmid genome vector comprising, as an insert under the control of regulatory expression sequences functional in yeast, a cloned DNA molecule which comprises a cDNA encoding part of the antigenome of said non-segmented negative-strand RNA virus including in the 5 to 3 orientation, a viral Terminator sequence, a polynucleotide which codes a selectable marker cloned in sense orientation with respect to the cis-acting sequences of said virus and the Leader sequence of said virus; and (iii) one or more trans-complementation plasmid vectors comprising, under the control of regulation expression sequences functional in yeast, nucleotide sequences which enable said vector(s) to collectively express the proteins necessary for the synthesis of the viral transcriptase complex of said non-segmented negative-strand RNA virus, and enable assembly of the ribonucleocapsid (RNPs) of said non-segmented negative-strand virus or assembly of RNPs-like comprising recombinant RNA derived from viral RNA of a non-segmented negative-strand RNA virus, wherein the RNPs or RNPs-like are functional for the replication and transcription, each of said vector(s) further comprises, under the control of regulatory expression sequences functional in yeast, a selectable marker, wherein in said vectors all the selectable markers are different from each other, and wherein the vector encoding the viral L polymerase of said non-segmented negative-strand RNA virus is a priming plasmid harboring an auxotrophy marker gene.

2. The recombinant yeast strain according to claim 1, wherein the non-segmented negative-strand RNA virus is selected from the group consisting of: Rhabdoviridae, Paramyxoviridae, Filovihdae, and Bomaviridae.

3. The recombinant yeast strain according to claim 2, wherein the non-segmented negative-strand RNA virus is selected from the group consisting of: Measles virus, RSV, HPIV2, and HPIV3.

4. The recombinant yeast strain according to claim 1; wherein the non-segmented negative-strand RNA virus is a measles virus (MV); wherein the one or more trans-complementation plasmid vectors are capable of expressing the nucleoprotein (N), the Phosphoprotein (P) and the Polymerase (L) or derivatives thereof as functional ribonucleoproteins (RNPs) comprising the transcriptase complex; and wherein the first or second plasmid genome vector comprises a cloned molecule which comprises a cDNA encoding the full-length (+) strand antigenome of said measles virus and wherein said cDNA is framed by autocatalytic ribozyme sequences.

5. The recombinant yeast strain according to claim 1; wherein the non-segmented negative-strand RNA virus is a measles virus; and wherein the one or more trans-complementation plasmid vectors and the first and second plasmid genome vectors are further characterized as follows: (a) the one or more trans-complementation plasmid vectors are capable of collectively expressing the nucleoprotein (N), the Phosphoprotein (P) and the Polymerase (L) or functional derivatives thereof which enable assembly of functional ribonucleoproteins (RNPs) or RNPs-like comprising the transcriptase complex; and (b) the first or second plasmid genome vectors comprises, in an insert, a cloned DNA molecule which comprises a cDNA encoding a fragment of the (+)strand (antigenome) of said virus, including the cis-acting Leader and Trailer sequences, and furthermore one or more coding sequences, or ORF(s), heterologous to said virus, the expression of which is sought.

6. The recombinant yeast strain according to claim 4, wherein the nucleoprotein (N), the phosphoprotein (P) and the polymerase (L) are expressed by several plasmid expression vectors, said expression vectors comprising cloned polynucleotides consisting of viral coding sequences for one of the N, P or L proteins, under the control of a promoter suitable for expression in yeast.

7. The recombinant yeast strain according to claim 4, wherein the nucleoprotein (N), and the phosphoprotein (P) are expressed by a single expression vector, and the polymerase (L) is expressed by another expression vector said expression vectors comprising cloned polynucleotides consisting of viral coding sequences for the N and P proteins or for the L protein respectively, under the control of a promoter suitable for expression in yeast.

8. The recombinant yeast strain according to claim 1, wherein in the first and second plasmid genome vectors the cloned molecule is cloned in a plasmid under the control of expression control sequences suitable for expression in yeast, including a promoter and a transcription terminator sequence in sense or in antisense orientation.

9. The recombinant yeast strain according to claim 1, wherein in at least one of the first and second plasmid genome vectors the cDNA in the cloned DNA molecule comprises at least one of the following polynucleotides: (a) a Leader and/or Trailer sequence of measles virus (MV); (b) an additional Promoter sequence derived from the MV, selected from the group consisting of: the promoter of the nucleoprotein (N), phosphoprotein (P) and polymerase (L) of an MV; (c) an additional Terminator sequence derived from the MV, selected from the group consisting of: the terminator of the polymerase (L) or of the nucleoprotein (N), and the phosphoprotein (P) of an MV; and (d) the cDNA of the cloned molecule is framed by different or identical autocatalytic ribozymes selected among hammerhead ribozyme and hepatitis delta virus ribozyme.

10. The recombinant yeast strain according to claim 9, wherein the measles virus is an attenuated measles virus.

11. The recombinant yeast strain according to claim 10, wherein the measles virus is a Schwarz MV.

12. The recombinant yeast strain according to claim 1, wherein at least one of said plasmid vectors is selected from pCM101, pCM103, pCM104, pCM105, pCM106, pCM112, pCM113, pCM201, pCM224, pCM225, pCM226, pCM227, pCM402, pCM476, pCM503, and pCM603 deposited at the Collection Nationale de Cultures de Microorganismes (CNCM) under No. I-3896, I-3897, I-3898, I-3899, I-3900, I-3901, I-3902, I-3903, I-3904, I-3905, I-3906, I-3907, I-4117, I-4118, I-4119, and I-4120, respectively.

13. The recombinant yeast strain according to claim 1, wherein in the second plasmid genome vector the cDNA encoding part of the antigenome of said non-segmented negative-strand RNA virus is devoid of all the viral genes or is devoid of all the viral coding sequences.

14. The recombinant yeast strain according to claim 1, wherein in at least one of the first and the second genome vectors the cDNA of the cloned molecule is a recombinant cDNA which comprises a coding sequence of a reporter gene.

15. The recombinant yeast strain according to claim 1, wherein in at least one of the first and the second genome vectors the cDNA of the cloned molecule is a recombinant cDNA which comprises a coding sequence of a cellular protein.

16. The recombinant yeast strain according to claim 1, wherein in at least one of the first and the second genome vectors the cDNA of the cloned molecule is a recombinant cDNA which comprises a coding sequence of an antigen or an epitope, suitable for eliciting an immune response in a host in need thereof.

17. The recombinant yeast strain according to claim 1, which is a strain of Saccharomyces Cerevisiae.

18. The recombinant yeast strain according to claim 1, which is a strain of Pichia Pastoris or Saccharomyces Pombe.

19. The recombinant yeast strain according to claim 1, which is the strain yCM112, yCM113, yCM226, or yCM403 deposited at the CNCM under No. I-3908, I-3909, I-3910, and I-4121, respectively.

20. A set of RNPs of a non-segmented negative-strand RNA virus or a set of RNPs-like of a non-segmented negative-strand RNA virus, which is expressed from a recombinant yeast strain according to claim 1.

21. The set of RNPs or RNPs-like according to claim 20, wherein the RNPs or RNPs-like are formulated with a transfectant agent.

22. An immunogenic composition comprising RNPs or RNPs-like according to claim 20.

23. A system for the preparation of RNPs or RNPs-like from a non-segmented negative-strand RNA virus by reverse genetics in yeast strains, wherein said system comprises: (a) the recombinant yeast strain according to claim 1; and (b) a culture medium for said yeast strain, which comprises an adequate culture medium for a yeast which is devoid of the components which are expressed by the selectable markers contained in complementation vectors of said recombinant yeast.

24. The recombinant yeast strain according to claim 6, wherein the promoter suitable for expression in yeast is an inducible promoter.

25. The recombinant yeast strain according to claim 7, wherein the promoter suitable for expression in yeast is an inducible promoter.

26. The recombinant yeast strain according to claim 1; wherein the one or more trans-complementation plasmid vectors each independently comprise a selectable auxotrophy marker.

27. A process for the preparation of infectious RNPs of a non-segmented negative-strand RNA virus or infectious RNPs-like, wherein said RNPs or RNPs-like are expressed from yeast after: (a) transforming a yeast strain with vectors according to claim 1; (b) growing said recombinant yeast strain; and (c) recovering the produced infectious virus RNPs or infectious RNPs-like.

28. A process for preparation of RNPs or RNPs-like of a non-segmented negative-strand RNA virus characterized in that it comprises the steps of: (a) obtaining recombinant yeasts expressing RNPs or RNPs-like according to claim 1; and (b) recovering the RNPs or RNPs-like from said yeasts.

29. A method for preparing an immunogenic composition comprising infectious RNPs or RNPs-like, which comprises seeding a culture with the recombinant yeast strain according to claim 1, and isolating infectious RNPs or RNPs-like.

Description

LEGEND OF THE FIGURES

(1) FIG. 1: Real time RT-PCR analysis of MV N, P and L genes expression. Real time RT-PCR was performed to quantify viral N (striped bars), P (white bars), and L (black bars) mRNA expressed in the yeast strain W303-NPL.sub.MV. (Glu: culture with glucose, Gal: culture with galactose). In all quantitative PCR calculations, the amount of RNA was standardized using yeast 18S RNA genes. All quantification data are presented as the standardized values, meanstandard deviation of triplicates.

(2) FIG. 2A: Composition of Schwarz MV minigenomes. pYES2 plasmid expression vector containing the URA3 selectable marker, 2 replication origin and GAL1 inducible promoter were used for the different constructions. GAL1: yeast galactose inducible promoter; Rz: autocatalytic ribozymes; Tr: MV virus Trailer sequence; T.sub.L: MV virus L terminator sequence; 3K: KANMX4 gene 3 non coding sequence; KAN: KANMX4 gene coding sequence; P.sub.N: MV virus N promoter sequence; Le: MV virus Leader sequence; Ter: yeast transcription terminator sequence.

(3) FIG. 2B: The molecular events involved in the geneticin resistance mediated by minigenome .

(4) FIG. 2C: The molecular events involved in the geneticin resistance mediated by minigenome .

(5) FIG. 3: Replication of MV minigenome is possible in yeast. W303-NPL.sub.MV yeast growth in medium containing geneticin after transformation by the four different minigenomic constructs , , , (7 days culture at 30 C., pH 5.6 and 1% raffinose et 2% galactose). Only the minigenomes or allow yeast to grow in selective medium. C+: positive control.

(6) FIG. 4: Replication and transcription of MV minigenomes are strictly dependent on viral N, P and L genes. Yeast W303-NPL.sub.MV coexpressing different combination of MV N, P, L genes and the or minigenomes (7 days culture at 30 C., pH 6.5 and 1% raffinose et 2% galactose). Only the strains coexpressing simultaneously N, P, L and a or (3 minigenomes can grow in presence of geneticin.

(7) FIGS. 5A and 5B: Reconstitution of MV full-length genome RNP in S. cerevisiae. Yeast strain containing the N, P, L priming vector), the derivatives / minigenomes and the expression plasmid harboring full MV genome that will produce infectious viral RNPs particles. When yeast grows in presence of canavanin, the priming L vector is eliminated by counter selection. The complementation by L expressed from full-length MV genome is essential for yeast growth in presence of geneticin.

(8) FIGS. 6A and 6B: Reconstitution of recombinant MV full-length genome RNA in Saccharomyces Cerevisiae.

(9) A. Yeast strain containing the NPL expresser plasmid pESC-LEU-N, pESC-TRPp. pESC-HIS-L and a recombinant full-length MV genome with two additional heterologous genes eGFP and KANMX4

(10) B. Visualisation of transformed yeast expressing eGFP from MV genome.

(11) FIG. 7: Transfection of 293 T and Vero cells with RNPs obtained from yeast as described in FIG. 6 and visualization of the expression of eGFP in yeast.

(12) FIGS. 8A and 8B: A. Amplification of Vero cells of recombinant MV obtained from RNP transfected cells as mentioned in FIG. 7 (eGFP visualization) B. Visualization by RT PCR and sequencing of the presence of KANMX4 reporter gene in the genome of recombinant MV obtained from yeast.

(13) FIG. 9: Genome-wide identification of host genes affecting replication and transcription of MV virus. Yeast Knock-out deletion collection (the deleted gene contain the bar code UPTAG and DOWNTAG unique sequences allowing the identification of the yeast strain) will be transformed by the N, P, L and the derivatives (up)/ (down) minigenomes containing the Luciferase reporter gene and the level of transcription/replication will be measured.

(14) FIG. 10: Identification of host genes and peptides libraries regulators of min-MV replication/transcription in yeast. Yeast W303-NPL.sub.MV coexpressing viral N, P, L genes and the derivatives minigenome will be transformed by DNA libraries coding for yeast/mammalian genes or peptides and the level of transcription/replication will be measured.

(15) FIG. 11A: Schematic representation of MV viral particle (A) and RNP (B). N (nucleoprotein); P (phosphoprotein); M (matrix protein); F (fusion protein); H (hemagglutinin); L (large polymerase).

(16) FIG. 11B: Mice immunization with MV-RNP

(17) FIG. 11C: Partial protection of mice from lethal WNV challenge after immunization with RNP from recombinant MV-sEWNV expressing the envelope protein from WNV.

(18) FIG. 12A: Screening and identification of antiviral compounds inhibiting viral replication in yeast. Yeast W303-NPL.sub.MV coexpressing MV N, P, L genes and the derivatives minigenome containing CAN1 gene under the control of viral Trailer sequence will be exposed to chemical compound libraries and the antiviral active compounds (i) will be identified by selecting colonies growing on canavanin.

(19) FIG. 12B: Screening and identification of antiviral compounds inhibiting viral transcription in yeast. Yeast W303-NPL.sub.MV coexpressing MV N, P, L genes and the derivatives minigenome containing CAN1 gene under the control of viral Leader sequence will be exposed to chemical compound libraries and the antiviral active compounds (i) will be identified by selecting colonies growing on canavanin.

(20) FIG. 13: pYES2: 5856 nucleotides.

(21) FIGS. 14A, 14B, 14C, and 14D: Nucleotide sequences of plasmid constructs of minigenomes, of complementation plasmids expressing N, P and L proteins, using the Schwarz strain of the measles virus The plasmids used are pYES2 plasmids for the preparation of the minigenomes and pESC for the preparation of the complementation plasmids.

(22) FIGS. 15.1, 15.2, 15.3, 15.4, and 15.5 show the Minigenome sequence (PCM112).

(23) FIGS. 16.1, 16.2, 16.3, 16.4, and 16.5 show the Minigenome sequence (pCM113).

(24) FIGS. 17.1, 17.2, 17.3, 17.4, and 17.5 show the Minigenome sequence (pCM114).

(25) FIGS. 18.1, 18.2, 18.3, 18.4, and 18.5 show the Minigenome sequence (pCM115).

(26) FIGS. 19.1, 19.2, 19.3, 19.4, 19.5, and 19.6 show the Minigenome based CAN1 sequence (pCM224).

(27) FIGS. 20.1, 20.2, 20.3, 20.4, 20.5, 20.6, and 20.7 show the Minigenome based CAN1 sequence pCM225).

(28) FIGS. 21.1, 21.2, 21.3, 21.4, 21.5, and 21.6 show the ADE2 plasmid containing minigenome KANMX4 based sequence (pCM226).

(29) FIGS. 22.1, 22.2, 22.3, 22.4, 22.5, and 22.6 show the ADE2 plasmid containing minigenome KANMX4 based sequence (pCM227).

(30) FIGS. 23.1, 23.2, 23.3, 23.4, and 23.5 show the pESC-Leu-N (pCM103) sequence.

(31) FIGS. 24.1, 24.2, 24.3, and 24.4 show the pESC-TRP-P (pCM104) sequence.

(32) FIGS. 25.1, 25.2, 25.3, 25.4, 25.5, and 25.6 show the pESC-LEU-NP (pCM106) sequence.

(33) FIGS. 26.1, 26.2, 26.3, 26.4, 26.5, 26.6, and 26.7 show the pESC-HIS-L (pCM105) sequence.

(34) FIGS. 27.1, 27.2, 27.3, 27.4, 27.5, 27.6, 27.7, 27.8, 27.9, and 27.10 show the pCM105-CAN1 (pCM201) sequence.

(35) FIGS. 28.1, 28.2, 28.3, 28.4, 28.5, 28.6, 28.7, 28.8, 28.9, 28.10, 28.11, 28.12, 28.13, and 28.14 show the pESC-URA-MV (pCM101) sequence.

(36) FIGS. 29.1, 29.2, and 29.3 show the Gap repair plasmid based sequence (pCM476).

(37) FIGS. 30.1, 30.2, 30.3, 30.4, 30.5, 30.6, 30.7, 30.8, and 30.9, show the Recombinant measles genome sequence: 2.sup.nd Gap repair plasmid (pCM402).

(38) FIGS. 31.1, 31.2, 31.3, 31.4, 31.5, 31.6, 31.7, 31.8, 31.9, 31.10, and 31.11 show the Recombinant measles genome sequence of the resulting plasmid after the Gap repair (pCM403).

(39) FIGS. 32.1, 32.2, 32.3, 32.4, 32.5, 32.6, 32.7, 32.8, 32.9, and 32.10 show the Recombinant measles genome sequence (pCM503).

(40) FIGS. 33.1, 33.2, 33.3, 33.4, 33.5, 33.6, 33.7, 33.8, 33.9, 33.10, and 33.11 show the Recombinant measles genome sequence (pCM603).

EXAMPLES

(41) To demonstrate the capacity of yeast strain W303-NPL.sub.MV to support the transcriptional and replicative activity of Schwarz MV RNPs, we generated various subgenomic constructions (minigenomes) derived from the Schwarz measles virus. These minigenomes contain the MV leader-trailer sequences necessary for viral genome transcription/replication flanking the reporter gene KANMX4 that confers to yeasts resistance to geneticin drug. Gene KANMX4 was cloned either in sense or in antisense under the control of the cis-active sequences of measles virus, cloned themselves in sense or in antisense under the control of the yeast GAL1 promoter. Autocatalytic ribozyme sequences were added at the two ends of constructions in order to prevent the expression of the minigenomes dependent on the yeast GAL1 promoter. Transformation of the yeast strain W303-NPL.sub.MV by the minigenomes allowed yeast to grow in presence of geneticin, the KANMX4 gene being expressed by functional MV RNPs.

(42) This result demonstrates that the replication and the transcription of a minigenome derived from measles virus are possible in yeast. This system enabled us to determine the cloning parameters of the viral genome in a yeast expression vector, which are compatible with the production of functional RNPs. The minigenome can be replaced by a complete genome coding for the whole viral proteins.

(43) Construction of Yeast Strain W303-NPL.sub.MV Expressing N, P and L Genes from Schwarz MV

(44) In order to allow replication of measles virus RNPs in yeast, we established a strain of S. cerevisiae expressing the viral proteins N, P and L coding respectively for the nucleoprotein, the phosphoprotein and the polymerase of measles virus (Schwarz vaccine strain), which are the minimal components required for measles RNP formation. We first constructed yeast expression plasmids harboring N, P, and L. The sequences corresponding to the viral N, P and L open reading frames (ORF) were cloned in the pESC series (FIG. 14) of galactose-inducible yeast expression vectors containing the LEU, TRP and HIS selectable markers, respectively, to generate pESC-LEU-N, pESC-TRP-P, pESC-HIS-L plasmids. These plasmids were used to transform the yeast strain W303 to generate the new strain W303-NPL.sub.MV. We choose the W303 reference strain because it has been used successfully, notably to replicate papillomavirus (11). The transformed (ref. 20) yeast was cultured at 30 C. in defined drop out medium, with selected nutrients omitted (tryptophan, histidin, leucin) to provide selection for the 3 DNA plasmids together. The culture conditions were optimized to allow the expression of viral components. Optimal induction of N, P and L expression was obtained in a medium containing raffinose (see below). This nonfermentable carbon source does not interfere with galactose induction and favours cell growth.

(45) The RNA expression of measles virus N, P and L genes under the control of the galactose inducible yeast GAL1 promoter was evaluated by real time RT-PCR in the W303-NPL.sub.MV strain grown in the presence of galactose. The viral N, P and L genes were highly induced (FIG. 1). Interestingly, the expression profile of N, P and L in yeast is close to their expression profile in MV infected-mammalian cells: N and P are expressed at a similar high level, while L is expressed at a much lower level. Indeed, to achieve optimal viral replication in mammalian cells, the L should be under expressed as compared to N and P(17). Thus, the observed expression profile of N, P and L in yeast appears favorable for measles minigenome replication.

(46) Construction of Measles Virus Minigenomes

(47) To demonstrate that measles virus N, P and L proteins are functional to assemble measles virus RNPs and to promote viral transcription and replication in yeast, we designed different minigenomic constructs harboring a reporter gene, which enabled us to analyze transcriptional and translational activities associated with viral RNPs in yeast. These minigenomes can be replaced by full-length genomes coding for all the viral proteins or by recombinant minigenome or full-length genomes. Minigenomes are viral subgenomic constructs from which all viral ORFs have been removed and replaced by a single reporter gene. Such constructs are able to form transcriptionally active RNPs when expressed together with the N, P and L viral proteins (3). The critical step consisted in designing precise Schwarz measles vaccine subgenomic constructs (minigenomes) harbouring the reporter gene KANMX4, in order to confer to yeast resistance to geneticin drug (G418), as a selectable marker. Minigenomes were designed such as after transformation of W303-NPL.sub.MV yeast and growth in presence of geneticin in an appropriate medium and under galactose induction, transformed yeast can grow only upon MV-dependant expression of KANMX4 gene. The minigenomes of the present invention (schematically shown in FIG. 2) contain the Schwarz MV cis-active <<leader>> (nucleotides 1-55) and <<trailer>> (nucleotides 15854-15894) sequences necessary for measles virus replication, flanking the KANMX4 reporter gene. The expression of reporter KANMX4 gene is under the control of the MV N gene promoter (contained in MV nucleotides 55-111) and MV L gene terminator (contained in MV nucleotides 15785-15854). These sequences are flanked on both sides by autocatalytic ribozyme sequences (hammerhead ribozyme in 5 and hepatitis delta virus ribozyme in 3). The minigenomes were constructed into the galactose-inducible yeast expression vector pYES2 (FIG. 10) containing the URA3 selectable marker (FIG. 2).

(48) Four minigenomic constructs were generated, in which the reporter KANMX4 gene was cloned in sense (, ) or antisense (), according to MV genome organization. They were placed in pYES2 plasmid either in sense (, ) or antisense (, ) according to the yeast GAL1 promoter.

(49) 1. Minigenome

(50) Upon transformation of W303-NPL.sub.MV yeast by the minigenome, the inducible GAL1-dependent transcription of KANMX4 gene, which is mediated by yeast RNA polymerase, produces non functional KANMX4 mRNA (because the KANMX4 ORF is not cloned in sens with GAL1 promoter). Yeast should thus be sensible to geneticin. However, the viral N promoter-dependant transcription of KANMX4 gene, which is mediated by viral L RNA polymerase should produce functional KANMX4 mRNA and thus induce resistance to geneticin (FIG. 2B).

(51) 2. Minigenome

(52) In the minigenome construct, the KANMX4 ORF is cloned in sense with GAL1 promoter and should directly confer resistance to geneticin upon galactose induction. However, the autocatalytic ribozyme sequences added at both extremities prevent the yeast GAL1 promoter-dependant expression of minigenome by cleaving RNA molecules almost simultaneously with synthesis. Resistance to geneticin will be conferred by the minigenome only if the viral L polymerase replicates (duplicates) the positive strand RNA minigenome (generated by yeast RNA Pol II and than cannot be translated because uncapped and unpolyadenylated) to negative strand RNA minigenome (MV genome). This negative strand MV genome will be transcribed in turn by the viral L polymerase to produce functional KANMX4 mRNA allowing yeast to grow in the presence of geneticin. The geneticin resistance occurring in the case of the minigenome need two steps; the replication step followed by the transcription step by the viral L polymerase. While the geneticin resistance occurring in the case of the minigenome need only the transcription step and thus the yeast cells grow faster in this case compared to the 13 minigenome associated growth on geneticin (FIG. 2C).

(53) 3. Minigenomes and .

(54) It cannot be excluded that some transcription of the KANMX4 gene from or minigenomes should arise from cryptic yeast promoters within the minigenomes sequences, or from inefficient autocatalytic ribozyme activity in yeast, or from minigenomes integration in yeast chromosomes. To exclude these eventualities we constructed the and minigenomes in which the KANMX4 ORF is cloned in antisense with the viral cis-active sequences. Thus, MV-dependant replication and transcription by the viral L polymerase will produce an antisense KANMX4 mRNA non functional to confer G418 resistance. Indeed, the and minigenomes have the same architecture than and minigenomes respectively regarding the KANMX4 dependent transcription by GAL1 promoter.

(55) The FIGS. 2B and 2C explain the molecular events involved in the geneticin resistance mediated by and minigenomes. The following molecular mechanisms shed some light on the observed phenotypes: the yeast RNA pol II transcription of the minigenomes flanked by the ribozymes produces polyadenylated and capped mRNA followed by the nuclear export to the cytoplasm. The autocatalytic activity of ribozymes liberates the minigenome. The viral proteins N, P and L encapsidate the minigenome to generate RNPs particles, which are functional to replicate and transcribe the KANMX4 gene. For survival in presence of G418 and a permanent expression of the KANMX4 resistance phenotype, yeast constrains MV minigenome to assemble and to replicate efficiently.

(56) Transcription and Replication of MV Minigenomes in Yeast W303-NPL.sub.MV

(57) The , , or minigenomes constructs were coexpressed with N, P and L after galactose induction in the yeast strain W303-NPL.sub.MV. Interestingly, only the and minigenomes (KANMX4 ORF cloned in sens with the viral Leader sequence and N promoter, whatever the cloning sens regarding GAL1 promoter) allowed yeast to grow in geneticin-containing selective medium. The or minigenomes were not able to confer resistance to geneticin in the same condition (FIG. 3). We thus conclude that viral N, P, L and / minigenomes are functional in budding yeast Saccharomyces cerevisiae. The growth in geneticin-containing selective medium of the yeast containing the and minigenomes constructs demonstrate that transcription and replication of negative strand RNA minigenome virus is possible in yeast.

(58) Transcription and Replication of MV Minigenome in Yeast is Strictly Dependent on Viral Replication Factors

(59) In order to demonstrate that the activity of and minigenomes is strictly dependant on the association of functional measles virus RNPs containing the three viral components N, P and L proteins, we generated control W303 yeast strains containing either N, P, L alone or NP (FIG. 4) or NL or PL (data not shown). When transformed by or minigenomes, none of them was able to grow on selective medium. FIG. 4 shows that only the strains coexpressing simultaneously N, P, L and or minigenomes can grow in presence of G418. This excludes the possibility that yeast factors would be responsible of KANMX4 gene expression and demonstrates that negative strand RNA virus genomes can assemble in functional RNPs in yeast and display RNA dependent RNA polymerase activity.

(60) I Production and Purification of MV-RNPs in Yeast

(61) The minigenomic constructs demonstrate the proof-of-concept for negative strand RNA viruses replication in yeast. The system generated in the present invention that consists of the W303-NPL.sub.MV yeast strain and - or -type negative strand RNA virus minigenomes may be used for screening cellular factors or antiviral compounds associated with viral replication.

(62) In another major application, the system makes it possible to generate full-length viral RNPs that could be purified from yeast and used to produce live attenuated viruses. In order to assemble functional full-length RNPs that do not contain yeast selection marker inserted inside the viral genomic sequence, yeast must harbour together with the full-length genome a minigenome expressing the resistance gene.

(63) The yeast strain W303-NPL.sub.MV is mutated in the CAN1 gene (encoding arginine permease; null mutant of CAN1 gene confers resistance to the arginine analogue Canavanin). The viral polymerase L is expressed from a plasmid harboring the CAN1 gene (FIG. 5). The CAN1 yeast episomal plasmid vector replicates autonomously because of the presence of a yeast origin of replication (2 m ori). Under conditions of non selective growth in the presence of Canavanin drug, CAN1 plasmid is highly unstable, being lost rapidly from yeast after each generation during cell division.

(64) To produce infectious RNPs harboring full-length MV genome, the yeast W303-NPL.sub.MV coexpressing the N, P, L genes from MV is co-transformed by a full-length infectious cDNA corresponding to the MV antigenome and by minigenome (FIG. 5). The minigenome is an -like minigenome lacking the MV trailer sequence, thus unable to be transcribed or replicated without complementation. The expression of viral L polymerase from CAN1 plasmid is required to prime the transcription/replication of full-length MV genome. Then, this plasmid will be lost upon yeast growth in the presence of Canavanin, thus making geneticin resistance dependent on the transcription of L polymerase from MV full-length genome (FIG. 5). The trans-complementation by L expressed from full-length MV genome after natural elimination of the L priming plasmid induced by the Canavanin drug becomes thus essential for yeast growth on geneticin. This system allows the production of viral RNPs containing a full-length genome with no selection marker inserted. The E minigenome cannot replicate in yeast or mammalian cells due to the lack of the cis-active trailer sequence (FIG. 5).

(65) We studied the effect of Canavanin on MV minigenomes replication and observed that Canavanin does not interfere with MV minigenomes replication/transcription. We concluded that Canavanin based screening may be used. We established the optimal Canavanin concentration required for Canavanin based screening in yeast, i.e., (200 ug/ml).

(66) We generated a plasmid expressing the viral L polymerase and the CAN1 gene. We constructed a vector containing ADE2 selectable marker from the minigenome plasmid. The MV full-length genome was cloned into a pESC-URA3 yeast vector. After transformation, the final yeast strain will harbor five plasmids with 7 selectable markers.

(67) Interestingly, the yeast strain W303-NPL.sub.MV containing the N, P, L/CAN1 or W303-MV-NP.sup.c plasmids and the / minigenome and a full-length MV genome was able to grow in medium containing Canavanin and G418, as compared to the same strain lacking the full-length MV genome plasmid that did not grow. Thus, despite the loss of the L plasmid due to the presence of Canavanin, the viral L polymerase was expressed from MV genome and the viral proteins N, P and L were likely encapsidated the minigenome to generate RNPs particles, which, in turn, produced functional KANMX4 mRNA, thus inducing resistance to geneticin.

(68) After extraction from yeast, viral RNPs containing a full-length genome can be used to transfect mammalian cells in order to reproduce infectious virus with a high yield. This invention allows to produce in yeast fermentors a new formulation of measles vaccine or of any other similar live attenuated vaccine. We demonstrated that viral RNPs purified from mammalian cells are infectious and immunogenic (FIG. 11A, B).

(69) IIExpression in Yeast of Recombinant MV Genome Containing Heterologous Genes KANMX4 and/or eGFP.

(70) 1. Generation of a Yeast Strain Capable of Stable and Long-Lasting Expression of Complete RNPs of Measles Virus.

(71) In order to enable the replication of viral RNPs particles in the yeast, a strain of Saccharomyces Cerevisiae W303NPL MV-eGFP-KANMX4 has been prepared, which expresses N, P and L viral proteins of the measles virus, together with a full-length recombinant viral antigenome containing two additional genes: the eGFP reporter gene cloned between viral N and P genes, and the KANMX4 gene for resistance to geneticin between F and L viral genes (FIG. 26). This antigenome is cloned in reverse sense with respect to the GAL1 yeast promoter in order to prevent direct expression of the reporter genes by the RNA polymerase of the yeast. These reporter genes can only be expressed after replication and transcription of the antigenomic viral RNA through the action of the viral L polymerase using the viral promoters (Leader, Trailer and specific promoters of the viral genes). Only the first antigenomic RNA is produced by the RNA polymerase of the yeast.

(72) The yeast strain W303 and a strain W303 MV-eGFP-KANMX4 expressing the recombinant genome and devoid of plasmids encoding N, P and L have been used as controls for this study.

(73) 2) Purification of Viral RNPs from the Cytoplasm of Yeasts

(74) The strain WO303.sup.NPL MV-eGFP-KANMX4 was grown in 400 ml of SD medium for 14-18 hours until exponential phase (OD=0.6-0.8, 6-810.sup.6 cells/ml). The yeasts have been incubated for 4-6 hours in a medium containing galactose in order to induce expression of N, P, L proteins and of recombinant antigenome. The yeasts have been yield and then transformed into spheroplasts for a part thereof and lyzed with glass microbeads for the other part. The RNPs contained in the extracts obtained by both techniques have been purified by treatment with Triton, clarification and ultracentrifugation through a 30% sucrose cushion. The material which was collected in the centrifugation pellet was taken in a Tris-EDTA buffer.

(75) 3) The RNPs Purified from the Yeast are Infectious

(76) In order to assay its infectivity, the purified material was transfected (with lipofectamine) in Vero and 293T cells. The day after transfection for the 293T cells and 3 days after transfection for the Vero cells, fluorescent cells and fluorescent syncytia plates were apparent in the cultures (FIG. 7). These plates propagated within the following 48 hours. This experiment shows that yeast W303NPL MV-eGFP-KANMX4 has reconstituted infectious RNPs of the measles virus, which are recombinant for the eGFP reporter gene.

(77) The Vero and 293T cells expressing the eGFP have then been grown with fresh Vero cells. FIG. 8 shows that the viruses derived from the first transfections have propagated into the culture. These viruses elicit especially the formation of typical syncytium. A Petri box was covered with syncytia (90%) in 48 hours.

(78) After amplification of the virus on Vero cells, total RNAs of infected cells have been extracted. A PCR amplification with primers located upstream and downstream of the KANMX4 gene inserted into the measles genome has demonstrated the presence of a band corresponding to the KANMX4 insert (FIG. 8). Sequencing of the amplified band allowed to confirm its nature.

(79) These results show that RNPs of recombinant measles obtained from yeast are infectious on cultured cells.

(80) 4) Material Et Methods

(81) Generation of Yeast Strain W303.sup.NPL MV-eGFP-KANMX4

(82) The yeast strain W303-1B (ATCC 201238) having genotype MATalpha leu2-112 trp1-1ura3-1 his3-11 his3-15 ade2-1 can1-100 has been transformed by pESC-LEU-N, pESC-TRP-P, pESC-HIS-L and with a recombinant genome containing the eGFP reporter gene, cloned between N and P genes, and containing the gene for selection with geneticin (KANMX4) cloned between the F and L genes.

(83) To prepare the recombinant yeast strain, the following plasmids were prepared and used (the biological material was deposited on Jan. 30, 2009):

(84) pCM476 (CNCM I-4117)

(85) pCM476 is a plasmid comprising synthetic DNA fragment containing Ribozymes sequences and Leader Trailer sequences purchased from Genecust (Luxembourg). The fragment was synthesized in the pUC57 plasmid in SmaI restriction site. The EcoRI-SphI fragment containing the synthetic DNA fragment was then cloned into pYES2 vector containing Ampicillin marker.

(86) The sequence of the synthetic DNA fragment is the following:

(87) TABLE-US-00001 GCGGCCGCCAACTTTGTTTGGTCTGATGAGTCCGTGAGGACGAAACCCGG AGTCCCGGGTCACCAGACAAAGCTGGGAATAGAAACTTCGTATTTTCAAA GTTTTCTTTAATATATTGCAAATAATGCCTAACCACCTAGGGCAGGATTA GGGTTCCGGAGTTCAACCAATTAGTCCTTAATCAGGGCACTGTATCCGAC TAACTTATACCATTCTTTGGACTAGTGACGTCCGCGGTCGACACGTGAGA TCTGATGGCCATCTCGGATATCCCTAATCCTGCTCTTGTCCCTGATAATA GGATCTTGAATCCTAAGTGCACTAGAAGATGATCATTGATTGAACTATCC TTACCCAACTTTGTTTGGTGGCCGGCATGGTCCCAGCCTCCTCGCTGGCG CCGGCTGGGCAACATTCCGAGGGGACCGTCCCCTCGGTAATGGCGAATGG GAC pCM402(CNCMI-4117)

(88) pCM402 (CNCM I-4117)

(89) pCM402 is a plasmid comprising DNA inserts for eGFP and KANMX4 markers cloned into the Measles Schwarz genome and then cloned into pYES2 vector containing Ampicillin marker.

(90) The KANMX4 was amplified by PCR from pFA6a-kanMX4 plasmid using the primers:

(91) TABLE-US-00002 MscIKAN: CACGTACGATGGGTAAGGAAAAGACTCACG KANAatII: TCCTTGCGCGCTTAGAAAAACTCATCGAGC

(92) The pTM-MVSchw plasmid harboring BssHII/BsiWI restriction site between Measles virus F and L genes was digested with BssHII/BsiWI and the KANMX4 fragment was cloned in the same site to obtain pCM401 plasmid.

(93) The pTM-MVSchw plasmid harboring eGFP cloned between Measles virus N and P genes and pCM401 plasmids were digested with SalI to obtain two fragments with each plasmid. The fragments containing eGFP and KANMX4 were purified and ligated to obtain pCM402 plasmid.

(94) pCM403

(95) The pCM403 plasmid was obtained by gap repair in yeast: pCM476 was digested with MscI/PflMI and pCM402 was digested by NotI and then the digested plasmids were cotransformed in yeast to obtain pCM403.

(96) pCM503 (CNCM I-4119)

(97) The pTM-MVSchw plasmid harboring eGFP cloned between Schwarz Measles virus N and P genes was digested by NotI and the Schwarz Measles genome containing the eGFP marker was cloned into pYES2 vector containing Ampicillin marker which was digested with NotI.

(98) pCM603 (CNCM I-4120)

(99) pCM603 contains Schwarz Measles genome containing inserts for eGFP and KNAMX4 markers cloned in pYES2 vector containing Ampicillin marker. The pCM401 plasmid was digested with NotI and the Measles virus genome containing eGFP cloned between the N and P genes and KANMX4 cloned between Measles virus genes F and L was cloned in the plasmid pYES2 digested with NotI to obtain pCM603.

(100) Yeast Strain yCM403 (CNCM I-4121)

(101) The yeast strain yCM403 was obtained from Yeast S. Cerevisiae strain W303 NPL MV-eGFP-KANMX4: the diploid of the strain W3031B (ATCC 201238) having leu2-3 leu2-112 trp1-1 ura3-1 his3-11 his3-15 ade2-1 can1-100 was co-transformed by pESC-LEU-N (such as pCM103), pESC-TRP-P (such as pCM104), pESC-HIS-L (such as pCM105). This strain contains pCM403 (Measles alpha genome harboring eGFP and KNAMX4 markers). pCM403 plasmid was obtained by gap repair in yeast: pCM476 plasmid is digested with MscI/PflMI and pCM402 plasmid was digested by Not1 and then cotransformed in yeast to obtain pCM403. Purification of RNPs from yeast: Protocol 1: Overnight culture of strain W303-MV(GFP-KAN)-NPL, strain W303-MV(GFP-KAN), strain W303 in 400 ml of SD medium in a 1 liter flask and grow 14-18 hours to a final concentration of 810.sup.6 cells/ml (0D=0.6-0.8). The cells were washed in 20 ml of sterile water and grown in 20 ml of sterile YG (YNB+Gal+raff+AA dropout) pH6-6.5 inducing medium at 30 C. with shaking for 4-6 h. Cells were centrifuged at 22 C. 1000-1200 g for 5 minutes. The cells were washed in 20 ml of sterile water and in 20 ml of 1 M sorbitol and resuspended in 20 ml of sterile 1 M sorbitol, 10 mM EDTA then transferred to 50 ml centrifuge tubes. 100_l of 2 M DTT and 5 U Lyticase per 10.sup.6 cells of lyticase were added. The samples were incubated at 37 C. for 15 minutes then centrifuged at 200-300 g at 22 C. for 5 minutes. The spheroplasts were washed with 20 ml of 1 M sorbitol and with 20 ml of sterile 1 M sorbitol, 10 mM Tris pH 7.5 then centrifuged at 22 C., 200-300 g for 5 minutes. The spheroplasts were resuspended in 10 mM NaCl, 0.2% TritonX-100, 10 mM Tris pH7.5, 10 mM EDTA, a Protease Inhibitor Cocktail and RNAses inhibitors. The spheroplasts extract containing RNPs particles were centrifuged 5 mn at 1500 rpm. The extract were centrifuged through a 30% sucrose cushion in PBS, 3 h at 36 000 rpm. The RNPs were resuspended in 100 ul of Tris-EDTA and 80 C. (5 ug/ul). At the end we have 200 ug OD.sub.260 per 10.sup.8 cells. By Bradford measures we obtain 0.4 ug RNP proteins/10.sup.6 cells. (0.1 OD yeast=10.sup.6 cells). Protocol 2: Overnight culture of strain W303-MV(GFP-KAN)-NPL, strain W303-MV(GFP-KAN), strain W303 in 400 ml of SD medium in a 1 liter fiask and grow 14-18 hours to a final concentration of 810.sup.6 cells/ml (0D=0.8). The cells were washed in 20 ml of sterile water and grown in 20 ml of sterile YG (YNB+Gal+raff+AA dropout) pH6-6.5 inducing medium at 30 C. with shaking for 4-6 h. Cells were centrifuged 850 ml at 22 C. 1000-1200 g for 5 minutes in falcon tubes. The cells were washed in 20 ml of sterile water. The frozen or not yeast cell are lysed in lysis buffer containing, 10 mM NaCl, 0.2% TritonX-100, 10 mM Tris pH7.5, 10 mM EDTA, a Protease inhibitor Cocktail and RNAses inhibitors. A cold lysis buffer was added to an equal volume of glass beads and vortexed on ice. The yeast extract containing RNPs particles were centrifuged 5 mn, 1500 rpm. 10 mM Tris pH7.5, 1 mM EDTA was added then followed by centrifugation through a 30% sucrose cushion in PBS. 3 h at 36 000 rpm. Add 100 ul of Tris-EDTA and 80 C.

(102) Transfection of Vero and 293T Cells.

(103) Vero cells at 90% confluent in were grown in 3 ml plates of DMEM, 10% serum without antibiotic. 20 g yRNPs were added to 375 l DMEM w/o serum w/o antibiotic. 10 l of Lipofectamine2000 were diluted in 375 l DMEM w/o serum w/o antibiotic. The two solutions were mixed immediately and incubated for 20 mn at room temperature. The 750 l mix were added to the cells in 3 ml plates. The medium were discarded after 16 h and replaced by fresh DMEM, 10% serum without antibiotic the cells were incubated for 6 days.

(104) III Using Viral RNP as a New Formulation of Measles Vaccine,

(105) Before the widespread use of live attenuated measles vaccine, measles was the single most lethal infectious agent. In the early 1960s, as many as 135 million cases of measles and over 6 million measles-related deaths are estimated to have occurred yearly (Clements C L, Hussey G D. Measles. In: Murray C J L, Lopez A D, Mathers C D, eds. Global Epidemiology of Infectious Diseases. Geneva: World Health Organization, 2004). The introduction of routine measles vaccination in most developing countries during the 1980s as part of the Expanded Programme on Immunization had a major effect on global measles mortality. By 1987, WHO estimated that the number of deaths from measles worldwide had been reduced to 1.9 million (Kejak K, Chan C, Hayden G, Henderson R H. Expanded Programme on Immunisation. World Health Stat Q 1988; 41: 59-63). During the 1990-1999 period, many industrialised countries introduced a second routine dose, usually at or around the time of school entry, to protect children who did not respond to the first dose (Henao-Restrepo A M, Strebel P, John Hoekstra E, Birmingham M, Bilous J. Experience in global measles control, 1990-2001. J Infect Dis 2003; 187 (suppl 1): S15-21). However, despite the availability of a safe, effective, and relatively inexpensive vaccine for over 40 years, measles remains a leading cause of childhood mortality, especially for children living in developing countries (Strebel P, Cochi S, Grabowsky M, et al. The unfinished measles immunization agenda. J Infect Dis 2003; 187 (suppl 1): S1-7). Most measles cases and deaths occur in developing countries, but outbreaks continue to occur in developed countries as well. In 2002, WHO and UNICEF began to implement a strategy for accelerated reduction in mortality due to measles by targeting 45 priority countries accounting for more than 90% of estimated global measles deaths. This program led to an important reduction in measles mortality. WHO claims that between 1999 and 2005, the mortality owing to measles was reduced by 60%, from an estimated 873 000 deaths (634 000-1 140 000) in 1999 to 345 000 deaths (247 000-458 000) in 2005 (L J Wolfson, P M Strebel, M Gacic-Dobo, E J Hoekstra, J W McFarland, B S Hersh. Has the 2005 measles mortality reduction goal been achieved A natural history modelling study. Lancet 2007; 369: 191-200).

(106) Despite these vaccination campaigns, measles still remains the most common cause of vaccine-preventable death. The major reasons for the difficulty to control measles epidemics and outbreaks by routine vaccination are i) the failure to immunize efficiently children before the age of 9 months, mainly because of the presence of passive antibodies transmitted by the mother, and ii) problems with delivery and stability of the vaccine (live enveloped viral vaccines must be kept under 8 C.). Measles vaccine is given in developed countries between 12 and 15 months of age with seroconversion rates of 95%. In developing countries, many cases of measles occur in infants under the age of 1 year, and the vaccine is given at 9 months of age with seroconversion rates of 85% (Cutts, F T, Henao-Restrepo, A. & Olive, J M. (1999) Vaccine 17, Suppl. 3, S47-S52). In both situations, a second dose is necessary to establish sufficient herd immunity to interrupt endemic transmission (Centers for Disease Control, 2000. Morbid. Mortal. Wkly. Rep. 49, 1116-1118). A measles vaccine given before the age of 6 months despite the presence of maternal immunity and a formulation of the vaccine with a greater stability to temperature could improve measles control in many regions of the world.

(107) To address these problems, we developed the possibility of using measles RNP as a new formulation of the vaccine. The viral glycoproteins H and F, which are targeted by neutralizing antibodies, are exposed on the surface of the viral envelope. Inside the viral particle, the RNP is composed of the negative strand RNA genome encapsidated by the nucleoprotein N and the polymerase complex P/L, involving a large number of viral proteins. FIG. 11A shows a schematic representation of MV RNP.

(108) This viral RNPs complex contains all the information for the generation of replicating virus (full-length genome) but does not contain the surface glycoproteins. It should thus be insensitive to neutralisation by antibodies directed to the H and F glycoproteins. Using such RNPs complexes for immunisation could allow to circumvent the pre-existing neutralizing maternal immunity, at least for the first round of infection, and thus increase the uptake of the vaccine by younger infants. Moreover, the RNP formulation that does not contain the viral envelope and the surface glycoproteins should be more stable than the virus itself at higher temperatures.

(109) Infectivity of MV RNP in Cell Culture

(110) To first demonstrate the infectivity of MV RNPs and their capacity of initiating and spreading MV infection in cell culture, we purified MV RNPs from MV-infected cells and from a bulk vaccine batch (as a commercial product). The purification procedure consisted of cell lysis (freezing-thawing), viral membrane disruption using NP40 detergent, low-speed clarification, and centrifugation through a sucrose cushion. MV RNPs were obtained from Schwarz MV vaccine and from Vero cells infected with MV Schwarz strain. The yield was 100 g (OD.sub.260) per 10.sup.7 pfu. The infectivity of these RNPs was analyzed by transfecting Vero cells using lipofectamine. Table 1 shows that, using different conditions, MV RNPs were infectious for Vero cells after transfection, as detected by syncytia apparition in cell culture. Without lipofectamine, no infection was detected, demonstrating the absence of enveloped viral particles in the RNPs preparation. Infectivity was also tested using FUGENE reagent or calcium phosphate procedures.

(111) TABLE-US-00003 TABLE 1 Transfection of Vero cells by MV RNP/lipofectamine RNP l lipofect Syncytia (1 g/l) l Vero (nb) 5 0 0 10 0 0 5 5 20 5 10 1200 5 20 170 5 50 0 10 20 600
Immunogenicity of MV RNPs in Mice

(112) The best condition for in vitro infection (5 l RNP+10 l lipofectamine) was chosen for mice immunization. CD46.sup.+/ IFNAR.sup./ mice (susceptible to MV infection) were inoculated intraperitoneally with a mixture of RNPs/lipofectamine. To control for passive immunization, the same preparation previously UV inactivated (MV genome is UV sensitive) was also inoculated. FIG. 8B shows that after immunization with MV RNPs-lipofectamine, mice developed an immune response against measles, as detected by ELISA (Trinity Biotech, USA) 1 month after inoculation. The mice inoculated with the UV-inactivated RNPs remained MV negative, thus showing that the antibodies detected in other mice were not due to passive immunization.

(113) MV RNP cannot be titrated directly because the infectivity is determined after transfection. However, the dose used in this experiment was estimated at 10.sup.3-10.sup.4 TCID.sub.50 which corresponds to the vaccine dose of standard measles vaccine. Immunization of the same mice with standard measles vaccine, is 5-10 times more efficient (as determined by ELISA). This difference should be reduced after a better formulation of RNPs. Moreover, higher doses of RNPs should be assayed in order to determine whether the same level of immunization than with standard vaccine can be obtained.

(114) A similar experience was performed using RNPs purified from recombinant MV-sEWNV expressing the secreted form of the envelope E protein from West Nile virus (WNV). This recombinant virus was previously shown to protect mice from a lethal WNV challenge (Despres et al. 2005, J. of Infectious Diseases, 191, 207-214). Mice immunized with MV-sEWNV RNPs were challenged using lethal WNV doses. FIG. 8C shows that mice immunized with recombinant RNPs were partially protected from lethal infection.

(115) In conclusion, these experiments demonstrated that MV RNP are infectious after lipofectamine transfection, and immunogenic in mice at a reasonable dose. Indeed, this new vaccination concept depends on the possibility to provide means allowing availability of RNPs on an industrial scale.

(116) IV Genome-Wide Identification of Host Genes Affecting Replication and Transcription of a Negative-Strand RNA Virus

(117) The engineered / minigenomes will be used to systematically identify host factors implicated in the replication and transcription of viral RNPs. Approximately 4500 yeast deletion strains from the Yeast Knock-out (YKO) deletion collection (more than 90% of yeast genes) can be screened (18). Each deletion strain will be transformed by the N, P, L and the derivatives / minigenomes in which KANMX4 gene will be replaced by a luciferase reporter gene. Luciferase expression, which is dependent on viral RNA replication and transcription, will be measured in yeast cells. This approach allows the identification of yeast genes whose absence inhibits or stimulates MV or any other negative strand RNA viruses replication/transcription. This functional genomics approach likely will reveal novel host genes required for MV or any other negative strand RNA viruses replication (FIG. 12A) and transcription processes (FIG. 12B).

(118) The YKO deletion collection will be cotransformed in bulk by new vectors expressing N, P, L genes and the derivatives / minigenomes (or W303-MV-NPL.sup.c strain). To this end, we cloned the derivative 13 minigenome containing the CAN1 genes in the same plasmid expressing viral L polymerase and we generated a second plasmid expressing N and P genes from two distinct promoters. The growing yeast in the presence of Canavanin will be selected and the host genes affecting replication of the MV-minigenome will be identified. The CAN1 genes will be replaced by the Luciferase gene to obtain more quantitative results and measure the effects of each host gene in the replication of the negative-strand RNA virus.

(119) V Genome-Wide Identification of Host Genes and Peptides Libraries Regulators of Min-MV Replication/Transcription in Yeast.

(120) Yeast W303-NPL.sub.MV coexpressing MV N, P, L genes and the derivatives and minigenomes containing the luciferase or CAN1 genes under the control of viral transcription/replication machinery are transformed by DNA libraries coding for yeast/mammalian or peptides and the level of transcription/replication can be measured (FIG. 12A and FIG. 12B).

(121) We generated a plasmid expressing the derivatives and minigenome containing the CAN1 genes and ADE2 selectable marker. The yeast strain W303-NPL.sub.MV coexpressing N, P, L and CAN1 genes will then be transformed by a yeast expression genomic DNA library. We performed gDNA library from yeast strain W303. Indeed, we partially digested the genomic DNA from the yeast strain W303 and cloned all the fragments (from 20 bp to 20 kb) in the expression GAL1 vector pYES2. This library is advantageous compared to the classical libraries because the DNA fragment from gDNA is not fused to any nuclear localization signal (NLS) or Tag/protein largely used in almost all genetic screens in yeast and notably yeast two hybrid screen. Thus we will be able to identify other factors required for MV replication. We cloned small fragment to identify small peptides expressed from theses short gDNA that could regulate MV replication.

(122) We will perform cDNA library from human and screen for human cellular factors implicated in the MV replication.

(123) VI Screening and Identification of Antiviral Compounds Inhibiting Viral Replication in Yeast.

(124) Yeast W303-NPL.sub.MV coexpressing MV N, P, L genes and the derivatives and minigenomes containing CAN1 gene under the control of viral replication (FIG. 12A) and transcription (FIG. 12B) respectively are exposed to chemical compounds libraries and the antiviral active compounds identified by selecting colonies growing in the presence of canavanin. High-throughput screening of chemical compounds can be used to identify modulators of minigenomes replication/transcription (15).

(125) The same strain used to identify factors required for MV replication will serve to screen and identify antiviral compounds inhibiting viral replication in yeast. Several chemical compounds libraries are under study.

(126) Experimental Procedures

(127) All the plasmids and yeast strains have been deposited at the CNCM on Jan. 31, 2008.

(128) For the deposited yeast strains the culture medium is a synthetic complete drop out medium (SD): 13.4 g YNB with ammonium sulfate, 30 g Glucose, 4 g Dropout Amino Acid, 20 g Bacto-agar (Difco) and 1000 ml distilled water (final volume). Adjust the pH to 5.6 with 10 N NaOH and filter sterilize.

(129) For the deposited plasmids, the culture medium is LB medium supplemented with ampicillin.

(130) Construction of pESC-LEU-N Plasmid (pCM103) CNCM I-3897

(131) The pESC series was purchased from Stratagene (#217455)

(132) The N gene was amplified by PCR from pTM-MVSchw (19) plasmid using primers NSalI_5CATGGTCGACAAGAGCAGGATTAGGGATAT3 and NXhoI_SGCATCTCGAGTGGATGGTTGATGGGCTGGC3 and was cloned in the same restriction sites of pESC-LEU (Stratagene, France) plasmid expression vector containing the LEU2 selectable marker, 2 replication origin and GAL1 inducible promoter.

(133) Construction of pESC-TRP-P Plasmid (pCM104) CNCM I-3898

(134) The P gene was amplified by PCR from pTM-MVSchw plasmid using primers P2SalI_5CATGGTCGACCAGGTCCACACAGCCGCCAG3 and P2XhoI_5GCATCTCGAGGGTCGACTGGCATGGGGTTG3 and was cloned in the same restriction sites of pESC-TRP (Stratagene, France) plasmid expression vector containing the TRP1 selectable marker.

(135) Construction of pESC-HIS-L Plasmid (pCM105) CNCM I-3899

(136) The 6.7 kb SpeI/BglI blunt ended fragment containing L coding region from pTMMVSchw plasmid was transferred to SalI/XhoI blunt ended pESC-HIS plasmid (Stratagene, France) expression vector containing the HIS3 selectable marker.

(137) Construction of pESC-LEU-NP Plasmid (pCM106) CNCM I-3900

(138) The 1.66 kb Xho/SalI blunt ended fragment containing P coding region from pCM104 plasmid was transferred to NotI/SacI blunt ended pCM103 plasmid.

(139) Construction of MV Schwarz Minigenomes (pCM112CNCM I-3901, pCM113CNCM I-3902, and pCM114 and pCM115),

(140) The 1.1 kb DraI/EcoRV fragment containing KANMX4 coding region from pFA6a-KANM4 plasmid (1) was transferred to pTM-MVSchw, which contains a full-length infectious Schwarz MV antigenome/genome flanked by ribozymes sequences and NotI sites, digested by PflMI-MscI and blunt ended. The sequence corresponding to KANMX4 ORF was then cloned in sense (KANMX4 in frame with N promoter) and antisens (KANMX4 not in frame with N promoter) between the 5Leader-N promoter and L terminator-Trailer sequences flanked by ribozymes sequences and NotI restriction sites.

(141) This 1.7 kb NotI fragment containing the two minigenomes was cloned in the yeast plasmid expression vector pYES2 (Invitrogen, France) containing the URA3 selectable marker, 2 replication origin and GAL1 inducible promoter, digested by NotI. In the one hand, the minigenome containing KANMX4 in frame with N promoter, was cloned in sens with GAL1 yeast promoter (expressing positive RNA minigenome, (3 construction or pCM113 plasmid), in the other hand, the minigenome containing KANMX4 which is not in frame with N promoter, was cloned in sense with GAL1 yeast promoter (expressing positive RNA minigenome, 6 construction or pCM115 plasmid)

(142) The minigenome containing KANMX4 in frame with N promoter, was cloned in antisense with GAL1 promoter to obtain an intermediary plasmid containing a minigenome without ribozymes (pCM12). This construction was used to construct the a minigenome or pCM112 plasmid (expressing negative RNA minigenome). The overlapping primers below were used to obtain by PCR the a construction.

(143) PCR from pCM 12 using the primers:

(144) TABLE-US-00004 HHALPHA_1_5ACCAGACAAAGCTGGGAATAGAAACTTCGTATTTTCAA AGTTTTCTTTAATATATTGCAAATAATGCC3 and HDVALPHA1_5GTCCCATTCGCCATTACCGAGGGGACGGTCCCCTCGGA ATGTTGCCCAGCCGGCGCCAGCGAGGAGGCTGGGACCATGCCGGCCACCA AACAAAGTTGGG3

(145) Then the PCR fragment was used to make PCR with the following primers:

(146) TABLE-US-00005 HHALPHA1_5GACGGATCCAACTTTGTTTGGTCTGATGAGTCCGTGAGG ACGAAACCCGGAGTCCCGGGTCACCAGACAAAGCTGGGAATAG3 and HDVALPHA2/2_5CGAGCTGCTCGAGTCCCATTCGCCATTACC3

(147) Then the PCR fragment was used to make PCR with the following primers:

(148) TABLE-US-00006 HHALPHA2_5GAAGCTTGACGGATCCAACTTTGTTTGGTCTG3 and HDVALPHA2/2_5CGAGCTGCTCGAGTCCCATTCGCCATTACC3

(149) The PCR fragment was digested by BamHI/XhoI and cloned in the same restriction sites of the pYES2 vector to obtain pCM112 plasmid. The same strategy was used to obtain pCM114 plasmid. It is remarkable that pCM 12 plasmid confers G418 resistance in the yeast strain W303-NPL.sub.MV growing in medium containing G418.

(150) Construction of MV Schwarz Minigenomes Containing ADE2 Based Minigenome (pCM226CNCM I-3906 and pCM227CNCM i-3907)

(151) The ADE2 gene was amplified by PCR from yeast genomic DNA plasmid using primers ADE2NheI_5CCATGCTAGCCGAGAATTTTGTAACACC and ADE2ApaI_5GGCATGGGCCCTTGCTTCTTGTTACTGG and was cloned in the same restriction sites of the pCM112 and pCM113 plasmids. We obtained respectively pCM322 and pCM325 plasmids.

(152) The pCM322 and pCM325 plasmids were digested by KpnI/SacI, blunt ended and ligated to eliminate extraminigenomic SacI site to obtain pCM226 plasmid (a minigenome) and pCM227 plasmid ( minigenome) respectively.

(153) Construction of MV Schwarz Minigenomes Containing CAN1 Based Minigenome (pCM224CNCM I-3904 and pCM225CNCM I-3905)

(154) The CAN1 gene was amplified by PCR from yeast genomic DNA plasmid using primers CAN1SacI_5GAATTCGAGCTCATGACAAATTCAAAAG and CAN1NcoI_5CTACTGCCATGGACTATGCTACAACATTC, digested with SacI/NcoI and cloned in the pCM226 and the pCM227 digested with SacI/NcoI to obtain pCM224 and pCM225 respectively.

(155) Construction of pESC-URA3-MV Plasmid (pCM101-CNCM I-3896)

(156) The 16.2 kb NotI fragment containing full-length MV genome from pTM-MVSchw plasmid was transferred to NotI pESC-URA plasmid (Stratagene, France) expression vector containing the URA3 selectable marker.

(157) Construction of pCM101-CAN1 Plasmid (pCM201CNCM I-3903)

(158) The CAN1 gene was amplified by PCR from yeast genomic DNA plasmid using primers CAN1NotI_GCTCGCGGGCCGCATGACAAATTCAAAAGA and CAN1NheI_CCATGGGCTAGCACTATGCTACAACATTCC, digested with NotI/NheI and was cloned in pCM105 plasmid digested by NotI/SpeI.

(159) Generation of Yeast Strain W303-NPL.sub.MV

(160) The strain W303-1B (=ATCC 201238) with the genotype MATalpha leu2-3 leu2-112 trp1-1 ura3-1 his3-11 his3-15 ade2-1 can1-100 was co-transformed by pESC-LEU-N (such as pCM103), pESC-TRP-P (such as pCM104), pESC-HIS-L (such as pCM105) and one of the or or or minigenome constructions. When the minigenome was the alpha one (pCM112), the yCM112 recombinant yeast strain was obtained. It is deposited at the CNCM on Jan. 31, 2008 under N0 I-3908. When the minigenome was the one (pCM113), the yCM113 recombinant yeast strain was obtained. It is deposited at the CNCM on Jan. 31, 2008 under N0 I-3909.

(161) Generation of Yeast Strain W303-MV-NPL.sup.c

(162) The strain W303-1B (=ATCC 201238) with the genotype MATalpha leu2-3 leu2-112 trp1-1 ura3-1 his3-11 his3-15 ade2-1 can1-100 was co-transformed by pESC-LEU-N (such as pCM103), pESC-TRP-P (such as pCM104), the priming plasmid pESC-HIS-L-CAN1 (such as pCM201) and one of the ADE2 (pCM226/pCM227) based minigenomes constructions. When the minigenome was the alpha one (pCM112), the yCM226 recombinant yeast strain was obtained. It is deposited at the CNCM under N0 I-3910.

(163) Yeast Culture Conditions

(164) The yeast strain W303 was grown in YPD medium before plasmid transformation. W303-NPL.sub.MV was grown at 30 C. for 24 hours in 25 ml of defined medium to an optical density at TO of 0.5 or 5 10.sup.6 cells/ml (8 h in 2% Raffinose, we do not wash away the raffinose medium before the induction for 16 h in 2% Galactose+1% Raffinose) and were pelleted. The yeasts were cultured at 30 C. in defined drop out medium, with selected nutrients omitted (tryptophan, histidin, leucin, uracil, adenin) to provide selection for DNA plasmids. The Synthetic Complete drop-out Medium Mix was enriched 2 times for YNB (Yeast Nitrogen Base with Ammonium Sulfate and without Amino Acids) (Difco, France) and 4 times for amino-acids (Sigma, France). Galactose-inducible expression of KANMX4 was obtained by using a mix of 2% of galactose (Sigma, France) and 1% of raffinose (Sigma, France). KANMX4 expression was selected by growth in medium supplemented with 100 mg/I G418 geneticin (Invitrogen, France). CAN1 based plasmid was eliminated by growth in medium supplemented with 200 mg/I L-Canavanine sulfate salt (C9758, Sigma). The pH of medium was adjusted to 5.6 or 6.5. All plasmids were introduced into yeast by the transformation method described in Gietz et al (20).

(165) Yeast Culture Media

(166) YPD medium (growing yeast without plasmids before transformation): 20 g yeast extract (Difco), 40 g Peptone (Difco), 30 g Glucose, 200 mg adenine hemisulphate, 20 g Bacto-agar (Difco) and 1000 ml distilled water (final volume), filter sterilize.

(167) Synthetic complete drop-out medium (SG): 13.4 g YNB with ammonium sulfate, 10 g Galactose, 20 g Raffinose (Sigma R7630), 4 g Dropout AA, 20 g Bacto-agar (Difco) and 1000 ml distilled water (final volume). Adjust the pH to 5.6 or 6.5 with 10 N NaOH and filter sterilize.

(168) Synthetic complete drop-out medium (SD): 13.4 g YNB with ammonium sulfate, 30 g glucose, 4 g Dropout AA, 20 g Bacto-agar (Difco) and 1000 ml distilled water (final volume). Adjust the pH to 5.6 or 6.5 with 10 N NaOH and filter sterilize.

(169) Synthetic Complete Drop Out Mix: 2 g Arginine, 2 g Threonine, 2 g Cysteine, 2 g Isoleucine, 2 g Tyrosine, 2 g Glutamate, 2 g Lysine, 6 g Valine, 2 g Glutamine, 2 g Methionine, 2 g Alanine, 2 g Glycine, 3 g Phenylalanine, 2 g Aspartate, 2 g Proline, 2 g Serine and 2 g Asparagine.

(170) The different metabolites used in medium complementations are 100 concentrated and filter sterilized: Adenine 2.0 mg/ml, Uracil 2.0 mg/ml, Histidine HCl 4.0 mg/ml, Leucine 6.0 mg/ml, Tryptophan 6.0 mg/ml. One ml of metabolites stock was added per plate containing 25 ml medium.

(171) Transformation of Yeast

(172) Yeast was inoculated into 15 ml liquid medium (2YPD or 2SD selection medium) and incubated overnight on a shaker at 200 rpm and 30 C. The day after, cells were diluted to an OD600=0.5 in same medium and incubated under stirring (200 rpm) at 30 C. for 3-4 hours, until OD600 reaches 1. Cells were harvested by centrifugation (3000 g for 5 min), washed two times in 25 ml and 1 ml of sterile water and centrifuged for 15 sec. to collect cell pellet. Transforming plasmid mixtures prepared according to table were added to cell pellets.

(173) TABLE-US-00007 Reagents PEG 3500 50% w/v 240 l LiAc 1.0M 36 l Boiled SS-carrier DNA 50 l Plasmid DNA plus Water 34 l Total 360 l

(174) PEG (Sigma P3640), LiAc (Sigma L6883), SS-carrier DNA (DNA Sodium Salt Type III from Salmon Testes, Sigma D1626).

(175) Cells are resuspended by mixing vigorously and incubated at 42 C. for 40 min. The transformation mixture was removed by centrifugation and cells were washed with 1 ml sterile water before plating appropriate dilutions onto SD selection medium. After 3 to 4 days incubation at 30 C., the number of transformants was determined.

(176) RNA Expression Analysis by Reverse Transcription and Real-Time PCR Assay.

(177) The yeasts were grown at 30 C. for 24 hours in 25 ml of defined medium and were pelleted. We isolated total RNA using Trizol method (Invitrogen) followed by RNEASY (Qiagen), a silica-membrane spin column-based RNA purification kit, and prepared cDNA using SuperScript II reverse transcriptase (Invitrogen, France) (21). Quantitative PCR analysis was done using SYBR PCR Mix (Applied Biosystems, France) and the Abiprism 7000 machine (Applied Biosystems, France). Quantification is described in Miled et al (22). In all quantitative PCR calculations, the amount of nucleic acid material was standardized using oligonucleotide primers for yeast 18S RNA genes. All quantification data are presented as the standardized values, meanstandard deviation of triplicates.

(178) Oligonucleotides Used for qRT-PCR

(179) TABLE-US-00008 Genes Forward Reverse YeastSc18S 5GAATAAGGGTTCGATTCCGGAG 5CTGCCTTCCTTGGATGTGGTAG VirusMvSsN 5CCCTGGAGATTCCTCAATTACCA 5CCAATTAACCTCACCAACCGG VirusMvSsP 5CAGACGCGAGATTAGCCTCATT 5GGTTGCACCACCTGTCAATAAAG VirusMvSsL 5TGCTTATGAGAGCGGAGTAAGGA TACGGCTATGGTCTGATTGTCCC

(180) Primers are purchased from Sigma-Proligo, France.

(181) RNPs Purification from Yeast

(182) The frozen or unfrozen yeast cells were lysed in lysis buffer containing, 10% Glycerol, 0.2% TritonX-100 150 mM NaCl, 25 mM Tris(pH7.5), 1 mM EDTA, a Protease Inhibitor Cocktail and RNAases inhibitors. A cold lysis buffer was added to an equal volume of glass beads and vortexed on ice. The yeast extract containing RNPs particles was filtered to remove cellular debris and followed by centrifugation through a 30% sucrose cushion. The resulting preparation containing purified viral RNPs may be adjuvanted with any available adjuvant.

REFERENCES

(183) 1. A. Wach, A. Brachat, R. Pohlmann, P. Philippsen (1994). New heterologous modules for classical or PCR-based gene disruptions in Saccharomyces cerevisiae. Yeast 10, 1793. 2. A. Pekosz, B. He, R. A. Lamb (1999). Reverse genetics of negative-strand RNA viruses: closing the circle. Proc Natl Acad Sci USA 96, 8804. 3. K. K. Conzelmann (2004). Reverse genetics of mononegavirales. Curr Top Microbiol Immunol 283, 1. 4. M. J. Schnell, T. Mebatsion, K. K. Conzelmann (1994). Infectious rabies viruses from cloned cDNA. Embo J 13, 4195. 5. B. Suter, D. Auerbach, I. Stagljar (2006). Yeast-based functional genomics and proteomics technologies: the first 15 years and beyond. Biotechniques 40, 625. 6. J. T. Bryan (2007). Developing an HPV vaccine to prevent cervical cancer and genital warts. Vaccine 25, 3001. 7. I. Alves-Rodrigues, R. P. Galao, A. Meyerhans, J. Diez (2006). Saccharomyces cerevisiae: a useful model host to study fundamental biology of viral replication. Virus Res 120, 49. 8. M. Janda, P. Ahlquist (1993). RNA-dependent replication, transcription, and persistence of brome mosaic virus RNA replicons in S. cerevisiae. Cell 72, 961. 9. T. Panavas, P. D. Nagy (2003). Yeast as a model host to study replication and recombination of defective interfering RNA of Tomato bushy stunt virus. Virology 314, 315. 10. B. D. Price, R. R. Rueckert, P. Ahlquist (1996). Complete replication of an animal virus and maintenance of expression vectors derived from it in Saccharomyces cerevisiae. Proc Natl Acad Sci USA 93, 9465. 11. P. C. Angeletti, K. Kim, F. J. Fernandes, P. F. Lambert (2002). Stable replication of papillomavirus genomes in Saccharomyces cerevisiae. J Virol 76, 3350. 12. K. N. Zhao, I. H. Frazer (2002). Saccharomyces cerevisiae is permissive for replication of bovine papillomavirus type 1. J Virol 76, 12265. 13. V. Pantaleo, L. Rubino, M. Russo (2003). Replication of Carnation Italian ringspot virus defective interfering RNA in Saccharomyces cerevisiae. J Virol 77, 2116. 14. B. D. Price, L. D. Eckerle, L. A. Ball, K. L. Johnson (2005). Nodamura virus RNA replication in Saccharomyces cerevisiae: heterologous gene expression allows replication-dependent colony formation. J Virol 79, 495. 15. W. H. Mager, J. Winderickx (2005). Yeast as a model for medical and medicinal research. Trends Pharmacol Sci 26, 265. 16. A. B. Parsons, R. Geyer, T. R. Hughes, C. Boone (2003). Yeast genomics and proteomics in drug discovery and target validation. Prog Cell Cycle Res 5, 159. 17. S. Plumet, W. P. Duprex, D. Gerlier (2005). Dynamics of viral RNA synthesis during measles virus infection. J Virol 79, 6900. 18. D. B. Kushner, B. D. Lindenbach, V. Z. Grdzelishvili, A. O. Noueiry, S. M. Paul, P. Ahlquist (2003). Systematic, genome-wide identification of host genes affecting replication of a positive-strand RNA virus. Proc Natl Acad Sci USA 100, 15764. 19. C. Combredet, V. Labrousse, L. Mollet, C. Lorin, F. Delebecque, B. Hurtrel, H. McClure, M. B. Feinberg, M. Brahic, F. Tangy (2003). A molecularly cloned Schwarz strain of measles virus vaccine induces strong immune responses in macaques and transgenic mice. J Virol 77, 11546. 20. R. D. Gietz, R. H. Schiestl (2007). High-efficiency yeast transformation using the LiAc/SS carrier DNA/PEG method. Nat Protoc 2, 31. 21. D. K. Fogg, C. Sibon, C. Miled, S. Jung, P. Aucouturier, D. R. Littman, A. Cumano, F. Geissmann (2006). A clonogenic bone marrow progenitor specific for macrophages and dendritic cells. Science 311, 83. 22. C. Miled, M. Pontoglio, S. Garbay, M. Yaniv, J. B. Weitzman (2005). A genomic map of p53 binding sites identifies novel p53 targets involved in an apoptotic network. Cancer Res 65, 5096.