Interferon-alpha fusion protein in which cytoplasmic transduction peptide and polyethylene glycol are bonded to one another
09682152 ยท 2017-06-20
Assignee
Inventors
- Yong Soo BAE (Suwon-si, KR)
- Seung Ho Hong (Seongnam-si, KR)
- Young Hoon Kim (Namyangju-si, KR)
- Seung Soo Han (Seongnam-si, KR)
- Jin KIM (Seoul, KR)
Cpc classification
C07K2319/10
CHEMISTRY; METALLURGY
A61K47/60
HUMAN NECESSITIES
A61P1/16
HUMAN NECESSITIES
A61P35/00
HUMAN NECESSITIES
International classification
A61K38/16
HUMAN NECESSITIES
A61K38/03
HUMAN NECESSITIES
Abstract
The present invention relates to IFN- fusion protein in which a cytoplasmic transduction peptide (CTP) and polyethylene glycol (PEG) are bonded to an IFN- protein. The IFN- fusion protein of the present invention is characterized in that the specific activity of interferon remains high, the half-life of the INF- fusion protein is extended when delivered in vivo, and the mobility of the interferon in a liver is improved. The IFN- fusion protein of the present invention can be used in the development of protein drugs effective in preventing or treating liver diseases, including various types of viral infections or the like.
Claims
1. A fusion protein comprising interferon-alpha (IFN-) protein fused to a cytoplasmic transduction peptide (CTP) and polyethylene glycol (PEG), further comprising linkers, wherein the fusion protein is of the structure: CTP-X-IFN-Y-PEG, wherein the fusion protein comprises an amino acid sequence selected from the group consisting of SEQ ID NOs:15 to 20 and further comprises polyethylene glycol (PEG) bound thereto.
2. The fusion protein of claim 1, wherein, the polyethylene glycol (PEG) is linear PEG.
3. The fusion protein of claim 1, wherein, the molecular weight of the PEG is 20 to 60 kDa.
4. A nucleic acid molecule coding a peptide moiety of the formula: CTP-X-IFN-Y within the fusion protein of claim 1.
5. A vector comprising the nucleic acid molecule of claim 4.
6. A transformant transformed with the vector of claim 5.
7. A pharmaceutical composition comprising: (a) a pharmaceutically effective amount of the fusion protein of claim 1; and (b) a pharmaceutically acceptable carrier.
8. A method of treating liver disease in a patient with liver disease, the method comprising administering a pharmaceutical composition of claim 7 to the patient with liver disease.
9. The method of claim 8, wherein the liver disease is a hepatoma cancer or hepatitis.
10. The method of claim 8, wherein the hepatitis is hepatitis type C caused by Hepatitis C virus (HCV).
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
MODE FOR CARRYING OUT THE INVENTION
(6) Hereinafter, the present invention will be described in more detail with reference to examples. These examples are provided to only specifically describe the present invention, and it will be obvious to a person skilled in the art that the scope of the present invention is not limited to the examples according to the essential features of the present invention.
EXAMPLE
Example 1: Synthesis of CTP Fusion IFN Gene Through Polymerase Chain Reaction (PCR)
(7) A CTP peptide was inserted to an N-terminal of human-derived Interferon- (IFN), and a glycine linker including 4 or 6 glycines was inserted between CTP and IFN. By using the glycine linker to link CTP and IFN, flexibility was imparted to the CTP peptide so that a function of CTP peptide was facilitated, and precipitation during purification due to hydrophobic CTP was minimized. In addition, by inserting cysteine to a C-terminal of the IFN gene through the PCR method, PEG may be attached to the C-terminal through a maleimide PEG reaction. In vivo half-life may be significantly increased by attaching linear PEG to the C-terminal.
(8) At first, to insert the glycine linker between IFN and the CTP peptide attached to the N-terminal of IFN, PCR was performed by using the primer described in Table 1 below.
(9) A first PCR was performed by using PR2 and PR3 primers and IFN as a template. A second PCR was performed by using PR1 and PR2 primers and the produced PCR product as a template again. A final product thus obtained was a nucleic acid molecule coding the peptide CTP-GGGGGG-IFN to which a linker including six glycines was linked. The final product, i.e., the CTP-GGGGGG-IFN protein was named as CFN7 (SEQ ID NO: 32).
(10) A first PCR was performed by using PR2 and PR4 primers and IFN as a template. A second PCR was performed by using PR1 and PR2 primers and the produced PCR product, as a template again. A final product thus obtained was a nucleic acid molecule coding CTP-GGGG-IFN to which a linker including four glycines was linked. The final product, i.e., the CTP-GGGG-IFN protein was named as CFN8 (SEQ ID NO: 33).
(11) To insert a hepsin cleavage sequence between IFN and the CTP peptide attached to the N-terminal of IFN, PCR was performed by using the primer described in Table 1 below. A first PCR was performed by using PR2 and PR5 primers and IFN as a template. A second PCR was performed by using PR1 and PR2 primers and the produced PCR product, as a template again. A final product thus obtained was a nucleic acid molecule coding CTP-KQLRVVNG-IFN which was a peptide to which a linker including the hepsin cleavage sequence was linked. The final product, i.e., the CTP-KQLRVVNG-IFN protein was named as CFN11 (SEQ ID NO: 34).
(12) To co-insert glycine and the hepsin cleavage sequence between IFN and the CTP peptide attached to the N-terminal of IFN, PCR was performed by using the primer described in Table 1 below. A first PCR was performed by using PR2 and PR7 primers and IFN, as a template. A second PCR was performed by using PR1 and PR2 primers and the produced PCR product, as a template again. A final product thus obtained was a nucleic acid molecule coding the peptide CTP-GGGGKQLRVVNGGGG-IFN in which linkers respectively including four glycines and three glycines were linked at both sides of the hepsin cleavage sequence. The final product, i.e., the CTP-GGGGKQLRVVNGGGG-IFN protein was named as CFN12 (SEQ ID NO: 35).
(13) To co-insert glycine and a hepatocyte growth factor activator between IFN and the CTP peptide attached to the N-terminal of IFN, PCR was performed by using primers described in Table 1 below. A first PCR was performed by using PR2 and PR8 primers and IFN as a template. A second PCR was performed by using PR1 and PR2 primers and the produced PCR product as a template again. A final product thus obtained was a nucleic acid molecule coding CTP-AKTKQLRVVNGGGG-IFN which was a peptide to which a linker including the hepatocyte growth factor activator and three glycines was linked. The final product i.e., the CTP-AKTKQLRVVNGGGG-IFN protein was named as CFN13 (SEQ ID No: 36).
(14) Structures of CFN7, CFN8, CFN11, CFN12, and CFN13 thus constructed were shown in
(15) TABLE-US-00001 TABLE1 SEQ Primer ID. name Basesequenceofprimer NO. Note PR1 5-TAATCTAGAAAAAACCAAGGA 23 GGTAATAACATATGTATGGTCGTC GTGCACGT-3 PR2 5-CAAGGATCCCTCGAGCTATTA 24 TTCTTTGCTACGCAGGCT-3 PR3 5-TATGGTCGTCGTGCACGTCGT 25 CFN7 CGTCGTCGTCGTGGTGGTGGTGGT GGTGGTTGCGATCTGCCGCAG ACC-3 PR4 5-TATGGTCGTCGTGCACGTCGT 26 CFN8 CGTCGTCGTCGTGGTGGTGGTGGT TGCGATCTGCCGCAGACC-3 PR5 5-TATGGTCGTCGTGCACGTCGT 27 CFN11 CGTCGTCGTCGTaaaCAGCTGCGT GTGGTGAACGGTTGCGATCTGCCG CAGACC-3 PR6 5-TATGGTCGTCGTGCACGTCGT 28 CFN12 CGTCGTCGTCGTGGTGGTGGTGGT AAACAGCTGCGTGTGGTGAACGGT GGTGGTGGTTGCGATCTGCCGCAG ACC-5 PR7 5-TATGGTCGTCGTGCACGTCGT 29 CFN13 CGTCGTCGTCGTGCAAAAACCAAA CAGCTGCGTGTGGTGAACGGTGGT GGTGGTTGCGATCTGCCGCAG ACC-5
(16) Then, PCR was performed to insert cysteine to the C-terminal. A final product thus obtained was a nucleic acid molecule coding CTP-GGGG-IFN-C in which cysteine was inserted to the C-terminal of the CTP-GGGG-IFN gene by using PR8 and PR9 primers and CTP-GGGG-IFN having a glycine linker of 4 glycines linked thereto as a template. The final product, i.e., the CTP-GGGG-IFN-C protein was named as CFN8C (SEQ ID NO: 18).
(17) TABLE-US-00002 TABLE2 SEQ Primer ID. name Basesequenceofprimer NO. Note PR8 5-CTAGTCTAGAAAAAACCAA 30 GGAGGTAATAACATATGTATG-3 PR9 5-CGCGGATCCCTATTAGCA 31 CFN8C ACCACCACCACCTTCTTTGCT ACGCAGGCTTTCTTGC-3
Example 2: Preparation of E. coli Expression Vector of Interferon-Alpha Fusion Protein
(18) To express, in E. coli, genes respectively coding CFN7 (CTP-GGGGGG-IFN), CFN8 (CTP-GGGG-IFN), CFN8C (CTP-GGGG-IFN-C), CFN11 (CTP-KQLRVVNG-IFN), CFN12 (CTP-GGGGKQLRVVNGGGG-IFN), and CFN13 (CTP-AKTKQLRVVNGGGG-IFN) obtained by PCR, genes were respectively cloned to pCFM536s, which is an E. coli expression vector, to construct pCFM536-CFN7, pCFM536-CFN8, pCFM536-CFN8C, pCFM536-CFN11, pCFM536-CFN12, and pCFM536-CFN13 expression vectors.
(19) Firstly, CFN7 (CTP-GGGGGG-IFN), CFN8 (CTP-GGGG-IFN), CFN8C (CTP-GGGG-IFN-C), CFN11 (CTP-KQLRVVNG-IFN), CFN12 (CTP-GGGGKQLRVVNGGGG-IFN) and CFN13 (CTP-AKTKQLRVVNGGGG-IFN) PCR products were respectively cloned to pGEM-T vectors, and base sequences thereof were analyzed. Therefore, pGEM-CFN7, pGEM-CFN8, pGEM-CFN8C, pGEM-CFN11, pGEM-CFN12, and pGEM-CFN13 recombinant vectors were obtained which were synthesized without a modification in the desired amino acid sequence. From the recombinant pGEM-CFN7, pGEM-CFN8 and pGEM-CFN8C vectors, inserts were obtained through XbaI and BamHI restriction enzymes, which were included in primers during PCR. Then, the inserts were introduced to pCFM536 vectors to respectively derive expression vectors which were pCFM536-CFN7, pCFM536-CFN8, pCFM536-CFN8C, pCFM536-CFN11, pCFM536-CFN12 and pCFM536-CFN13.
Example 3: Evaluation and Expression of Interferon-Alpha Fusion Protein in E. coli
(20) POP2136 competent cells were transformed with pCFM536 vectors, to which CFN7, CFN8, CFN8C, CFN11, CFN12, and CFN13 genes, as prepared in Example 2 were cloned, and then spread on a solid medium having ampicillin added thereto. A colony grown in the solid medium was obtained, inoculated to LB broth medium, and cultured for 18 hours at 30 C. When optical density at 600 nm of wavelength became 0.4 to 0.6, the temperature was raised to 42 C. to induce expression. Culture was continued for additional four hours, and protein expression from the cultured cells was evaluated through SDS-PAGE analysis.
Example 4: Mass Production of Interferon-Alpha Fusion Protein
(21) To prepare a large amount of an IFN fusion protein, mass culture and purification were performed by using a 5 L fermentation reactor.
(22) 1. Mass Culture Using 5 L Fermentor
(23) To prepare a large amount of an IFN fusion protein by culturing a producing strain, mass culture was performed by using a 5 L fermentor (Biostat B, B. Braun Biotech International). Firstly, a strain, which was proven to express the IFN fusion protein, was constructed to master cell bank (MCB) and working cell bank (WCB), and stored at 80 C. A day before main culture, the stored WCB was inoculated to 100 ml of 2YT medium (tryptone 16 g/L, yeast extract 10 g/L, and NaCl g/L) to which ampicillin was added such that a concentration of ampicillin became 50 g/ml, and cultured for 16 hours at 30 C. For main culture, a culture medium was prepared by adding ampicillin to 3 L of 2YT medium (tryptone 16 g/L, yeast extract 10 g/L, and NaCl 5 g/L) such that a concentration of ampicillin became 50 g/ml. As the initial main culture condition, temperature of 30 C., pH 6.8, and vvm 1 were used, and DO was not dropped to 50% or less. An OD value was measured at one hour interval. When the OD value became 10, an additional medium was added, and culture temperature was raised to 42 C. to induce expression. After induction of expression, the OD value was measured at one hour interval, and culture was terminated at the section where the OD value was not increased any more.
(24) 2. Isolation of Inclusion Body and Refolding
(25) Cells were collected from cell culture medium above, and collected cells were washed with PBS. Cells were floated in inclusion body washing solution 1 [50 mM Tris (pH 8.0), 1% Triton X-100], disrupted by using a cell disrupter, and then centrifuged to collect an insoluble inclusion body fraction. The insoluble inclusion body fraction was collected by performing the washing process in an order of cell floating, stirring, washing, and centrifuging by sequentially using inclusion body washing solution 1 to 4 [washing solution 1: 50 mM Tris (pH 8.0), 1% Triton X-100, washing solution 2: 50 mM Tris, 1% Triton X-100, 0.1 M NaCl (pH 8.0), washing solution 3: 50 mM Tris, 1% Triton X-100, 0.2 M NaCl (pH 8.0), washing solution 4: 50 mM Tris, 1% Triton X-100, 0.3 M NaCl (pH8.0)].
(26) To obtain a structurally active IFN fusion protein, isolated inclusion bodies were respectively dissolved in a solubilization buffer which was optimized by each type, and stirred in a respective refolding buffer to perform refolding. The buffers used in solubilization and refolding of each inclusion body of IFN were shown in Table 3 below.
(27) TABLE-US-00003 TABLE 3 Solubilization Refolding Type buffer Refolding buffer condition IFN 50 mM Glycine, 50 mM Glycine, Stirring at 8M Urea 2M Urea room (pH 11.0) (pH 9.5) temperature for 24 hours CFN7 50 mM tris-HCl, 50 mM tris-HCl, Stirring at CFN8 5 mM EDTA 1 mM EDTA, 2M 4 C. CFN8C 8M Urea Urea, 10% Sucrose, temperature CFN11 (pH 11.0) 0.1 mM oxidized for 24 hours CFN12 glutathione, CFN13 1 mM reduced glutathione (pH 8.0)
(28) For collection of a protein, cells were floated by adding 0.5 ml of deionized distilled water, and the inclusion body was dissolved by adding a solubilization buffer [6 M Guanidine, 50 mM Tris, 2.5 mM EDTA (pH 9.5)] by 1 ml-basis such that guanidine has the final concentration of 6 M. After completely dissolving the inclusion body by stirring at least four hours, centrifugation (12,000 rpm, 4 C., 30 min) was performed, and supernatant was filtered out by using a 0.2 m filter.
(29) The completely dissolved inclusion body was refolded by the dilution method. In the refolding buffer (50 mM Tris, 1 mM GSH, 0.2 mM GSSG, 1 mM EDTA, 5% Sucrose, pH 8.0), which has a final guanidine concentration of 1.5 M, the inclusion body was slowly mixed and reacted for 24 hours. After completion of the reaction, acetic acid was added to the sample to adjust pH to 4.0. After additional reaction for at least two hours, the reactant was filtered with 0.2 m filter. Refolding was evaluated by using RP-HPLC.
(30) 3. High-Purity Purification by Using Chromatography
(31) After refolding was performed by the method above, to purify a structurally and normally refolded CTP-X-IFN-Y protein at high purity, desalting and cation-exchange chromatography were performed.
(32) The completely refolded CTP-X-IFN-Y protein was dialyzed for 16 hours in a column binding buffer (50 mM Sodium Citrate-Citric acid, and 1 mM EDTA, pH 4.0) to remove 1.5 M of guanidine. A column filled with 10 ml sepharose cation chromatograph resin was installed in FPLC. The column was equilibrated with the column binding buffer (50 mM Sodium Citrate-Citric acid, 1 mM EDTA, pH 4.0), and then sample was loaded on the column. The sample bound to the column was separated by using a concentration gradient buffer (50 mM Sodium Citrate-Citric acid, 1 mM EDTA, and 1 M NaCl, pH 4.0). The separated and purified protein was evaluated by using HPLC analysis. The concentration of the separated sample was measured by using Bradford method and UV spectrometer at 595 nm.
Example 5: Structural Analysis of Interferon-Alpha Fusion Protein
(33) A secondary structure of an IFN fusion protein, which was constructed by binding a linker as described in the Example above, was analyzed. Analysis of the secondary structure was performed by using interferon (IFN), as a control, CFN1 (CTP-IFN), CFN7 (CTP-GGGGGG-IFN), CFN8 (CTP-GGGG-IFN), and Hepsin Cleavage linker-inserted CFN11, CFN12, CFN13. A secondary structure of a protein was analyzed by using a CD spectrophotometer (Jasco-815). A final concentration of a protein to be analyzed was adjusted to 1 mg/ml in 50 mM sodium citrate-citric acid, and 1 mM EDTA (pH4.0). Then, a spectrum was obtained in a range of 190 nm to 250 nm by using quartz cells having a path length of 0.1 cm with 0.2 nm resolution, 1.0 nm bandwidth, and 50 nm/min scan speed at 25 C.
(34) As a result obtained by analyzing the spectrum shown in
Example 6: Pegylation of Interferon-Alpha Fusion Protein
(35) Linear PEG or branched PEG having molecular weight of 30 kDa or 40 kDa was PEGylated at an N-terminal, a C-terminal, or an internal portion. N-terminal PEGylation was a form to which PEG was attached to a head of CTP of an IFN fusion protein, and internal PEGylation (random PEGylation) was a form in which PEG was randomly attached to a lysine residue within the IFN fusion protein. Further, C-terminal PEGylation was a form in which linear PEG or branched PEG was attached to the C-terminal of the IFN fusion protein (see
(36) For N-terminal PEGylation, a buffer for the IFN fusion protein CFN8 (CTP-GGGG-IFN, SEQ ID NO: 33) was replaced by 50 mM sodium phosphate (pH 4.5) buffer. The IFN fusion protein CFN8 was mixed with aldehyde-PEG at a ratio of 1:10. To this mixture, 1 M NaBH.sub.3CN was added as a reducing agent such that the mixture has the final concentration of 20 mM, and the resultant was reacted for two hours at the room temperature. PEGylation degree was evaluated through SDS-PAGE, and a PEGylated protein was finally separated by using cation exchange chromatography and gel filtration chromatography. PEGylation yield was about 40%.
(37) For internal PEGylation, a buffer for the IFN fusion protein CFN8 (CTP-GGGG-IFN, SEQ ID NO: 33) was replaced by 50 mM sodium phosphate (pH 7.5) buffer. PEG-NHS ester was mixed at a ratio of 1:10. To this mixture, 1 M NaBH.sub.3CN was added as a reducing agent such that the mixture has the final concentration of 20 mM, and the resultant was reacted for two hours at the room temperature. 2 M glycine was added to stop the reaction, and PEGylation degree was evaluated with SDS-PAGE. A PEGylated protein was finally separated through cation exchange chromatography and gel filtration chromatography. PEGylation yield was about 17%.
(38) Among IFN fusion proteins, C-terminal PEGylation was performed to the CFN8C (CTP-GGGG-IFN-C, SEQ ID NO: 18) protein having cysteine added to the c-terminal of IFN. PEG was attached to bind to cysteine produced at the C-terminal of CFN8C (CTP-GGGG-IFN-C) by using Maleimide-PEG. The protein and PEG were mixed at a ratio of 1:10. The 1 M sodium phosphate (pH 8.0) buffer was added to have the final concentration of 100 mM, and the resultant was reacted for two hours. PEGylation degree was evaluated through SDS-PAGE, and a PEGylated protein was finally separated by using cation exchange chromatography and gel filtration chromatography. PEGylation yield was about 25%.
(39) Respective preparation yields depending on methods of PEGylation were shown in Table 4 below.
(40) TABLE-US-00004 TABLE 4 PEG-CFN8 or Functional Functional CFN8C- PEGylation group group Candidate CFN8 CFN8C PEG Yield method (protein) (PEG) material (mg) (mg) (mg) (%) N-terminal Amine Aldehyde 301N-PEG linear 26 2.6 10 PEGylation type Di-PEG linear 1.5 6 type 401N-PEG linear 10 2.0 20 type 202N-PEG branch 10 4.0 40 type Random Amine NHS-ester 202K-PEG branch 10 1.6 17 PEGylation type [2 + 4] K-PEG branch type C-terminal Thiol Maleimide 401C-PEG linear 9 2.2 25 PEGylation type 202C-PEG branch 9 1.6 19 type
Example 7: Anti-Viral Activity Measurement of Interferon-Alpha Fusion Protein
(41) 1. Method of Measuring Anti-Viral Activity
(42) Anti-viral activities of prepared interferon-alpha fusion proteins were measured by in vitro experiment. The anti-viral activity was measured by degree of abilities of interferon-alpha fusion proteins to alleviate a cytopathic effect caused by vesicular stomatitis virus (VSV) (Korean cell line bank) infection on Madin-Darby bovine kidney (MDBK) (Korean cell line bank) cells.
(43) Firstly, MDBK cells were diluted to 1.010.sup.5 cells/ml in DMEM medium. Then 200 l of cells were seed on each well of a 96-well plate, and cultured for 18 hours in a 37 C., 5% CO.sub.2 incubator. For a protein, 5000 pg/ml concentration of the interferon-alpha fusion protein, blood diluted to 1/50, a liver sample diluted to 1/10 were prepared, and serially diluted to 1/2. Then, cells were treated with 100 l of resultant diluents. A reaction was induced for four hours at 37 C. under 5% CO.sub.2. Thereafter, VSV was diluted to 0.01 multiplicity of infection (MOI), and added to each cell of the 96-well plate in an amount of 100 l. After VSV infection, culture was continued for about additional 18 hours to trigger the cytopathic effect. At the end of culture, cells were washed twice with PBS, and fixed by adding 200 l of 4% formaldehyde to each well. After two times of washing with PBS, 100 l of 0.05% of crystal violet was added to each well to stain the resultant for 30 minutes. After two times of washing using PBS, drying was performed for 30 minutes. To each well, 100 l of 80% ethanol was added to dissolve the staining agent, and optical density at 570 nm was measured. The activity was measured by using a well showing 50% of the cytopathic effect, as a standard, compared with an uninfected control.
(44) 2. Anti-Viral Activity Measurement Result Depending on Interferon-Alpha Fusion Protein Form
(45) By the measurement method above, activities of interferon-alpha fusion proteins, which were CFN 7, CFN 8, CFN 11, CFN 12, and CFN 13, were measured, and the result were shown in Table 5 below.
(46) TABLE-US-00005 TABLE 5 Fusion Relative activities protein on IFN (%) IFN 100 CFN7 57.6 CFN8 90.7 CFN8C 95.0 CFN11 40.8 CFN12 43.6 CFN13 34.2
(47) 3. Anti-Viral Activity Measurement Result According to PEGylation of Interferon-Alpha Fusion Protein
(48) By the measurement method above, measured was an anti-viral activity of the interferon-alpha fusion protein according to differences in the size of PEG and a method for PEGylation.
(49) Measurement of the anti-viral activity was performed on standard IFN which was an IFN protein having no CTP and PEG attached thereto; an IFN fusion protein (CTP-X-IFN-Y protein) in which CTP was attached to an N-terminal while PEG was not attached; Di-PEG, 202K, [2+4]K, 401C, and 202C which were IFN fusion proteins in which PEG was attached to an N-terminal or a C-terminal of the CTP-X-IFN-Y protein in various forms.
(50) The Di-PEG fusion protein was an IFN fusion protein in which two linear PEGs (30 kDa) were respectively bound to an amine group (NH.sub.2) of an N-terminal of the CFN8 protein, and an amine group (NH.sub.2) of an internal lysine residue of the protein; the 202K fusion protein was an IFN fusion protein in which two linear PEGs (20 kDa) were simultaneously bound to the amine group (NH.sub.2) of the internal lysine of the CFN8 protein; the [2+4]K fusion protein was an IFN fusion protein in which two linear PEGs (5 kDa) and four linear PEGs (7.5 kDa) were simultaneously bound to an amine group (NH.sub.2) of the internal lysine residue of the CFN8 protein; the 401C fusion protein was an IFN fusion protein in which one linear PEG (40 kDa) was bound to a sulfhydryl (SH) group of a C-terminal cysteine residue of the CFN8C protein; and the 202C fusion protein was an IFN fusion protein in which two linear PEGs (20 kDa) were simultaneously bound to sulfhydryl (SH) group of a C-terminal cysteine residue of the CFN8C protein.
(51) As the result described in Table 6 below, comparing with standard IFN, the anti-viral activity of the IFN fusion protein to which PEG was not bound was similar to the activity of standard IFN. On the other hand, although IFN fusion protein having PEG bound thereto showed various activity values depending on the binding method and types of PEG, all activities thereof were reduced with respect to the standard to which PEG was not attached.
(52) Further, anti-viral activities of 401C, which is the IFN fusion protein of the present invention, and PEGASYS (Hoffman LaRoche Ltd.), which is a commercially available PEG attached IFN drug, were measured and compared. PEGASYS is an IFN fusion protein in which branched PEG (20 kDa) was randomly bound to the IFN protein. Consequently, as shown in Table 6 below, it has been proven that the 401C fusion protein of the present invention showed the anti-viral activity three times higher than PEGASYS (Hoffman LaRoche Ltd.).
(53) TABLE-US-00006 TABLE 6 Activity Protein rate (%) Standard IFN 100.0 PEG CFN8(CTP- CFN8C(CTP- 95 unattached GGGG-IFN) GGGG-IFN-C) Various Di-PEG 16.7 forms of 202N 57.2 PEG 202K 22.1 attached [2 + 4]K 17.8 protein 401C 32.4 202C 39.0 PEGASYS 10.8
Example 8: Pharmacokinetic Property Measurement of Interferon-Alpha Fusion Protein
(54) 1. Pharmacokinetic Data of Mouse
(55) Three mice per group were used as a control or an experimental group. A mouse was subcutaneously injected with 30 g of each interferon-alpha fusion protein sample to a posterior region of neck on time basis (4 h, 8 h, 12 h, 1 d, 2 d, 3 d, 4 d, and 5 d). Samples used in the experiment were as follows: 202K, 202C and 401C fusion proteins as experimental groups; and PEGASYS (Hoffman LaRoche Ltd.) which is a PEG attached IFN drug as a control. PEGASYS is an IFN fusion protein in which branched PEG of 20 kDa was randomly bound to the IFN protein. After the sample was injected, 1 ml of blood was taken from orbit of the mouse at each time point, stayed in ice for one hour, and then centrifuged (13,000 rpm, 4 C., 0.5 h) to collect serum alone. The collected serum was diluted to 1/50 to measure an anti-viral activity. Results of measurement were shown in Table 7 below. As shown in Table 7, it has been proven that the 401C form showed higher activities in blood and liver, and a higher rate of activity in liver to activity in blood than 202K or PEGASYS.
(56) 2. Pharmacokinetic Data of Monkey
(57) Two monkeys were used as one group. A monkey was subcutaneously injected with 300 g/kg of each sample to a posterior region of neck on time basis (4 h, 8 h, 12 h, 1 d, 2 d, 3 d, 4 d, 5 d, and 6 d). As samples, PEGASYS, and the PEG attached IFN fusion protein, i.e., 401C were used, wherein, 401C was an experimental group and PEGASYS, which is a commercially available IFN- drug, was used as a control. Prior and post injection, about 2.5 ml of blood was taken from a hind leg vein of the monkey at each time point, stayed in ice for one hour, and centrifuged (13,000 rpm, 4 C., 0.5 h) to collect serum alone. Serum was diluted to 1/50 to measure an anti-viral activity. The result of measurement was shown in
(58) In accordance with pharmacokinetic of the interferon-alpha fusion protein of the present invention, i.e., 401C, using a monkey, in an early phase of drug administration, i.e., within three days of administration of the interferon-alpha fusion protein of the present invention 401C, the effect of increasing an initial activity after drug administration similar to that of PEGINTRON (which is a therapeutic agent for hepatitis, Merck & Co., Inc) was showed, and a late phase of drug administration, i.e., within 4 to 7 days after administration, stability similar to that of PEGASYS (which is a therapeutic agent for hepatitis, Hoffman LaRoche Ltd.) was showed (see
Example 9: Measurement of Ability of Interferon Alpha Fusion Protein to Migrate to Liver
(59) Three mice per group were subcutaneously injected with 30 g of each sample to a posterior region of neck of the mouse on time basis (4 h, 8 h, 12 h, 1 d, 2 d, 3 d, 4 d, and 5 d). Samples used in the experiment were as follows: 202K, 202C and 401C fusion proteins as experimental group; and PEGASYS (Hoffman LaRoche Ltd.) which is a PEG attached IFN drug as a control. After injection, liver perfusion was performed at each time point by infusing cold-stored PBS into a blood vessel of liver after incising abdomen of the mouse. After removing blood from liver, whole liver was dissected, and placed into 10% sucrose buffer. Then liver was washed with PBS two times. Liver was placed to the PBS buffer containing a protease inhibitor, and then disrupted by a disrupter. 400 l of the 10RIPA buffer was added and mixed to become the 1RIPA buffer. About 1.2 ml per sample was aliquoted to three 1.5 ml tubes, and stored for 12 hours at 4 C. After centrifugation (13,000 rpm, 4, 0.5 h), only 700 l of supernatant was collected from each tube, and thus about 2 ml for each sample was collected. 1 ml of the sample was purified through FPLC (using Hi-trap desalting column, fixed flow of 3). To measure an amount of a collected protein fraction, area under concentration (AUC) was measured to calculate dilution fold. [ELISA measured value (ng/ml)22total disrupted volume (ml)]/[weight of liver (g)(amount of protein obtained by FPLC purification)/(total amount of FPLC purified protein)]=ng/g of liver. Using liver extracts at each time point, the activity of interferon- was measured, and thus abilities of the PEG-attached interferon- fusion protein and the commercial drug, PEGASYS, to migrate into liver were compared and evaluated.
(60) As shown in results of
(61) Table 7 below shows results comparing the activity values of 401C and 202K, which are pharmacokinetically best experimental groups, with the activity value of PEGASYS which is a control. Consequently, 401C showed the most excellent pharmacokinetic activity in liver and blood when compared with the experimental group, as well as, the control.
(62) TABLE-US-00007 TABLE 7 Activity in Activity in liver blood (AUC) (AUC) (IU .Math. d/ml) (IU .Math. d/g liver) Fold Fold Activity in comparing comparing liver/ Fusion Measured to Measured to Activity in protein value PEGASYS value PEGASYS blood (%) 401C 850,333 3.7 32,986 13 3.87 202C 1,084,000 4.8 2,078 0.84 0.19 202K 704,042 3.1 14,150 5.7 2.00 202N 62,767 0.3 0 0 0 PEGASYS 225,267 1.0 2,463 1.0 1.09
(63) To sum up, the present invention relates to an interferon alpha fusion protein having improved retention property and ability to migrate to liver. The present invention was completed by selecting a linker which does not induce a structural modification based on the structure of the interferon-alpha fusion protein depending on types and sizes of the linker to link the fusion protein, and demonstrating that the activity of the interferon alpha protein, the interferon alpha protein's ability to migrate to liver, and retention property of the interferon alpha protein are improved through the in vivo and in vitro properties of the fusion protein. Further, the fusion protein according to one example of the present invention has the improved activity and half-life comparing with the convention fusion protein. Also, preparation and quality control of the fusion protein according to one example of the present invention is easy. Therefore, the fusion protein according to one example of the present invention may be usefully applied as a composition for treating liver diseases.
(64) Hitherto, specific features of the present invention are described in detail. However, it would be apparent to a person skilled in the art that the specific description is preferable embodiment only, and the scope of the invention is not limited thereto. Therefore, substantial scope of the present invention would be defined by accompanying claims and equivalents thereof.