T CELL EPITOPES OF HCMV AND USES OF THEREOF

Abstract

The present invention relates to relates to T cell epitope peptides, proteins, nucleic acids and cells for use in immunother-apeutic methods. In particular, the present invention relates to the immunotherapy of viral infection. The present invention specifically relates to virus-associated T-cell peptide epitopes, alone or in combination with other virus-associated peptides that can serve as active pharmaceutical ingredients of vaccine compositions that stimulate anti-viral immune responses, or to stimulate T cells ex vivo and transfer into patients. Peptides bound to molecules of the major histocompatibility complex (MHC), or peptides as such, can also be targets of antibodies, soluble T-cell receptors, and other binding molecules.

Claims

1-22. (canceled)

23. A peptide comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 101, and variant sequences of SEQ ID NO: 1 to SEQ ID NO: 101 that comprise one amino acid exchange and bind to molecule(s) of the major histocompatibility complex (MHC) and/or induce T cells cross-reacting with said variant peptide, and pharmaceutical acceptable salts thereof, wherein said peptide has an overall length of between 8 and 30 amino acids.

24. The peptide or variant according to claim 23, wherein said peptide consists of an amino acid sequence according to any of SEQ ID NO: 1 to SEQ ID NO: 100 and optionally comprising an extension of one N- and/or one C-terminal amino acid.

25. The peptide or variant according to claim 23, wherein the amino acid sequence is selected from SEQ ID NO: 1 to 4, 24 to 29, 40, 41, 51 to 55, 67, 68, 80, 87 to 89, and 99 to 101.

26. The peptide or variant thereof according to claim 23, wherein said peptide is modified and/or includes non-peptide bonds.

27. The peptide or variant thereof according to claim 23, wherein said peptide is part of a fusion protein, comprising the N-terminal amino acids of the HLA-DR antigen-associated invariant chain (li).

28. A soluble or membrane-bound antibody, that specifically binds to the peptide or variant thereof according to claim 23, and/or the peptide or variant thereof when bound to an MHC molecule.

29. A recombinant, soluble or membrane-bound T cell receptor that is reactive with an HLA ligand, wherein said ligand is at least 75% identical to an amino acid sequence according to claim 24.

30. The T cell receptor according to claim 29, wherein said T cell receptor is a soluble molecule, and optionally comprises an effector function.

31. A nucleic acid encoding: a peptide or variant thereof according to claim 23; a soluble or membrane-bound antibody that specifically binds to the peptide or variant thereof according to claim 23 and/or a peptide or variant thereof when bound to an MHC molecule; or a recombinant, soluble or membrane-bound T cell receptor that is reactive with an HLA ligand, wherein said ligand is at least 75% identical to an amino acid sequence according to any of SEQ ID NO: 1 to SEQ ID NO: 100, and optionally comprising an extension of one N- and/or one C-terminal amino acid; wherein said nucleic acid is optionally linked to a heterologous promoter sequence.

32. An expression vector expressing the nucleic acid according to claim 31.

33. A recombinant host cell comprising: a recombinant peptide according to claim 23; a soluble or membrane-bound antibody that specifically binds to the peptide or variant thereof according to claim 23, and/or a peptide or variant thereof when bound to an MHC molecule; a recombinant, soluble or membrane-bound T cell receptor that is reactive with an HLA ligand, wherein said ligand is at least 75% identical to an amino acid sequence according to any of SEQ ID NO:1 to SEQ ID NO:100 and optionally comprising an extension of one N- and/or one C-terminal amino acid; a nucleic acid encoding a peptide or variant thereof according to claim 23; a soluble or membrane-bound antibody that specifically binds to the peptide or variant thereof according to claim 23; a recombinant, soluble or membrane-bound T cell receptor that is reactive with an HLA ligand, wherein said ligand is at least 75% identical to an amino acid sequence according to any of SEQ ID NO: 1 to SEQ ID NO: 100 and optionally comprising an extension of one N- and/or one C-terminal amino acid; wherein said nucleic acid is optionally linked to a heterologous promoter sequence.

34. A method for producing: a peptide comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 101, and variant sequences of SEQ ID NO: 1 to SEQ ID NO: 101 that comprise one amino acid exchange and bind to molecule(s) of the major histocompatibility complex (MHC) and/or induce T cells cross-reacting with said variant peptide, wherein said peptide has an overall length of between 8 and 30 amino acids; a soluble or membrane-bound antibody, that specifically binds to said peptide or variant thereof, and/or said peptide or variant thereof when bound to an MHC molecule; or a recombinant, soluble or membrane-bound T cell receptor that is reactive with an HLA ligand, wherein said ligand is at least 75% identical to an amino acid sequence according to any of SEQ ID NO:1 to SEQ ID NO:100 and optionally comprising an extension of one N- and/or one C-terminal amino acid; the method comprising culturing the host cell according to claim 33 that presents said peptide; or expresses said nucleic acid; and isolating said peptide or variant thereof, said antibody, or said T cell receptor from said host cell and/or its culture medium.

35. An in vitro method for producing activated T lymphocytes, the method comprising contacting in vitro T cells with antigen loaded human class I or II MHC molecules expressed on the surface of a suitable antigen-presenting cell or an artificial construct mimicking an antigen-presenting cell for a period of time sufficient to activate said T cells in an antigen specific manner, wherein said antigen is a peptide according to claim 23.

36. An activated T lymphocyte, produced by the method according to claim 35, that selectively recognizes a cell that presents a peptide comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 101, and variant sequences of SEQ ID NO: 1 to SEQ ID NO: 101 that comprise one amino acid exchange and bind to molecule(s) of the major histocompatibility complex (MHC) and/or induce T cells cross-reacting with said variant peptide, wherein said peptide has an overall length of between 8 and 30 amino acids.

37. A pharmaceutical composition comprising at least one active ingredient selected from the group consisting of: a peptide comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 101, and variant sequences of SEQ ID NO: 1 to SEQ ID NO: 101 that comprise one amino acid exchange and bind to molecule(s) of the major histocompatibility complex (MHC) and/or induce T cells cross-reacting with said variant peptide, and pharmaceutical acceptable salts thereof, wherein said peptide has an overall length of between 8 and 30 amino acids; a soluble or membrane-bound antibody, that specifically binds to said peptide or variant thereof, and/or said peptide or variant thereof when bound to an MHC molecule; a recombinant, soluble or membrane-bound T cell receptor that is reactive with an HLA ligand, wherein said ligand is at least 75% identical to an amino acid sequence according to any of SEQ ID NO:1 to SEQ ID NO:100 and optionally comprising an extension of one N- and/or one C-terminal amino acid; a nucleic acid encoding said peptide or variant; said soluble or membrane-bound antibody; or said recombinant, soluble or membrane-bound T cell receptor; wherein said nucleic acid is optionally linked to a heterologous promoter sequence; a recombinant host cell according to claim 33; or an activated T lymphocyte that selectively recognizes a cell that presents a peptide comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 101, and variant sequences of SEQ ID NO: 1 to SEQ ID NO: 101 that comprise one amino acid exchange and bind to molecule(s) of the major histocompatibility complex (MHC) and/or induce T cells cross-reacting with said variant peptide, wherein said peptide has an overall length of between 8 and 30 amino acids; and a pharmaceutically acceptable carrier, and optionally additional pharmaceutically acceptable excipients and/or stabilizers.

38. A method for producing a personalized anti-viral vaccine, said method comprising: a) identifying at least one HCMV-associated peptide according to any one of SEQ ID NO: 1 to SEQ ID NO: 101 in a sample from said individual patient; b) selecting at least one peptide as identified in said sample from step a), and c) formulating the at least one peptide as selected in step b) into a personalized anti-viral vaccine.

39. A kit comprising: a) a container comprising a peptide comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 101, and variant sequences of SEQ ID NO: 1 to SEQ ID NO: 101 that comprise one amino acid exchange and bind to molecule(s) of the major histocompatibility complex (MHC) and/or induce T cells cross-reacting with said variant peptide, and pharmaceutical acceptable salts thereof, wherein said peptide has an overall length of between 8 and 30 amino acids; a soluble or membrane-bound antibody, that specifically binds to said peptide or variant thereof, and/or said peptide or variant thereof when bound to an MHC molecule; a recombinant, soluble or membrane-bound T cell receptor that is reactive with an HLA ligand, wherein said ligand is at least 75% identical to an amino acid sequence according to any of SEQ ID NO:1 to SEQ ID NO:100 and optionally comprising an extension of one N- and/or one C-terminal amino acid; a nucleic acid encoding said peptide or variant; said soluble or membrane-bound antibody; or said recombinant, soluble or membrane-bound T cell receptor; wherein said nucleic acid is optionally linked to a heterologous promoter sequence; a host cell according to claim 33; or an activated T lymphocyte that selectively recognizes a cell that presents a peptide comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 101, and variant sequences of SEQ ID NO: 1 to SEQ ID NO: 101 that comprise one amino acid exchange and bind to molecule(s) of the major histocompatibility complex (MHC) and/or induce T cells cross-reacting with said variant peptide, wherein said peptide has an overall length of between 8 and 30 amino acids; or a vaccine as produced a method for producing a personalized anti-viral vaccine, said method comprising: a) identifying at least one HCMV-associated peptide according to any one of SEQ ID NO: 1 to SEQ ID NO: 101 in a sample from said individual patient; b) selecting at least one peptide as identified in said sample from step a), and c) formulating the at least one peptide as selected in step b) into a personalized anti-viral vaccine; in solution or in lyophilized form; b) optionally, a second container containing a diluent or reconstituting solution for the lyophilized formulation; c) optionally, at least one additional peptide selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 101, d) optionally, instructions for (i) use of the solution or (ii) reconstitution and/or use of the lyophilized formulation, and e) a substance or combination of substances acting as an adjuvant.

40. The kit according to claim 39, further comprising one or more of (iii) a buffer, (iv) a diluent, (v) a filter, (vi) a needle, (v) a syringe, and vi) a mixing device.

41. A method for treating HCMV infection in target cells in a patient, wherein said target cells present at least one peptide comprising an amino acid sequence according to any of SEQ ID NO: 1 to SEQ ID NO: 100 and optionally comprising an extension of one N-and/or one C-terminal amino acid, wherein said method comprises administering to said patient an effective amount of: an activated T lymphocyte that selectively recognizes a cell that presents a peptide comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 101, and variant sequences of SEQ ID NO: 1 to SEQ ID NO: 101 that comprise one amino acid exchange and bind to molecule(s) of the major histocompatibility complex (MHC) and/or induce T cells cross-reacting with said variant peptide, wherein said peptide has an overall length of between 8 and 30 amino acids; the pharmaceutical composition according to claim 37, and/or the vaccine as produced by a method for producing a personalized anti-viral vaccine, said method comprising: a) identifying at least one HCMV-associated peptide according to any one of SEQ ID NO: 1 to SEQ ID NO: 101 in a sample from said individual patient; b) selecting at least one peptide as identified in said sample from step a), and c) formulating the at least one peptide as selected in step b) into a personalized anti-viral vaccine.

42. The method according to claim 41, wherein said HCMV infection exhibits a co-morbidity with cancer, inflammatory diseases, hypertensive diseases, and/or pulmonary diseases.

Description

[0132] FIG. 1 shows that deletion of the genes US2-US11 allows high level of HLA-I expression. a) MRC-5 or HF-99/7 fibroblasts were mock treated or infected with AD169VarL wild-type virus or deletion mutants with an MOI of 5. Cell surface expression of HLA-I (W6/32) was analyzed by flow cytometry at 48 h.p.i. b) The rate of infection was determined using the cells from (a). The cells were permeabilized and treated with Fc-FITC, which binds to the HCMV encoded Fc-receptors (vFcR). FITC levels were determined by flow cytometry.

[0133] FIG. 2 shows the identification of HCMV-derived HLA ligands from MRC-5 lung fibroblasts by LC-MS/MS. a) Overview of HLA ligand identifications obtained by LC-MS/MS analysis of MRC-5 cells after mock treatment (n=2 independent experiments), infection with AD169VarL (n=1), infection with the deletion viruses AD169 ΔUS2-6 (n=3) or ΔUS2-6/ΔUS11 (n=5). Identified ligands of mock treated (n=1) or AD169 ΔUS2-11 infected (n=1) HF-99/7 cells are depicted on the right side. Peptide identifications were defined as HLA ligands if they showed predicted HLA binding defined as NetMHC IC50≤500 nM and/or normalized SYFPEITHI scores≥50%. The purity of HLA ligand extracts (i.e. the ratio of predicted binders/total peptide identifications) of the individual HLA ligand elutions is indicated by red triangles. b) Overlap analysis of the combined datasets of HCMV individual HLA ligands identified on MRC-5 cells infected with the three different virus variants. c) Overlap of HCMV-derived HLA ligands identified in three independent experiments using MRC-5 cells infected with the deletion virus ΔUS2-6. d) Distribution of HLA restrictions among the 198 (MRC-5) and 181 (HF-99/7) unique HCMV-derived HLA ligands identified in total. Abbreviations: IDs, identifications.

[0134] FIG. 3 shows the identification and characterization of naturally presented T-cell epitopes by ELISpot. HCMV ligands were tested for memory T-cell response by IFNγ ELISpot with PBMCs of healthy, seropositive donors. a) Distribution of dominant and subdominant HCMV ligands restricted to HLA-A and -B 19 allotypes. b) Proportion of epitope source proteins assigned to five different temporal classes of protein expression according to Weekes et al. (36). Source proteins not assigned to one of those classes are depicted as not determined (ND). c) ELISpot screening of positively tested HLA-B*07:02-restricted peptides. Shown are numbers of IFNγ spot forming cells (SFC) for each tested donor minus the spot numbers of the negative control of the respective donor. Spot counts of >1000 were set to 1000 because of inaccurate spot count due to technical limitations. Positive evaluated spot counts are depicted in black, negative evaluated spot counts in grey. d) Comparison of IFNγ SFC in ex vivo ELISpots (black) and ELISpots with prior 12 day amplification (grey). Shown are exemplary results of five donors each for two B*08 epitopes (UL34 180-188 and UL26 61-69).

[0135] FIG. 4 shows the characterization of HCMV-specific memory T-cells. a) Representative tetramer staining after 12 day amplification in vitro of CD8+ T cells derived from HLA-matched healthy donors. Shown are results of three peptides per HLA. Novel HCMV ligands are compared to known pp65 epitopes (left column). b) Exemplary intracellular IFNγ and TNFα staining of healthy donors' PBMCs after 12 day amplification. Cells were stimulated with novel HCMV peptides or known pp65 epitopes. Bars represent percentage of CD8+ T cells producing IFNγ (black), TNFα (grey) or both (light grey). Three peptides per HLA restriction, tested in one HLA-matched donor, are shown.

[0136] FIG. 5 shows the characterization and cytotoxicity of HCMV-specific CD8+ T-cell clones. a) Exemplary staining of a UL23 22-30-specific T-cell clone (B*07:02 restricted) with the respective tetramer and intracellular cytokine staining with TNF, IFNγ and the degranulation marker CD107a. b-d) Real-time cytotoxicity of different UL23 22-30-specific T-cell clones monitored by the xCELLigence system. 20,000 cells/well of infected or not infected MRC-5 cells were seeded into 96-well E-plates. After attachment of target cells, effector cells were added 48 h.p.i. at indicated E:T ratios (t0). Synthetic peptides were added to target cells one hour prior to effector cells (final concentration 1 μg/ml). Impedance was measured every 15 min and normalized to impedance of wells with medium only. The resulting dimensionless normalized cell index indicates the changes in impedance normalized to t0. Percentage of lysis was calculated in relation to cells without effector T cells. Experiments were performed in triplicates. b) MRC-5 cells were loaded with specific (UL23 22-30, RPWKPGQRV) (SEQ ID NO: 28) or unspecific (HIV Nef 128-137, TPGPGVRYPL) (SEQ ID NO: 103) peptide or infected with AD169 ΔUS2-6 (MOI 2) and incubated with effector cells in an E:T ratio of 5:1. Controls were MRC-5 cells without effector cells or without peptide. c) Comparison of specific lysis of ΔUS2-US6-infected MRC-5 cells with different E:T ratios. d) Specific lysis of AD169VarL wild type infected or peptide-loaded cells with indicated E:T ratios.

[0137] FIG. 6: The rate of infection was determined using the cells from FIG. 1. The cells were permeabilized and treated with Fc-FITC, which binds to the HCMV encoded Fc-receptors (vFcR). FITC levels were determined by flow cytometry.

[0138] FIG. 7: Overlap of HCMV-derived HLA ligands between five independent HLA ligand elutions from MRC-5 cells infected with AD169 ΔUS2-6/AU1.

[0139] FIG. 8: ELISpot screening of positively tested peptides with HLA-A*02:01 (a), A*29:02 (b), B*44:02 (c), A*01:01 (d), A*03:01 (e), B*08:01 (f) and B*51:01 (g) restriction. Shown are numbers of IFNγ spot forming cells (SFC) for each tested donor minus the spot numbers of the negative control of the respective donor. Positive evaluated donors are depicted in black, negative tested donors in grey.

[0140] FIG. 9: Parallel recognition of multiple HCMV epitopes. Exemplary ELISpot results after 12 day amplification with HLA-B*07-restricted (a) and HLA-B*44-restricted (b) epitopes using PBMCs of two and three donors, respectively. PBMCs were stimulated with ten novel and already known epitopes (column 1-10). a) UL83 265-275 (RPHERNGFTVL, column 10) (SEQ ID NO: 102) is a previously identified epitope which was not contained in the here identified ligands. HIV Nef 128-137 (TPGPGVRYPL) (SEQ ID NO: 103) and medium served as negative controls, Phytohaemagglutinin (PHA) as positive control. b) UL83 364-373 (SEHPTFTSQY) (SEQ ID NO: 110) and UL83 511-521 (QEFFWDANDIY) (SEQ ID NO: 111) are already known epitopes that were not found as ligands in this study. UL57 193-203 (EEIPASDDVLF) (SEQ ID NO: 107) served as negative control.

[0141] FIG. 10: Overview of frequencies of recognition by healthy donors for all identified HCMV epitopes. Dashed line indicates threshold for dominant epitopes.

[0142] FIG. 11: Infection of MRC-5 cells with AD169 ΔUS2-6 for following cytotoxicity testing of peptide-specific T cell clones. a) Comparison of morphology of uninfected and infected (20 h.p.i., MOI 1) MRC-5 cells. b) Titration of MOIs in comparison with uninfected (mock) MRC-5 cells for the xCelligence system. 20,000 cells/well of infected or not infected MRC-5 cells were seeded into 96-well E-plates. Impedance was measured every 15 min and normalized to impedance of wells with medium only. The resulting dimensionless normalized cell index indicates the changes in impedance normalized to t0. Experiment was performed in triplicate.

[0143] Table 1 shows peptide epitopes of the invention, the source (underlying) protein, sequence, and other data relating to the peptides.

[0144] Table 2 shows data for preferred dominant epitopes of the invention.

EXAMPLES

Methods

Cells and Viruses

[0145] MRC-5 fibroblasts (ECACC 05090501) and human foreskin fibroblasts (HF-99/7 ; donated as kind gift by Dieter Neumann-Haefelin and Valeria Kapper-Falcone, Freiburg) were grown in DMEM supplemented with 10% FCS, penicillin and streptomycin. The AD169VarL-based BAC mutants (51) were propagated on MRC-5 cells.

[0146] The recombinant HCMV mutants ΔUS2-6, ΔUS2-6/ΔUS11 and ΔUS2-11 were generated according to a previously published procedure (52) using the BAC-cloned AD169varL genome pAD169 (51) as parental BAC. Briefly, a PCR fragment was generated using the primers

TABLE-US-00003 KL-DeltaUS11-Kana1 (SEQ ID NO: 115) CAAAAAGTCTGGTGAGTCGTTTCCGAGCGACT CGAGATGCACTCCGCTTCAGTCTATATACCAG TGAATTCGAGCTCGGTAC and KL-DeltaUS11-Kana2 (SEQ ID NO: 116) TAAGACAGCCTTACAGCTTTTGAGTCTAGACA GGGTAACAGCCTTCCCTTGTAAGACAGAGACC ATGATTACGCCAAGCTCC
and the plasmid pSLFRTKn (53) as template DNA. The PCR fragment containing a kanamycin resistance gene was inserted 11 into the parental BAC by homologous recombination in E. coli. Correct mutagenesis was confirmed by Southern blot and PCR analysis. Recombinant HCMVs were reconstituted from HCMV BAC DNA by Superfect (Qiagen) transfection into permissive MRC-5 cells. Virus titers were determined by standard plaque assay.

Flow Cytometry Analysis of Infected Cells

[0147] Cells were detached with accutase (Sigma) and stained with antibodies diluted in 3% FCS/PBS. Cells were washed in 3% FCS/PBS supplemented with DAPI and fixed in 3% paraformaldehyde. For intracellular staining of viral Fc-receptors cells were fixed and permeabilized using the BD Cytofix/Cytoperm™ Kit and stained with Fc-FITC (Rockland Immunochemicals Inc). Cells were measured with a BD FACSCanto™ II system (BD Biosciences) and acquired data was analyzed by FlowJo (v10.1, Tree Star Inc.). Analysis of HLA ligands by liquid chromatography-coupled tandem mass spectrometry (LC-MS/MS) Approximately 2-3×10.sup.8 cells (30 t175 flasks) of MRC-5 fibroblasts (A*02:01, A*29:02, B*07:02, B*44:02, C*05:01, and C*07:02) or human foreskin fibroblasts (HF-99/7) (A*01:01, A*03:01, B*08:01, B*51:01, C*01:02, C*07:01) were infected with an MOI of 4-7. At 48 h.p.i., the cells were collected by scraping and washed three times with PBS. The cell pellet was stored at −80° C. HLA-I ligands were isolated using standard immunoaffinity purification employing the pan-HLA class I-specific mAb W6/32 (54). HLA ligand extracts were analyzed as described previously (54). In brief, HLA ligand extracts were separated by reversed-phase liquid chromatography (nanoUHPLC, UltiMate 3000RSLCnano, Dionex) using a 75 μm×25 cm PepMap C18 column (Thermo Fisher Scientific). Linear gradients were applied ranging from 2.4% to 32% AcN over the course of 90 min in almost all analyses. In single experiments other methods, applying 195 or 300 min gradients on a 75 μm×50 cm PepMap column, were tested. Peptides eluted from MRC-5 cells were analyzed in an online coupled LTQ Orbitrap XL mass spectrometer (Thermo Fisher Scientific) using a top 5 collision induced fragmentation (CID) method generating ion trap MS/MS spectra. Extracts of HF-99/7 cells were analyzed in an online coupled LTQ Orbitrap Fusion Lumos mass spectrometer (Thermo Fisher Scientific) using a top speed CID method leading to orbitrap MS/MS spectra. Database search and filtering Data processing was performed as described previously (55). In brief, the Mascot search engine (Mascot 2.2.04; Matrix Science) (for ion trap fragment spectra) or the SEQUEST HT search engine (University of Washington) (for Orbitrap fragment spectra) (56) were used to search the human and HCMV proteome. Ion trap spectra were searched against a concatenated FASTA consisting of the Swiss-Prot reviewed human (September 2013; 20,279 sequences contained) and HCMV proteomes (April 2014; 400 sequences contained). Orbitrap spectra were searched against a FASTA consisting of the Swiss-Prot database of reviewed human proteins (March 2016; 20,270 sequences) and the HCMV proteome. The search combined data of technical replicates and was not restricted by enzymatic specificity. Precursor mass tolerance was set to 5 ppm, and fragment mass tolerance to 0.5 Da for ion trap spectra analyzed by Mascot and 0.02 Da for orbitrap spectra analyzed by SEQUEST HT, respectively. Oxidized methionine was allowed as a dynamic modification. FDR was estimated using the Percolator algorithm (57).

[0148] Peptide-12 spectrum matches were filtered for an FDR of 5%, search engine rank=1 and peptide lengths of 8-12 aa. For Mascot database searches the additional filter of Mascot Ion Scores≥20 were utilized. Peptide identifications were annotated to their respective HLA motifs using both SYFPEITHI (37), with a normalized score of ≥50%, and NetMHCv3.4 (58) for MRC-5 or Net MHCpan3.0 (59) for HF-99/7, applying IC 50≤500 nM percentile rank<2% (for NetMHCpan3.0) as cutoffs. Peptides fulfilling the cutoff in either or both prediction tools were designated as HLA ligands in this manuscript. In case of multiple possible annotations, the HLA allotype yielding the best rank/score was selected. Peptides were tested in donor samples of different restrict ions if the two algorithms resulted in inconsistent allotype annotations. Peptide and HLA: peptide monomer synthesis Synthetic peptides were produced by standard 9-fluorenylmethyloxycarbonyl/tert-butyl strategy using peptide synthesizers 433A (Applied Biosystems, Darmstadt, Germany), P11 (Activotec, Cambridge, UK) or Liberty Blue (CEM, Kamp-Lintfort, Germany). Purity was assessed by reversed phase HPLC (e2695, Waters, Eschborn, Germany) and identity affirmed by nano-UHPLC (UltiMate 3000 RSLCnano) coupled online to a hybrid mass spectrometer (LTQ Orbitrap XL, both Thermo Fisher). Lyophilized peptides were dissolved at 10 mg/ml in DMSO and diluted 1:10 in bidestilled H.sub.2O. Frozen aliquots were further diluted in cell culture medium and sterile filtered if necessary. Synthetic peptides were used for validation of LC-MS/MS identifications as well as for functional experiments. Biotinylated recombinant HLA molecules and fluorescent HLA:peptide tetramers were produced as described previously (60-62). Target cell infection for cytotoxicity assays MRC-5 cells were cultured in DMEM (1×) (Life technologies) supplemented with 10% FCS, 100 U/ml penicillin and 100 μg/m1 streptomycin at 37° C. and 7.5% CO.sub.2. For cytotoxicity assays MRC-5 cells were infected with an MOI of 2 and subsequently centrifuged for 30 min at 300 g. After resting for approximately 1 h cells were harvested by trypsination for 2 min at 37° C. and seeded in E-plates 96 (Roche) with 20,000 cells per well. T-cell culture blood samples were kindly provided by the Institute for Clinical and Experimental Transfusion Medicine at the University Hospital of Tubingen after obtaining written informed consent. Peripheral blood mononuclear cells (PBMCs) were isolated from healthy HCMV-seropositive blood donors by Ficoll-Hypaque density gradient centrifugation. Cells were frozen at −80° C. in FCS+10% DMSO. After thawing, cells were rested overnight prior to stimulation. Culture conditions were 7.5% CO.sub.2 and 37° C. in humidified incubators in IMDM (PAA) supplemented with 5% heat-inactivated pooled human plasma (isolated from healthy blood donors), 100 U/ml penicillin, 100 μg/ml streptomycin, 25 μg/ml gentamicin (Life technologies) and 50 μM β-mercaptoethanol (Carl Roth). IFNγ-ELISpot assay The IFNγ-ELISpot assay was performed after 12 day stimulation as described previously (62) or directly ex vivo one day after thawing. Readout was performed according to manufacturers' recommendation and the cancer immunotherapy monitoring panel (63). PHA was used as positive control. The following 13 peptides, restricted to the respective HL A, served as negative controls: GSEELRSLY HIV POL 71-79 (A*01) (SEQ ID NO: 114), YLLPAIVHI HUMAN DDX5 148-156 (A*02) (SEQ ID NO: 104), RLRPGGKKK HIV GAG 20-28 (A*03) (SEQ ID NO: 105), TPGPGVRYPL HIV Nef 128-137 (B *07) (SEQ ID NO: 113), GGKKKYKL HIV GAG 24-31 (B*08) (SEQ ID NO: 106), EEIPASDDVLF HCMV DNBI 1095-1105 (B*44) (SEQ ID NO: 107), DPYKATSAV HUMAN MUC16 6326-6334 (B *51) (SEQ ID NO: 108). DMSO was used as a negative control for HLA-A*29. Blue spots specific for IFNγ-producing cells were automatically counted using an ImmunoSpot S5 analyzer (CTL) and ImmunoSpot Software. T-cell responses were considered to be positive when >10 spots/well were counted and mean spot count per well was at least 3-fold higher than the mean number of spots in negative control wells. Background staining due to excess cytokine and overlapping spots hamper the detection of reliable counts in wells of highly responsive donors. Therefore, spot counts of >1000 or “too numerous to count” were set to 1000. Analysis of T cells HLA tetramer staining of T cells was performed by incubation with 5 μg/ml tetramer diluted in tetramer staining buffer (2% FCS, 0.01% sodium azide and 2 mM EDTA in PBS) for 30 min at 4° C. Afterwards, T cells were stained with CD8-PerCP (Biolegend) for 20 min at 4° C. For ICS 0.5-1 Mio cells/well were stimulated with individual peptides (10 μg/ml) in presence of BrefeldinA (Sigma-Aldrich), GolgiStop (BD Biosciences) and anti-CD107a-FITC mAB (BD Biosciences) in 150 μl per well for 12-14 h. After incubation cells were washed and stained with anti-CD8-PerCP (Biolegend) and anti-CD4-APC (BD Biosciences) followed by fixation and permeabilization for further 20 min at 4° C. (Cytofix/Cytoperm, BD Biosciences). After washing with permwash buffer cytokines were stained with anti-TNFα-PacificBlue (Biologend) and anti-IFNγ-PE (BD Biosciences) for 20 min at 4° C. Flow cytometric measurements were performed on a FACSCanto II cytometer (BD Biosciences) with the DIVA software and analyzed using FlowJo Version 10. T-cell clones PBMCs of HLA-matched seropositive donors were stimulated with 1 μg/ml specific peptide one day after thawing and IL-2 (20 U/ml) (Novartis) on day 2 and 5. On day 14 HLA tetramer staining was performed and tetramer-positive CD8+ T cells were sorted in 96-well plates containing 1.5×10.sup.5 irradiated PBMCs (60-Gray, 1000 Elite Gammacell), 1.5×10.sup.4 irradiated LG2-EBV (200 Gray) (kind gift of Pierre van der Bruggen, Ludwig Institute for Cancer Research, Brussels, Belgium) as feeder cells, 150 U/ml IL-2 and 0.5 μg/ml PHA-L (Sigma-Aldrich) in 150 μl media per well. Sorting was performed using BD FACSJazz™ equipped with BD FACS™ Software. Five or ten tetramer-positive CD8+ T cells were sorted per well and incubated at 37° C. and 7.5% CO.sub.2. After resting for one week cells were stimulated twice per week with 150 U/ml IL-2, freshly irradiated feeder cells (as described above) were added every second or third week together with 150 U/ml IL-2 and 1m/ml PHA-L (Roche).

Real-Time Cytotoxicity Assay (XCelligence)

[0149] Real-time cytotoxicity assays were carried out as described previously (64). All experiments were performed in DMEM with 10% FCS and 1% PenStrep. Background values were determined using 50 μl medium per well. MRC-5 cells, infected or uninfected, were seeded in 96-well E-plates (Roche) at a concentration of 20,000 cells per well in 50 μl medium. Effector cells were added 48 h after target cells in 14 indicated E:T ratios. In case of peptide loading of MRC-5 cells, synthetic peptides (f.c. 1 μg/ml) were added to target cells one hour prior to effector cells. Cell attachment was monitored using the RTCA SP (Roche) instrument and the RTCA software Version 1.1 (Roche). Impedance measurements were performed every 15 minutes for up to 140 h. All experiments were performed in triplicates.

Results

[0150] The epitope peptides as well as their characteristics as determined are depicted in the following tables 1 and 2:

TABLE-US-00004 TABLE 1 Peptide epitopes of the invention, the source (underlying) protein, sequence, and other data relating to the peptides Actual HLA restric- tion % Posi- (identi- tive fied donors % Pre- using Posi- (after Posi- Intra- Source dicted tetramer tive 12 tive cellu- protein HLA staining donors days of donors lar Cell and Sequence/ restric- and as stimu- (ex cytokine Tetramer- line position SEQ ID NO: tion ICS) tested lation) vivo) staining staining MRC- US8 74-82 GVLDAVWRV A*02:01 A*02:01 13/18 72.2 50.0 CD8 Positive 5 (SEQ ID NO: 1) MRC- UL150A 152- ALWDVALLEV A*02:01 A*02:01 10/14 71.4 25.0 CD8 Positive 5 161 (SEQ ID NO: 2) MRC- UL100 200- TLIVNLVEV A*02:01 A*02:01 11/20 55.0 25.0 CD8 Positive 5 208 (SEQ ID NO: 3) MRC- UL44 259- GLFAVENFL A*02:01 DR  7/13 53.9 0.0 CD4 Nt 5 267 (SEQ ID NO: 4) MRC- UL71 40-48 FLDENFKQL A*02:01 DR 10/21 47.6 37.5 CD4 Negative 5 (SEQ ID NO: 5) MRC- UL105 431- RLFDLPVYC A*02:01  5/12 41.7 Nt Nt Nt 5 439 (SEQ ID NO: 6) MRC- UL29 175- RLQPNVPLV A*02:01  6/18 33.3 0.0 Nt Nt 5 183 (SEQ ID NO: 7) MRC- US16 134- GLLAHIPALGV A*02:01  6/22 27.3 0.0 Nt Nt 5 144 (SEQ ID NO: 8) MRC- US29 293- ALSPSTSKV A*02:01  4/17 23.5 Nt Nt Nt 5 301 (SEQ ID NO: 9) MRC- UL29 344- SLYEANPEL A*02:01  4/17 23.5 Nt Nt Nt 5 352 (SEQ ID NO: 10) MRC- UL86 146- TILDKILNV A*02:01  4/20 20.0 Nt Nt Nt 5 154 (SEQIDNO: 11) MRC- US16 186- TLINGVWVV A*02:01  2/11 18.2 Nt Nt Nt 5 194 (SEQ ID NO: 12) MRC- US16 134- GLLAHIPAL A*02:01  2/11 18.2 Nt Nt Nt 5 142 (SEQ ID NO: 13) MRC- UL48 132- ALYPEYIYTV A*02:01  3/18 16.7 Nt Nt Nt 5 141 (SEQ ID NO: 14) MRC- UL47 766- GLNERLLSV A*02:01  3/20 15.0 Nt Nt Nt 5 744 (SEQ ID NO: 15) MRC- UL34 BO- ALFNQLVFTA A*02:01  2/15 13.3 Nt Nt Nt 5 138 (SEQ ID NO: 16) MRC- UL56 124- FTDNVRFSV A*02:01  1/13 7.8 Nt Nt Nt 5 132 (SEQ ID NO: 17) MRC- UL128 145- GLDQYLESV A*02:01  1/13 7.8 Nt Nt Nt 5 153 (SEQ ID NO: 18) MRC- UL84 133- ALLGRLYFI A*02:01  1/15 6.7 Nt Nt Nt 5 141 (SEQ ID NO: 19) MRC- UL4 96-104 NYNEQHYRY A*29:02  5/13 38.5 Nt Nt Nt 5 (SEQ ID NO: 20) MRC- US27 276- LYVGQFLAY A*29:02  3/12 25.0 Nt Nt Nt 5 284 (SEQ ID NO: 21) MRC- UL4 88-97 SFFPKLQGNY A*29:02  2/9 22.2 Nt Nt Nt 5 (SEQ ID NO: 22) MRC- UL4 89-97 FFPKLQGNY A*29:02  2/12 16.7 Nt Nt Nt 5 (SEQ ID NO: 23) MRC- UL16 162- YPRPPGSGL B*07:02 B*07:02 19/22 86.4 25.0 Nega- Positive 5 170 (SEQ ID NO: 24) tive MRC- UL83 417- TPRVTGGGAM B*07:02 B*07:02 31/38 81.6 100.0 CD8 Positive 5 426 (SEQ ID NO: 25) MRC- TRS1 166- SPRDAWIVL B*07:02 B*07:02 15/22 68.2 20.0 CD8 Positive 5 174 (SEQ ID NO: 26) MRC- UL52 349- SPSRDRFVQL B*07:02 B*07:02 14/21 66.7 33.3 Nega- Positive 5 357 (SEQ ID NO: 27) tive MRC- UL23 22-30 RPWKPGQRV B*07:02 B*07:02 15/28 53.6 66.7 CD8 Positive 5 (SEQ ID NO: 28) MRC- UL46 76-84 SPRHLYISL B*07:02 B*07:02 11/22 50.0 0.0 CD4/CD8 Positive 5 (SEQ ID NO: 29) MRC- UL38 225- IPMTFVDRDSL B*07:02  5/14 35.7 Nt Nt Nt 5 235 (SEQ ID NO: 30) MRC- US30 313- RPFPSTHQL B*07:02  4/13 30.8 0.0 Nt Nt 5 321 (SEQ ID NO: 31) MRC- UL83 49-57 RVSQPSLIL B*07:02  4/15 26.7 Nt Nt Nt 5 (SEQ ID NO: 32) MRC- UL82 245- SPHPPTSVFL B*07:02  3/12 25.0 Nt Nt Nt 5 254 (SEQ ID NO: 33) MRC- UL27 485- IPDYRSVSL B*07:02  4/18 22.2 Nt Nt Nt 5 493 (SEQ ID NO: 34) MRC- UL31 310- APFGRVSV B*07:02  3/15 20.0 Nt Nt Nt 5 317 (SEQ ID NO: 35) MRC- TRS1/IRS1 IPVERQAL B*07:02  2/12 16.7 Nt Nt Nt 5 92-99 (SEQ ID NO: 36) MRC- UL98 135- APNYRQVEL B*07:02  2/12 16.7 Nt Nt Nt 5 143 (SEQ ID NO: 37) MRC- UL40 210- LPNDHHYAL B*07:02  1/17 5.9 Nt Nt Nt 5 218 (SEQ ID NO: 38) MRC- US12 82-89 APYLRDTL B*07:02  1/19 5.3 Nt Nt Nt 5 (SEQ ID NO: 39) MRC- UL112/UL11 SENGNLQVTY B*44:02 B*44:02 26/31 83.9 62.5 CD8 Positive 5 3 125-134 (SEQ ID NO: 40) MRC- ULI 17 358- HETGVYQMW B*44:02 B*44:02 17/26 65.4 62.5 CD8 Positive 5 366 (SEQ ID NO: 41) MRC- UL17 24-32 DEQVSKRSW B*44:02 B*44:02 11/24 45.8 12.5 CD8 Positive 5 (SEQ ID NO: 42) MRC- TRL12 402- SESEFIVRY B*44:02 B*44:02  8/20 40.0 37.5 CD8 Positive 5 410 (SEQ ID NO: 43) MRC- UL147A51- EEQDYRALL B*44:02  4/12 33.3 Nt Nt Nt 5 59 (SEQ ID NO: 44) MRC- UL78 ISO- RENAGVALY B*44:02  4/21 19.1 Nt Nt Nt 5 158 (SEQ ID NO: 45) MRC- US21 71-80 AEPNFPKNVW B*44:02  2/14 14.3 Nt Nt Nt 5 (SEQ ID NO: 46) MRC- TRSl/IRS1 EEATALGREL B*44:02  1/10 10.0 Nt Nt Nt 5 276-285 (SEQ ID NO: 47) MRC- US 11 103- SESLVAKRY B*44:02  1/10 10.0 Nt Nt Nt 5 111 (SEQ ID NO: 48) MRC- UL54 755- LENGVTHRF B*44:02  1/14 7.1 Nt Nt Nt 5 763 (SEQ ID NO: 49) MRC- US22 72-81 REQAAIPQIY B*44:02  1/16 6.3 Nt Nt Nt 5 (SEQ ID NO: 50) HF- UL105 715- YADPFFLKY A*01:01 A*01:01 15/15 100.0 90.9 CD8 Positive 99/7 723 (SEQ ID NO: 51) HF- UL44 245- VTEHDTLLY A*01:01 A*01:01 13/14 92.9 100.0 Nt Nt 99/7 253 (SEQ ID NO: 52) HF- UL69 569- RTDPATLTAY A*01:01 A*01:01 19/23 82.6 66.7 CD8 Positive 99/7 578 (SEQ ID NO: 53) HF- US28 122- ITEIALDRY A*01:01 A*01:01 14/24 58.3 14.3 CD8 Positive 99/7 130 (SEQ ID NO: 54) HF- UL55 657- NTDFRVLELY A*01:01 A*01:01  9/16 56.3 0.0 CD8 Positive 99/7 665 (SEQ ID NO: 55) HF- UL36 82-91 FVEGPGFMRY A*01:01  5/14 35.7 Nt Nt Nt 99/7 (SEQ ID NO: 56) HF- UL148 282- SLDRFIVQY A*01:01 DR  5/14 35.7 Nt CD4 Nt 99/7 290 (SEQ ID NO: 57) HF- UL25 370- YTSRGALYLY A*01:01  3/14 21.4 Nt Nt Nt 99/7 379 (SEQ ID NO: 58) HF- UL86 1346- TSETHFGNY A*01:01  3/15 20.0 Nt Nt Nt 99/7 1354 (SEQ ID NO: 59) HF- US34 92-101 GSDALPAGLY A*01:01  3/16 18.8 Nt Nt Nt 99/7 (SEQ ID NO: 60) HF- UL48 1607- VTDYGNVAFK A*01:01  3/16 18.8 Nt Nt Nt 99/7 1617 Y (SEQ ID NO: 61) HF- IRSl/TRSI LLDELGAVFG A*01:01  2/13 15.4 Nt Nt Nt 99/7 464-474 Y (SEQ ID NO: 62) HF- UL112/UL113 ISENGNLQVTY A*01:01  3/20 15.0 Nt Nt Nt 99/7 124-134 (SEQ ID NO: 63) HF- UL105 616- VTDPEHLMM A*01:01  2/14 14.3 Nt Nt Nt 99/7 624 (SEQ ID NO: 64) HF- UL105 360- DLDFGDLLKY A*01:01  2/16 12.5 Nt Nt Nt 99/7 369 (SEQ ID NO: 65) HF- UL78 222- YSDRRDHVWS A*01:01  1/16 6.3 Nt Nt Nt 99/7 232 Y (SEQ ID NO: 66) HF- UL77 228- GLYTQPRWK A*03:01 A*03:01 16/21 76.2 50.0 CD8 Positive 99/7 236 (SEQ ID NO: 67) HF- UL57 790- RVKNRPIYR A*03:01 A*03:01 14/23 60.9 33.3 CD8 Positive 99/7 798 (SEQ ID NO: 68) HF- UL36 51-60 RSALGPFVGK A*03:01 A*03:01  6/15 40.0 Nt CD8 Positive 99/7 (SEQ ID NO: 69) HF- UL123 184- KLGGALQAK A*03:01  6/15 40.0 Nt Nt Nt 99/7 192 (SEQ ID NO: 70) HF- US33A 13-21 KLGYRPHAK A*03:01 A*03:01 11/29 37.9 Nt CD8 Positive 99/7 (SEQ ID NO: 71) HF- US24 136- RVYAYDTREK A*03:01  4/11 36.4 Nt Nt Nt 99/7 145 (SEQ ID NO: 72) HF- UL25 580- GVSSVTLLK A*03:01  5/14 35.7 Nt Nt Nt 99/7 588 (SEQ ID NO: 73) HF- UL84 3-11 RVDPNLRNR A*03:01  5/15 33.3 Nt Nt Nt 99/7 (SEQ ID NO: 74) HF- UL70 698- SVRLPYMYK A*03:01  4/16 25.0 Nt Nt Nt 99/7 706 (SEQ ID NO: 75) HF- UL79 237- RTFAGTLSR A*03:01  3/14 21.4 Nt Nt Nt 99/7 245 (SEQ ID NO: 76) HF- UL57 1044- RLADVLIKR A*03:01  2/13 15.4 Nt Nt Nt 99/7 1052 (SEQ ID NO: 77) HF- UL70 697- RSVRLPYMYK A*03:01  2/15 13.3 Nt Nt Nt 99/7 706 (SEQ ID NO: 78) HF- UL122 113- SVSSAPLNK A*03:01  1/14 7.1 Nt Nt Nt 99/7 121 (SEQ ID NO: 79) HF- UL13 465- YLVRRPMTI B*08:01 B*08:01 11/22 50.0 33.3 Nega- Positive 99/7 473 (SEQ ID NO: 80) tive HF- UL36 199- VMKFKETSF B*08:01  5/13 38.5 Nt Nt Nt 99/7 207 (SEQ ID NO: 81) HF- UL84 239- TPLLKRLPL B*08:01  4/14 28.6 Nt Nt Nt 99/7 247 (SEQ ID NO: 82) HF- UL40 170- HLKLRPATF B*08:01  3/13 23.1 Nt Nt Nt 99/7 178 (SEQ ID NO: 83) HF- UL84 500- FISSKHTL B*08:01  3/14 21.4 Nt Nt Nt 99/7 507 (SEQ ID NO: 84) HF- UL44 26-34 QLRSVIRAL B*08:01  2/14 14.3 Nt Nt Nt 99/7 (SEQ ID NO: 85) HF- UL148 1-8 MLRLLFTL B*08:01 B*08:01  1/14 7.1 Nt Nt Nt 99/7 (SEQ ID NO: 86) HF- UL83 116- LPLKMLNI B*51:01 B*51:01 12/15 80.0 87.5 CD8 Positive 99/7 123 (SEQ ID NO: 87) HF- UL38 156- FPVEVRSHV B*51:01 B*51:01 15/23 65.2 0.0 CD8 Positive 99/7 164 (SEQ ID NO: 88) HF- UL56 503- DARSRIHNV B*51:01 B*51:01  8/15 53.3 Nt CD8 Positive 99/7 511 (SEQ ID NO: 89) HF- UL71 330- IPPPQIPFV B*51:01  6/15 40.0 Nt Nt Nt 99/7 338 (SEQ ID NO: 90) HF- US28 158- IAIPHFMVV B*51:01  5/15 33.3 Nt Nt Nt 99/7 166 (SEQ ID NO: 91) HF- US23 65-73 IPHNWFLQV B*51:01  5/15 33.3 Nt Nt Nt 99/7 (SEQ ID NO: 92) HF- UL33 162- VPAAVYTTV B*51:01  5/15 33.3 Nt Nt Nt 99/7 170 (SEQ ID NO: 93) HF- ULM 66-74 FPAHDWPEV B*51:01  2/15 13.3 Nt Nt Nt 99/7 (SEQ ID NO: 94) HF- UL122 449- MPVTHPPEV B*51:01  2/15 13.3 Nt Nt Nt 99/7 457 (SEQ ID NO: 95) HF- UL75 540- FPDATVPATV B*51:01  1/15 6.7 Nt Nt Nt 99/7 549 (SEQ ID NO: 96) HF- UL48 1322- LPYLSAERTV B*51:01  1/15 6.7 Nt Nt Nt 99/7 1331 (SEQ ID NO: 97) MRC- UL147A 2-10 SLFYRAVAL A*02:01  5/13 38.5 12.5 Nt Nt 5 (SEQ ID NO: 98) B*08:01  4/22 18.2 Nt Nt Nt HF- 99/7 HF- UL26 61-69 LPYPRGYTL B*08:01 B*08:01/ 11/16 68.8 16.7 CD8 positive 99/7 (SEQ ID NO: 99) B*51:01 B51*:01 10/16 62.5 33.3 CD8 positive HF- B*08:01/ 99/7 B*51:01 HF- UL34 180- LPHERHREL B*08:01 B*08:01 20/22 90.9 85.7 CD8 positive 99/7 188 (SEQ ID NO: B*07:02  3/12 25.0 Nt Nt Nt MRC- 100) 5

TABLE-US-00005 TABLE 2 Summary of dominant epitopes. Ex vivo ELISpots were performed using donors that were positively tested in ELISpots with 12d stimulation. Abbreviations: 12d stim, 12-day amplification with IL-2 in vitro; nt, not tested. ELISpot actual response ELISpot Intra- HLA rate response cellu- Sequence Tested restric- (12 d rate lar Tetramer Protein SEQ ID NO: HLA tion stim.) (ex vivo)† staining staining UL83 495-503 NLVPMVATV* A*02:01 A*02:01 75.0 100.0 CD8 positive SEQ ID NO: 101 US8 74-82 GVLDAVWRV A*02:01 A*02:01 72.2 50.0 CD8 positive SEQ ID NO: 1 UL150A 152- ALWDVALLEV A*02:01 A*02:01 71.4 25.0 CD8 positive 161 SEQ ID NO: 2 UL100 200-208 TLIVNLVEV A*02:01 A*02:01 55.0 25.0 CD8 positive SEQ ID NO: 3 UL44 259-267 GLFA VENFL A*02:01 Class II 53.9 0.0 CD4 not tested SEQ ID NO: 4 UL16 162-170 YPRPPGSGL* B*07:02 B*07:02 86.4 25.0 nega- positive SEQ ID NO: 24 tive UL83 417-426 TPRVTGGGAM* B*07:02 B*07:02 81.6 100.0 CD8 positive SEQ ID NO: 25 TRS1 166-174 SPRDAWIVL B*07:02 B*07:02 68.2 20.0 CD8 positive SEQ ID NO: 26 UL52 349-357 SPSRDRFVQL B*07:02 B*07:02 66.7 33.3 nega- positive SEQ ID NO: 27 tive UL23 22-30 RPWKPGQRV B*07:02 B*07:02 53.6 66.7 CD8 positive SEQ ID NO: 28 UL46 76-84 SPRHLYISL B*07:02 B*07:02 50.0 0.0 CD4/ positive SEQ ID NO: 29 CD8 UL112/UL113 SENGNLQVTY B*44:02 B*44:02 83.9 62.5 CD8 positive 125-134 SEQ ID NO: 40 UL117 358-366 HETGVYQMW B*44:02 B*44:02 65.4 62.5 CD8 positive SEQ ID NO: 41 UL105 715-723 YADPFFLKY* A*01:01 A*01:01 100.0 90.9 CD8 positive SEQ ID NO: 51 UL44 245-253 VTEHDTLLY* A*01:01 A*01:01 92.9 100.0 CD8 positive SEQ ID NO: 52 UL69 569-578 RTDPATLTAY A*01:01 A*01:01 82.6 66.7 CD8 positive SEQ ID NO: 53 US28 122-130 ITEIALDRY A*01:01 A*01:01 58.3 14.3 CD8 positive SEQ ID NO: 54 UL55 657-665 NTDFRVLELY A*01:01 A*01:01 56.3 0.0 CD8 positive SEQ ID NO: 55 UL77 228-236 GLYTQPRWK A*03:01 A*03:01 76.2 50.0 CD8 positive SEQ ID NO: 67 UL57 790-798 RVKNRPIYR A*03:01 A*03:01 60.9 33.3 CD8 positive SEQ ID NO: 68 UL34 180-188 LPHERHREL B*08:01 B*08:01 90.9 85.7 CD8 positive SEQ ID NO: 100 UL26 61-69 LPYPRGYTL B*08:01 B*08:01/ 68.8 16.7 CD8 positive SEQ ID NO: 99 51:01 UL13 465-473 YLVRRPMTI B*08:01 B*08:01 50.0 33.3 nega- positive SEQ ID NO: 80 tive UL83 116-123 LPLKMLNI* B*51:01 B*51:01 80.0 87.5 CD8 positive SEQ ID NO: 87 UL38 156-164 FPVEVRSHV B*51:01 B*51:01 65.2 0.0 CD8 positive SEQ ID NO: 88 UL26 61-69 LPYPRGYTL B*51:01 B*08:01/ 62.5 33.3 CD8 positive SEQ ID NO: 99 51:01 UL56 503-511 DARSRIHNV B*51:01 B*51:01 53.3 20.0 CD8 positive SEQ ID NO: 89

[0151] Deletion of HCMV encoded immunoevasins rescues HLA-I expression of infected cells So far, attempts to isolate naturally presented HCMV derived HLA-I ligands have not been successful. HCMV encodes for several immunoevasins targeting HLA-I at various stages of the antigen presentation pathway. Therefore, the inventors speculated that deletion of genes involved in HLA-I regulation would enable the identification of virally encoded HLA-I ligands. The inventors constructed AD169VarL (with partial ULb′ region (35)) deletion mutants lacking the genes US2-6 (ΔUS2-6), US2-6+US11 (ΔUS2-6/US11) and US2-11 (ΔUS2-11). To measure the level of HLA-I rescue due to lack of specific immunoevasins, the inventors infected two different fibroblast cell cultures expressing HLA-I types of interest: MRC-5 (HLA-A*02:01, -A*29:02, -B*07:02, -B*44:02, -C*05:01, and -C*07:02) and HFF-99/7 (HLA-A*01:01, A*03:01, B*08:01, B*51:01, C*01:02, and C*07:01). The rate of infection was determined using Fc-FITC, which binds to the HC MV encoded Fc-receptors (vFcR) (FIG. 6). At 48 h post-infection (h.p.i.) the HLA-I cell surface level was determined by flow cytometry using the pan-HLA-I antibody W6/32 (FIG. 1). Interestingly, HLA-I downregulation by AD 169VarL wild-type virus varied strongly between fibroblasts. Since in MRC-5 cells HLA-B*44:02 is expressed at very low level in mock treated cells, but is induced strongly in HCMV infected cells, this molecule could be the reason for the apparent low level of reduction by AD169VarL (compared to mock treated cells). As expected, infection with HCMV mutant viruses lacking HLA-I immunoevasins showed a robust rescue of HLA-I at the cell surface and the inventors next proceeded with detailed HLA-I ligandome analysis using the virus mutants. Direct identification of HCMV-derived HLA-I ligands by LC-MS/MS First, for direct identification of processed and presented HCMV-derived HLA-I ligands the inventors performed mass spectrometric analysis of immunoaffinity-purified peptide extracts isolated from MRC-5 cells. At 48 h.p.i. , HLA-I ligands isolated from cells infected with AD169VarL (n=1 sample), ΔUS2-6 (n=3 samples), ΔUS2-6/ΔUS11 (n=5 samples), and mock controls (n=1 sample) were exhaustively analyzed in five to seven LC-MS/MS runs per sample. These MS analyses revealed 816 to 2,714 unique HLA ligands per sample (FIG. 2a). As expected, only 3/816 (0.4%) of HLA ligands, eluted from MRC-5 cells infected with AD169VarL wild-type virus, were derived from HCMV, while infection with the deletion viruses resulted in substantially increased viral peptide identification rates and numbers. In MRC-5 cells infected with the mutant viruses ΔUS2-6 and ΔUS2-6/ΔUS11 a total of 79 and 181 HCMV-derived HLA ligands were identified, respectively, resulting in a total number of 194 unique viral peptides. Overlap analysis revealed 66/194 viral peptides to be presented on MRC-5 after infection with both deletion viruses (FIG. 2b). Interestingly, 13/79 (17%) and 114/181 (63%) viral peptides of ΔUS2-6 and ΔUS2-6/ΔUS11 infected cells, respectively, were unique. This demonstrates that the HLA-I immunoevasins not only affect the quantity, but also the quality of HLA-I antigen processing and presentation. Therefore, the use of varying HCMV deletion mutants can result in a higher variability of identified HCMV-derived peptide species. Furthermore, the inventors isolated the HLA-presented peptides from several biological replicates for each infection to maximize the number of identified HCMV-derived peptides. Thereby, the inventors were able to identify between 37 and 63 (mean: 51) unique viral HLA ligands on cells infected with ΔUS2-6, corresponding to 2.4-3.0% (mean: 2.8%) of total HLA ligand identifications. Overlap analysis of viral ligands identified in the three independent HLA precipitations revealed 31/79 (39%) of peptides to be uniquely identified in a single experiment, while 61% showed reproducible identification in at least two out of three experiments (FIG. 2c). On cells infected with ΔUS2-6/ΔUS11 even higher proportions of viral ligands were identified, resulting in 79-119 (mean: 93) unique viral HLA ligands corresponding to 3.2-4.5% (mean: 3.9%) of total HLA ligands. Here, a similar degree of reproducibility was observed for the five independent precipitations, which resulted in 120/181 (66%) reproducible viral ligands (in≥2/5 experiments), while 61/181 (34%) were uniquely identified in individual experiments (FIG. 7). In total, analyses of infected MRC-5 fibroblasts allowed the identification of 198 unique HCMV-derived HLA ligands, of which 78, 15, 66, 31, 3, and 5 are restricted to HLA-A*02:01, -A*29:02, -B*07:02, -B*44:02, -C*05:01, and -C*07:02, respectively (FIG. 2d). Due to the applied 5% false discovery rate (FDR) in data processing, the identified 7/2, (0.34%) and 3/1, (0.27%) viral peptides in mock controls (FIG. 2a) are most likely false-positive annotations. In order to estimate the actual false discovery rate of HCMV-derived peptides, the inventors compared fragment spectra of 50 randomly selected A*02:01 and B*44:02-restricted synthetic peptides to their natural counterparts. Fragmentation patterns matched for 48/50 (96%) spectrum pairs by manual validation, which indicates an overall false-positive annotation rate of HCMV-derived HLA ligands of <5%. To extend the set of HCMV-derived ligands to additional HLA allotypes, the inventors next infected primary human foreskin fibroblasts (HF-99/7) with the ΔUS2-US11 deletion mutant. Peptide extracts from mock treated and infected cells (one sample each) were analyzed in three LC-MS/MS runs yielding a total number of 2,839 and 5,511 HLA ligands, respectively (FIG. 2a). Of these, 37, 44, 21, 43, 17, and 4 viral peptides (altogether 181) were restricted to HLA-A*01:01, -A*03:01, -B*08:01, -B*51:01, -C*01:02, and -C*07:01, respectively (FIG. 2d). The HLA annotation of 15 peptides was ambiguous. Therefore, in total, 368 unique viral HLA-I ligands were identified from two different fibroblast cell cultures. Eleven ligands were found on both cell lines. The inventors had speculated that an infection time of 48 hrs would allow the detection of peptides originating from proteins with various expression kinetics (36). Indeed, the source proteins of the identified ligands represent all classes of gene expression. IFNγ ELISpot screening validates numerous HCMV-derived ligands to be T-cell epitopes.

[0152] All viral ligands identified from MRC-5 cells and the top ranked ligands from HF-99/7 cells (≥70% SYFPEITHI score, ≤50 nM IC50 and/or <0.5% NetMHC percentile rank) were further tested for immunogenicity. All peptides were synthesized in house and tested for memory T-cell responses in at least seven different HCMV seropositive HLA-matched individuals by IFNγ ELISpot assay. HLA restriction and virus-specificity of these T-cell responses was confirmed using HLA mismatched and HCMV seronegative donors as controls. In total, 28% of all peptides were tested positive in at least one individual. This percentage was roughly the same across all HLA restrictions (FIG. 3a). Although the inventors performed the ligandome analysis at only one time point (48 h.p.i.), all temporal classes of gene expression (36) were present among the source proteins of the identified epitopes (FIG. 3b). As expected, normalized spot counts of IFNγ ELISpots after peptide stimulation were donor dependent and in part highly variable (FIGS. 3c, 8, and 9). Dependent on the frequency of recognition the inventors grouped the peptides in to three categories: negative (no memory response in any individual), subdominant (recognized by <50% of individuals) and dominant (recognized by ≥50% of individuals). Interestingly, in addition to the well-known epitopes derived from pp65, the inventors found a number of other highly immunogenic peptides for each HLA restriction. Most immunogenic peptides in proportion to the number of tested peptides were found for HLA-A*01:01, whereas the highest percentage of dominant epitopes was found for HLA-B*07:02 (FIG. 3a). The inventors observed that for peptides with higher recognition rates the mean number of specific memory T cells after 12 day stimulation is often higher compared to peptides with lower recognition rates (FIGS. 3c and 8). To exclude that this effect is caused by competitive effects among the different epitopes during the 12 day amplification, the inventors additionally performed ex vivo IFNγ ELISpots without this prestimulation. The dominant epitopes were retested with PBMC samples of previously tested positive donors. Only a few of the best epitopes elicited frequent, detectable responses ex vivo (Table 1). In most cases, memory T-cell numbers were too small to be detectable ex vivo but underwent, in part massive, amplification (up to 1000-fold) upon pre-stimulation (FIG. 3d). The amplification rate was highly individual for epitopes as well as for donors. In total, 103 HCMV-derived T-cell epitopes were identified, whereof 26 were shown to be dominant (Table 2). In case of positive results in HLA-I mismatched ELISpots, the respective peptide was tested for the next best predicted HLA-I allele in ELISpots and/or for CD8+/CD4+ T-cell responses by intracellular cytokine staining (ICS). Three peptides elicited responses by CD4+ T cells, indicating binding to HLA class II. Three epitopes (UL147A 2-10, UL34 180-188, and UL26 61-69) are potentially able to bind to more than one HLA-I allotype since they stimulated T cells of different donors harboring either of two well predicted alleles. In summary, in addition to seven previously described epitopes, the inventors were able to identify 96 novel HCMV-derived T-cell epitopes. As the inventors have observed a long time ago (20), ELISpot experiments revealed that HCMV-specific T-cell responses directed against a broad range of antigens exist within one donor; up to eight epitopes restricted by one specific HLA-I allotype were recognized in parallel (FIG. 9). While most of the donors showed responses to a similar set of epitopes, some donors had highly individual patterns of recognition.

HCMV-Specific Memory T Cells are Multifunctional

[0153] Peptide and HLA specificity of memory T cells was tested by HLA tetramer staining after 12 day amplification in vitro (Table 1 and FIG. 4a). The inventors were able to show distinct HCMV-specific CD8+ T-cell populations for all but one (UL44 259-267) dominant epitopes in several PBMC samples (Table 2). Specific T-cell populations ranged from 0.3% to 52% for one specificity. Functional activity of memory T cells after stimulation with HCMV peptides could be demonstrated by ICS via detection of IFNγ and TNF (FIG. 4b, Table 1). Predicted HLA restriction could be confirmed for 26 of 27 dominant epitopes. Stimulation with UL44 259-267 resulted in a T-cell response mediated by CD4+ cells. Also, the inventors could demonstrate that some epitopes elicit T-cell responses restricted to more than one HLA-I allotype. UL46 76-84 was able to activate CD4+ and CD8+ T cells in different PBMC samples. T-cell responses to UL26 61-69 were detected in seven B*08+/B*51− and B*08-/B*51+ samples and were mediated by CD8+ T cells in all tested donors. Tetramer stainings demonstrated B*08 and B*51 restriction of the epitope. However, mismatch ELISpots with B*08-/B*51− PBMC samples also showed responses indicating a binding to yet more HLA allotypes which will have to be further investigated. In summary, the inventors were able to further characterize dominant HCMV-derived epitopes using ICS, tetramer staining and mismatch experiments. HCMV-specific CD8+ T-cell clones effectively kill peptide-loaded or infected target cells For examination of cytotoxic activity CD8+ T-cell clones specific for UL23 22-30 (B*07) were generated. Specificity and activity of the clones were assessed by HLA tetramer staining and ICS. T-cell clones used for cytotoxicity experiments were highly specific and showed secretion of IFNγ, TNF and the degranulation marker CD107a (FIG. 5a). For further cytotoxicity analysis the inventors applied the XCelligence system. Without reactive CD8+ T cells the HCMV-infected MRC-5 cells displayed a specific cell index pattern as the infection proceeded and changed the cell morphology. A few hours after infection MRC-5 cells started to round up and lose adherence in comparison to uninfected cells. This is detected by a lower cell index in the xCELLigence system. Around 20 h.p.i., cell indices increased again as MRC-5 cells started to re-adhere. Finally, the cell index dropped drastically 3-5 days post infection (depending on the applied MOI) due to cell lysis. For optimal measurement of T-cell dependent cytotoxicity, effector T-cells were added approximately 48 h.p.i. This allowed the infected cells to reach higher cell index values prior to late cell index drop due to infection. To test peptide specificity of the CD8+ T-cell clones, mock treated MRC-5 cells were loaded with specific or unspecific peptides or infected with the ΔUS2-6 mutant, and effector cells were added in a 5:1 effector to target cell (E:T) ratio. Killing of peptide loaded cells occurred very fast and was highly specific (FIG. 5b); within 12 h almost all UL23 22-30 loaded target cells were killed by the specific T-cell clone. Killing of ΔUS2-6-infected cells was delayed but equally efficient. Cell index values were much higher (less cell lysis) for cells loaded with an unspecific or no peptide when co-cultured with the UL23 22-30-specific T-cell clone. An E:T ratio dependent killing of ΔUS2-6 infected MRC-5 cells started a few hours after addition of effector cells (FIG. 5c), it reached 50% after 18 h (E:T of 1:1 and higher) and after 36 h (corresponding to 84 h.p.i.) almost all infected cells were killed by the peptide-specific CD8+ T-cell clones. Interestingly, despite the minimal expression of HLA-I/peptide complexes on the surface of AD169VarL infected cells, a cytolytic effect was observed at higher E:T ratios, when normalized to infected cells without effector cells (FIG. 5d). In accordance to the assumption that low a mounts of HLA-I/peptide complexes are responsible for the slow killing of AD169VarL infected cells, the additional loading of specific peptide led to a dramatic increase of lysis (FIG. 5d).

Comparison of in Silico Epitope Prediction to Mass Spectrometric HLA-I Ligand Identification

[0154] To compare the inventors' approach of identifying epitopes with an established in silico prediction method, the inventors applied the prediction tools SYFPEITHI and NetMHCpan3.0 to the proteome of HCMV. The inventors ranked all peptides according to their prediction score and determined the position of the inventors' dominant epitopes 8 within this dataset (Table 2). For both SYFPEITHI and NetMHC, 25 of the 26 identified dominant epitopes are among the top-scoring 2% of all predicted peptides. This is in line with the previous experience with SYFPEITHI that the top 2% of predicted peptides usually contain the natural T-cell epitopes (37). NetMHC categorizes its predicted peptides into weak (affinity<500 nM, % rank<2) and strong binders (affinity<50 nM, % rank<0.5). Thus, it would be necessary to test approximately 1,300 (SYFPEITHI) or 2,000 (NetMHC) peptides per HLA-I allotype and length variant in order to screen epitopes from the entire HCMV proteome within these thresholds.

REFERENCES AS CITED

References

[0155] 1. Staras S A, Dollard S C, Radford K W, Flanders W D, Pass R F, Cannon M J (2006) Seroprevalence of cytomegalovirus infection in the United States, 1988-1994. Clin Infect Dis 43:1143-1151.

[0156] 2. Fulop T, Larbi A, Pawelec G (2013) Human T cell aging and the impact of persistent viral infections. Front Immunol 4:271.

[0157] 3. Quinnan G V, Jr., Kirmani N, Rook A H, Manischewitz J F, Jackson L, Moreschi G, Santos G W, Saral R, Burns W H (1982) Cytotoxic t cells in cytomegalovirus infection: HLA-restricted T-lymphocyte and non-T-lymphocyte cytotoxic responses correlate with recovery from cytomegalovirus infection in bone-marrow-transplant recipients. The New England journal of medicine 307:7-13.

[0158] 4. Reusser P, Riddell S R, Meyers J D, Greenberg P D (1991) Cytotoxic T-lymphocyte response to cytomegalovirus after human allogeneic bone marrow transplantation: pattern of recovery and correlation with cytomegalovirus infection and disease. Blood 78:1373-1380.

[0159] 5. Einsele H, Roosnek E, Rufer N, Sinzger C, Riegler S, Loffler J, Grigoleit U, Moris A, Rammensee H G, Kanz L, Kleihauer A, Frank F, Jahn G, Hebart H (2002) Infusion of cytomegalovirus (CMV)-specific T cells for the treatment of CMV infection not responding to antiviral chemotherapy. Blood 99:3916-3922.

[0160] 6. Zhou Y F, Leon M B, Waclawiw M A, Popma J J, Yu Z X, Finkel T, Epstein S E (1996) Association between prior cytomegalovirus infection and the risk of restenosis after coronary atherectomy. The New England journal of medicine 335:624-630.

[0161] 7. Harkins L, Volk A L, Samanta M, Mikolaenko I, Britt W J, Bland K I, Cobbs C S (2002) Specific localisation of human cytomegalovirus nucleic acids and proteins in human colorectal cancer. Lancet 360:1557-1563.

[0162] 8. Soderberg-Naucler C (2006) Does cytomegalovirus play a causative role in the development of various inflammatory diseases and cancer? J Intern Med 259:219-246.

[0163] 9. Soderberg-Naucler C (2008) HCMV microinfections in inflammatory diseases and cancer. J Clin Virol 41:218-223.

[0164] 10. Li S, Zhu J, Zhang W, Chen Y, Zhang K, Popescu L M, Ma X, Lau W B, Rong R, Yu X, Wang B, Li Y, Xiao C, Zhang M, Wang S, Yu L, Chen A F, Yang X, Cai J (2011) Signature microRNA expression profile of essential hypertension and its novel link to human cytomegalovirus infection. Circulation 124:175-184.

[0165] 11. McLaughlin-Taylor E, Pande H, Forman S J, Tanamachi B, Li C R, Zaia J A, Greenberg P D, Riddell S R (1994) Identification of the major late human cytomegalovirus matrix protein pp65 as a target antigen for CD8+ virus-specific cytotoxic T lymphocytes. J Med Virol 43:103-110.

[0166] 12. Wills M R, Carmichael A J, Mynard K, Jin X, Weekes M P, Plachter B, Sissons J G (1996) The human cytotoxic T-lymphocyte (CTL) response to cytomegalovirus is dominated by structural protein pp65: frequency, specificity, and T-cell receptor usage of pp65-specific CTL. J Virol 70:7569-7579.

[0167] 13. Kern F, Surel I P, Faulhaber N, Frommel C, Schneider-Mergener J, Schonemann C, Reinke P, Volk H D (1999) Target structures of the CD8(+)-T-cell response to human cytomegalovirus: the 72-kilodalton major immediate-early protein revisited. J Virol 73:8179-8184.

[0168] 14. Akiyama Y, Maruyama K, Mochizuki T, Sasaki K, Takaue Y, Yamaguchi K (2002) Identification of HLA-A24-restricted CTL epitope encoded by the matrix protein pp65 of human cytomegalovirus. Immunol Lett 83:21-30.

[0169] 15. Le Roy E, Davignon J L (2005) Human cytomegalovirus-specific CD4(+) T-cell clones recognize cross-reactive peptides from the immediate early 1 protein. Viral Immunol 18:391-396.

[0170] 16. Elkington R, Walker S, Crough T, Menzies M, Tellam J, Bharadwaj M, Khanna R (2003) Ex vivo profiling of CD8+-T-cell responses to human cytomegalovirus reveals broad and multispecific reactivities in healthy virus carriers. J Virol 77:5226-5240.

[0171] 17. Manley T J, Luy L, Jones T, Boeckh M, Mutimer H, Riddell S R (2004) Immune evasion proteins of human cytomegalovirus do not prevent a diverse CD8+ cytotoxic T-cell response in natural infection. Blood 104:1075-1082.

[0172] 18. Sylwester A W, Mitchell B L, Edgar J B, Taormina C, Pelte C, Ruchti F, Sleath P R, Grabstein K H, Hosken N A, Kern F, Nelson J A, Picker L J (2005) Broadly targeted human cytomegalovirus-specific CD4+ and CD8+ T cells dominate the memory compartments of exposed subjects. J Exp Med 202:673-685.

[0173] 19. Hebart H, Daginik S, Stevanovic S, Grigoleit U, Dobler A, Baur M, Rauser G, Sinzger C, Jahn G, Loeffler J, Kanz L, Rammensee H G, Einsele H (2002) Sensitive detection of human cytomegalovirus peptide-specific cytotoxic T-lymphocyte responses by interferon-gamma-enzyme-linked immunospot assay and flow cytometry in healthy individuals and in patients after allogeneic stem cell transplantation. Blood 99:3830-3837.

[0174] 20. Nastke M D, Herrgen L, Walter S, Wernet D, Rammensee H G, Stevanovic S (2005) Major contribution of codominant CD8 and CD4 T cell epitopes to the human cytomegalovirus-specific T cell repertoire. Cell Mol Life Sci 62:77-86.

[0175] 21. McMurtrey C P, Lelic A, Piazza P, Chakrabarti A K, Yablonsky E J, Wahl A, Bardet W, Eckerd A, Cook R L, Hess R, Buchli R, Loeb M, Rinaldo C R, Bramson J, Hildebrand W H (2008) Epitope discovery in West Nile virus infection: Identification and immune recognition of viral epitopes. Proc Natl Acad Sci USA 105:2981-2986.

[0176] 22. Meyer V S, Kastenmuller W, Gasteiger G, Franz-Wachtel M, Lamkemeyer T, Rammensee H G, Stevanovic S, Sigurdardottir D, Drexler I (2008) Long-term immunity against actual poxviral HLA ligands as identified by differential stable isotope labeling. J Immunol 181:6371-6383.

[0177] 23. Gunther P S, Peper J K, Faist B, Kayser S, Hartl L, Feuchtinger T, Jahn G, Neuenhahn M, Busch D H, Stevanovic S, Dennehy K M (2015) Identification of a Novel Immunodominant HLA-B*07:02-restricted Adenoviral Peptide Epitope and Its Potential in Adoptive Transfer Immunotherapy. J Immunother 38:267-275.

[0178] 24. Ternette N, Yang H, Partridge T, Llano A, Cedeno S, Fischer R, Charles P D, Dudek N L, Mothe B, Crespo M, Fischer W M, Korber B T, Nielsen M, Borrow P, Purcell A W, Brander C, Dorrell L, Kessler B M, Hanke T (2016) Defining the HLA class I-associated viral antigen repertoire from HIV-1-infected human cells. European journal of immunology 46:60-69.

[0179] 25. Jones T R, Wiertz E J, Sun L, Fish K N, Nelson J A, Ploegh H L (1996) Human cytomegalovirus US3 impairs transport and maturation of major histocompatibility complex class I heavy chains. Proc Natl Acad Sci USA 93:11327-11333.

[0180] 26. Ahn K, Gruhler A, Galocha B, Jones T R, Wiertz E J, Ploegh H L, Peterson P A, Yang Y, Fruh K (1997) The ER-luminal domain of the HCMV glycoprotein US6 inhibits peptide translocation by TAP. Immunity 6:613-621.

[0181] 27. Gewurz B E, Gaudet R, Tortorella D, Wang E W, Ploegh H L, Wiley D C (2001) Antigen presentation subverted: Structure of the human cytomegalovirus protein US2 bound to the class I molecule HLA-A2. Proc Natl Acad Sci USA 98:6794-6799.

[0182] 28. Furman M H, Dey N, Tortorella D, Ploegh H L (2002) The human cytomegalovirus US10 gene product delays trafficking of major histocompatibility complex class I molecules. J Virol 76:11753-11756.

[0183] 29. Hegde N R, Tomazin R A, Wisner T W, Dunn C, Boname J M, Lewinsohn D M, Johnson D C (2002) Inhibition of HL-DR-assembly, transport, and loading by human cytomegalovirus glycoprotein US3: a novel mechanism for evading major histocompatibility complex class II antigen presentation. J Virol 76:10929-10941.

[0184] 30. Odeberg J, Plachter B, Branden L, Soderberg-Naucler C (2003) Human cytomegalovirus protein pp65 mediates accumulation of HLA-DR in lysosomes and destruction of the HLA-DR alpha-chain. Blood 101:4870-4877.

[0185] 31. Wiertz E J, Tortorella D, Bogyo M, Yu J, Mothes W, Jones T R, Rapoport T A, Ploegh H L (1996) Sec61-mediated transfer of a membrane protein from the endoplasmic reticulum to the proteasome for destruction. Nature 384:432-438.

[0186] 32. Wiertz E J, Jones T R, Sun L, Bogyo M, Geuze H J, Ploegh H L (1996) The human cytomegalovirus US11 gene product dislocates MHC class I heavy chains from the endoplasmic reticulum to the cytosol. Cell 84:769-779.

[0187] 33. Jones T R, Sun L (1997) Human cytomegalovirus US2 destabilizes major histocompatibility complex class I heavy chains. J Virol 71:2970-2979.

[0188] 34. Hewitt E W, Gupta S S, Lehner P J (2001) The human cytomegalovirus gene product US6 inhibits ATP binding by TAP. EMBO J 20:387-396.

[0189] 35. Le V T, Trilling M, Hengel H (2011) The cytomegaloviral protein pUL138 acts as potentiator of tumor necrosis factor (TNF) receptor 1 surface density to enhance ULb′-encoded modulation of TNF-alpha signaling. J Virol 85:13260-13270.

[0190] 36. Weekes M P, Tomasec P, Huttlin E L, Fielding C A, Nusinow D, Stanton R J, Wang E C, Aicheler R, Murrell I, Wilkinson G W, Lehner P J, Gygi S P (2014) Quantitative temporal viromics: an approach to investigate host-pathogen interaction.

[0191] Cell 157:1460-1472.

[0192] 37. Rammensee H, Bachmann J, Emmerich N P, Bachor O A, Stevanovic S (1999) SYFPEITHI: database for MHC ligands and peptide motifs. Immunogenetics 50:213-219.

[0193] 38. Vescovini R, Biasini C, Fagnoni F F, Telera A R, Zanlari L, Pedrazzoni M, Bucci L, Monti D, Medici M C, Chezzi C, Franceschi C, Sansoni P (2007) Massive load of functional effector CD4+ and CD8+ T cells against cytomegalovirus in very old subjects. J Immunol 179:4283-4291.

[0194] 39. Hengel H, Lucin P, Jonjic S, Ruppert T, Koszinowski U H (1994) Restoration of cytomegalovirus antigen presentation by gamma interferon combats viral escape. J Virol

[0195] 40. Busche A, Jirmo A C, Welten S P, Zischke J, Noack J, Constabel H, Gatzke A K, Keyser K A, Arens R, Behrens G M, Messerle M (2013) Priming of CD8+ T cells against cytomegalovirus-encoded antigens is dominated by cross-presentation. J Immunol 190:2767-2777.

[0196] 41. Hengel H, Reusch U, Geginat G, Holtappels R, Ruppert T, Hellebrand E, Koszinowski U H (2000) Macrophages escape inhibition of major histocompatibility complex class I-dependent antigen presentation by cytomegalovirus. J Virol 74:7861-7868.

[0197] 42. Frascaroli G, Lecher C, Varani S, Setz C, van der Merwe J, Brune W, Mertens T (2018) Human Macrophages Escape Inhibition of Major Histocompatibility Complex-Dependent Antigen Presentation by Cytomegalovirus and Drive Proliferation and Activation of Memory CD4(+) and CD8(+) T Cells. Front Immunol 9:1129.

[0198] 43. Rolland M, Nickle D C, Deng W, Frahm N, Brander C, Learn G H, Heckerman D, Jojic N, Jojic V, Walker B D, Mullins J I (2007) Recognition of HIV-1 peptides by host CTL is related to HIV-1 similarity to human proteins. PLoS One 2:e823.

[0199] 44. Wolff M, Rutebemberwa A, Mosbruger T, Mao Q, Li H M, Netski D, Ray S C, Pardoll D, Sidney J, Sette A, Allen T, Kuntzen T, Kavanagh D G, Kuball J, Greenberg P D, Cox A L (2008) Hepatitis C virus immune escape via exploitation of a hole in the T cell repertoire. J Immunol 181:6435-6446.

[0200] 45. Calis J J, de Boer R J, Kesmir C (2012) Degenerate T-cell recognition of peptides on MHC molecules creates large holes in the T-cell repertoire. PLoS computational biology 8:e1002412.

[0201] 46. Stern-Ginossar N, Weisburd B, Michalski A, Le V T, Hein M Y, Huang S X, Ma M, Shen B, Qian S B, Hengel H, Mann M, Ingolia N T, Weissman J S (2012) Decoding human cytomegalovirus. Science (New York, N.Y.) 338:1088-1093.

[0202] 47. Erhard F, Halenius A, Zimmermann C, L'Hernault A, Kowalewski D J, Weekes M P, Stevanovic S, Zimmer R, Dolken L (2018) Improved Ribo-seq enables identification of cryptic translation events. Nat Methods 15:363-366.

[0203] 48. Hoist P J, Jensen B A, Ragonnaud E, Thomsen A R, Christensen J P (2015) Targeting of non-dominant antigens as a vaccine strategy to broaden T-cell responses during chronic viral infection. PLoS One 10.

[0204] 49. Steffensen M A, Pedersen L H, Jahn M L, Nielsen K N, Christensen J P, Thomsen A R (2016) Vaccine Targeting of Subdominant CD8+ T Cell Epitopes Increases the Breadth of the T Cell Response upon Viral Challenge, but May Impair Immediate Virus Control. J Immunol 196:2666-2676.

[0205] 50. Panagioti E, Klenerman P, Lee L N, van der Burg S H, Arens R (2018) Features of Effective T Cell-Inducing Vaccines against Chronic Viral Infections. Front Immunol 9.

[0206] 51. Le V T K, Trilling M, Hengel H (2011) The Cytomegaloviral Protein pUL138 Acts as Potentiator of Tumor Necrosis Factor (TNF) Receptor 1 Surface Density To Enhance ULb′-Encoded Modulation of TNF-α Signaling. Journal of Virology 85:13260-13270.

[0207] 52. Wagner M, Gutermann A, Podlech J, Reddehase M J, Koszinowski U H (2002) Major Histocompatibility Complex Class I Allele-specific Cooperative and Competitive Interactions between Immune Evasion Proteins of Cytomegalovirus. The Journal of Experimental Medicine 196:805-816.

[0208] 53. Atalay R, Zimmermann A, Wagner M, Borst E, Benz C, Messerle M, Hengel H (2002) Identification and Expression of Human Cytomegalovirus Transcription Units Coding for Two Distinct Fcγ Receptor Homologs. Journal of Virology 76:8596-8608.

[0209] 54. Kowalewski D J, Stevanović S (2013) Biochemical Large-Scale Identification of MHC Class I Ligands. Antigen Processing: Methods and Protocols, ed van Endert P (Humana Press, Totowa, N.J.), pp 145-157.

[0210] 55. Kowalewski D J, Schuster H, Backert L, Berlin C, Kahn S, Kanz L, Salih H R, Rammensee H G, Stevanovic S, Stickel J S (2015) HLA ligandome analysis identifies the underlying specificities of spontaneous antileukemia immune responses in chronic lymphocytic leukemia (CLL). Proc Natl Acad Sci USA 112:29.

[0211] 56. Eng J K, McCormack A L, Yates J R (1994) An approach to correlate tandem mass spectral data of peptides with amino acid sequences in a protein database. J Am Soc Mass Spectrom 5:976-989.

[0212] 57. Kall L, Canterbury J D, Weston J, Noble W S, MacCoss M J (2007) Semi-supervised learning for peptide identification from shotgun proteomics datasets. Nat Methods 4:923-925.

[0213] 58. Lundegaard C, Lund O, Nielsen M (2008) Accurate approximation method for prediction of class I MHC affinities for peptides of length 8, 10 and 11 using prediction tools trained on 9mers. Bioinformatics 24:1397-1398.

[0214] 59. Nielsen M, Andreatta M (2016) NetMHCpan-3.0; improved prediction of binding to MHC class I molecules integrating information from multiple receptor and peptide length datasets. Genome medicine 8:33.

[0215] 60. Garboczi D N, Hung D T, Wiley D C (1992) HLA-A2-peptide complexes: refolding and crystallization of molecules expressed in Escherichia coli and complexed with single antigenic peptides. Proc Natl Acad Sci USA 89:3429-3433.

[0216] 61. Rodenko B, Toebes M, Hadrup S R, van Esch W J, Molenaar A M, Schumacher T N, Ovaa H (2006) Generation of peptide-MHC class I complexes through UV-mediated ligand exchange. Nat Protoc 1:1120-1132.

[0217] 62. Peper J K, Bosmuller H C, Schuster H, Guckel B, Horzer H, Roehle K, Schafer R, Wagner P, Rammensee H G, Stevanovic S, Fend F, Staebler A (2016) HLA ligandomics identifies histone deacetylase 1 as target for ovarian cancer immunotherapy. Oncoimmunology 5:e1065369.

[0218] 63. Britten C M, Gouttefangeas C, Welters M J, Pawelec G, Koch S, Ottensmeier C, Mander A, Walter S, Paschen A, Muller-Berghaus J, Haas I, Mackensen A, Kollgaard T, thor Straten P, Schmitt M, Giannopoulos K, Maier R, Veelken H, Bertinetti C, Konur A, Huber C, Stevanovic S, Wolfel T, van der Burg S H (2008) The CIMT-monitoring panel: a two-step approach to harmonize the enumeration of antigen-specific CD8+ T lymphocytes by structural and functional assays. Cancer Immunol Immunother 57:289-302.

[0219] 64. Peper J K, Schuster H, Loffler M W, Schmid-Horch B, Rammensee H G, Stevanovic S (2014) An impedance-based cytotoxicity assay for real-time and label-free assessment of T-cell-mediated killing of adherent cells. J Immunol Methods 405:192-198.