QUANTITATIVE ANALYSIS METHOD BASED ON AIR PRESSURE MEASURING

20170168044 ยท 2017-06-15

Assignee

Inventors

Cpc classification

International classification

Abstract

A quantitative analysis method based on air pressure measuring, which can be used for the high-sensitivity quantitative detection of various targets i.e. inorganic ions, small molecules and biological macromolecules such as proteins, DNA, and even viruses, bacteria, cells, etc. The present invention catalyzes hydrogen peroxide to generate a large amount of gas using enzymes or nanoparticles, etc.; converts the target molecule detection signal into a gas pressure intensity signal; achieves signal amplification; and finally converts the pressure change into an electrical signal to conduct a reading through an air pressure meter, thereby achieving high-sensitivity quantitative detection. The feasibility, wide applicability and reliability of the present invention are certified through three different detection systems, i.e. an ELISA system, a DNA hydrogel system and a functional DNA sensor system, respectively, using an air pressure meter.

Claims

1. A quantitative analysis method based on air pressure measuring, wherein by introducing signal amplification molecules or particles into an air-sealed system by molecular recognition, a large amount of gas molecules are generated by the reaction of the molecular signal amplification molecules or particles catalyzing the substrate, cause the air-sealed system pressure increasing, measure the pressure changes of the reacting detection system to detect the target concentration.

2. The quantitative analysis method based on air pressure measuring according to claim 1, wherein said molecular recognition comprising: identifying or labeling said targets by using molecules with specifically recognizing function, and then the signal molecules or particles are introduced into the detection system through the recognition molecules.

3. The quantitative analysis method based on air pressure measuring according to claim 2, wherein in the target recognizing or labeling by molecular recognition method, said target comprising proteins, nucleic acids, peptides, sugars, lipids, small organic molecules, inorganic ions, cells, bacteria and viruses.

4. The quantitative analysis method based on air pressure measuring according to claim 1, wherein said signal amplification molecules comprising catalase or enzyme which can catalyze substrate to generate gas molecules, the catalytic substrate is the material which can generate gas molecules after being catalyzed, gas molecules are the product after the substrate being catalyzed.

5. The quantitative analysis method based on air pressure measuring according to claim 4, wherein said signal amplification molecules comprising catalase, gold nanoparticles, platinum nanoparticles, gold-platinum nanoparticles or manganese oxide nanoparticles.

6. The quantitative analysis method based on air pressure measuring according to claim 1, wherein in said air-sealed system, said reacting detection system comprising enzyme-linked immunosorbent assay system, DNA hydrogel system or functional DNA sensing system.

7. The quantitative analysis method based on air pressure measuring according to claim 6, wherein in said enzyme-linked immunosorbent assay system, quantitative analysis method based on air pressure measuring comprises the following steps: (1) selecting corresponding capture antibodies and detection antibodies according to the testing antigens; (2) modifying the signal amplification molecules or particles, labeling them with detection antibody molecules, or to be able to specifically conjugate to detection antibodies; (3) coating the solid surface which can be used for enzyme-linked immunosorbent assay such as multi-wells plate or magnetic beads or microspheres, adding capture antibodies to let they being conjugated or absorbed onto the solid surface after the coating, and then blocking the surface with blocking solution, adding the antigen solution to be detected, and add detection antibody to form double-antibody sandwich structure, wash away excess detection antibodies; (4) introducing signal amplification molecules; (5) adding substrate in the multi-wells plate, sealing the wells, signal amplification molecules or particles catalyze the substrate molecules, then a large amount of gas molecules are generated, and producing the pressure variation signal which can be read by air pressure meter; (6) the target molecule concentration is quantitatively measured according to the pressure value changes of the air pressure meter.

8. The quantitative analysis method based on air pressure measuring according to claim 6, wherein in said DNA hydrogel system, quantitative analysis method based on air pressure measuring comprising the following steps: (1) mix two poly-acrylamide-DNA strands, an aptamer and signal amplification molecules to prepare DNA aptamer crosslinked hydrogel containing signal amplification molecules; (2) add solution containing different known concentrations of analyte to the hydrogel, reacting and releasing signal amplification molecules; (3) after the reaction, the supernatant is put into a reaction tube, and make the signal amplification molecules and substrate process catalytic reaction; in an air-sealed system, the large amount of gas make the pressure rise inside the system, use air pressure meter to read, and record the data, then standard curve can be established, thus the content of target in the unknown samples can be detected.

9. The quantitative analysis method based on air pressure measuring according to claim 6, wherein in said functional DNA sensing system, quantitative analysis method based on air pressure measuring, comprising the following steps: (1) selecting appropriate aptamer according to the target molecules, add a sequence complementary to capture probe to the aptamer; (2) designing suitable detection probe sequence according to the sequence of aptamer, allowing when there are not target molecular, the detection probe can combine onto the aptamer strand through the interaction between bases, while when the target molecules exist, the detection probes can be replaced by the target molecule; (3) connecting the capture probe onto the surface of magnetic bead by biological or chemical conjugation method, which comprising the decarboxylation reaction or biotin avidin interaction, adding detection DNA and aptamer, form sandwich hybridization structure of functionalization DNA on the surface of the magnetic beads; (4) adding target in DNA sandwich hybridization system, target combined to aptamer, thus the detection probe on three-strand-structure be replaced out; (5) using magnet to enrich magnetic beads, and put the supernatant into a reaction tube, add a solution phase substrates, signal amplification molecules act with the solution phase substrates, then produce signal molecules which can be read by the air pressure meter. (6) recording test results according to air pressure meter readings.

10. The quantitative analysis method based on air pressure measuring according to claim 7, wherein said detection probe combined with signal amplification molecules which can catalyze substrate to generate large amount of gas molecules.

11. The quantitative analysis method based on air pressure measuring according to claim 9, wherein the combination of the aptamer and the target molecules, enables the target molecules to compete and replace to release the detection probe conjugated with signal amplification molecules (enzyme or nanoparticles), and realize follow-up signal amplification.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0024] FIG. 1, at room temperature, the catalytic efficiency of hydrogen peroxide enzyme (Catalase) of different concentrations under 9.79 M H2O2.

[0025] FIG. 2, at room temperature, under the different concentration of H2O2, the catalytic efficiency of 5 nM hydrogen peroxide enzyme (Catalase).

[0026] FIG. 3, at room temperature, under the different concentration of H2O2, the catalytic efficiency of 0.005 nM Au @ PtNPs.

[0027] FIG. 4, at room temperature, the contrast of the catalytic efficiency among hydrogen peroxide enzyme (Catalase), AuNPs, Au @ PtNPs.

[0028] FIG. 5, at room temperature, by the output mode of pressure, when the H2O2 concentration is 9.79 M, the catalytic efficiency in 1 hr of different concentrations of Au @ PtNPs.

[0029] FIG. 6, at room temperature, in ELISA system, the signal amplification molecules are biotinylated catalase, in 1 hr, for H5N1 avian influenza virus HA protein ELISA detection, investigation of catalytic activity of hydrogen peroxide enzyme (Catalase).

[0030] FIG. 7, at room temperature, in ELISA system, the feasibility of detection of recombinant protein system of human prostate specific antigen (PSA) was vitrificated in conventional ELISA method.

[0031] FIG. 8, at room temperature, in ELISA system, use nanoparticles are used to detect different concentration of target protein, target people detect prostate specific antigen (PSA) recombinant protein.

[0032] FIG. 9, at room temperature, in ELISA system, human serum albumin (HAS), sheep anti rat (IgG), matrix metalloproteinases (MMPS), thrombin (Thr) are used as negative contrast, investigate the selectivity of prostate specific antigen (PSA) in the system, the figure are the response of 120 um HSA, IgG, MMP, Thr, PSA, the reaction time is 1 hr.

[0033] FIG. 10, at room temperature, in ELISA system, on the basis of conventional ELISA method, investigate detecting accuracy of nanoparticles used to target protein, prostate specific antigen (PSA) of different concentration.

[0034] FIG. 11, at room temperature, in ELISA system, feasibility of H5N1 avian flu virus HA protein system of conventional ELISA.

[0035] FIG. 12, at room temperature, in ELISA system, use nanoparticles to detect target protein, the H5N1 avian flu virus HA protein of different concentrations.

[0036] FIG. 13, at room temperature, in ELISA system, the goat-anti-mouse second antibody (IgG), human serum albumin (HSA), influenza a (H3N2) virus (H3N2), SARS coronavirus (SARS) are used as negative contrast, investigate the selectivity of the H5N1 avian flu virus HA protein in the system, the figure is the responds about 120 um H5N1, IgG, HSA, H3N2, SARS, the reaction time is 1 hr.

[0037] FIG. 14, at room temperature, ELISA system, in the serum environment, detect the target protein, the H5N1 avian flu virus HA protein of different concentration by the use of nanoparticles.

[0038] FIG. 15, at room temperature, ELISA system, feasibility of people matrix metalloproteinases (MMP9) recombinant protein system by conventional ELISA.

[0039] FIG. 16, at room temperature, ELISA system, the use of nanoparticles, detect target protein, people matrix metalloproteinases (MMP9) of recombinant proteins of different concentrations.

[0040] FIG. 17, at room temperature, ELISA system, thrombin (Thr) and lysozyme (Lys), sheep-anti-rat (IgG) and human serum albumin (HSA) are used as negative control, investigate the selectivity of matrix metalloproteinases (MMP9) in the system. and the figure shows the response about to 120 m MMPS, Thr, Lys, IgG, HSA, the reaction time is 1 hr.

[0041] FIG. 18, at room temperature, in the DNA hydrogel system, detecting for different concentrations of cocaine, the reaction time is 5 min.

[0042] FIG. 19, at room temperature, in the DNA hydrogel system, detecting for different concentrations of cocaine, the reaction time is 15 min.

[0043] FIG. 20, at room temperature, in the DNA hydrogel system, in the actual urine sample system, detecting for different concentrations of cocaine, the reaction time is 5 min.

[0044] FIG. 21, at room temperature, in the DNA hydrogel system, benzoyl ecgonine and methyl ecgonine of cocaine metabolites are used as negative contrast, investigate t the selectivity of the system, the figure shows responses to 250 m cocaine and 2.5 mM benzoyl ecgonine and methyl ecgonine, the reaction time is 5 min.

[0045] FIG. 22, at room temperature, in the DNA hydrogel system, on the basis of LC/MS method, investigate the accuracy of the test by using nanoparticles, with the output pressure, detecting cocaine in different concentration target.

[0046] FIG. 23, at room temperature, in the DNA hydrogel system, detecting different concentrations of Adenosine (Adenosine), the reaction time is 5 min.

[0047] FIG. 24, at room temperature, in the DNA hydrogel system, with Cytidine (Cytidine and Uridine (Uridine) as the negative control, testing the selectivity of the system, the figure shows response to 1 mM Adenosine (Adenosine) and 10 mM Cytidine (Cytidine and Uridine (Uridine), reaction time is 5 min.

[0048] FIG. 25, at room temperature, in the DNA hydrogel system, detecting for different concentrations of Pb.sup.2+, the reaction time is 5 min.

[0049] FIG. 26 at room temperature, in the DNA hydrogel system, Ni.sup.2+, Mn.sup.2+, Ca.sup.2+, Co.sup.2+, Hg.sup.2+, Fe.sup.3+, Cu.sup.2+, Zn.sup.2+ and Cd.sup.2+ are used as negative contrast, investigate g the selectivity of the system, the figure shows the response to 1 mM Ni.sup.2+, Mn.sup.2+, Ca.sup.2+, Co.sup.2+, Hg.sup.2+, Fe.sup.3+, Cu.sup.2+, Zn.sup.2+ and Cd.sup.2+ and 400 nM Pb.sup.2+, the reaction time is 5 min.

[0050] FIG. 27, at room temperature, in the DNA hydrogel system, used for testing different concentrations of ochratoxin A (OTA), the reaction time is 5 min.

[0051] FIG. 28, at room temperature, in the DNA hydrogel system, aflatoxin M1 (AFM1), corn gibberellic ketene (zearalenone, ZEN), T-2 toxin (T-2), aspergillus toxin called patulin (patulin, PAT), citrinin (citrinin, CIT), ochre and aspergillus toxin B (OTB), noise aspergillus toxin (sterigmatocystin on STC are used as negative control, investigate the selectivity of the system, the figure shows the response to 1 mM AFM1, ZEN, T-2, PAT, CIT, OTB, on STC, and 25 mu M ochratoxin A (OTA), the reaction time is 5 min.

[0052] FIG. 29, at room temperature, in functional DNA sensing system, investigate the effect of different DNA numbers modified on the nanoparticles to the sensitivity of air pressure meter, by adenosine system, for example, the reaction time is 1.5 hr.

[0053] FIG. 30 at room temperature, in functional DNA sensor system, detecting for different concentrations of Adenosine (Adenosine), the reaction time is 1.5 hr.

PREFERRED EMBODIMENTS OF THE INVENTION

Embodiment 1: The Synthesis of Acrylic Acid and Phosphate Amide Monomer

[0054] The synthesis of acrylic acid and phosphate amide monomer is divided into three steps: 1) 6-amino-1-hexanol (1 g, 8.53 mmol), triethylamine (2.36 mL, 17 mmol) added into 100 mL methylene chloride in an ice bath, chase anaerobic conditions in the absence of water and oxygen, drop in methyl acryloyl chloride (2.67 g, 2.55 mmol), the entire system mixing for 2 hours at room temperature. 2) solvent dried by centrifugation under vacuum, add 10 mL ethanol and 15% NaOH (4 mL) into the product, then the product selective hydrolysis into N-(6-hydroxyhexyl) methacrylamide. The N-(6-hydroxyhexyl) methacrylamide is separated in silica gel column with ethyl acetate, after separation it begin the next phase of the reaction. 3) after purification, N-(6-hydroxyhexyl) methacrylamide (0.50 g, 2.70 mmol) is dissolved in 10 mL anhydrous methylene chloride, under the condition of 0 C., N, N-diisopropyl ethylamine (DIPEA, 0.98 g, 7.5 mmol) is dropped in, then 2-cyanoethylated N, N-diisopropyl chlorinated and phosphoramide (0.87 mL, 3.25 mmol) is dropped in, react at room temperature for 2 hours. After solvent was dried under an centrifuging-vacuum condition, product is eluted on silica gel column with the eluent of ethyl acetate, petroleum ether, triethylamine 40:60:3. The final product is colorless oily liquid. The final product nuclear magnetic characterization data is as follows: .sup.1H NMR (CDCl.sub.3): 5.92 (br, 1H), 5.63 (m, 1H), 5.27 (m, 1H), 3.86-3.72 (m, 2H), 3.66-3.49 (m, 4H), 3.30-3.23 (m, 2H), 2.61 (t, 2H), 1.92 (m, 3H), 1.58-1.50 (m, 4H) 1.37-1.32 (m, 4H) 1.17-1.13 (m, 12H). .sup.13C NMR (CDCl.sub.3): custom-character 168.6, 140.4, 119.3, 118.0, 63.8, 63.6, 58.6, 58.3, 43.2, 43.1, 39.8, 31.3, 29.7, 26.8, 25.8, 24.9, 24.8, 24.7, 19.0. 31P (CDCl3): 148.

Embodiment 2 Synthesis and Purification of the Nucleic Acids Modified by Methyl Allyl Group, Biotin Groups and Thiol Groups

[0055] Traditional CPG is used as solid carrier, and single DNA bases is used as raw material, then strand A, strand B, linker-aptamer, detection DNA, ELISA DNA are synthesized from the 3end to the 5 end on DNA synthesizer, finally the 5end of the strand of A and B are modified (modification is on the synthesizer) by the acrylic acid and phosphate amide monomer synthesized in embodiment 1, detection DNA is modified by thiol, detailed synthetic sequences are shown in table 1, table 2 and table 3. the CPG modified by Biotin modify is used as solid phase carrier, single DNA bases are used as raw material, capture DNA is synthesized from the 3end to 5 end on the DNA synthesizer, detailed synthetic sequences are shown in table 2. After the synthesis, transferring the CPG to 2 mL Eppendorf tube of clean and sterilization, add 0.5 mL solution which formed by methylamine:ammonia=1:1, ammonia solution under 65 C. for 30 min, so that the DNA can be cut off the CPG. After Ammonia solution, get supernatant, and use a small amount of ultrapure water cleaning the CPG, combine the supernatant. Add 2.5 times the volume of frozen anhydrous ethanol and 0.1 times the volume of 3 mol/L NaCl to the system, in 20 C. refrigerator for 30 min alcohol precipitation. After the alcohol precipitation, under 14000 RPM speed centrifuge for 10 min, abandon the supernatant. the coarse product obtained then is dissolved in pH 8, 0.1 mol/L acetate triethylamine (TEAA), using reversed-phase high performance liquid chromatograph for purification. products after reverse phaseHPLC purification then is vacuum dried. Besides the DNA modified by mercapto, the other DNA dissolved in 80% acetic acid to remove DMT, react after 30 min, dry and then dissolve in ultrapure water, desalination processing by using gel filtration column. Use ultraviolet-visible spectrophotometer to determine the absorbance of nucleic acid at 260 nm, calculate the corresponding amount of substance and density according to the extinction coefficient of the DNA. After the quantitative concentration, vacuum concentration. After 5 thiol modified DNA being purified in HPLC, add pH 6.5 0.1 M TEAA to dissolve DNA, detect A260, and diluted to A260=100, record total volume as V; then add 0.15 V 1 M AgNO3, blending, react in room temperature response for 30 min; Add 1 M 0.20 V DTT (dithiothreitol), blending, react at room temperature for 5 min. Centrifugal, take supernatant (DTT complex), washing precipitation with 1 v 0.1 M TEAA, and washing liquid is gathered together, Using gel filtration column for desalination processing. Use ultraviolet-visible spectrophotometer to detect the nucleic acid absorbance at 260 nm, calculate the corresponding amount of substance and density according to the extinction coefficient of the DNA. After the quantitation, the solution is concentrated under vacuum.

TABLE-US-00001 TABLE1 DNAsequenceusedinembodiment2 name sequence Cocaine 5-ACTCATCTGTGAATCTCG Linker-Apt GGAGACAAGGATAAATCCTTC AATGAAGTGGGTCTCCC-3 (underlinedpartisthe sequenceofaptamer) CocaineStrandA 5-acrydite-AAAATCACAGAT GAGT-3 CocaineStrandB 5-acrydite-AAAAGTCTCCCG AGAT-3 Adenosine 5-ACTCATCTGTGAAGAGAA Linker-Apt CCTGGGGGAGTATTGCGGAGG AAGGT-3 (underlinedpart isthesequenceofaptamer) Adenosine 5-acrydite-AAAATCACAGAT StrandA GAGT-3 Adenosine 5-acrydite-AAAACCCAGGTT StrandB CTCT-3 Pb.sup.2+Substrate 5-CTACAAAAACACATACTC strand ACTATrAGGAAGAGATGATCC ACATTTTCACAG-3 Pb.sup.2+Enzyme 5-CATCTCTGAAGTAGCGCC strand GCCGTATAGT-3 Pb.sup.2+StrandA 5-acrydite-CTGTGAAAATGT GG-3 Pb.sup.2+StrandB 5-acrydite-ATGTGTTTTTGT AG-3 OTALinker 5-CAGTGTCTGTGAGTATGC GATCGGGTGTGGGTGGCGTAA AGGGAGCATCGGACA-3 (underlinedpartisthe sequenceofaptamer) OTAStrandA 5-acrydite-CACAGACACTG-3 OTAStrandB 5-acrydite-CCGATCGCATA-3

TABLE-US-00002 TABLE2 DNAsequenceusedinembodiment2 name sequence Biotin- 5-TCACAGATGAGTAAAAAA-AAAAAA- DNA Biotin-3 Cocaine- 5-TTTTTTACTCATCTGTGAATCTCG Aptamer GGAGACAAGGATAAATCCTTCAATGAA GTGGGTCTCCC-3 (underlinedpart isthesequenceofaptamer) Cocaine- 5-HS-AAAAAAAAAAAAGTCTCCCGA DNA-SH GAT-3 Adenosine- 5-TTTTTTACTCATCTGTGAAGAGAA Aptamer CCTGGGGGAGTATTGCGGAGGAAG GT-3 (underlinedpartisthe sequenceofaptamer) Adenosine- 5-HS-AAAAAAAAAAAACCCAGG DNA-SH TTCTCT-3

TABLE-US-00003 TABLE3 DNAsequenceusedinembodiment2 name sequence ELISADNA 5-TTTTTTTTTT-PEG-PEG-PEG-Biotin-3

Embodiment 3: Double-Antibody Sandwich Preparation

[0056] Preparation of the H5N1 avian flu virus HA protein, for example, capture antibody is packaged in 96-well plate, the concentration is 2.0 g/mL, the volume is 100 L, seal the plate, 4 C. overnight. Washing three times using Wash Buffer. Add 300 L blocking liquid for at least 1 hr at room temperature for sealing. Add 100 L antigens to be detected with different concentrations, incubation 2 hr at room temperature, after washing three times, add 100 L, 1.5 g/mL detection antibody, incubation at room temperature for 1 hr, form double-antibody sandwich structure.

Embodiment 4: Feasibility Verifying Test of Conventional ELISA Protein System

[0057] Conventional ELISA reaction process is that, firstly the capture antibody is coated, protein and polystyrene solid phase carrier are combined by hydrophobic force. Then respectively add antigen, biotinylated detection antibody, SA-HRP complexes and the substrate, under the reaction of the substrate, by determining absorption of detecting targets, the result shown in FIG. 7, FIG. 10 and FIG. 15.

Embodiment 5: Preparation of Biotinylated Hydrogen Peroxide Enzyme (Catalase)

[0058] buffer used in biotinylating is: 0.1 M sodium bicarbonate, pH 8.4. 1 mg/ml BNHS (biotin-N-Amber imine esters) is slowly dropped into 10 mg/ml hydrogen peroxide enzyme (Catalase), control the final reaction volume ratio of 8:1., shaking and mixed, react at room temperature for 4 h. Ultrafiltration centrifugal, remove free BNHS, biotinylated hydrogen peroxide enzyme (Catalase) thus obtained.

Embodiment 6: ELISA System Test-Signal Amplification Molecules is Hydrogen Peroxide Enzyme (Catalase)

[0059] Add 100 L, 1 g/mL Streptavidin into the microcavity of 96-well palate having prepared double-antibody sandwich structure, incubation at room temperature for 1 hr, make it combined with the biotin on the detection antibody; Add 100 L, 20 nm Catalase-biotin, room temperature incubation for 1 hr, wash away excess hydrogen peroxide enzyme; add solution phase in the substrates into 96-well plate, cover the reaction cover to seal. the Signal amplification molecular, hydrogen peroxide enzyme act to the substrates in solution phase, produce signal molecule which can be read by the air pressure meter. According to pressure meter readings, record the test results. The results are shown in FIG. 6.

[0060] FIG. 6 is at room temperature, ELISA system, use hydrogen peroxide enzyme to detect target protein, the H5N1 avian flu virus HA protein with different concentrations. Capture antibody is coated in 96-well plates, its concentration is 2 g/mL, its volume is 100 L, then seal the plate, 4 C. overnight. Then wash three times using Wash Buffer. Add 300 L blocking liquid and block at room temperature for at least 1 hr. Add the 100 L antigens being detected with different concentrations, incubated at room temperature for 2 hr, after washing three times, add 100 L, 1.5 g/mL detection antibody, incubated at room temperature for 1 hr, form double-antibody sandwich structure, then wash out the detection antibody; add 100 L, 1 g/mL Streptavidin, and incubate at room temperature for 1 hr, make it being combinate to the biotin on the detection antibody; Add 100 L, 20 nM Catalase-biotin, incubate at room temperature for 1 hr, wash away excess hydrogen peroxide enzyme; add solution phase, the substrates H2O2 (0.31 M) into 96-well plates, cover the reaction cover, make it being sealed. Signal amplification molecular, the hydrogen peroxide enzyme act in the solution phase substrates, produce signal molecules which can be read by the air pressure meter. Control the reaction time for 1 hr. Record test results according to the readings of the air pressure meter.

Embodiment 7: ELISA System Test-Signal Amplification Molecule is Au @ PtNPs

[0061] Add 100 L, 1 g/mL Streptavidin into the microcavity of 96-well palate having prepared double-antibody sandwich structure, incubation at room temperature for 1 hr, make it combined with the biotin on the detection antibody; Add 100 L, 2.5 nM Au@PtNPs-DNA-biotin, room temperature incubation for 1 hr, wash away excess nanoparticles; add solution phase in the substrates into 96-well plate, cover the reaction cover to seal. The Signal amplification molecular, Au @ PtNPs act to the substrates in solution phase, produce signal molecule which can be read by the air pressure meter. According to pressure meter readings, record the test results. The results are shown in FIG. 8, FIG. 9, FIG. 11, FIG. 12 and FIG. 13, FIG. 14, FIG. 16, FIG. 17.

[0062] FIG. 8 is at room temperature, ELISA system, use nanoparticles to detect target protein, PSA recombinant proteins with different concentrations. capture antibody package is coated in 96-well plate, the concentration is 2.0 g/mL, the volume is 100 L, seal the plate, 4 C. overnight. Wash three times by Wash Buffer. add 300 L blocking liquid to block at least 1 hr at room temperature. Add 100 L of antigens to be detected with different concentrations, incubate 2 hr at room temperature, after washing three times, add 100 L, 0.2 g/mL detection antibody, incubate 1 hr at room temperature, form the double-antibody sandwich structure, wash away the detection antibody; add 100 L, 1 g/mL Streptavidin, incubate at room temperature for 1 hr, make it the combined with the biotin on the detection antibody; add 100 L, 0.625 nM Au @ PtNPs-DNA-biotin, incubate 1 hr at room temperature, wash away excess nanoparticles; add substrates in solution phase into the 96-well plates, cover the reaction cover, make it being sealed. Molecular signal amplification Au @ PtNPs act to the substrates in solution phase, produce signal molecule which can be read by the air pressure meter. Control the reaction time for 1 hr. Record test results according to the readings of the air pressure meter.

[0063] FIG. 9 is at room temperature, ELISA system, HSA, IgG, MMP, Thr are used as negative control, investigate the PSA selective of the system, the figure shows the response for 120 m HSA, IgG, MMP, Thr, PSA, the reaction time is 1 hr.

[0064] FIG. 11 is at room temperature, ELISA system, use nanoparticles to detect target protein, H5N1 avian flu virus HA protein with different concentrations. capture antibody package is coated in 96-well plate, the concentration is 2.0 g/mL, the volume is 100 L, seal the plate, 4 C. overnight. Wash three times by Wash Buffer. add 300 L blocking liquid to block at least 1 hr at room temperature. Add 100 L of antigens to be detected with different concentrations, incubate 2 hr at room temperature, after washing three times, add 100 L, 0.2 g/mL detection antibody, incubate 1 hr at room temperature, form the double-antibody sandwich structure, wash away the detection antibody; add 100 L, 1 g/mL Streptavidin, incubate at room temperature for 1 hr, make it the combined with the biotin on the detection antibody; add 100 L, 2.5 nMAu@PtAuNPs-DNA-biotin, incubate 1 hr at room temperature, wash away excess nanoparticles; add substrates in solution phase into the 96-well plates, cover the reaction cover, make it being sealed. Molecular signal amplification Au@PtAuNPs act to the substrates in solution phase, produce signal molecule which can be read by the air pressure meter. Control the reaction time for 1 hr. Record test results according to the readings of the air pressure meter. FIG. 12 is at room temperature, ELISA system, IgG, HSA, H3N2, SARS are used as negative control, investigate the selectivity of the system to the H5N1 avian flu virus HA protein, the figure shows responses to 120 m HSA, H3N2, H5N1, IgG SARS, the reaction time is 1 hr. FIG. 13 is at room temperature, ELISA system, in the context of serum HA, by adding different concentrations of H5N1 bird flu virus, with nanoparticles as signal amplification molecules, detect target protein, the H5N1 avian flu virus HA protein with different concentration.

[0065] FIG. 14 is at room temperature, ELISA system, detect target protein, the H5N1 avian flu virus HA protein with different concentrations. the protein samples containing different concentrations of H5N1 avian flu virus HA were divided into two groups, one group is detected by conventional ELISA in a standard way, another group use nanoparticles as signal amplification method to detect target protein, the H5N1 avian flu virus HA protein with different concentrations, investigate the accuracy of the method of the invention.

[0066] FIG. 16 is at room temperature, ELISA system, use nanoparticles to detect target protein, reorganization of human MMP9 protein with different concentrations. capture antibody package is coated in 96-well plate, the concentration is 2.0 g/mL, the volume is 100 L, seal the plate, 4 C. overnight. Wash three times by Wash Buffer. add 300 L blocking liquid (2% BSA), block at least 1 hr at room temperature. Add 100 L of antigens to be detected with different concentrations, incubate 2 hr at room temperature, after washing three times, add 100 L, 0.25 g/mL detection antibody, incubate 1 hr at room temperature, form the double-antibody sandwich structure, wash away the detection antibody; (4) add 100 L, 1 g/mL Streptavidin, incubate at room temperature for 1 hr, make it the combined with the biotin on the detection antibody; (5) add 100 L, 0.625 nM Au @ PtNPs-DNA-biotin, incubate 1 hr at room temperature, wash away excess nanoparticles; (6) add substrates in solution phase into the 96-well plates, cover the reaction cover, make it being sealed. Molecular signal amplification Au @ PtNPs act to the substrates in solution phase, produce signal molecule which can be read by the air pressure meter. Control the reaction time for 1 hr. Record test results according to the readings of the air pressure meter.

[0067] FIG. 17 is at room temperature, ELISA system, Thr, Lys, IgG, HSA are used as negative control, investigate the MMP selective in the system, the figure shows the response for 120 mMMP, Thr, Lys, IgG, HSA, the reaction time is 1 hr.

Embodiment 8: the Preparation of Hydrogels

[0068] Respectively dissolve the strand A and strand B into ultrapure water to form stock solution of high concentration DNA. Respectively prepare 10% ammonium persulfate and 5% TEMED (N, N,N,N-tetramethyl ethylenediamine), i.e. 0.05 g ammonium persulfate dissolved to 0.5 mL ultrapure water and 25 l TEMED dissolved in 0.5 mL ultrapure water. DNA and the acrylamide with the final concentration of 4% are mixed as mixture, vacuum degassing in the vacuum dryer for 10 min. add fresh compound initiator (ammonium persulfate) and accelerator (TEMED) with the final concentration of 1.4%, put the reaction system in the vacuum dryer after blending, under the condition of 30 C., vacuum reaction 15 min, get linear polymer product PS-A, PS-B of the strand A and strand B. Mix PS-A and PS-B according to 1:1, add 1 L, 10 reaction buffer (PB buffer for cocaine: 77 mM Na.sub.2HPO.sub.4, 23 mM NaH.sub.2PO.sub.4, 50 mM NaCl, 5 mM MgCl.sub.2, pH 7.3; Tris-HCl buffer for adenosine: 10 mM Tris-HCl, 100 mM NaCl, 10 mM MgCl.sub.2, pH 8.0; using Tris-CH3COOH buffer for Pb.sup.2+: 10 mM Tris-HCl, 300 mM NaCl, pH 8.0; Tris-HCl buffer for ochratoxin A: 10 mM Tris-HCl, 120 mM NaCl, 25 mM KCl, 20 mM CaCl.sub.2, pH 8.5), then add 2 l, 23 nM Au @ PtNPs blend by oscillation, then add PS-A, PS-B and linker aptamer in the ratio of is 1:1:0. 6. Repeat oscillation and the heating process, until get the three-dimensional crosslinked hydrogel coated with Au @ PtNPs. The forward reaction is process in dry bath, keep step heating at 65 C. for 5 mM, then cool to room temperature by nature.

Example 9: Steps of DNA Hydrogel Visual Quantitative Testing

[0069] Before using, wash the prepared hydrogel by corresponding 1Buffer 3 times, to remove signal amplification molecules residue in centrifugal tube wall and on the surface of the hydrogel, and then remove the water. Prepare targets detection by use of buffer solution, and add it to the centrifuge tube containing hydrogel. Transfer the centrifuge tube to shaker, at 30 C., fully reactions under the speed of 150 RPM. Collected the supernatant after the reaction, in 200 L homemade reaction tube, add 50 L supernatant respectively with 50 LH2O2, control of reaction time, read and record the data according to the changes of gas pressure, the results are shown in FIG. 18, FIG. 19 and FIG. 20, FIG. 21, FIG. 22, FIG. 23, 24, 25, FIG. 26 FIG. 27 and FIG. 28.

[0070] FIG. 18, at room temperature, in the DNA hydrogel system, for the detection of different concentrations of Cocaine. DNA hydrogel peptization experiment is in PB buffer (77 mM Na.sub.2HPO.sub.4, 23 mM NaH.sub.2PO.sub.4, 50 mM NaCl, 5 mM MgCl.sub.2, pH 7.3) in 30 C., 150 RPM to react 1 hr. Collect the supernatant, in the 200 mu L homemade reaction tube, respectively add 50 L supernatant and 50 LH2O2, after reaction 5 min, measuring the pressure, and record the data. The pressure difference value of measured value to value of blank group (0 M group), was calculated for plotting.

[0071] FIG. 19, at room temperature, in the DNA hydrogel system, for the detection of different concentrations of Cocaine. DNA hydrogel peptization experiment is in PB buffer (77 mM Na.sub.2HPO.sub.4, 23 mM NaH.sub.2PO.sub.4, 50 mM NaCl, 5 mM MgCl.sub.2, pH 7.3) in 30 C., 150 RPM to react 1 hr. Collect the supernatant, in the 200 mu L homemade reaction tube, respectively add 50 L supernatant and 50 LH2O2, after reaction 15 min, measuring the pressure, and record the data. With 0 M difference between the experimental group, drawing. Through the extension of the reaction time, to realize lower limit of detection for the system.

[0072] FIG. 20, at room temperature, in the DNA hydrogel system, in the actual samples in the urine, for the detection of different concentrations of Cocaine. DNA hydrogel peptization experiment is in PB buffer (77 mM Na.sub.2HPO.sub.4, 23 mM NaH.sub.2PO.sub.4, 50 mM NaCl, 5 mM MgCl.sub.2, pH 7.3) in 30 C., 150 RPM to react 1 hr. Collect the supernatant, in the 200 L homemade reaction tube, respectively add 50 L supernatant and 50 LH2O2, after reaction 5 min, measuring the pressure, and record the data. The difference value of measured pressure value to 0 M experimental group was calculated, and plotted to sample concentration

[0073] FIG. 21, at room temperature, in the DNA hydrogel system, benzoyl ecgonine and methyl ecgonine of cocaine metabolites are used as negative control, investigate the selectivity of the system, the figure shows the response to 250 m cocaine and 2.5 mM benzoyl ecgonine and methyl ecgonine, DNA hydrogel dispergation experiment is proceed in PB buffer (77 mM Na.sub.2HPO.sub.4, 23 mM NaH.sub.2PO.sub.4, 50 mM NaCl, 5 mM MgCl.sub.2, pH 7.3) in 30 C., 150 RPM reaction 1 hr. Collect supernatant, in the 200 L homemade reaction tube, respectively add 50 L reaction solution with 50 L H2O2, react for 5 min.

[0074] FIG. 22, at room temperature, in the DNA hydrogel system, in the actual samples of urine, detecting for different concentrations of Cocaine. Samples are divided into two copies, one copy of LC/MS detection in a standard way, another to mentioned method of the invention, output by air pressure, detect the target cocaine of different concentrations, investigate the accuracy of the method.

[0075] FIG. 23, at room temperature, in the DNA hydrogel system, detecting for Adenosine with different concentrations, the reaction time is 5 min. Changing the DNA sequence of hydrogel according to the target, can realize the detecting for corresponding target. DNA hydrogel peptization experiment is in Tris-HCl buffer (10 mMTris-HCl, 100 mM NaCl, 10 mM MgCl.sub.2, pH 8.0) in 30 C., 150 RPM react for 2 hr. Collect the supernatant, in the 200 mu L homemade reaction tube, respectively add 50 L supernatant and 50 L H2O2, after reacting for 5 min, measure the pressure, and record the data. The difference value of measured pressure value to 0 M experimental group was calculated, and plotted to sample concentration.

[0076] FIG. 24, at room temperature, in the DNA hydrogel system, Cytidine and Uridine are used as the negative control, investigate the selectivity of the system, the figure shows response to 1 mM Adenosine and 10 mM Cytidine, Uridine, response time is 5 min. DNA hydrogel peptization experiment is in Tris-HCl buffer (10 mMTris-HCl, 100 mM NaCl, 10 mM MgCl2, pH 8.0) in 30 C., 150 RPM react for 2 hr. Collect the supernatant, in the 200 L homemade reaction tube, respectively add 50 L supernatant and 50 L H2O2, react 5 min, then measure the pressure, and record the data. The difference value of measured pressure value to 0 M experimental group was calculated, and plotted to sample concentration.

[0077] FIG. 25, at room temperature, in the DNA hydrogel system, for detecting of Pb2+ with different concentrations, the reaction time is 5 min. DNA hydrogel peptization experiment is in Tris-HCl buffer (10 mMTris-CH3COOH, Tris HCl-10 mM, 300 mM NaCl, pH 8.0) in 30 C., 150 RPM 2.5 hr. Collect supernatant, in the 200 L homemade reaction tube, respectively add 50 L supernatant and 50 L H2O2, react for 5 min, then measure the pressure, and record the data. The difference value of measured pressure value to 0 M experimental group was calculated, and plotted to sample concentration.

[0078] FIG. 26, at room temperature, in the DNA the hydrogel system, Ni.sup.2+, Mn.sup.2+, Ca.sup.2+, Co.sup.2+, Hg.sup.2+, Fe.sup.3+, Cu.sup.2+, Zn.sup.2+ and Cd.sup.2+ are used as negative control, investigate the selectivity of the system, the figure shows the response to 1 mM Ni.sup.2+, Mn.sup.2+, Ca.sup.2+, Co.sup.2+, Hg.sup.2+, Fe.sup.3+, Cu.sup.2+, Zn.sup.2+, Cd.sup.2+ and 400 nM Pb.sup.2+, the reaction time is 5 min. DNA hydrogel peptization experiment is in Tris-HCl buffer (10 mMTris-CH.sub.3COOH, 10 mM Tris-HCl, 300 mM NaCl, pH 8.0) in 30 C., 150 RPM, 2.5 hr. Collect supernatant, in the 200 L homemade reaction in vitro, respectively add 50 L supernatant and 50 L H2O2, react for 5 min, measure the pressure, and record the data. The difference value of measured pressure value to 0 M experimental group was calculated, and plotted to sample concentration.

[0079] FIG. 27, at room temperature, in the DNA hydrogel system, being used for detecting ochratoxin A (OTA) with different concentrations, the reacting time is 5 min. DNA hydrogel peptization experiment is in Tris-HCl buffer (10 mMTris-HCl, 120 mM NaCl, 25 mM KCl, 20 mM CaCl.sub.2, pH 8.5) in 30 C., 150 RPM 1.5 hr. Collect supernatant, in the 200 L homemade reaction tube, respectively add 50 L supernatant and 50 L H2O2, react for 5 min, measure the pressure, and record the data. The difference value of measured pressure value to 0 M experimental group was calculated, and plotted to sample concentration.

[0080] FIG. 28, at room temperature, in the DNA hydrogel system, aflatoxin M1 (AFM1), corn gibberellic ketene (zearalenone, ZEN), T-2 toxin (T-2), aspergillus toxin called patulin (patulin, PAT), citrinin (citrinin, CIT), ochre and aspergillus toxin B (OTB), noise aspergillus toxin (sterigmatocystin on STC) are used as negative control, investigate the selectivity of the system, the figure shows the response to 1 mM AFM1, 2EA, T-2, PAT, CIT, OTB, SOER and 25 m ochratoxin A (OTA), the reaction time is 5 min. DNA hydrogel peptization experiment is in Tris-HCl buffer (10 mMTris-HCl, 120 mM NaCl, 25 mM KCl, 20 mM CaCl2, pH 8.5) in 30 C., 150 RPM 1.5 hr. Collect supernatant, in the 200 L homemade reaction tube, respectively add 50 L supernatant and 50 L H2O2, react for 5 min, measure the pressure, and record the data. The difference value of measured pressure value to 0 M experimental group was calculated, and plotted to sample concentration.

Embodiment 10: Preparation of Detection DNA

[0081] Take 1 ml solution of 13 nm Au @ PtAu, 14000 r/m centrifugal, remove the supernatant, add 1 ml Buffer, resuspended, repeated three times. Add 100 L F127 whose volume concentration is 10%, blending. Add 8 L DNA-SH, blending. Add 50 L 0.2 M H3PO4, blending. 37 C. rotation reaction for 1 h., 14000 r/m centrifugal, remove the supernatant, add 1 ml Buffer resuspend, repeated three times. By control the DNA-SH concentration, Au @ PtNPs modified with different number of DNA can be prepared, the results are shown in FIG. 29.

[0082] FIG. 29, under the condition of 25 C., in functional DNA sensing system, investigate the different DNA number modified on nanoparticles effect to the sensitivity of air pressure meter, adenosine system, for example, the reaction time is 1.5 hr. Take 150 l Streptavidin to modify magnetic beads, use 1 mL of PBS-T Buffer 1 time to clean; Heavy suspension in 950 l PBS Buffer-T, add 25 L 4 M Biotin-DNA and 25 L 4 M Ade-Apt, 200 RPM, 25 C. shake for 30 min; wash by PBS Buffer-T three times, watch time 1 mL; Take 600 l suspending liquid containing magnetic beads modified by Apt, add 200 l 25 nM Pt-DNA modified with different number of DNA and 300 l PBS-T Buffer (increasing the reaction volume, is advantageous to the blending of magnetic beads), 25 C. blending for 30 min; use PBS-T Buffer to wash 6 times, each time 1 mL; suspending in 300 L PBS_t Buffer, respectively divide into two centrifugal tubes, each centrifugal tube including 50 L, abandon supernatant, each group is added in adenosine with the final concentration 100 nm, the control group is added in PBS-T Buffer, final volume are 50 L, 25 C. blending for 30 min; put 10 L supernatant+40 L PBS buffer+50 L H2O2 in air pressure meter reaction tube, blending with a suction gun 10 times, then covered tightly. React for 1.5 h, then detect the pressure inside the system. Each sample has four parallel experiments. The signal/blank ratio was obtained by the dividing the pressure value of experiment group by the pressure value of blank group.

Embodiment 11: The Preparation of Functional DNA Sandwich Structure

[0083] Take 15 L magnetic beads modified by Streptavidin (strand mildew avidin), wash with 100 L PBS t Buffer 1 time; heavy Suspended in 98 L PBS-T Buffer, add 2 L 4 M Biotin-DNA, 200 RPM, 25 C. shake for 30 min; wash by PBS-T Buffer, each time 100 L; Heavy suspension in 80 L PBS-T Buffer, add 20 L 330 nM Aptamer, 200 RPM, 25 C. shake for 30 min; Each time, wash with PBS-T Buffer three times each time 100 L; add 240 L 2.5 nM DNA-Pt, 200 RPM, 25 C. shake for 30 min, then get the functional DNA sandwich structure.

Embodiment 12: Visual Quantitative Detection of Functional DNA

[0084] The prepared functional DNA sandwich structure is heavy suspended in 100 L PBS-T Buffer, add target solution with different concentrations, put on shaking bed, 200 RPM, 25 C. shake for 30 min After the reaction, take the supernatant into reaction tubes, let Au @ PtNPs catalyzed with H2O2; In the closing system, the generated O2 is transferred into pressure, using air pressure meter to read, and record the data. The results are shown in FIG. 30.

[0085] FIG. 30, under the condition of 25 C., in the functional DNA sensor system, used for detecting Adenosine with different concentrations, the reaction time is 1.5 hr. Take 150 L magnetic beads modified by Streptavidin, wash by 1 mL PBS-T Buffer 1 time; Heavy suspension in 950 L PBS-T Buffer, add 25 L 4 M Biotin-DNA and 25 L Ade-Apt, 200 RPM, 25 C. shake for 30 min; washed by PBS-T Buffer three times, Each time 1 mL; Take 600 L suspending liquid containing magnetic beads modified by Apt, add 200 L 25 nM Pt-DNA and 300 L PBS-T Buffer (increasing the reaction volume, is advantageous to the blending of magnetic beads), 25 C. blending for 30 min; washed by PBS-T Buffer 6 times, each time 1 mL; Heavy suspension in 300 L PBS-T Buffer, divided into six centrifugal tubes, each centrifugal tube including 504, abandon supernatant, respectively, add 50 L, 49.5 L, 47.5 L, 49.5 L, 49 L, 48.5 L PBS-T buffer into a, b, c, d, e, f, then respectively, add 0 L, 0.5 L, 2.5 L 0.1 M Adenosine into a, b, c, while add 0.5 L, 1 L, 1.5 L Adenosine into d,e,f, makes the final volume of 50 L, blending in 25 C. for 30 min; Put 10 L supernatant+40 L LPBS-T Buffer+50 L H2O2 into air pressure meter reaction tube, blending 10 times by a suction gun, and air-sealed tightly. detect the pressure inside the system after 1.5 h. Each sample has four parallel experiments.

[0086] The foregoing description of the exemplary embodiment of the invention has been presented for the purposes of illustration and description. It is not intended to be exhaustive or to limit the invention to the precise form disclosed. Many modifications and variations are possible in light of the above teaching. It is intended that the scope of the invention be limited not with detailed description, but rather by the claims appended hereto.

INDUSTRIAL APPLICABILITY

[0087] The present invention is to generate large amount of gas molecules by using enzymes or nanometer particles, etc.; converts target molecules detection signal into gas pressure signal; achieves signal amplification; and finally converts the pressure change into an electrical signal to conduct a reading through a barometer, thereby achieving high-sensitivity quantitative detection.