HUMAN HEPATIC 3D CO-CULTURE MODEL AND USES THEREOF

20170166870 ยท 2017-06-15

Assignee

Inventors

Cpc classification

International classification

Abstract

The invention in general relates to human hepatic 3D co-culture models, more in particular 3D spheroid co-cultures of human hepatocyte-like cells and hepatic stellate cells. Furthermore, the invention provides a method for obtaining such co-cultures, as well as the use of said co-cultures in the identification of pro-fibrotic and/or anti-fibrotic compounds.

Claims

1. A 3D co-culture comprising hepatocyte-like cells and hepatic stellate cells (HSCs); wherein said hepatic stellate cells are present in equal or excess amounts of said hepatocyte-like cells.

2. The 3D co-culture according to claim 1, wherein said hepatocyte-like cells are human hepatocyte-like cells selected from primary human hepatocytes, HepaRG cells, human embryonic stem cells (hESC) differentiated into hepatocyte-like cells, human induced pluripotent stem cells (hiPSC) differentiated into hepatocyte-like cells, primary fibroblast transdifferentiated into hepatocyte-like cells, and hepatocyte-like cell lines.

3. The 3D co-culture according to claim 1, wherein said hepatic stellate cells are human hepatic stellate cells selected from primary human hepatic stellate cells, human embryonic stem cells (hESC) differentiated into HSC-like cells, human induced pluripotent stem cells (hiPSC) differentiated into HSC-like cells, and human hepatic stellate cell lines.

4. The 3D co-culture according to claim 1, wherein said 3D co-culture is free-floating in the culture medium.

5. The 3D co-culture according to claim 1, wherein the amount of HSC cells is about double the amount of hepatocyte-like cells.

6. (canceled)

7. A screening assay for pro-fibrotic and/or anti-fibrotic compounds; said assay comprising: (a) providing a 3D co-culture according to claim 1, (b) incubating said co-culture with a test compound, and (c) determining whether said compound induces or inhibits transdifferentiation and/or activation of said hepatic stellate cells; wherein a compound that induces transdifferentiation and/or activation of said hepatic stellate cells is a pro-fibrotic compound; and wherein a compound that inhibits a fibrotic-compound induced-trans-differentiation and/or activation of said hepatic stellate cells is an anti-fibrotic compound.

8. The screening assay according to claim 7, wherein Col1a1, Col3a1 and/or Loxl2 expression levels are used as a read-out for hepatic stellate cell activation or transdifferentiation in (c).

9. The screening assay according to claim 8, wherein a compound that increases Col1a1, Col3a1 and/or Loxl2 expression is a pro-fibrotic compound; and wherein a compound that reduces Col1a1 and/or Loxl2 expression is an anti-fibrotic compound.

10. The screening assay according to claim 1, wherein said co-culture is incubated with said test compound as a single exposure or as repeated exposures.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0021] With specific reference now to the figures, it is stressed that the particulars shown are by way of example and for purposes of illustrative discussion of the different embodiments of the present invention only. They are presented in the cause of providing what is believed to be the most useful and readily description of the principles and conceptual aspects of the invention. In this regard no attempt is made to show structural details of the invention in more detail than is necessary for a fundamental understanding of the invention. The description taken with the drawings making apparent to those skilled in the art how the several forms of the invention may be embodied in practice.

[0022] FIG. 1: Screen of hepatocyte:hepatic stellate cell ratios in 3D mouse cultures. Figure represents the HSC activation markers (A, B) and Hepatocyte markers (C) measured in the different 3D mouse hepatic co-cultures. Abasal gene expression of fibrotic markers (aSMA and Col1a1) on day 9 of culture. BFold increase of aSMA and Col1a1 on day 9 upon 6 days treatment with the pro-fibrotic factor LPS. Horizontal line corresponds to non-treated 3D co-cultures for each case. Cover-time gene expression of albumin (a) and CYP3A11 (b) in the 3D co-cultures where better results were obtained previously (2hep:1HSC and 1Hep:2HSC). Comparisons between groups were analyzed for statistical significance by one-way ANOVA followed by Tukey. *** p<0.001; ** p<0.01; * p<0.05.

[0023] FIG. 2: Human 3D HSC activation/inactivation gene expression. Agene expression of activation markers in 3D human HSC kept in 3D spheroids for 10 days in regular HSC medium. Bgene expression of activation markers in 3D Co-culture and respective 3D HSC control in HepaRG medium on days 7 and 21. Each point/bar represents a pool of 6 spheroids, error bars represent standard deviation values. *p<0.05-3D HepaRG/HSC vs 3D HSC.

[0024] FIG. 3: mRNA fold increase of HSC markers upon incubation with reference pro-fibrotic factors. Afold increase of 6 day LPS-treated cells (on first and third weeks of culture) over non treated cells. Values are meanss.d. (n=6 spheroids). .sup.#p<0.05-treated HepaRG/HSC vs non-treated 3D HepaRG/HSC. BmRNA expression, of 3D HepaRG/HSC co-culture day 21, upon 48 h exposure to 10 ng/ml TGF; fold increase from the solvent control.

[0025] FIG. 4: Hepatocyte profile in 3D HepaRG/HSC co-culture vs 3D HepaRG mono-culture. ACYP induction in the HepaRG cultures upon exposure to prototype CYP inducers (RifampicinRIF; -NaphtoflavoneBNF; PhenobarbitalPB) for 48 hours on day 21; error bars represent the standard deviation between the 3 independent assays. BGene expression of reference hepatocyte markers (Albumin; Phase ICYP 3A4); Phase IIGSTa1; transporter SLCO1B1 in the HepaRG cultures on days 7 and 21 of culture on the 3 independent assays. Error bars represent the standard deviation between 2 measurements.

[0026] FIG. 5: 3D HepaRG/HSC culture resume.Fibrosis Adverse Outcome Pathway

[0027] FIG. 6: 24h APAP dose-exposure on 3D Co-culture and respective mono-culture controls. ACell viability in 3D co-culture after 24 hours incubation with different concentrations of APAP on day 21. The graph shows 3 independent experiments where each point represents N=5 spheroids. Bars represent standard deviation. BmRNA gene expression APAP dose-response activation in 3D Co-culture and respective controls. Each point represents the pool of 5 spheroids. Error bars are standard deviation of the PCR analysis. *p<0.05 vs 3D HepaRG/HSC culture, .sup.#p<0.05 vs solvent (0 mM APAP) control.

[0028] FIG. 7: Pro-collagen secretion. 3D HepaRG/HSC and respective mono-culture controls. Procollagen measured in the suppernantant 24 h after incubation with APAP/solvent in 3D HepaRG mono and 3D HepaRG/HSC co-culture. n=3 assays (suppernatant pooled from 6 spheroids).

[0029] FIG. 8: In vitro confirmation of the APAP in vitro data.Cell viability of 3D HepaRG/HSC co-culture exposed to APAP alone or together with (A) cytokine mixture (CK) or (C) fibrosis inhibitors such as Valproic Acid (VPA). Relative mRNA expression from the control (0mM APAP). Effect of the inflammatory mixture (B) and fibrosis inhibitors (D) and wash out and recovery on the activation markers (E). *p<0.05; test vs APAP alone n2 independent assays (4-6 spheroids/condition).

[0030] FIG. 9: Hepatic stellate cell activation markers gene upon acute and chronic exposure to APAP. ASMA, Col1a1 and Lox dose-response gene expression on mouse HSC isolated after 24 h of single dose injection of the named doses of APAP. Bgene expression of the same markers upon chronic exposure (4 weeks) to 375 mg APAP/kg weight. Statistical analysis using Unpaired T-test had significantly differences between treated (APAP) and control mice *** p<0.001; ** p<0.01; * p<0.05.

[0031] FIG. 10: APAP and reference fibrotic compounds in single- and repeated-exposure of the 3D HepaRG/HSC co-culture. (A, C and E) cell viability, represented by % ATP and (B, D and F) gene expression. Error bars represent the standard deviation between independent assays (N=2) each point represents the pool of 5-6 spheroids. (D, F) Graph inserts represent the second repeat of the assay. Due to the variation between assays values could not be averaged together. Each point represents the pool of 5-6 spheroids. (G-H) Fibrosis read-outs at the protein level. (G) Procollagen measurements in culture supernatant upon single and repeated compound exposure (day 14 and 21) to 3D HepaRG/HSCs. (H) Procollagen measurements in culture supernatant upon 24 h incubation with the reference pro-fibrotic compounds of 3D HepaRG and 3D HSCmono-cultures.

[0032] FIG. 11: HSC recover after single and repeated exposure to Acetaminophen, Methotrexate and Allyl Alcohol.Activation markers 24 h upon last exposure and 3 days washout.

DETAILED DESCRIPTION OF THE INVENTION

[0033] As evident from the examples that follow hereinafter, we have found that a 3D co-culture comprising hepatocyte-like cells and equal or excess amounts of hepatic stellate cells (HSC), results in a stable culture of functional hepatocyte-like cells with only marginal activation of HSCs in the absence of stimulating compounds. It is only upon incubation with pro-fibrotic compounds, that direct or indirect activation of the HSCs, via their close interaction with the hepatocyte-like cells, occurs. Therefore, the 3D co-cultures according to this invention, are preferred over the prior art known co-cultures (which include excess amounts of hepatocytes over HSCs), in particular for the testing of pro-fibrotic compounds.

[0034] Hence, in a first aspect, the present invention provides a 3D co-culture comprising hepatocyte- like cells and hepatic stellate cells (HSC); wherein said hepatic stellate cells are present in equal or excess amounts of said hepatocyte-like cells. In a particular embodiment, the amount of HSC cells is about double the amount of hepatocyte-like cells.

[0035] In the context of the present invention the term co-culture is meant to be an in vitro cell culture system containing at least two distinct cell types, more in particular hepatocyte-like cells and (quiescent-like) hepatic stellate cells. Conversely, the term mono-culture is meant to be a cell culture system containing only 1 type of hepatic cells. In a preferred embodiment, in the context of the present invention, the co-culture is a three-dimensional (3D) co-culture of cells preferably in the form resembling a sphere (i.e. spheroid 3D co-culture).

[0036] The term hepatocyte-like cells is meant to include cells which have similar functionalities as primary hepatocytes, and in particular show phenotypical features of functional hepatocytes when exposed to hepatogenic growth factors. Said phenotypical features may include expression and nuclear localization of liver-specific transcription factors, expression and polarization of drug transporters, expression of plasma proteins and typical building blocks of hepatic intercellular communication, activity of drug metabolizing enzymes at a level similar to primary hepatocytes. In particular, in the context of the present invention, hepatocyte-like cells are meant to include primary human hepatocytes, HepaRG cells, human embryonic stem cells (hESC) differentiated into hepatocyte-like cells, human induced pluripotent stem cells (hiPSC) differentiated into hepatocyte-like cells, primary fibroblast transdifferentiated into hepatocyte-like cells, or any hepatocyte-like cell line such as HepG2 or Upcyted hepatocytes . . . ; in particular HepaRG cells.

[0037] Hepatic stellate cells (HSC) also known as perisinusoidal cells or Ito cells are pericyte-like cells found in the perisinusoidal space (area between the sinusoids and hepatocytes) of the liver, also known as the space of Disse. In particular, in the context of the present invention, hepatic stellate cells are meant to include human hepatic stellate cells; in particular human hepatic stellate cells selected from the list comprising: primary human hepatic stellate cells, human embryonic stem cells (hESC) differentiated into HSC-like cells, human induced pluripotent stem cells (hiPSC) differentiated into HSC-like cells, and human hepatic stellate cell lines such as LX-2, JS-1, hTERT-HSC,upcyted-HSCs . . . ; in particular primary human hepatic stellate cells.

[0038] As already indicated herein before, any contact of the HSCs with the culture plates may already be sufficient to have them activated. Hence, and in order to keep the cells in a quiescent-like state for as long as possible, in a preferred embodiment, the 3D co-cultures are free-floating in the medium. This is preferably achieved by culturing them in cell-repellent culture dishes, more preferably with permanent rotation or stirring. Alternatively, low attachment cell culture plates either or not in combination with cell repellent agents such as PDMS (polydimethylsiloxaan), POLYHEMA (poly-2-hydroxyethyl methacrylate) or pluronic-type block copolymers (based on ethylene oxide and propylene oxide) may be used, again preferably with permanent rotation or stirring.

[0039] The 3D co-cultures of the present invention are in particular suitable for testing compounds suspected of having pro-and/or anti-fibrotic activity. Hence, in a further aspect, the present invention provides the use of the 3D co-culture according to this invention in a screening assay for pro-fibrotic and/or anti-fibrotic compounds; more in particular for the screening of pro-fibrotic compounds.

[0040] In the context of the present invention a pro-fibrotic compound is meant to be any compound that acts directly on HSC or indirectly via activation or action in other cell types resulting in HSC activation. By HSC activation is meant the (1) increased production of collagen, procollagen, loxl or any other ECM constitutive that can lead to fibrosis; (2) proliferation of the HSC by increasing their cell number accompanied or not by HSC motility and (3) by the change of gene expression increasing activation markers such as aSMA, members of the collagen family (Col1a1, Col3a1, etc.) or members of the Lox or Loxl family (Loxl1, Loxl2, etc). In the context of the present invention an anti-fibrotic compound is meant to be any compound that can inhibit or reverse the activation process in the HSCs or inhibit the signaling leading to this activation, excluding hepato-protective agents.

[0041] The present invention also provides a screening assay for pro-fibrotic and/or anti-fibrotic compounds; said assay comprising the steps of: [0042] (a) providing a 3D co-culture according to this invention, [0043] (b) incubating said co-culture with a test compound, and [0044] (c) determining whether said test compound induces or inhibits transdifferentiation and/or activation of said hepatic stellate cells;
wherein a compound that induces transdifferentiation and/or activation of said hepatic stellate cells is a pro-fibrotic compound; and wherein a compound that inhibits a fibrotic-compound induced-trans-differentiation and/or activation of said hepatic stellate cells is an anti-fibrotic compound.

[0045] In a particular embodiment, in step (c) of the screening assay according to this invention, Col1a1 , Col3a1 and/or Loxl2 expression levels may be used as a read-out for hepatic stellate cell activation or transdifferentiation. In said particular embodiment, a compound that increases Col1a1 , Col3a1 and/or Loxl2 expression is considered a pro-fibrotic compound; and a compound that reduces Col1a1 , Col3a1 and/or Loxl2 expression is considered an anti-fibrotic compound.

[0046] The 3D co-culture of the present invention may be obtained using the following general procedure: [0047] HSCs and hepatocyte-like cells were seeded in HepaRG thawing medium (William's Medium E supplemented with 2mM I-glutamine, 1% (v/v) pen/strep 5 g/ml bovine insulin and 50 M hydrocortisone and 10% (v/v) FBS and 0.5% (v/v) DMSO). in cell-repellent culture plates; wherein the HSCs are added in equal or excess amounts of the hepatocyte-like cells [0048] The plates were kept in the cell culture incubator (Heracell 150, Thermo electron corporation) 37 C., 5% CO.sub.2 for 10-15 min [0049] Within the cell culture incubator, the plates were stirred at 80 rpm during the entire period of culture [0050] After 24 h, HepaRG culture medium without DMSO was added [0051] The medium was refreshed every 2 days by changing 90% of the medium with fresh HepaRG culture medium without DMSO

EXAMPLES

Example 1

Selection of 3D Co-Culture Ratios

Material and Methods

Liver Cell Isolations and Seeding

[0052] Male balbC mice were used for all experiments; animals were housed in a controlled environment with free access to chow and water. Cells were isolated from mice aged 20-25 weeks after anesthesia with Nembutal. Previously described procedures for hepatic stellate cells (HSC) (Guimaraes et al., 2010; J. Hepatol 52(3): 389-397) and hepatocytes (Hep) (Goncalves et al., 2007 Malar J 6:169) were followed. Cells were maintained in hepatocyte culture medium consisting of William' E medium (1) with 2 mM of Gln, 20 mU/ml insulin, 50 nM dexamethasone, 2.5 g/ml fungizone, 50 g/ml gentamycin, 100 g/ml vancomycin, 100 U/ml penicillin, 100 g/ml streptamycin, 7 ng/ml glucagon and 10% FBS. After isolation, the different cell types were put together at different ratios (2Hep:1HSC; 1Hep:2HSC; 1Hep:4HSC) and seeded at 10 pl/well with a final amount of 5000 cells/well. Cells were kept in a low attachment plates with U bottom (Greiner 650185). 24 h after seeding, 100 l of the previously described medium without FBS was added to each well. Medium was refreshed every 2 days by changing 90% of the medium with medium lacking FBS.

RNA Analysis

[0053] Total RNA was extracted from cells using the ReliaPrep RNA Cell Miniprep System (Promega, Madison, Wis.). Reverse-transcription using the Revert Aid Kit (ThermoFisher Scientific, St. Leon-Rot, Germany) allowed conversion of RNA to cDNA. The RT reaction was performed at 25 C. for ten minutes followed by 30 minutes at 50 C. For quantitative real-time polymerase chain reaction (qPCR), GoTaq QPCR Master Mix with BRYTE green (Promega, Madison, Wis.) was used, subjected to qPCR in a 7500 real time PCR system and analysed using System SDS software v2.0.5 (Applied Biosystems), using GAPDH for normalisation. Reliability of GAPDH as house-keeping gene was determined using Normfinder (Andersen, Jensen et al. 2004) to produce the CT values. Besides CT, mRNA gene expression results are also expressed in fold change differences between samples were determined using the comparative Ct (Ct) method. The expression level of different targets, relative to GAPDH and relative to the calibrator, was given by 2.sup.Ct. Primers were produced by Integrated DNA Technologies (Leuven, Belgium).

Albumin Measurements

[0054] Albumin measurements were performed using the ELISA kit from AssayProGentaur, following the manufacture instructions.

Results

[0055] The readouts used to decide on the best ratio of cells were to assess good quality and functionality of the cells: i.e. quiescent HSCs for longer times however still able to respond to pro-fibrotic factors and functional hepatocytes.

[0056] As evident from FIG. 1A, all co-culture ratios (2Hep:1HSC, 1Hep:2HSC, 1Hep:4HSC) could keep the HSC activation markers aSMA and Col1a1 at the same or lower level compared to the 3D HSC without hepatocytes. However, the best results (lower aSMA and Col1a1 expression) were achieved with the ratios of 1Hep:2HSC and 1Hep:4HSC (FIG. 1A). Based on these results, further analysis of the 3D co-cultures was performed using the ratio of 1 Hep:2HSC.

[0057] When stimulated with a pro-fibrotic factor (LPS) the 1Hep:2HSC ratio showed a significantly better activation response (increased aSMA and Col1a1), when compared to the 2Hep:1HSC ratio and an even greater activation response when compared to the 3D HSC without hepatocytes (FIG. 1B).

[0058] Finally, long term expression of the hepatocyte markers albumin and cyp3a11 (FIG. 1C) was analyzed. The verification of an higher expression of the named markers in the 1Hep:2HSC 3D co-culture confirm the preference of higher amounts of HSCs in 3D co-culture for the testing of pro-fibrotic compounds.

Example 2

Characterization and Proof Testing of the 3D HepaRG/HSC Co-Culture

HSC Cells

[0059] Human cells Hepatic Stellate Cells (HSC) were isolated from hepatic non-parenchymal fraction and prepared for culture as described in Thoen et al., 2011 (J Hepatol 55(6): 1353-1360).

HepaRG

[0060] Cells were obtained from Biopredic, 8M differentiated cells/vial and thawed at the day 0 (starting of the co-culture). Thawing was performed following the instructions of the providers.

Medium

[0061] Cells were maintained in HepaRG maintenance medium without DMSO. All compound incubations (CYP inducers and APAP) were performed in Induction/Toxicity medium which is the same medium but without serum.

[0062] Generation and maintenance of 3D cell spheroids For the generation of the cell spheroids, 96-well plates treated with cell-repellent (Greiner ref. 650970) are used. HepaRG cells are directly used upon thawing and HSCs were trypsinized and collected in HepaRG thawing medium. Mono- and co-culture suspensions were prepared in HepaRG thawing medium as shown below and seeded at 10 l/well:

TABLE-US-00001 TABLE 1 3D cell seeding Type of culture HSC seeding HepaRG seeding 3D HepaRG mono-culture 0.2 million cells/ml 3D HSC mono-culture 0.2 million cells/ml 3D HepaRG/HSC co-culture 0.133 million cells/ml 0.067 million cells/ml

[0063] After 10-15 min in the incubator, plates were stirred at 80 rpm for the entire period of the culture. 24 h after seeding, 100 l of HepaRG culture medium 0% DMSO was added to each well. Medium was refreshed every 2 days by changing 90% of the medium. 3D HepaRG/HSC co-culture and control mono-culture were cultured for 21 days. Cross diameter of the spheroids never exceeded 200 turn (date not shown).

CYP induction

[0064] CYP induction assays were performed in 3D HepaRG/co-culture as well as in 3D HepaRG monoculture. For 48 h, starting at day 19, cells were exposed to prototype inducers (530 M phenobarbital [PB], 10 M rifampicin [RIF], and 25 M -naphthoflavone [BNF]), as previously described in Leite et al., 2012 (Toxicol Sci 130(1): 106-116) using HepaRG induction/toxicity medium. Controls were kept in the same medium with the same amount of solvent (0.1% DMS0). Spheroids were exposed to the inducers individually. After the incubation time, cells were washed and pulled, 5 spheroids/condition to perform the activity assay using the P450-Glo CYP2C9 Assay, CYP3A and CYP 1A2 (Promega) respectively, following the instructions of the manufacturer. At the end of the incubation, results were normalized by total ATP content measured using the Cell titer Glo (Promega).

Exposure to Pro-Fibrotic Factors

[0065] From day 14 to day 21, 3D HepaRG/HSC spheroids were exposed to a solution of 100 ng/ml Lipopolysaccharide (LPS, Sigma) in culture medium, refreshed every second day up to day 21. Incubation with the Transforming growth factor-1 (TGF-1, R&D systems inc., Minneapolis, Minn., USA) was performed on day 19 for 48 h at a concentration of 10 ng/ml in HepaRG Induction/Toxicity medium. On day 21, cells were lysed and gene expression was analyzed upon RNA extraction.

APAP Incubation

[0066] APAP toxicity assay was performed in 3D HepaRG/co-culture as well as in 3D HepaRG monoculture. For 24 h, starting at day 20, cells were exposed to a range of APAP concentrations between 0.5 and 80 mM, keeping cells with the solvent (0.1% DMSO) as a control. For some experiments the culture medium was supplemented with 2.5 mM valproic acid (VPA sodium salt, Sigma-Aldrich) or with cytokine mixture (Raicevic et al.,2012)-interleukin (IL)-1 25 ng/mL (Peprotech, Rocky Hill, N.J., USA), interferon (IFN)- 10.sup.3 U/mL, tumor necrosis factor (TNF)-a 50 ng/mL, and IFN- 3.Math.10.sup.3 U/mL (all from Prospec, Inc., East Brunswick, N.J., USA). For the recovery assay, at the end of APAP incubation, cells were washed using HepaRG culture 0% DMSO medium and kept in the same medium for 3 more days.

[0067] At the end of the incubation period, 5 spheroids per condition were pooled and lysed for RNA analyses, while the remaining spheroids per condition were lysed individually for viability analysis using the Cell titer Glo kit (Promega) for ATP measurements following the instructions of the manufacturer.

RNA Analysis

[0068] Total RNA was extracted from cells using the ReliaPrep RNA Cell Miniprep System (Promega, Madison, Wis.). Reverse-transcription using the Revert Aid Kit (ThermoFisher Scientific, St. Leon-Rot, Germany) allowed conversion of RNA to cDNA. The RT reaction was performed at 25 C. for ten minutes followed by 30 minutes at 50 C. For quantitative real-time polymerase chain reaction (qPCR), GoTaq QPCR Master Mix with BRYTE green (Promega, Madison, Wis.) was used, subjected to qPCR in a 7500 real time PCR system and analysed using System SDS software v2.0.5 (Applied Biosystems), using GAPDH for normalisation. Primers were produced by Integrated DNA Technologies (Leuven, Belgium) are listed in Table 2.

TABLE-US-00002 TABLE2 PrimersusedforQPCRanalysis(*mouseprimers) GenBank SEQ SEQ Gene AccNo ForwardPrimer IDNo ReversePrimer IDNo GAPDH NM_002046.4 AGCCACATCGCTCAG 1 GCCCAATACGACCAAA 17 ACAC TCC ACTA2 NM_001141945.1 CTGTTCCAGCCATCC 2 TCATGATGCTGTTGTA 18 TTCAT GGTGG COL1A1 NM_000088.3 GACACAGAGGTTTCA 3 CACCCTTAGCACCAAC 19 GTGG AG LOX NM_001178102.1 CACAGTTGTCATCAA 4 CTGACCTTTAGGATAT 20 CATTACC AGTTTCCAG IL6 NM_000600.3 GATGAGTACAAAAGT 5 CTGCAGCCACTGGTTC 21 CCTGATCCA TGT MMP1 NM_001145938.1 GCTAACCTTTGATGC 6 TTTGTGCGCATGTAGA 22 NM_002421.3 TATAACTACGA ATCTG CCL2 NM_002982.3 AGTCTCTGCCGCCCT 7 GTGACTGGGGCATTGA 23 TCT TTG TNF NM_000594 CCTCTCTCTAATCAG 8 GAGGACCTGGGAGTA 24 CCCTCTG GATGAG IL1B NM_000576 AGCTACGAATCTCCG 9 CGTTATCCCATGTGTC 25 ACCAC GAAGAA COL3A1 NM_000090.3 GGAGCTGGCTACTTC 10 GGGAACATCCTCCTTC 26 TCGC AACAG LOXL2 NM_002318.2 GGAGAGGACATACA 11 CCATGGAGAATGGCCA 27 ATACCAAAGTG GTAG MKI67 NM_002417 ACGCCTGGTTACTAT 12 CAGACCCATTTACTTG 28 CAAAAGG TGTTGGA ALB NM_000477.5 TGGCACAATGAAGTG 13 CTGAGCAAAGGCAATC 29 GGTAA AACA CYP3A4 NM_017460.5 CCTCCCTGAAAGATT 14 TGAAGAAGTCCTCCTA 30 NM_001202855.2 CAGC AGCT GSTA1 NM_145740 CTGCCCGTATGTCCA 15 AGCTCCTCGACGTAGT 31 CCTG AGAGA SLCO1B1 NM_006446.4 GCAATAGCAATGATT 16 CCAACCCATCGAGAAT 32 GGTCC CAG

Albumin Measurements

[0069] Albumin measurements were performed using the ELISA kit from AssayProGentaur, following the manufacture instructions.

Pro-Collagen Measurements

[0070] Samples for pro-collagen measurement were five times concentrated using 10 kD Vivaspin 500 ultrafiltration columns (VWR, Radnor, Pa.), the resulting supernatant was analysed for the presence of Type I C-Peptide using the TAKARA (Chanteloup-en-Brie, France) kit.

Seahorse

[0071] Mitochondrial functions of the 3D HSC, 3D HepaRG and 3D HepaRG/HSC were explored using a XFe96 Analyser. Measurements of the Oxygen Consumption Rate (OCR) and Glycolysis (through proton productionExtracellular Acidification rate, ECAR) were done first in the basal conditions and upon APAP exposure. In the basal state, cells were challenged to stress situations using the XF Cell Mito Stress Test Kit (Seahorse Biosciences) following the instructions of the manufacturer. Equivalent assay was performed in the three culture systems after 12 and 24 hours of APAP incubation.

Statistics

[0072] Comparisons between more than two groups were analyzed for statistical significance by one-way ANOVA followed by Tukey. Statistical analysis of values for comparison between two groups was performed using an independent sample t-test. Results were considered significant when p<0.05.

RESULTS

[0073] For the development of the human 3D hepatic co-culture cryopreserved differentiated HepaRG were used as functional hepatocyte-like cells and human HSCs generated in-house were used as hepatic stellate. HSCs were isolated from the non-parenchymal fraction of human livers, expanded in culture and frozen as previously described and characterized by us (Thoen, Guimaraes et al. 2011). To generate the co-culture cell spheroids on day 0, specific cell amounts in single cell suspension from both cell types were put in contact with each other in non-attaching round wells and orbital stirring. This strategy allowed spontaneous and quick generation of spheroids and together with the fact that the cells do not expand in these conditions, we could ensure an optimal spheroid diameter at 200 pm maximum for the entire culture time. It is known, that this size avoids the formation of necrotic cores mimicking also the maximum distance that a cell is from a blood vessel within the body. This size together with the active mass transfer induced by the stirring, allows a good nutrient and oxygen diffusion within the spheroid. Both control mono-cultures of HSC and HepaRG were kept with equivalent total cell amount/spheroid to ensure similar diffusion. Notably, after 21 days in culture, the cells in 3D HepaRG/HSC spheroid show a segregated organization with a concentration of HSCs in the core of the spheroid, while hepatocyte-like cells, the first target of compounds, accumulate more in the periphery (data not shown). Cell ratio and medium composition was optimized based on the better establishment of hepatocyte functions and less activated state of the HSCs. We achieved this balance by culturing the cells in a ratio of 1HepaRG:2HSC in a hepatocyte-based medium. As detailed below, we have found that by culturing HSC in 3D spheroids, the expression of regular fibrotic markers such as aSMA, Col1a1 and Lox, that are normally increased in 2D monolayer cultures, can be reduced (FIG. 2A). As detailed in example 1, and confirmed herein below, this effect is further improved when HSCs are kept in equal or excess amounts in 3D co-culture spheroids with hepatocyte-like cells (HepaRG), in hepatocyte medium, (FIG. 2B). Consequently, in order to test the HSCs functions at this stage, we analyzed the responsiveness of the 3D HepaRG/HSC to LPS and TGF, two known pro-fibrogenic factors that induce specific HSC responses. We observed that as it happens during liver fibrosis, LPS induced an up-regulation of the survivor markers (IL6, MMP1, CCL2, TNF, IL1) (FIG. 3A) while TGF acted on the activation markers (Acta2, Col1a1, Col3a1, Loxl2) (FIG. 3B). Such up-regulations could not be observed in the respective 3D mono-cultures (data not shown).

[0074] In spite of the inactive state of the HSCs in 3D mono-culture, when compared with regular 2D HSC cultures, little or inexistent activation was observed when challenged with pro-fibrotic factors. It is our believe that, as it happens in vivo, cells need multiple stimuli for activation, which in 2D is overcompensated by the rigidity of the tissue culture dish surface.

[0075] In order to analyze the activation of HSCs in a controlled and more reliable way, we developed a more complex 3D system by introducing human hepatocyte-like cells (HepaRG (BioPredic, France), which are the main targets of most drugs and the main liver metabolizers. Notwithstanding of being insufficient as mono-culture to mimic a fibrotic response, the role of hepatocytes in this model is crucial not only as a trigger of HSC once injured, but also for the metabolization/biotransformation of drugs that can alter their effect in the development of liver fibrosis. There remains the need to ensure their functionalities, but also to avoid HSC activation in response to hepatocyte de-differentiation or death after a while in culture. Our studies showed that the metabolic profile of the HepaRGs is not affected by the presence of HSCs (CYP-activity and inducibilityFIG. 4A; hepatocyte gene expressionFIG. 4B), and that the inactivation state of the HSCs is even improved (FIG. 2B) by the co-culture environment as mentioned before. Likewise, induction values are in alignment with CYP inducing capacities of HepaRG maintained in similar conditions (Table 3).

[0076] Additionally, CYP3A4 staining in the 3D HepaRG/HSC spheroid section, showed good protein expression (data not shown) since only 1/6 of the 3D co-culture spheroid cells (half of HepaRG) are hepatocyte-like cells. To complement the characterization of hepatocyte functions, we evaluated the transport capacities by the excretion of CMFDA, a MRP2 substrate. Once inside the cells, CMFDA is metabolized into its fluorescence form and then excreted by the functional hepatocytes. The visualization of its accumulation upon excretion, on specific sites resembling bile before totally wash out, was only possible upon fixation showing a good elimination capacity of the spheroid (data not shown).

[0077] In spite of the good metabolic activity in the first week (data not shown), values were more stable at the last week of culture, where the cell-cell interaction has been better promoted between the different cell types. Therefore, our further assays were design to have the cellular readouts at day 21.

[0078] After optimization of the strategy to efficiently generate 3D co-culture spheroids, with the proper cell ratio and correct media formulation for 21 days in culture, the model was validated for the use of a compound that would induce in vitro hepatocyte injury and consequent HSC activation. In order to exploit the capacity of our method to respond to fibrosis, we followed a fibrosis Adversed Outcome Pathway (AOP) developed by us and others (FIG. 5).

[0079] Acetaminophen (APAP) was used as a reference compound with a known outcome, i.e. hepatotoxicity and perhaps the ability to induce indirectly HSC activation. This also serves as a quality control of the hepatocyte/HSC co-culture since it verifies effective metabolisation by hepatocytes (cells die from the accumulation of NAPQI, a CYP2E1-mediated metabolite of APAP and this can indicate the good quality of the cells after 21 days) and the potential of the HSCs to activate upon hepatocyte injury. When the EC50 values (concentration at which the compound kills half of the populationTable 3) were evaluated, we confirmed that it is slightly decreased in the co-cultures when compared with the HepaRG mono-cultures (table 4). Since for APAP to become actively hepatotoxic it is necessary to be metabolized, the reduction most likely indicates that the CYP activity in the 3D co-cultures is higher than in the HepaRG monocultures. Furthermore, when compared with similar studies we can see that this activity is improving over time in our studies while in Gunness et. al. studies (Gunness et al., 2013; Toxicol. Sci 133(1), 67-78) this is decreasing. Besides the presence of the HSCs, we believe that this result is probably due to the absence of DMSO at the beginning and continuation of the culture.

TABLE-US-00003 TABLE 4 APAP EC.sub.50 values (stdev) Day 6/7 Day 21/22 Current study 3D HepaRG 11.6 11.6 2.15 0% DMSO 3D HepaRG/HSC 10.0 1.09 8.0 4.17 Gunness et al. 2013 3D HepaRG 2.7 7.14 10.1 9.90 2% DMSO (Gunness et al. , 2013; Toxicol. Sci 133(1), 67-78)

[0080] Despite the toxic effect of APAP on the HSC, this is only observed at the highest concentrations (data not shown) normally not related with the CYP metabolization into NAPQI but mithocondrial oxidative stress. We investigated the effect of APAP on the different cell types by measurement of the two major energy producing pathways assessing at the mitochondrial functional level. For that purpose, we measured the Oxygen Consumption Rate (OCR) and Glycolisis (through proton productionExtracellular Acidification rate, ECAR) using the XF Cell Mito Stress Test Kit (Seahorse Biosciences) 0, 12 and 24 hours of APAP incubation in the three 3D cultures. When we compare the two 3D mono-culture, (0 mM APAP) we detect a severely higher ATP production in the HepaRG, leading us to assume that majority of the ATP levels in the co-culture accrues from these cells (data not shown). We can then infer that the observed drop on the ATP levels in the 3D HepaRG/HSC, after APAP incubation is mainly a consequence of toxicity in HepaRG, most probably hepatotoxicity. The same assay allowed the comparison of the three culture systems regarding the recover from mithocondrial stress. When challenged in sequential respiratory inhibition and rescue, using Oligomycin, FCCP and Antimycin A+Rotenone, the higher OCR and ECAR values show that, both in basal and APAP conditions, the 3D HepaRG/HSC has better capacity to cope and recover from stress that any of the mono-cultures (data not shown). This effect difference is more pronounced when compared with the 3D HSCs. Additionally, the hepatotoxic effect of APAP is also confirmed by caspase 3 stainings concentrated in the remaining cells of the outer layer of the spheroid.

[0081] Additionally, results show that upon an efficient dose-response APAP toxicity (FIG. 6A), mRNA levels of several pro-fibrotic markers are induced in a dose-dependent fashion (FIG. 6B). When analyzing the relative improvement of expression of the activation markers Col1a1, Col3a1 and Loxl2 it can be confirmed that expression is only increased or in a higher extent in the co- culture (bold values in table 5) and not in the correspondent mono-cultures.

TABLE-US-00004 TABLE 5 mRNA fold increase after exposure to 20 mM APAP (24h) 3D HepaRG/HSC 3D HSC 3D HepaRG aSMA Assay 1 3.27 +/ 0.12 0.67 +/ 0.87 ND Assay 2 0.59 +/ 0.03 0.38 +/ 0.00 0.69 +/ 0.09 Assay 3 0.86 +/ 0.10 0.17 +/ 0.17 1.06 +/ 0.13 Col1a1 Assay 1 51.73 +/ 4.10 ND ND Assay 2 3.68 +/ 0.64 0.78 +/ 0.03 3.01 +/ 0.06 Assay 3 10.21 +/ 1.75 0.27 +/ 0.27 4.80 +/ 4.83 Col3a1 Assay 1 4.87 +/ 0.01 0.37 +/ 0.02 ND Assay 2 2.08 +/ 0.10 0.08 +/ 0.01 13.59 +/ 14.64 Assay 3 4.44 +/ 0.20 0.16 +/ 0.16 0.65 +/ 0.02 Loxl2 Assay 1 302.54 +/ 1.60 1.13 +/ 0.05 ND Assay 2 9.49 +/ 1.93 0.70 +/ 0.23 ND Assay 3 22.97 +/ 0.07 0.85 +/ 0.86 ND

[0082] The irresponsiveness of ACTA2 in these conditions, together with parallel studies involving TGF-blockers (data not shown) made us doubt on the role of TGF HSC activation upon APAP. Yet, we could detect an increase at the protein level, in the center of the spheroid (data not shown). Regarding the collagen's fold increase, not much difference was detected between the 3D HepaRG/HSC and the 3D HepaRG, nevertheless, there is a 10 to 100 difference in the basal gene expression levels lower in the 3D HepaRG (data not shown). This differences in levels are translated into the amount of collagen secreted into the medium. Following the clinical method of measurement of the C-terminal pro-collagen in the cultures supernatants, we observed a significant increase of collagen secretion in the 3D HepaRG/HSC cultures upon APAP incubation, which is not observed in the 3D HepaRG cultures (FIG. 7). Additionally, we could further confirm collagen secretion, by staining and detection of cross-linked collagen (picrosirius) in the paraffin section of the 3D HepaRG/HSC (data not shown). Even though the collagen accumulation in the spheroid is quite reserved when compared with normal fibrotic liver biopsies, it is important to bear in mind that this is the result of a short insult.

Confirmation of the APAP In Vitro Data

[0083] Acute liver failure as a consequence of exposure to high doses of APAP has been widely reported in animals and humans. However, the liver effects upon exposure to sub-lethal doses of APAP were never investigated, especially regarding fibrosis, where the foremost manner of in vivo HSC activation is hepatocyte injury. In order to warrant that the APAP-dependent HSC activation we observed in the 3D HepaRG/HSC model is not an artefact, we further characterized the system and test in the possible in vivo model. We based our additional characterization of the hepatic co-culture in 3 fibrosis features, observed in vivo: [0084] response to inflammation; [0085] inhibition of HSC activation by inhibiting HDAC; and [0086] fibrosis recovery

[0087] Following the key events of the fibrosis AOP, it is known that the recruitment of Macrophages and Kupffer cells will trigger the fibrotic response. Knowing that inflammation is one of the steps of APAP toxicity we mimicked the cytokine release from immune cells by performing the APAP exposure together with cytokine mixture (CK: TNF, IL1, IFN and IFN). While CK alone (0 mM of APAP+CK) had no effect on the culture read-outs (FIG. 8A and B), when combined with the increasing concentrations of APAP, the toxic effect was potentiated (FIG. 8A), as well as the up-regulation of COL1A1, COL3A1 and LOXL2 (FIG. 8B). This assay proves the possibility to mimic the fibrotic inflammatory environment in the 3D co-culture. Furthermore, it also shows that there are stimuli that are not sufficient to induce a response of the system (CK alone has no effect on activation). FIG. 3A and B shows that HSC in the 3D HepaRG/HSC can activate as response to factors known to have a direct effect on these cells. For APAP, in order to confirm that the LOXL2, COL1A1 and COL1A3 up-regulations depicts HSC activation, we used valproic acid (VPA) an HDAC inhibitor, acting on HSC without changing hepatotoxicity, as previously shown by us (Mannaerts et al., 2010). In the study of Mannaerts et. al. VPA inhibited HSC activation both in 2D cultures and CCL.sub.4 fibrosis mice, in the latter case, no decrease of the ALT values was observed. Identically, we observed that VPA did not affect APAP toxicity in the 3D HepaRG/HSC while we detect a lower up-regulation of the HSC markers at the highest APAP concentrations (FIG. 8 C and D). Finally, when we kept the culture in culture for additional 3 days upon APAP washout, we observed a decrease of the HSC activation markers (FIG. 8E) simulating HSC recover (Kisseleva, Cong et al. 2012).

Example 3

In Vivo Confirmation of the Pro-Fibrotic Profile of the APAP

Material and Methods

Liver In Vivo Animal Models

[0088] Male balbC and C57BL/6 mice were used for all experiments; animals were housed in a controlled environment with free access to chow and water. The experimental protocol was approved by the institutional Animal Care and Use Committee of Vrije Universiteit Brussel, permit number 14-212-2, and National Institutes of Health principles of laboratory animal care (NIH publication 86-23, revised 1995) were followed.

[0089] Acute and chronic models for liver fibrosis were used on mice of age 7-8 weeks. Acute injury was induced by a single dose of Acetaminophen (APAP) of 50; 150; 300 or 500 mg APAP/kg weight. Chronic injury was induced by repeated injections of APAP twice per week for 4 weeks. Hepatic stellate cells were collected at the end of the treatment. Isolation of stellate cells was done using FACS, based on UV-positivity. After isolation cells were not cultured, but immediately used for mRNA analysis.

RNA Analysis

[0090] Total RNA was extracted from cells using the ReliaPrep RNA Cell Miniprep System (Promega, Madison, Wis.). Reverse-transcription using the Revert Aid Kit (ThermoFisher Scientific, St. Leon-Rot, Germany) allowed conversion of RNA to cDNA. The RT reaction was performed at 25 C. for ten minutes followed by 30 minutes at 50 C. For quantitative real-time polymerase chain reaction (qPCR), GoTaq QPCR Master Mix with BRYTE green (Promega, Madison, Wis.) was used, subjected to qPCR in a 7500 real time PCR system and analysed using System SDS software v2.0.5 (Applied Biosystems), using GAPDH for normalisation. Reliability of GAPDH as house-keeping gene was determined using Normfinder (Andersen et al., 2004; Cancer Res 64(15): 5245-5250) to produce the CT values. Primers were produced by Integrated DNA Technologies (Leuven, Belgium). Primers produced by Integrated DNA Technologies (Leuven, Belgium) are listed in Table 6.

TABLE-US-00005 TABLE6 PrimersusedforQPCRanalysis GenBank SEQ SEQ Gene AccNo ForwardPrimer IDNo ReversePrimer IDNo Gapdh* NM_008084 TGTCCGTCGTGGATCTGAC 33 CCTGCTTCACCACCT 37 TCTTG Acta2* NM_007392 CCAGCACCATGAAGATCAAG 34 TGGAAGGTAGACAG 38 CGAAGC Col1a1* NM_007742 ACCTAAGGGTACCGCTGGA 35 TCCAGCTTCTCCATC 39 TTTGC Lox* NM_010728 CTCCTGGGAGTGGCACAG 36 CTTGCTTTGTGGCCT 40 TCAG

RESULTS

[0091] In literature, as result of the most common liver injury observed for this compound, APAP is frequently classified as a hepatotoxic compound with no further pursue of other liver injury outcomes. Knowing that in vivo, HSC activate upon hepatocyte damage, especially when apoptosis and necrosis occurs, we decided to further investigate and at the same time validate our in vitro results (using the 3D hepatic co-culture) in terms of the pro-fibrotic capacities of this compound. As expected from the in vitro 3D hepatic co-culture results (see example 2), both upon acute and chronic exposure to doses equal or higher than 300 mg/kg weight we observed a significantly increase of the activation marker gene expression in the isolated HSC (FIG. 9A), and even more pronounced in the chronic exposure (FIG. 9B). For the chronic exposure the fibrosis profile is confirmed at the protein level by the deposition of collagen around the portal area with septa formation, which is not observed in the liver of the control mice (data not shown). The increase of amount of cross-linked collagen upon APAP exposure is similar, but not at the same level, as CCL.sub.4 mouse fibrosis model. These data validate the classification of APAP as a pro-fibrotic compound on top of its hepatotoxic classification.

Example 4

Testing of Fibrosis-Induced Compounds

Material and Methods

Cell Culture

[0092] Human Hepatic Stellate Cells (HSC) were isolated from hepatic non-parenchymal fraction and prepared for culture as described in Thoen et al., 2011. Cells from two different donors were used, both male, healthy and under 13 years old. For the 3D cultures, cells were used between passages 5 and 10. Differentiated cryopreserved HepaRG cells were obtained from Biopredic (Saint-Gregoire, France). On day 0 of culture, HSC were trypsinized and HepaRG thawn according to the instructions of the providers. For the generation of the cell spheroids, 96-well plates treated with cell- repellent coating (Greiner ref. 650970, Frickenhausen, Germany) were used. Mono- and co-culture suspensions were prepared and seeded at 10 l/well in the concentrations shown in table 7 below:

TABLE-US-00006 TABLE 7 3D cell seeding HSC seeding HepaRG seeding Type of culture (10.sup.5 cells/ml) (10.sup.5 cells/ml) 3D HepaRG 2.00 3D HSC 2.00 3D HepaRG/HSC 1.33 0.67

[0093] After 15-30 min settling in the incubator, plates were placed on an orbital shaker, where stirring was kept at 80 rpm for the entire culture period. 24h after seeding, 100 l of culture medium was added to each well and refreshed every second day (90%) thereafter. 3D HepaRG/HSC co-culture and control mono-cultures were cultured for 21 days. Cross diameter of the spheroids never exceeded 200 pm.

[0094] Culture medium. Day 0 cells were resuspended in HepaRG thawing medium and from day 1 to 21 cells were kept in the HepaRG culture medium 0% DMSO, until day 8. For the repeated versus single compound exposure assays, on day 8, the HepaRG culture medium 0% DMSO was replaced by the Serum-free HepaRG maintenance medium described in Klein et. al. 2013 (HepaRG Induction/Toxicity medium, DMSO 0.5% (v/v), 2 g/ml of epidermal growth factor and 10 g/ml of hepatocyte growth factor) and kept in this medium until the end of culture.

[0095] Single and repeated exposure. For the single and repeated compound exposure cell spheroids (3D HepaRG/HSC, 3D HepaRG and 3D HSC) were exposed respectively on day 20 for 24 h or every second day from day 8 to day 21 in serum-free medium with no additional solvent. Cells were exposed to a range of 8 concentrations between 0.5 and 80 mM for APAP single-dose, 0.125 and 40 mM for APAP repeated-dose, 0.3 and 500 M Allyl Alcohol (AA, Sigma-Aldrich), 1.9 and 1000 M Methotrexate (MTX, Pfizer, NY, USA). For the recovery assay, on day 21, cells were washed using serum-free medium and kept for 3 extra days.

[0096] Cell viability assay was performed by measuring ATP production upon individual spheroid exposure to the different concentrations of the test compound. Cell spheroids were lysed individually for viability analysis using the Cell titer Glo kit (Promega) following the instructions of the manufacturer. Luminescence values were converted into percentage of ATP by comparison with controls and converted into dose-response curves using Prism 5 software.

mRNA Analysis

[0097] For the cell culture samples, total RNA from 4-6 pooled spheroids was extracted from cells using the RNeasy Micro Kit (Qiagen, Venlo, Limburg, Netherlands). In the mouse assays, sorted HSC from different mice were lysed separately. Total RNA from tissue cultured cells was extracted using ReliaPrep RNA Cell Miniprep System (Promega).

[0098] Reverse-transcription using the Revert Aid Kit (ThermoFisher Scientific, Waltham, Massachusetts, USA) allowed conversion of RNA to cDNA. The RT reaction was performed at 25 C. for ten minutes followed by 30 minutes at 50 C. For quantitative real-time polymerase chain reaction (qPCR), GoTaq QPCR Master Mix with BRYTE green (Promega) was used, subjected to qPCR in a 7500 real time PCR system and analysed using System SDS software v2.0.5 (Applied Biosystems, Waltham, Mass., USA), using GAPDH for normalisation. Reliability of GAPDH as house-keeping gene was determined using Normfinder (Anderson et al., 2004). Fold change differences between samples were determined using the comparative Ct (Ct) method. The expression level of different targets, relative to GAPDH (Ct) and relative to the calibrator, was given by 2.sup.Ct. Primers produced by Integrated DNA Technologies (Leuven, Belgium) are listed in Table 8.

TABLE-US-00007 TABLE8 PrimersusedforQPCRanalysis(*mouseprimers) GenBank SEQ SEQ Gene AccNo ForwardPrimer IDNo ReversePrimer IDNo GAPDH NM_002046.4 AGCCACATCGCTCAGAC 1 GCCCAATACGACCAAAT 17 AC CC COL1A1 NM_000088.3 GACACAGAGGTTTCAGT 3 CACCCTTAGCACCAACA 19 GG G COL3A1 NM_000090.3 GGAGCTGGCTACTTCTC 10 GGGAACATCCTCCTTCA 26 GC ACAG LOXL2 NM_002318.2 GGAGAGGACATACAATA 11 CCATGGAGAATGGCCAG 27 CCAAAGTG TAG

Spheroid and Tissue Imaging

[0099] Paraffin sections. 3D spheroids were fixed with 4% (w/v) paraformaldehyde (PFA) with 4% (w/v) sucrose in PBS for 20 min an embedded in paraffin as described in the work of Wong et. al. (Wong, Vosburgh et al. 2012). Mouse liver tissue from healthy and injured mice was formalin fixed and embedded in paraffin. After sectioned in 4-5 m-thick slices, samples were deparaffinazed and rehydrated in serial decreasing ethanol solutions before proceeding with the correspondent staining protocol.

[0100] Immunohistochemistry. Antigen retrieval citrate buffer (pH6.0) was used. This was followed by permeablization (PBS-Tween, 0.05%), blocked with 5% blocking solution (3% normal serum +2% BSA) and incubated with primary antibody. After rinsing, sections were incubated with Streptavidin-peroxidase conjugate. Peroxidase reactivity was visualised with 3,3-diaminobenzidine (DAB)/H2O2.

TABLE-US-00008 TABLE 9 Antibodies used for Immunofluorescence and Immunohistochemistry Proteins Supplier Catn Application CYP3A4 Cypex limited PAP011 IF, 1/100 PDGFr (APC labeled) abcam ab119861 IF, 1/50 CASPASE 3 Cell Signaling Technology 9661 IHC, 1/100 COLLAGEN I abcam ab34710 IHC, 1/500 ACTA2 Sigma A2547 IHC, 1/600

[0101] Picrosirius Staining. Slices were stained for 45 minutes with 0.1% Sirius Red phase green in a saturated picric acid solution. Picture quantification was carried out using ImageJ software.

Statistics

[0102] Comparisons between more than two groups were analyzed for statistical significance by one- way ANOVA followed by Tukey. Statistical analysis of values for comparison between two groups was performed using an independent sample t-test. Results were considered significant when p<0.05.

RESULTS

[0103] After testing and confirming the APAP effect in the indirect HSC activation described in the examples 2 and 3, we next finalized the characterization of the use of the co-culture in drug-induced fibrosis testing by exposing the cells to reference pro-fibrotic compounds. As such we used Allyl Alcohol (used to induce fibrosis in rat) and Methotrexate (classified as to induce fibrosis in some human subjects after prolonged treatment). Since the fibrotic effect of these compounds is observed upon long-term treatment, to cover any possible outcome, both compounds were tested in single and repeated fashion. Due to the kinetic interference of the serum in compound exposure, especially in repeated fashion we adapted the system to serum-free medium following the indications on the work of Klein et al. 2013. Before start we first ensured that at the end of the 21 days, hepatocyte gene expression was comparable with the previously used medium (data not shown). For HSC activation, APAP single and repeated was performed as positive control. We compared both single- and repeated-exposure (Table 9) by measuring cell viability and gene expression of the activation markers 24 h upon last compound exposure.

[0104] In the case of APAP, we observed toxicity and HSC activation both in single and repeated-exposure, however in the last one there is a shift of the peak effect to lower concentrations (FIG. 10 A, B) with an EC.sub.50 shift from 10.42.3 to 2.250.35 mM in average. The HSC activation follows the hepatotoxic shift with a peak of the repeated exposure at around 5-10 mM instead of 20-40 mM (FIG. 10B). These results show the capacity of the cells to activate in the serum-free medium but also the increase of sensitivity upon the repeated exposure to the toxicant which we could also see by microscopic observation of the spheroids (data not shown). For Methotrexate (MTX), single exposure does not seem to affect cell viability at any of the tested concentrations (FIG. 10C). However, upon repeated exposure, the percentage of ATP production even at the lowest concentration decreased to less than 20%. Nevertheless, even though the spheroids were smaller, the amount of disaggregating cells around the spheroid exposed repeatedly to 1.9 M MTX is less than the spheroid repeatedly exposed to 5 mM APAP, where the delimiting line of the sphere can no longer be observed (data not shown). In terms of HSC activation, the up-regulation of the markers upon 24 h exposure to MTX, previously observed when cells were kept in serum containing medium (data not shown) was no longer observed (FIG. 10D). The incapacity of the cells to activate in the serum-free medium, was dramatically compensated once the 3D HepaRG/HSC culture was repeatedly exposed to the compound, for several concentrations.

[0105] Finally, for Allyl Alcohol, the dose-response observed at the single exposure disappeared upon repeated exposure, letting us to presume some toxicity resistance of the cells (FIG. 10E) explained by the metabolism of the compound (Covaci, Bucur et al. 2011). Nevertheless, both operational exposures lead to an increase of the HSC activation markers at mRNA levels, with a more consistent effect in the repeated-dose exposure (FIG. 10F). Repeated-dose exposures lead to a 100 fold increase of secreted collagen at day 14 (FIG. 10G) and a strong Sirius Red staining at the end of the experiment (Data not shown). Repeated exposure of MTX and Allyl alcohol to HepaRG/HSCs lead to high collagen secretion at day 14 which could not be observed at day 21, where the last 24 h exposure lead to a higher or similar release of pro- collagen for the single exposure than after repeated MTX exposure (FIG. 10G). For both compounds, no collagen secretion is detected in the 3D mono-cultures (FIG. 10H).

[0106] Even if for APAP and MTX single exposure, the activation profile is similar to the 3D HepaRG, again, the basal levels are very different. Nevertheless, once in repeated-dose, the increase of the activation markers is higher, and sometimes unique for the 3D HepaRG/HSC (FIG. 11).

[0107] This assay shows that the 3D HepaRG/HSC co-culture has the capacity to respond positively to the reference fibrotic compounds and furthermore to have different responses depending on the nature of the compound. Once again, the capacity of cells to recover was checked 3 days after compound washout, however this was only observed in some cases such as APAP single exposure and MTX repeated exposure 63 M (FIG. 12) which again reflects the variability of the compound effect.

GENERAL DISCUSSION

[0108] In conclusion, we can say that we have developed a human liver organoid with the main cellular players of fibrosis, in which drug-induced fibrosis can be reproduced. The system has the specificity that lacks in the hepatic mono-cultures and is sensitive to the different nature of the compounds, for toxicity, HSC activation and recovery. Taking into account that 40% of the drugs failing during clinical trials are due to DILI effects, the existence of a model like ours would represent a significant improvement in terms of costs, animal use and human predictability.

REFERENCES

[0109] Andersen, C. L., J. L. Jensen and T. F. Orntoft (2004). Normalization of real-time quantitative reverse transcription-PCR data: a model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res 64(15): 5245-5250. [0110] Covaci, O. I., B. Bucur and G. L. Radu (2011). Acrolein detection based on alcohol dehydrogenase inhibition. International journal of Environmental Analytical Chemistry. [0111] Kisseleva, T., M. Cong, Y. Paik, D. Scholten, C. Jiang, C. Benner, K. Iwaisako, T. Moore-Morris, B. Scott, H. Tsukamoto, S. M. Evans, W. Dillmann, C. K. Glass and D. A. Brenner (2012). Myofibroblasts revert to an inactive phenotype during regression of liver fibrosis. Proc Natl Acad Sci U S A 109(24): 9448-9453. [0112] Thoen, L. F., E. L. Guimaraes, L. Dolle, I. Mannaerts, M. Najimi, E. Sokal and L. A. van Grunsven (2011). A role for autophagy during hepatic stellate cell activation. J Hepatol 55(6): 1353-1360. [0113] Wong, C., E. Vosburgh, A. J. Levine, L. Cong and E. Y. Xu (2012). Human neuroendocrine tumor cell lines as a three-dimensional model for the study of human neuroendocrine tumor therapy. J Vis Exp(66): e4218. [0114] Lubberstedt, M. et al. HepaRG human hepatic cell line utility as a surrogate for primary human hepatocytes in drug metabolism assessment in vitro. J Pharmacol Toxicol Methods 63, 59-68 (2011). [0115] Mannaerts, I. et al. Chronic administration of valproic acid inhibits activation of mouse hepatic stellate cells in vitro and in vivo. Hepatology 51, 603-614 (2010). [0116] Watelet, J. et al. Toxicity of chronic paracetamol ingestion. Aliment Pharmacol Ther 26, 1543-1544; author reply 1545-1546 (2007).