DIAGNOSIS OF VIRAL INFECTIONS BY DETECTION OF GENOMIC AND INFECTIOUS VIRAL DNA BY MOLECULAR COMBING
20230127554 · 2023-04-27
Assignee
Inventors
- Charlotte MAHIET (Paris, FR)
- Fabrice SALVAIRE (Benzons, FR)
- Emmanuel Conseiller (Paris, FR)
- Sebastien BARRADEAU (Paris, FR)
Cpc classification
C12Q1/705
CHEMISTRY; METALLURGY
C12Q1/6883
CHEMISTRY; METALLURGY
International classification
Abstract
A method for detecting in vitro the presence of a genome of a DNA virus or a viral derived DNA in an infected eukaryotic cell, tissue or biological fluid using Molecular Combing or other nucleic acid stretching methods together with probes, especially nucleic acid probes, having a special design. A method for monitoring in vitro the effects of anti-viral treatment by following the presence of genomic viral or viral derived DNA polynucleotides in a virus-infected cell, tissue or biological fluid. Detection of an infectious form of a virus using Molecular Combing and DNA hybridization. A kit comprising probes used to carry out these methods and a composition comprising the probes.
Claims
1. (canceled)
2. A method for detecting, in a biological sample, rearrangements of a human papilloma virus (HPV) 33 DNA or its integration into a DNA of a human subject, wherein the method comprises: (a) extracting the HPV33 DNA from said sample; (b) immobilizing said HPV33 DNA and then stretching said HPV33 DNA to form a stretched polynucleotide organized in linear and parallel strands; (c) hybridizing said stretched polynucleotide to a set of fluorescently labeled probes, wherein said hybridization step comprises (i) heat-denaturing a hybridization sample comprising the set of fluorescently labelled probes and the HPV33 DNA at 90° C. for 5 min and hybridized overnight at 37° C. and (ii) washing the hybridization sample for 5 min at room temperature, and wherein the set of fluorescently labeled probes consists of 2 to 20 fluorescently labeled probes covering SEQ ID NO: 23, and allowing the detection of the HPV DNA and the identification of rearrangements of the HPV33 DNA; and (d) detecting by fluorescence microscopy the fluorescent signals corresponding to hybridized fluorescently labeled probes; thereby detecting rearrangements of the HPV33 DNA or its integration into the DNA of the human subject.
3. The method of claim 2, wherein the set of fluorescently labeled probes consists of 2 to 10 fluorescently labeled probes covering SEQ ID NO: 23.
4. The method of claim 2, wherein the fluorescently labelled probes are of at least 1, 2, 3, 4 or 5 kb.
5. The method of claim 2, wherein the fluorescently labelled probes are of 30, 50, 100 or 150 kb.
6. The method of claim 2, wherein said biological sample is a tissue sample, cell(s), serum, blood, cerebrospinal fluid (CSF), or synovial fluid sample obtained from the human subject.
7. The method of claim 2, wherein said HPV33 DNA is integrated into the DNA of the human subject or is in episomal form,
8. The method of claim 2, wherein said set of probes comprises at least two subsets of probes that are tagged with different fluorescent labels.
9. The method of claim 2, wherein said hybridization employs a hybridization buffer comprising 50% formamide, 2× Saline-Sodium Citrate (SSC), 0.5% Sodium Dodecyl Sulfate (SDS). 0.5% Sodium lauroyl sarcosinate (Sarkosyl), 10 mM NaCl, and 30% of BLOCKAID™ BLOCKING SOLUTION.
10. The method of claim 1, wherein the hybridization sample is washed 3 times in 50% formamide. 2× Saline-Sodium Citrate (SSC) and 3 times in 2× Saline-Sodium Citrate (SSC) solutions.
11. The method of claim 2, wherein rearrangements of the HPV 33 DNA or its integration into the DNA of the human subject allow to diagnose the risks of progression of the HPV infection or the disease associated with rearrangements of the HPV genome.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
DETAILED DESCRIPTION OF THE INVENTION
[0081] The invention enables a rapid, specific and sensitive detection of infectious viral polynucleotides or infectious viral origin DNA in a sample that avoids the significant constraints imposed by amplification methods like PCR or serological tests such as ELISA.
[0082] In contrast to prior art methods, the Molecular Combing techniques of the invention permit the successful detection of complete viral genomes or infectious or virulent portions of viral polynucleotide sequences leading to improved diagnosis of acute or latent viral infections.
[0083] The method of the invention enables to detect the type of HSV and the structure of its genome reliably, in a time- and cost-effective fashion, and with none of the constraints of manipulating radioactivity. Moreover, the method of the invention enables to follow the presence of the viral infection after antiviral treatment, whatever the type of treatment considered.
[0084] The present invention relates to a method for detecting in vitro the presence of a genome of DNA viruses in infected cells of eukaryotic cells, in particular the detection of the HSV genome. Said method comprises a hybridization step of nucleic acid representative of given virus with at least a probe or a set of probes which is (are) specific for HSV DNA.
[0085] Molecular Combing techniques which may be used in accordance with the invention are disclosed by Bensimon, et al., U.S. Pat. No. 6,303,296 and by Lebofsky, et al., WO 2008/028931 the disclosure of which are hereby incorporated by reference. The inventors recognized that no technique can detect the presence of a complete or non-rearranged genome of infectious form of a virus except by traditional culture techniques and thus sought to apply and adapt these techniques to detection of infectious viral DNA. The combing method was never tested as an efficient tool to detect such viral DNA forms but only for the location of long sequences of DNA inserted in a cellular genome in view of understanding the genetic influence of such sequence in a specific genetic environment. Non-limiting examples of detection of infectious viral (HSV) DNA by the modified methods developed by the inventors are shown below.
[0086] The inventors modified the standard extraction protocol to isolate viral genomic DNA from viral particles. Generally, 0.1% SDS is used for the lysis of viral particles in the low-melting agarose plugs instead of 0.1% sarkosyl in the standard protocol. A methodology was also developed to extract genomic DNA from cornea to investigate the presence of HSV DNA in infected cornea for purposes of diagnosis.
[0087] The present invention relates to a method for detecting viral DNA, in particular HSV DNA and HIV DNA, contained on nucleic acid of infected cells, tissue or biological fluid. Said method comprises a hybridization step of nucleic acid representative of said viral DNA with specific probes or set of probes that cover the entire said viral DNA and that permit to identify rearrangements within the nucleic acid representative of said viral DNA.
[0088] The term “nucleic acid” and in particular “nucleic acid representative of viral DNA” as used herein designates one or several molecules of any type of nucleic acid capable of being attached to and stretched on a support as defined herein, and more particularly stretched by using Molecular Combing technology; nucleic acid molecules include DNA (in particular genomic DNA, especially viral DNA, or cDNA) and RNA (in particular mRNA). A nucleic acid molecule can be single-stranded or double-stranded.
[0089] “Nucleic acid representative of said viral DNA” means that said nucleic acid contains the totality of the genetic information or the essential information with respect to the purpose of the invention, which is present on said viral DNA. This term includes genomic viral DNA, such as that integrated into a host chromosome and which can produce infectious virus, infectious viral DNA which may lack certain genomic elements but can be infectious when expressed in particular host cells, and viral genes which exert a pathogenic effect on host cells, such as viral oncogenes.
[0090] A proto-oncogene includes those normal genes, which when altered by mutation can convert into oncogenes that causes a cell to grow or divide in an unregulated manner. Proto-oncogenes have diverse cellular functions, some provide signals for cell division, and others may play roles in apoptosis. Functional and structural characteristics of oncogenes, including their nucleic acid sequences, are well-known in the art and are incorporated by reference to Human Cancer Viruses: Principles of Transformation and Pathogenesis by J. Nicolas, et al., Karger Publishers (2010), ISBN3805585764, 9783805585767 (244 pages) which is incorporated by reference.
[0091] An oncogene encompasses a defective version of a proto-oncogene. A single copy of an oncogene can cause uncontrolled cell growth. Representative oncogenes include ras, myc, src, Her-2/neu, hTERT, and Bcl-2. Functional and structural characteristics of oncogenes, including their nucleic acid sequences, are well-known in the art and are incorporated by reference to Oncogene: Gene, Mutation, Tumor, Apoptosis, Gene Expression, Protein, Cell Growth, Cellular Differentiation, by L. M. Surhone, et al., Betascript Publishers (2010), ISBN6130361599, 9786130361594 (172 pages). Further description and identification of oncogenes is incorporated by reference to to Cooper G. Oncogenes. Jones and Bartlett Publishers, 1995 and Vogelstein B, Kinzler K W; The Genetic Basis of Human Cancer. McGraw-Hill: 1998, both of which are incorporated by reference. The process of activation of proto-oncogenes to oncogenes can include viral transduction or viral integration, point mutations, insertion mutations, gene amplification, chromosomal translocation and/or protein-protein interactions. Viruses that can induce activation of proto-oncogenes include HBV and HCV (hepatocellular carcinoma), HTLV (leukaemia), HPV (cervical, anal and penile cancer), HSV-8 (Kaposi's sarcoma), Merkel cell polyomavirus (Merkel cell carcinoma) and, EBV (Burkitt's lymphoma, Hodgkin's lymphoma, post-transplantation lymphoproliferative disease and Nasopharyngeal carcinoma)
[0092] In a particular embodiment, the nucleic acid sample used for stretching is genomic DNA, in particular total genomic DNA or more preferably chromosomal genomic DNA (nuclear genomic DNA) of infected cells or tissues, and/or fragments thereof. The term “nucleic acid” is in particular used herein to designate a nucleic acid representative of one or several chromosome(s) and/or of one or several fragment(s) of chromosomes. Said fragments can be of any size, the longest molecules reaching several megabases. Said fragment are generally comprised between 10 and 2000 kb, more preferably between 20 and 500 kb and are in average of about 300 kb.
[0093] The nucleic acid sample used in the method of the invention can be obtained from a biological fluid or from a tissue of biological origin, said sample or tissue being isolated for example from a human, a non human mammal or a bird.
[0094] As defined herein, a probe is a polynucleotide, a nucleic acid/polypeptide hybrid or a polypeptide, which has the capacity to hybridize to nucleic acid representative of virus DNA as defined herein, in particular to RNA and DNA. This term encompasses RNA (in particular mRNA) and DNA (in particular viral cDNA or viral genomic DNA) molecules, peptide nuclear acid (PNA), and protein domains. Said polynucleotide or nucleic acid hybrid generally comprises or consists of at least 100, 300, 500 nucleotides, preferably at least 700, 800 or 900 nucleotides, and more preferably at least 1, 2, 3, 4 or 5 kb. For example, probes of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 kb or more than 15 kb, in particular 30, 50, 100 or 150 kb can be used. Such a probe or a set of probes may correspond or cover 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70,75, 80, 85, 90, 95, 98, 99 or 100% of a viral genome, especially that of an infectious virus. A nucleic acid probe may be a single or double-stranded polynucleotide or a modified polynucleotide. A set of continuous set of probes will cover a particular section of the genome or the entire genome or overlap each other with respect to this section. A suitable probe may be based on a viral polynucleotide sequence, such as those disclosed herein, and may be identified or synthesized by any appropriate method. Probes may be labelled or tagged radioactivity, fluorescently or by other means known in the art.
[0095] A polypeptide probe generally specifically binds to a sequence of at least 6 nucleotides, and more preferably at least 10, 15, or 20 nucleotides. As used herein, the sequence of a probe, when the probe is a polypeptide, should be understood as the sequence to which said polypeptide specifically binds.
[0096] By “a portion of” a particular region, it is meant herein consecutive nucleotides of the sequence of said particular region. A portion according to the invention can comprise or consist of at least 15 or 20 consecutive nucleotides, preferably at least 100, 200, 300, 500 or 700 consecutive nucleotides, and more preferably at least 1, 2, 3, 4 or 5 consecutive kb of said particular region. For example, a portion can comprise or consist of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 consecutive kb of said particular region.
[0097] In a particular embodiment, the probe used or at least one of the probes used is a nucleotide variant of the probe showing a complementary sequence of 100% to a portion of one strand of the target nucleic acid. The sequence of said variant can have at least 70, 80, 85, 90 or 95% complementarity to the sequence of a portion of one strand of the target nucleic acid. Said variant can in particular differ from the probe which is 100% identical or complementary by 1 to 20, preferably by 1 to 10, nucleotide deletion(s), insertion(s) and/or more preferably substitution(s), in particular by, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotide deletion(s), insertion(s) and/or more preferably substitution(s) in the original nucleotide sequence. In a particular embodiment, the variant keeps the capacity to hybridize, in particular to specifically hybridize, to the sequence of the nucleic acid target, similarly to the probe that is 100% identical or 100% complementary to a sequence of the nucleic acid target (in particular in the hybridization conditions defined herein).
[0098] The term “complementary sequences” in the context of the invention means “complementary” and “reverse” or “inverse” sequences, i.e. the sequence of a DNA strand that would bind by Watson-Crick interaction to a DNA strand with the said sequence.
[0099] In a particular embodiment of the invention, the probes or one or several probes used to carry out the invention are labelled with one or several hapten(s) (for example biotin and digoxygenin) and revealed with specific antibodies directed against these haptens. Use of different haptens for a given probe or set of probe will allow to detect rearrangements within a given viral DNA. Said probes can be labelled as defined herein and as described in patent application WO 2008/028931, which is incorporated by reference.
[0100] A set of probes as used herein comprises of at least two probes. For example, said set of probes can consist of 2 to 20 probes (2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 probes). The number of probes in a set does usually not exceed 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100 probes depending on the sensitivity that is required and the length of the probe; a set of probes preferably consists of 2, 3, 4, 5, 6, 7, 8, 9 or 10 probes at the most.
[0101] The probes or the set of probes of the invention not only allow the detection of the entire whole genomic viral DNA but also to identify rearrangements that can occur within the genomic viral DNA. For example, the probe sets used in the Example 1 for HSV detection allow the detection of the different HSV genome isomers that are generated by homologous recombination between the inversed repeated sequences that surround the unique regions U.sub.L and U.sub.S. Moreover, each probes set (H1 to H6) for the detection of HSV are composed of several probes (3 to 19 different fragments) that are labeled with different two different haptens (digoxygenin for the fragments consisting of H1, H3 and H5 probes; biotin for the fragments consisting of H2, H4 and H6 probes). Changing the haptens of one or of several fragments by other haptens (whatever the nature of this hapten) within a given probe set permits the generation of a different color-fluorescence array that allows the identification of rearrangements within this specific region of the viral DNA.
[0102] Molecular Combing can also be a useful tool for an early diagnosis of patients susceptible of developing a cancer caused by a viral infection, for example, those at risk of conversion of a proto-oncogene into an oncogene. Indeed, Molecular Combing can discriminate between integrated and episomal viral genome. In the case where the viral DNA is integrated, by using a specific set of probes Molecular Combing will allow to determine whether the integrated viral DNA contains a complete viral oncogene or whether it is integrated in a close proximity of a cellular proto-oncogene.
[0103] The invention may also be used in conjunction with gene therapy. By using specific sets of probes for each transgene and/or viral vector, Molecular Combing provides a powerful tool for an evaluation of efficacy and safety of the viral vector-based gene therapy. Indeed, Molecular Combing can discriminate between integrated and episomal transgene. In the case where the transgene is integrated (lentiviruses and retrovirus based vectors), by using a specific set of probes Molecular Combing will allow to determine whether the integrated viral DNA is integrated in a gene (insertional mutagenesis) or in a close proximity of a cellular proto-oncogene. In the case the transgene is episomal (Adenoviral vector, AAV or HSV vector); Molecular Combing will be useful for the quantification of the transgene in the growing cell population and may help to define the right time for readministration of the transgene.
[0104] Specific embodiments of the invention include the following methods and products. A method for detecting an infectious viral polynucleotide in a biological sample comprising: separating, extracting or otherwise obtaining a polynucleotide from said sample, Molecular Combing said polynucleotide to form a stretched polynucleotide, contacting said stretched polynucleotide with one or more probes that recognize the infectious polynucleotide sequence, detecting hybridization of the probes to the combed sample. This method may be performed using a biological sample that is a tissue or cell sample obtained from a subject, for example, a blood, plasma, serum, CSF, synovial fluid sample or some other kind of biological fluid from the subject. A polynucleotide used in this method may be extracted from the tissue or cell sample or from components of a biological fluid obtained from the subject. Generally, the sample will be obtained from a living subject, but samples may also be obtained from deceased subjects. Samples can be obtained from humans or other mammals such as cattle, bovines, sheep, goats, horses, pigs, dogs, cats and non-human primates, or from other animals such as avian species such as a chicken, turkey, duck, goose, ostrich, emu, or other bird. The method can be practiced with polynucleotides which are DNAs which may also contain or comprise infectious or non-infectious genomic viral DNA or non-infectious non-genomic viral polynucleotides such as DNA or RNA. The polynucleotide detected or analyzed by this method may be integrated into the DNA of the subject or can be in episomal form. The polynucleotide to be detected can be contacted with one or more probes that bind to a DNA virus, including both single-stranded and double-stranded DNA viruses. For example, the polynucleotide may be contacted with one or more probes that bind to a herpes virus, such as herpes simplex virus (HSV). Other probes may be used which bind to other viruses like papilloma virus, hepatitis B virus, or retroviruses like HIV. In some embodiments the method will use a set of probes that bind to at least 80%, 90%, 95%, or 99% of the genomic or infectious DNA of a virus. In other embodiments the one or more probes used in the method will comprise at least two sets of probes that are tagged with different labels, for example, to permit the identification of different portions or segments of a viral genome to which the different probes bind or to permit the identification of rearrangements in a viral genome.
[0105] Other specific embodiments of the invention include:
[0106] A method for detecting, identifying or visualizing an infectious or genomic viral polynucleotide sequence in a mammalian cell, tissue or biological fluid comprising using Molecular Combing to detect the presence or the quantity of infectious viral polynucleotide or genomic viral polynucleotide in a cell, tissue or biological fluid.
[0107] A method for quantifying an infectious or genomic viral polynucleotide sequence comprising using Molecular Combing to detect quantity of infectious viral polynucleotide or genomic viral polynucleotide in a cell, tissue or biological fluid compared to an uninfected control sample or an otherwise similar sample obtained at a different point in time or from a different source or clinical sample.
[0108] A method for detecting or following viral presence or replication or viral genomic rearrangements in a mammalian cell comprising Molecular Combing for the presence of latent or replicating viral DNA or rearranged viral DNA in a cell, tissue or biological fluid.
[0109] A method for evaluating the efficacy of anti-viral treatment comprising detecting using Molecular Combing the presence, arrangement or quantity of infectious or genomic viral DNA in a sample obtained from a subject, treating said subject with an anti-viral agent, and re-evaluating using Molecular Combing the presence, arrangement or quantity of infectious viral or genomic viral DNA in said subject.
[0110] A set of probes covering 80-100% of the HSV, HIV, HBV or HPV genome.
[0111] A kit for performing molecule combing comprising a Molecular Combing apparatus and/or reagents, one or more probes that bind to an infectious polynucleotide, and optionally one or more cell, tissue or biological fluid sample(s). The kit which comprises a set of probes for detecting or identifying genomic viral DNA in a combed DNA molecule. The kit further comprising software for detecting or classifying the infectious sequences.
[0112] The following biological materials which have been deposited under the terms of the Budapest Treaty at the CNCM, Institut Pasteur 25 Rue du Docteur Roux, F-75724 Paris Cedex 15: HSV-B4 (CNCM 1-4298), HSV-B19 (CNCM 1-4299), HSV-Sc54 (CNCM I-4300), and HSV-P4 (CNCM I-4301).
EXAMPLES
Example 1
Herpes Simplex Virus Detection
[0113] Preparation of Embedded DNA Plugs from Viral Particles
[0114] HSV-1 DNA was extracted from viral particles by standard phenol:chloroform extraction (Ben-Zeev, Weinberg et al. 1974) or by a modified procedure described in Lebofsky et al. (Lebofsky, Heilig et al. 2006) which are both incorporated by reference. Briefly, HSV-1 particles were resuspended in 1× PBS at a concentration of 5.Math.10.sup.6 viral particles/mL, and mixed thoroughly at a 1:1 ratio with a 1.2% w/v solution of low-melting point agarose (Nusieve GTG, ref 50081, Cambrex) prepared in PBS, at 50° C. 90 μL of the viral particles/agarose mix was poured in a plug-forming well (BioRad, ref. 170-3713) and left to cool at least 30 min at 4° C. Embedded viral particles were lysed in 0.1% SDS-0.5M EDTA (pH 8.0) solution at 50° C. for 30 minutes. After three washing steps in 0.5M EDTA (pH 8.0) buffer of 10 minutes at room temperature, plugs were digested by overnight incubation at 50° C. with 2 mg/mL Proteinase K (Eurobio code GEXPRK01, France) in 250 digestion buffer (0.5M EDTA, pH 8.0). The use of 0.1% SDS instead of Sarkosyl was very productive and allows a very high quality of extracted viral DAN to be collected.
[0115] Preparation of Embedded DNA Plugs from Infected Cells
[0116] The extraction of HSV-1 DNA from infected cells culture (BSR, COS-7, Neuro 2A and Vero) was performed as previously described (Schurra and Bensimon 2009). Briefly, infected cells were pelleted by centrifugation at 5000 g for 5 minutes, resuspended at a concentration of 2.Math.10.sup.6 cells/mL in 1× PBS buffer and mixed thoroughly at a 1:1 ratio with a 1.2% w/v solution of low-melting point agarose (Nusieve GTG, ref 50081, Cambrex) prepared in 1× PBS at 50° C. 90 μL of the cell/agarose mix was poured in a plug-forming well (BioRad, ref 170-3713) and left to cool down at least 30 min at 4° C.
[0117] Lysis of cells in the blocks was performed as previously described (Schurra and Bensimon 2009). Briefly, Agarose plugs were incubated overnight at 50° C. in 250 μL of a 0.5M EDTA (pH 8), 1% Sarkosyl, 250 μg/mL proteinase K (Eurobio, code: GEXPRK01, France) solution, then washed twice in a Tris 10 mM, EDTA 1 mM solution for 30 in at room temperature.
[0118] Preparation of Embedded DNA Plugs from Infected Cornea
[0119] HSV-1 strain Sc16 infected mouse cornea was collected at a final stage of infection, and kept in Corneamax® (Eurobio code EYEMAX00, France) medium. After rinsing three times during 15 minutes at room temperature with 1× PBS solution, the entire cornea was cut into small pieces. Tissue lysis was carried out for up to 16 h at 37° C. in 0.3 mg/mL Collagenase type A (Roche, code 10 103 578 001), and 0.8 mg/mL GIBCO™ Dispase (Invitrogen, France, code 17105-041), both prepared in GIBCO™ 1× Hanks' Balanced Salt Solution HBSS buffer (Invitrogen, France, code 14060040). Lysates were pelleted by centrifugation at 5000 g for 10 minutes, resuspended at a concentration of 1.Math.10.sup.6 to 2.Math.10.sup.6cells/mL in 1× PBS buffer and mixed thoroughly at a 1:1 ratio with a 1.2% w/v solution of low-melting point agarose (Nusieve GTG, ref. 50081, Cambrex) prepared in 1× PBS at 50° C. 90 μL of the cell/agarose mix was poured in a plug-forming well (BioRad, ref 170-3713) and left to cool down at least 30 min at 4° C.
[0120] Lysis of cells in the blocks was performed as previously described (Schurra and Bensimon 2009). Briefly, Agarose plugs were incubated overnight at 50° C. in 250 μL of a 0.5M EDTA (pH 8), 1% Sarkosyl, 250 μg/mL proteinase K (Eurobio, code: GEXPRK01, France) solution, then washed twice in a Tris 10 mM, EDTA 1 mM solution for 30 in at room temperature.
[0121] Final Extraction of DNA and Molecular Combing
[0122] Plugs of embedded DNA from viral particles or corneas were treated for combing DNA as previously described (Schurra and Bensimon 2009). Briefly, plugs were melted at 68° C. in a MES 0.5 M (pH 5.5) solution for 20 min, and 1.5 units of beta-agarase (New England Biolabs, ref. M0392S, MA, USA) was added and left to incubate for up to 16 h at 42° C. The DNA solution was then poured in a Teflon reservoir and Molecular Combing was performed using the Molecular Combing System (Genomic Vision S.A., Paris, France) and Molecular Combing coverslips (20 mm×20 mm, Genomic Vision S.A., Paris, France). The combed surfaces were dried for 4 hours at 60° C.
[0123] Synthesis and Labelling of HSV--1 Probes
[0124] The coordinates of all the probes relative to the Genbank sequence NC_001806.1 are listed in Table A. Probe size ranges from 1110 to 9325 bp in this example.
[0125] The HSV-1 specific probes were produced by either SacI or BspEI (New England Biolabs Inc., Beverly, Mass., USA code R0156L and R0156L, respectively) enzymatic digestion of the HSV-1 sc16 strain obtained from the CNRS (Prof Marc Labetoulle, laboratoire de virology moléculaire et structurale, UMR CNRS 2472-INRA 1157, Gif-sur-Yvette, France) or by long-range PCR using LR Taq DNA polymerase (Roche, kit code: 11681842001) using the primers listed in table B and the DNA from HSV-1 sc16 as template DNA. SacI and BspEI HSV-1 fragments were ligated in SacI and XmaI-digested pNEB193 plasmid (New England Biolabs Inc., Beverly, Mass., USA, code N3051 S), respectively. PCR products were ligated in the pCR®2.1 vector using the TOPO® TA cloning Kit (Invitrogen, France, code K455040). The two extremities of each probe were sequenced for verification purpose. The apparent H1 (21 kb), H2 (56 kb), H3 (45 kb), H4 (13 kb), H5 (7.5 kb) and H6 (6.5 kb) probes are mixes of several adjacent or overlapping probes listed in table A. For the visualisation of the non canonical structure implicated the H4 and H6 probes, the apparent H2 probe was split in two probes H2A (31 kb) and H2B (25 kb).
[0126] The labelling of the probes was performed using conventional random priming protocols. For biotin-11-dCTP labelling, the BioPrime® DNA kit (Invitrogen, code: 18094-011, CA, USA) was used according to the manufacturer's instruction, except the labelling reaction was allowed to proceed overnight. For 11-digoxygenin-dUTP and Alexa488-7-OBEA-dCTP, the dNTP mix from the kit was replaced by the mix specified in table C. 200 ng of each plasmid was labelled in separate reactions. For isomer classification, H1, H3, H5 probes were labelled with 11-digoxygenin-dUTP while H2, H4 and H6 probes were labelled with biotin-11-dCTP. For the visualisation of the non canonical structure implicated the H4 and H6 probes, H1, H2B and H3 probes were labelled with biotin-11-dCTP, H2A and H5 probes with 11-digoxygenin-dUTP and H4, H6 with Alexa 488-7-OBEA-dCTP. The reaction products were visualized on an agarose gel to verify the synthesis of DNA.
[0127] Hybridization of HSV-1 Probes on Combed Viral DNA and Detection
[0128] Subsequent steps were also performed essentially as previously described in Schurra and Bensimon, 2009 (Schurra and Bensimon 2009) which is incorporated by reference. Briefly, a mix of labelled probes (250 ng of each probe, see below for details regarding probe synthesis and labelling) were ethanol-precipitated together with 10 μg herring sperm DNA and 2.5 μg Human Cot-1 DNA (Invitrogen, ref. 15279-011, CA, USA), resuspended in 20 μL of hybridization buffer (50 formamide, 2×SSC, 0.5 SDS, 0.5% Sarkosyl, 10 mM NaCl, 30% Block-aid (Invitrogen, ref. B-10710, CA,USA). The probe solution and probes were heat-denatured together on the Hybridizer (Dako, ref. S2451) at 90° C. for 5 min and hybridization was left to proceed on the Hybridizer overnight at 37° C. Slides were washed 3 times in 50% formamide, 2×SSC and 3 times in 2×SSC solutions, for 5 min at room temperature. Detection antibody layers and their respective dilution in Block-Aid are described in table D and E. For each layer, 20 μL of the antibody solution was added on the slide and covered with a combed coverslip and the slide was incubated in humid atmosphere at 37° C. for 20 min. The slides were washed 3 times in a 2×SSC, 1% Tween20 solution for 3 min at room temperature between each layer and after the last layer. For isomer classification, detection was carried out using a Texas Red coupled mouse anti digoxygenin (Jackson Immunoresearch, France) antibody in a 1:25 dilution for H1, H3, and H5 probes, and an Alexa488-coupled streptavidin antibody (Invitrogen, France) in a 1:25 dilution for H2, H4 and H6 probes as primary antibodies. As second layer, an Alexa594-coupled goat anti mouse (Invitrogen, France) diluted at 1:25 and a biotinylated goat antistreptavidin (Vector Laboratories, UK) diluted at 1:50 were used. To amplify the Alexa488-fluorescence signal of H2, H4 and H6 probes, an additional detection layer was realized by using the same Alexa488 coupled-streptavidin used for the first layer at a 1:25 dilution. For the visualisation of the non-canonical structure implicated the H4 and H6 probes, detection was carried out using an AMCA-coupled mouse anti-digoxygenin (Jackson Immunoresearch, France) antibody in a 1:25 dilution for the H2A and H5 probes, an Alexa 594-coupled streptavidin antibody (Invitrogen, France) in a 1:25 dilution for the H1, H2B and H3 and a rabbit anti Alexa 488 in a 1:25 dilution as primary antibodies. As second layer, an Alexa 594-coupled goat anti mouse (Invitrogen, France) diluted at 1:25, a biotinylated goat anti-streptavidin (Vector Laboratories, UK) diluted at 1:50 and an Alexa 488-coupled goat anti-mouse diluted at 1:25 were used. To amplify the Alexa 594-fluorescence signal of the H1, H2B and H3 probes and the AMCA/Alexa 350 signal of the H2A and H5 probes, an additional detection layer was realized by using the same Alexa 594 coupled-streptavidin used for the first layer at a 1:25 dilution and an Alexa350 coupled goat anti rat diluted at 1:25, respectively. After the last washing steps, all glass cover slips were dehydrated in ethanol and air dried.
[0129] Analysis of HSV-1 Detected Signals
[0130] For direct visualisation of combed HSV-1 fibers, cover slips were mounted with 20 μL of a Prolong (Invitrogen, France ref P36930)-YOYO-1 iodide (Molecular Probes, code Y3601) mixture (1/1000 v/v) and scanned with inverted automated epifluorescence microscope, equipped with a 40× objective (ImageXpress Micro, Molecular Devices, USA). Length of the YOYO-1-stained DNA fibers were measured and converted to kb using an extension factor of 2 kb/μm (Schurra and Bensimon 2009), with an internal software GVlab 04.2.1 (Genomic Vision S.A., Paris, France).
[0131] For isomers classification, hybridized-combed DNA from viral particles or cornea preparation were scanned without any mounting medium using an inverted automated epifluorescence microscope, equipped with a 40× objective (ImageXpress Micro, Molecular Devices, USA) and the signals can be detected visually or automatically by an in house software (Gvlab 0.4.2). Both FISH signals composed of a continuous signal of Texas Red/Alexa 594-fluorescence for H1, H3, H5, and Alexa 488-flurorescence for H2, H4 and H6, and signals composed of a continuous signal corresponding to one of the pattern described below were considered:
[0132] (a) A minimum of 28 kb long of Texas Red/Alexa 594-fluorescence signal, directly followed by an Alexa488-flurorescence signal corresponding to H4 and another Texas Red/Alexa594-fluorescence signal of a length minimal of 3 kb.
[0133] (b) A minimum of 28 kb long of Texas Red/Alexa 594-fluorescence signal, directly followed by an Alexa 488-flurorescence signal corresponding to H6 and another Texas Red/Alexa 594-fluorescence signal of a length minimal of 3 kb.
[0134] (c) A minimum of 3 kb an Alexa 488 fluorescence signal directly followed by a Texas Red/Alexa 594 fluorescence signal corresponding to H1, next to an Alexa 488-fluorescence signal corresponding to H4 and another Texas Red/Alexa 594-fluorescence signal of a length minimal of 3 kb.
[0135] (d) A minimum of 3 kb an Alexa 488-flurorescence signal directly followed by a Texas Red/Alexa 594-fluorescence signal corresponding to H1, next to an Alexa 488-fluorescence signal corresponding to H6 and another Texas Red/Alexa 594-fluorescence signal of a length minimal of 3 kb.
[0136] FISH signals selected were then classified depending of the pattern of the continuous FISH signals analysed:
[0137] The probe array composed of H1/H2/H3/H4/H5/H6 probes or the pattern (a) is classified as a Prototype (P) form of HSV-1 (Hayward, Jacob et al. 1975)
[0138] The pattern H1/H2/H3/H6/H5/H4 or the pattern (b) is classified as a Inverted Short (IS) genomic region form of HSV-1 (Hayward, Jacob et al. 1975)
[0139] The pattern H3/H2/H1/H4/H5/H6 or the pattern (c) is classified as a Inversed Long (IL) genomic region of HSV-1 (Hayward, Jacob et al. 1975)
[0140] The pattern H3/H2/H1/H6/H5/H4 or the pattern (d) is classified as a Inversed Long and Short (ILS) genomic region form of HSV-1 (Hayward, Jacob et al. 1975)
[0141] The hypothesis that the observed distribution differ significantly to the expected distribution (an equivalent number of events for the four isomers, (Bataille and Epstein 1997) was tested by a chi-square test, and accepted when the p-value observed was below 0.05.
[0142] For the visualisation of the non canonical structure implicated the H4 and H6 probes, hybridized-combed DNA from infected cells preparation were scanned without any mounting medium using an inverted automated epifluorescence microscope, equipped with a 40× objective (ImageXpress Micro, Molecular Devices, USA) and the signals can be detected visually on an in house software (Gvlab 0.4.2). All signals composed of a continuous signal of Alexa 488-fluorescence for H4 and H6 were selected. Signals corresponding to one of the pattern below were classified as canonical structure: [0143] (e) A continuous signal composed of a minimum of 3 kb of an Alexa 594-fluorescence signal, followed of 13 kb of an Alexa 488-flurorescence signal corresponding to the H4 probe, 7.5 kb of an AMCA/Alexa 350-fluorescence signal corresponding to the H5 probe and 7 kb of an Alexa 488-flurorescence corresponding to the H6 probe. [0144] (f) A continuous signal composed of a minimum of 3 kb of an Alexa 594-fluorescence signal, followed of 7 kb of an Alexa 488-flurorescence signal corresponding to the H6 probe, 7.5 kb of an AMCA/Alexa 350-fluorescence signal corresponding to the H5 probe and 13 kb of an Alexa 488-flurorescence corresponding to the H4 probe.
[0145] All other signals were classified as non canonical structure. The proportions of the canonical and non canonical structure were compared.
[0146] Extraction of HSV-1 DNA from Viral Particles
[0147] During sample preparation many DNA molecules are sheared at random location due to uncontrolled manipulation forces resulting in high variability in the size of DNA prepared. It has been showed that high molecular weight DNA can be stretched on by Molecular Combing using a glass coverslip when it is deproteinised in a molten agarose plug (Lebofsky and Bensimon 2003). Thus, the analyzed DNA molecules are of variable length, with an average of about 300 kb, the longest molecules reaching several megabases.
[0148] Since HSV-1 DNA has never been used for Molecular Combing, the inventors first evaluated the quality of the DNA fibers in terms of length extracted by two different methods: the standard phenol:chloroform extraction and the method described by (Lebofsky, Heilig et al. 2006) that have been slightly modified as described in the “Example” section.
[0149] As shown in
[0150] However, the median size of DNA fibers is 36 kb with 1.2% of fiber longer than 140 kb when extraction has been performed with the standard phenol:chloroform method. In contrast, the median size of HSV-1 DNA fiber is 84 kb with 2.5% of fiber longer than 140 kb when the extraction of DNA from agarose plug-embedded viral particles using our alternative protocol has been realized. Although the proportion of long molecules is low, there are a lot of long combed DNA molecules available for analysis since there are several ten thousand fibers combed on a glass coverslip.
[0151] These results indicate that the alternative method developed by the inventors improved the quality of combed DNA extracted from viral particles compared to standard method allowing analysis by Molecular Combing.
[0152] Structure of the HSV-1 Genome in Viral Particles and its Distribution
[0153] The inventors applied Molecular Combing to uniformly stretch the HSV-1 DNA extracted from viral particles and infected cells and hybridized the resulting combed HSV-1 DNA with labeled adjacent and overlapping HSV-1-specific DNA probes (
[0154] On hybridized combed HSV-1 infected cells, the distribution of the four isomers was compared between Sc16 and KOS HSV-1 strains produced in different cell lines (BSR, COS7, Neuro2A and Vero). 405 multicolor linear patterns corresponding to each production and that fulfilled the criteria for evaluations (see “Experimental procedures” section) were classified. The distribution between the four isomers was statistically equivalent (Chi2 test) in all production of HSV-1 Sc16 (in BSR, Vero, Neuro 2a and COS-7 cells). In the same way, the distribution was found equivalent for HSV-1 strain KOS produced in COS-7 cells. Strikingly, for the first time, the inventors have found that the IS and P isomers are the predominant forms of the HSV-1 DNA strain KOS preparation from Vero and Neuro2A cells while IL isomers is the less present isomers.
[0155] The inventors have found that the Molecular Combing techniques as described herein are powerful methods for analysis of the structure of the HSV-1 genome DNA at the level of the unique molecule and to quantify its distribution in a biological sample.
[0156] Extraction of Genomic DNA from Mouse and Rabbit Cornea
[0157] Molecular Combing has been successfully performed with DNA solution from isolated cells including cultured cells (i.e., established cell strains, immortalized primary cells) or biological fluids (i.e., peripheral blood lymphocytes, amniotic cells) (Gad, Klinger et al. 2002; Caburet, Conti et al. 2005). However, the human cornea is a solid tissue with a complex structure composed of 5 layers: the corneal epithelium, the collagen-rich Bowman's membrane, the corneal stroma which consisting of regularly-arranged collagen fibers along with sparsely distributed interconnected keratocytes), the acellular Descemet's membrane and, the corneal endothelium. In order to extract genomic DNA from cornea, the inventors developed a specific method to isolate corneal cells before proceeding with the standard procedure. Different methods including mechanical disruption and enzymatic digestion of cornea were tested. The latter was given the best results and was optimized using different types of proteases (i.e., trypsin, collagenase A, dispase . . . ) at different concentration.
[0158] Detection of HSV-1 Infection in Mouse Cornea
[0159] The inventors therefore adapted and applied Molecular Combing on DNA extracted from HSV-1 infected mouse cornea and hybridized with the HSV-1 specific probes as described above. As shown in
[0160] In addition to the detection of mature HSV-1 genome, the Molecular Combing procedures of the invention allow the detection of concatemers (
[0161] Detection of Non-Canonical Forms in Infected Cells and Mouse Cornea
[0162] The inventors detected non-canonical structure of the HSV-1 genome (
[0163] The labelled adjacent and overlapping HSV-1 specific probes were hybridized on combed DNA extracts from HSV-1 strain Sc16 infected Vero cells (
[0164] Molecular Combing enables the visualisation of non canonical structure and by their infinity of combination of barcode possible is a powerful method to analyse them.
TABLE-US-00001 TABLE A Name Start End Size HSV-B1 1 1323 1323 HSV-B2 1324 7259 5936 HSV-P4 9237 11276 2004 HSV-P5 11090 13245 2156 HSV-Sc4 13088 14971 1884 HSV-P6 14554 17565 3065 HSV-B4 14827 22438 7595 HSV-Sc7 17853 20762 2910 HSV-B7 22953 25152 2200 HSV-Sc11 23400 25447 2048 HSV-B8 25153 29997 4845 HSV-Sc14 27944 31215 3272 HSV-B10 30903 34697 3795 HSV-Sc16 33044 39471 6428 HSV-B13 35891 40272 4382 HSV-Sc18 40315 42288 1974 HSV-B15 41017 43898 2882 HSV-Sc21 42621 47358 4738 HSV-P8 44192 46987 2795 HSV-B18 44682 47174 2493 HSV-B19 47175 50931 3757 HSV-Sc23 49040 51392 2353 HSV-B21 50959 56138 5180 HSV-Sc24 51393 53348 1956 HSV-Sc25 53349 56049 2701 HSV-B22 56139 63370 7232 HSV-Sc30 56775 64599 7825 HSV-Sc31 64600 69017 4418 HSV-B24/25 65757 66423 4740 HSV-Sc32 69018 72802 3785 HSV-B26 70497 73717 3221 HSV-P8 73229 77332 4103 HSV-B27 73718 77164 3447 HSV-B28 77165 79105 1941 HSV-B30 79937 81056 1120 HSV-Sc44 80991 85801 4811 HSV-B31 81507 83780 2724 HSV-B33 84298 85576 1279 HSV-Sc45 85802 90164 4363 HSV-B35 86304 87747 1444 HSV-B38 89249 90453 1205 HSV-B39 90453 92176 1723 HSV-B40 92177 94195 2019 HSV-Sc47 91545 93723 2179 HSV-Sc49 94122 100285 6164 HSV-B41 94196 96148 1953 HSV-B42 96149 99454 3306 HSV-B44 99492 102440 2949 HSV-B45 102441 106065 3625 HSV-B46 106066 107175 1110 HSV-B48 108009 116579 8571 HSV-P8c 109960 113148 3188 HSV-Sc54 115744 125068 9325 HSV-B52 125044 129901 4858 HSV-Sc56 125079 128601 3523 HSV-Sc58 129089 133046 3958 HSV-B55 130841 135542 4702 HSV-Sc59 133047 137945 4899 HSV-B56 135543 137690 2148 HSV-Sc60 137946 140155 2210 HSV-P8d 138148 139821 1673 HSV-B58 138757 141926 3170 HSV-B60 142840 145515 2276 HSV-Sc64 144918 149148 4231
TABLE-US-00002 TABLE B Probes Forward Primer Reverse Primer HSV-P4 TGG TTG TGT TAC TCG ATC GAC GAC TGG GCA AA ACC ATA AA (SEQ ID NO: 1) (SEQ ID NO: 2) HSV-P5 CAG ATA CGA CTC CGA CGA CCT CGA CCG CAG AT CGT TAT TT (SEQ ID NO: 3) (SEQ ID NO: 4) HSV-P6 CGT GAG GTC CAA GAC AGG CAA GCT AAT CAC CT CAA AGT CC (SEQ TD NO: 5) (SEQ ID NO: 6) HSV-P8 AGA TGT CCA CGA CCT GAC TTT GTG GCA CCA G GGG CTA AA (SEQ ID NO: 7) (SEQ ID NO: 8)
[0165] Primers sequences used for the synthesis of probes by long-range PCR. An extract of DNA from HSV-1 strain Sc16 is used as template.
TABLE-US-00003 TABLE C Non-labelled dNTPs Labelled dNTP (Roche, (Invitrogen, ref. ref. 11 558 706 910, Labelling 10297-018, CA, USA) France) Dig-dUTP dATP, dCTP, dGTP 40 Dig-11-dUTP 20 μM μM each dTTP 20 μM Alexa488-7- dATP, dTTP, dGTP 40 Alexa488-7-OBEA- OBEA-dCTP μM each dCTP 20 μM dCTP 20 μM
[0166] Mixes used in replacement of the dNTP mix of the random priming kit for labelling with dig-dUTP and Alexa488-7-OBEA-dCTP. The concentrations indicated are the final concentration in the labelling reaction. The non-labelled dNTPs and the labelled dNTP were added together in replacement of the provided dNTP mix intended for labelling with biotin-11-dCTP-.
TABLE-US-00004 TABLE D Description Abbreviation Supplier Streptavidin, coupled to Strep/A488 Invitrogen (France, Alexa Fluor 488 S11223) Goat anti-streptavidin, G anti-strep/biotin Vector Laboratories coupled to biotin (France; BA-0500) Mouse anti-dig, coupled to M anti-DIG/TR Jackson Immuno Texas Red Research (France; 200-072-156) Goat anti-mouse, coupled G anti-M/A594 Invitrogen (France; to A594 A11005) Streptavidin, coupled to Strep/A594 Invitrogen (France, Alexa Fluor 594 S11227) Mouse anti-Dig, AMCA M anti-DIG/AMCA Jackson Immuno coupled Research (France; 200-152-156) Rat anti-mouse, AMCA R anti-M/AMCA Jackson Immuno coupled Research (France; 415-155-166) Goat anti-rat, Alexa 350 G anti-R/A350 Invitrogen (France, coupled A21093) Rabbit anti Alexa 488 R anti-A488 Invitrogen (France, A11094) Goat anti mouse, coupled G anti-M/A488 Invitrogen (France, Alexa 488 A11001)
[0167] List of antibodies and other hapten-binding molecules used for the detection of probes.
TABLE-US-00005 TABLE E 1.sup.st layer 2.sup.nd layer 3.sup.rd layer 1-color scheme Biotin/green strep/A488 Goat anti- strep/A488 (1/25) strep/biotin (1/25) (1/50) 2-color scheme Biotin/green strep/A488 Goat anti- strep/A488 (1/25) strep/biotin (1/25) (1/50) Dig/red Mouse anti- Goat anti-M/A594 — DIG/TR (1/25) (1/25) 3-color scheme Biotin/red Strep/A594 G anti- Strep/A594 (1/25) strep/biotin (1/25) (1/50) Dig/blue M anti- R anti-M/AMCA G anti-R/A350 DIG/AMCA (1/25) (1/25) (1/25) A488/green R anti-A488 G anti-M/A488 — (1/25) (1/25)
[0168] Composition of the 2 or 3 layers for the detection of probes by fluorescence. The dilution for each detection agent is indicated in brackets. The abbreviations refer to table D.
Example 2
Human Immunodeficiency Virus Detection
[0169] Preparation of Embedded DNA Plugs from ACH-2 Cells Culture
[0170] ACH-2 cell lines (Clouse, Powell et al. 1989) were cultivated according to the authors' instructions. DNA was extracted as described in (Schurra and Bensimon 2009). Briefly, cells were resuspended in 1×PBS at a concentration of 10.sup.7 cells/mL mixed thoroughly at a 1:1 ratio with a 1.2% w/v solution of low-melting point agarose (Nusieve GTG, ref. 50081, Cambrex) prepared in 1×PBS at 50° C. 90 μL of the cell/agarose mix was poured in a plug-forming well (BioRad, ref. 170-3713) and left to cool down at least 30 min at 4° C. Agarose plugs were incubated overnight at 50° C. in 250 μL of a 0.5M EDTA (pH 8), 1% Sarkosyl, 250 μg/mL proteinase K (Eurobio, code: GEXPRK01, France) solution, then washed twice in a Tris 10 mM, EDTA 1 mM solution for 30 in at room temperature.
[0171] Final Extraction of DNA and Molecular Combing
[0172] Plugs of embedded DNA from ACH-2 cells were treated for combing DNA as previously described (Schurra and Bensimon 2009). Briefly, plugs were melted at 68° C. in a MES 0.5 M (pH 5.5) solution for 20 min, and 1.5 units of beta-agarase (New England Biolabs, ref. M0392S, MA, USA) was added and left to incubate for up to 16 h at 42° C. The DNA solution was then poured in a Teflon reservoir and Molecular Combing was performed using the Molecular Combing System (Genomic Vision S.A., Paris, France) and Molecular Combing coverslips (20 mm×20 mm, Genomic Vision S.A., Paris, France). The combed surfaces were dried for 4 hours at 60° C.
[0173] Synthesis and Labelling of HIV-1 Probes
[0174] The coordinates of the three probes relative to the Genbank sequence M19921.1 are listed in table F. Probe size ranges from 2927 to 3749 bp in this example.
[0175] The HIV specific probes were produced by long-range PCR using LR Taq DNA polymerase (Roche, kit code: 11681842001) using the primers listed in table G and the DNA from HIV pNL4-3 as template DNA. PCR products were ligated in the pCR®2.1 vector using the TOPO® TA cloning Kit (Invitrogen, France, code 1(455040). The two extremities of each probe were sequenced for verification purpose.
[0176] Two fosmids G248P87988G9 and G248P86255A8 flanking the insertion site of HIV-1 or one fosmid G248P84833H9 encompassing the HIV-1 provirus insertion site in ACH-2 cells (Ishida, Hamano et al. 2006), according to Human Mar. 2006 Assembly (NCBI Build 36.1), and the HIV-1 probes were labeled using conventional random priming protocols. For biotin-11-dCTP labelling, the BioPrime® DNA kit (Invitrogen, code: 18094-011, CA, USA) was used according to the manufacturer's instruction, except the labelling reaction was allowed to proceed overnight. For digoxygenin-11-dUTP, the dNTP mix from the kit was replaced by the mix specified in table C. 200 ng of each plasmid/fosmid was labelled in separate reactions. For entire HIV-1 detection, HIV-1 was labelled with digoxygenin-11-dUTP while fosmids were labelled with biotin-11-dCTP. The reaction products were visualized on an agarose gel to verify the synthesis of DNA.
[0177] Hybridization of HIV-1 Probes on Combed Viral DNA and Detection
[0178] Subsequent steps were also performed essentially as previously described in Schurra and Bensimon, 2009 (Schurra and Bensimon 2009). Briefly, a mix of labelled probes (250 ng of each probe) were ethanol-precipitated together with 10 μg herring sperm DNA and 2.5 μg Human Cot-1 DNA (Invitrogen, ref. 15279-011, CA, USA), resuspended in 20 μL of hybridization buffer (50% formamide, 2×SSC, 0.5% SDS, 0.5% Sarkosyl, 10 mM NaCl, 30% Block-aid (Invitrogen, ref B-10710, CA,USA). The probe solution and probes were heat-denatured together on the Hybridizer (Dako, ref. S2451) at 90° C. for 5 min and hybridization was left to proceed on the Hybridizer overnight at 37° C. Slides were washed 3 times in 50 formamide, 2×SSC and 3 times in 2×SSC solutions, for 5 min at room temperature. Detection antibody layers and their respective dilution in Block-Aid are described in table D and E. For each layer, 20 μL of the antibody solution was added on the slide and covered with a combed coverslip and the slide was incubated in humid atmosphere at 37° C. for 20 min. The slides were washed 3 times in a 2×SSC, 1% Tween20 solution for 3 min at room temperature between each layer and after the last layer.
[0179] Detection of entire HIV-1 was carried out using a Texas Red coupled mouse anti-digoxygenin (Jackson Immunoresearch, France) antibody in a 1:25 dilution for HIV-1 probes, and an Alexa488-coupled streptavidin antibody (Invitrogen, France) in a 1:25 dilution for fosmids as primary antibodies. As second layer, an Alexa594-coupled goat anti mouse (Invitrogen, France) diluted at 1:25 and a biotinylated goat antistreptavidin (Vector Laboratories, UK) diluted at 1:50 were used. To amplify the Alexa488-fluorescence signal of fosmids, an additional detection layer was realized by using the same Alexa488 coupled-streptavidin used for the first layer at a 1:25 dilution. After the last washing steps, all glass cover slips were dehydrated in ethanol and air dried.
[0180] Analysis of HIV-1 Detected Signals
[0181] Hybridized-combed DNA from ACH-2 cells preparation were scanned without any mounting medium using an inverted automated epifluorescence microscope, equipped with a 40× objective (ImageXpress Micro, Molecular Devices, USA) and the signals can be detected visually or automatically by an in house software (Gvlab 0.4.2): [0182] Using the two fosmids G248P87988G9 and G248P86255A8 flanking the insertion site of HIV-1, FISH signals corresponding to one of the pattern as follow were considered and measured, using an extension factor of 2 kb/μm (Schurra and Bensimon 2009): [0183] FISH signals composed of a continuous signal of Texas Red/Alexa 594-fluorescence for HIV-1. The entire signal that correspond of isolated HIV proviral DNA is measured [0184] FISH signal array composed of signal chain of Texas Red/Alexa 594-fluorescence for HIV-1, flanked by two gaps, and two continuous signals of Alexa 488-flurorescence corresponding to the fosmid sequences. The entire Texas Red/Alexa 594 fluorescence signal and gaps length flanking this signal were measured and corresponds to HIV-1 proviral DNA integrated in the chromosome 7 at 7p15 (Ishida, Hamano et al. 2006). [0185] FISH signal array with two Alexa 488-flurorescence signals separated by a gap. Measurement of the gap length that corresponds to the 7p15 locus without integration of HIV-1 proviral DNA was performed. [0186] Using the fosmid G248P84833H9 encompassing the HIV-1 provirus insertion site, FISH signals corresponding to one of the pattern as follow were considered and measured, using an extension factor of 2 kb/pm (Schurra and Bensimon 2009): [0187] FISH signals composed of a continuous signal of Texas Red/Alexa 594-fluorescence for HIV-1. The entire signal that correspond of isolated HIV proviral DNA is measured [0188] FISH signal array composed of a continuous signal chain of Texas Red/Alexa 594-fluorescence for HIV-1, flanked by two signals of Alexa 488-flurorescence corresponding to the fosmid sequences. The entire Texas Red/Alexa 594 fluorescence signal was measured and corresponds to HIV-1 proviral DNA integrated in the chromosome 7 at 7p15 (Ishida, Hamano et al. 2006). [0189] FISH signal with one long Alexa 488-flurorescence signals corresponds to the 7p15 locus without integration of HIV-1 proviral DNA.
[0190] Detection of HIV-1 in ACH-2 Cells Culture
[0191] The inventors have applied Molecular Combing to detect complete HIV-1 integrated provirus in ACH-2 cell lines (Clouse, Powell et al. 1989), which contain a unique integrated form of HIV-1 in its genome in NT5C3 (Cytosolic 5′-nucleotidase III) gene on 7p14.3 (Ishida, Hamano et al. 2006). Labeled fosmids flanking the insertion site (G248P87988G9 and G248P86255A8) were hybridized on combed ACH-2 DNA simultaneously than labelled HIV-1 probes. A mean size of 10.2 kb+/−0.8 kb was obtained from measurement of 124 HIV-1 FISH signals flanking by one or both fosmids, corresponding to the expected size of HIV-1 (9.7 kb) (
[0192] These results indicate that Molecular Combing is a powerful method to analyze the structure of the HIV genome DNA and to quantify its integration in genomic DNA at the level of the unique molecule and in any biological sample.
TABLE-US-00006 TABLE F Name Start End Size (bp) HIV-S1 1 3026 3026 HIV-S2 3018 5944 2927 HIV-S3 5961 9709 3749
[0193] Coordinates of the three probes used in this example, relative to the Genbank sequence M19921.1
TABLE-US-00007 TABLE G Probes Forward Primer Reverse Primer HIV-S1 TGGAAGGGCTAATTTGGTC TATTGCTGGTGATCCTTTCC (SEQ ID NO: 9) (SEQ ID NO: 10) H1V-S2 CCAGCAATATTCCAGTGTA TGAAACAAACTTGGCAATGA GC (SEQ ID NO: 11) (SEQ ID NO: 12) HIV-S3 CATCTCCTATGGCAGGAAG TGCTAGAGATTTTCCACACT A (SEQ ID NO: 13) GA (SEQ ID NO: 14)
[0194] Primers sequences used for the synthesis of probes by long-range PCR. An extract of DNA from HIV-1 pNL-4 is used as template.
Example 3
Detecting an Oncogene by Molecular Combing
[0195] In a manner to analogous to the detection of HSV genomic DNA in Example 1, probes are designed to detect the presence of a viral oncogene. Probes are designed to complement 80-100% of the active viral oncogene of interest and Molecular Combing is performed. The results indicate the presence of an active oncogene in a subject, leading to diagnosis and therapeutic intervention.
Example 4
Detecting Rearrangements of Infectious Viral DNA Using Molecular Combing
[0196] In a manner to analogous to the detection of HSV genomic DNA in Example 1, probes are designed to detect the presence of different arrangements of infectious viral DNA. Different sets of probes tagged with different haptens recognized by different colored fluorescent probes are designed to complement 80-100% of the active viral oncogene of interest and Molecular Combing is performed. Variations in the arrangement of viral genes in a subject's cells, tissue or biological fluid are used to diagnose or prognose the risks of progression of the viral disease or disease associated with rearrangement of the viral genome, such as the risk of or induction of a tumorigenic properties by conversion of proto-oncogenes into oncogenes.
Example 5
Monitoring Genetic Therapy by Molecular Combing
[0197] In a manner to analogous to the detection of proviral forms of HIV-1 in Example 2, probes are specially designed to complement 80-100% of an integrated therapeutic adenovirus vector or the transgenetic sequence(s) it carries. Molecular Combing is performed using the specially designed probes to detect the presence of transgenic material integrated into a host chromosome and whether it is arranged in form that can actively express the transgene(s). The quantity of transgene(s) in the subject is followed longitudinally and a determination is made when and whether to re-administer the therapeutic adenovirus vector.
REFERENCES
[0198] Patents
[0199] U.S. Pat. No. 6,130,044: Surfaces for biological reactions, process for preparing them and process for their use Bensimon D., Bensimon A., Heslot F. Oct. 10, 2000
[0200] U.S. Pat. No. 6,303,296, US2006257910, U.S. Pat. No. 6,054,327: Process for aligning macromolecules by passage of a meniscus and applications, Bensimon D., Bensimon A., Heslot F., Oct. 16, 2001.
[0201] U.S. Pat. No. 6,225,055: Apparatus for the parallel alignment of macromolecules, and use thereof, Bensimon A. Bensimon D, May 22, 2002.
[0202] U.S. 2004033510: Method for the diagnosis of genetic diseases by molecular combing and diagnostic kit, Bensimon A., Bensimon D., Michalet X., Feb. 19, 2004
[0203] EP0263025: Fractions containing antigens specific for herpes virus type 1 (HSV-1) and type 2 (HSV-2), method for isolating these fractions and diagnostic method specific for HSV-1 and/or HSV-2 using these fractions, Markoulatos P., Jun. 30, 1993.
[0204] EP0139416: Molecularly cloned diagnostic product and method of use, Berman, P. W., Lasky L. A., Nov. 5, 2003.
[0205] WO9818959: Procédé de diagnostic de maladies génétiques par Peignage Moléculaire et coffret de diagnostic, Bensimon A., Bensimon D., Michalet X., Jun. 7, 1998.
[0206] WO0073503: Utilisation du peignage dans l'identification des origines de réplication d'ADN, Bensimon A., Herrick J., Hyrien O., Dec. 7, 2000.
[0207] WO0202131 : Compositions et méthodes de diagnostic et de traitement de l'infection du virus de l'herpès. Hosken N. A, Day C. H., Dillon D. C., McGowan P., Sleath P. R., Jan. 10, 2002.
[0208] WO2004036185 Diagnostic et traitement des maladies du virus de l'herpes simplex (HSV), Kriesel J. D.; Leppert M. F.; Spruance S. L., Otterud B. E M, Peiffer A. P., Apr. 29, 2004.
[0209] WO2008028931: Genomic Morse Code, Lebofsky R., Bensimon A., Walrafen P., Mar. 13, 2008.
Scientific Publications
[0210] Barton, E. S., D. W. White, et al. (2007). “Herpesvirus latency confers symbiotic protection from bacterial infection.” Nature 447(7142): 326-329.
[0211] Bataille, D. and A. L. Epstein (1997). “Equimolar generation of the four possible arrangements of adjacent L components in herpes simplex virus type 1 replicative intermediates.” J Virol 71(10): 7736-7743.
[0212] Ben-Zeev, A., E. Weinberg, et al. (1974). “Isolation of herpes simplex virus DNA from virus particles and infected cells by electrophoresis in polyacrylamide gels.” J Gen Virol 25(1): 63-73.
[0213] Bertoletti, A. and A. Gehring (2007). “Immune response and tolerance during chronic hepatitis B virus infection.” Hepatol Res 37 Suppl 3: S331-338.
[0214] Boehmer, P. E. and I. R. Lehman (1997). “Herpes simplex virus DNA replication.” Annu Rev Biochem 66: 347-384.
[0215] Breitbart, M. and F. Rohwer (2005). “Here a virus, there a virus, everywhere the same virus?” Trends Microbiol 13(6): 278-284.
[0216] Caburet, S., C. Conti, et al. (2005). “Human ribosomal RNA gene arrays display a broad range of palindromic structures.” Genome Res 15(8): 1079-1085.
[0217] Cockerham, G. C., K. Bijwaard, et al. (2000). “Primary graft failure: a clinicopathologic and molecular analysis.” Ophthalmology 107(11): 2083-2090; discussion 2090-2081.
[0218] Collier, L. H. and J. S. Oxford (2006). Human virology : a text for students of medicine, dentistry, and microbiology. Oxford; New York, Oxford University Press.
[0219] Crouse, C. A., S. C. Pflugfelder, et al. (1990). “Detection of herpes viral genomes in normal and diseased corneal epithelium.” Curr Eye Res 9(6): 569-581.
[0220] Davison, A. J. and N. M. Wilkie (1981). “Nucleotide sequences of the joint between the L and S segments of herpes simplex virus types 1 and 2.” J Gen Virol 55(Pt 2): 315-331.
[0221] Dimmock, N. J., A. J. Easton, et al. (2007). Introduction to modern virology. Malden, Mass., Blackwell Pub.
[0222] El-Aal, A. M., M. El Sayed, et al. (2006). “Evaluation of herpes simplex detection in corneal scrapings by three molecular methods.” Curr Microbiol 52(5): 379-382.
[0223] Fields, B. N., D. M. Knipe, et al. (2007). Fields' virology. Philadelphia, Wolters kluwer/Lippincott Williams & Wilkins.
[0224] Fukuda, M., T. Deai, et al. (2008). “Presence of a large amount of herpes simplex virus genome in tear fluid of herpetic stromal keratitis and persistent epithelial defect patients.” Semin Ophthalmol 23(4): 217-220.
[0225] Gad, S., A. Aurias, et al. (2001). “Color bar coding the BRCA1 gene on combed DNA: a useful strategy for detecting large gene rearrangements.” Genes Chromosomes Cancer 31(1): 75-84.
[0226] Gad, S., I. Bieche, et al. (2003). “Characterisation of a 161 kb deletion extending from the NBR1 to the BRCA1 genes in a French breast-ovarian cancer family.” Hum Mutat 21(6): 654.
[0227] Gad, S., V. Caux-Moncoutier, et al. (2002). “Significant contribution of large BRCA1 gene rearrangements in 120 French breast and ovarian cancer families.” Oncogene 21(44): 6841-6847.
[0228] Gad, S., M. Klinger, et al. (2002). “Bar code screening on combed DNA for large rearrangements of the BRCA1 and BRCA2 genes in French breast cancer families.” J Med Genet 39(11): 817-821.
[0229] Gardella, T., P. Medveczky, et al. (1984). “Detection of circular and linear herpesvirus DNA molecules in mammalian cells by gel electrophoresis.” J Virol 50(1): 248-254.
[0230] Goudsmit, J. (1998). Viral sex: the nature of AIDS. New York; Oxford, Oxford University Press.
[0231] group, T. H. E. D. S. (1998). “Acyclovir for the prevention of recurrent herpes simplex virus eye disease. Herpetic Eye Disease Study Group.” N Engl J Med 339(5): 300-306.
[0232] Hampson, A. W. and J. S. Mackenzie (2006). “The influenza viruses.” Med J Aust 185(10 Suppl): S39-43.
[0233] Hayward, G. S., R. J. Jacob, et al. (1975). “Anatomy of herpes simplex virus DNA: evidence for four populations of molecules that differ in the relative orientations of their long and short components.” Proc Natl Acad Sci USA 72(11): 4243-4247.
[0234] Herrick, J., C. Conti, et al. (2005). “Genomic organization of amplified MYC genes suggests distinct mechanisms of amplification in tumorigenesis.” Cancer Res 65(4): 1174-1179.
[0235] Herrick, J., S. Jun, et al. (2002). “Kinetic model of DNA replication in eukaryotic organisms.” J Mol Biol 320(4): 741-750.
[0236] Herrick, J., X. Michalet, et al. (2000). “Quantifying single gene copy number by measuring fluorescent probe lengths on combed genomic DNA.” Proc Natl Acad Sci USA 97(1): 222-227.
[0237] Herrick, J., P. Stanislawski, et al. (2000). “Replication fork density increases during DNA synthesis in X. laevis egg extracts.” J Mol Biol 300(5): 1133-1142.
[0238] Kabra, A., P. Lalitha, et al. (2006). “Herpes simplex keratitis and visual impairment: a case series.” Indian J Ophthalmol 54(1): 23-27.
[0239] Kessler, H. H., G. Muhlbauer, et al. (2000). “Detection of Herpes simplex virus DNA by real-time PCR.” J Clin Microbiol 38(7): 2638-2642.
[0240] Kotronias, D. and N. Kapranos (1998). “Detection of herpes simplex virus DNA in human spermatozoa by in situ hybridization technique.” In Vivo 12(4): 391-394.
[0241] Labetoulle, M., P. Auquier, et al. (2005). “Incidence of herpes simplex virus keratitis in France.” Ophthalmology 112(5): 888-895.
[0242] Lebofsky, R. and A. Bensimon (2003). “Single DNA molecule analysis: applications of molecular combing.” Brief Funct Genomic Proteomic 1(4): 385-396.
[0243] Lebofsky, R. and A. Bensimon (2005). “DNA replication origin plasticity and perturbed fork progression in human inverted repeats.” Mol Cell Biol 25(15): 6789-6797.
[0244] Lebofsky, R., R. Heilig, et al. (2006). “DNA replication origin interference increases the spacing between initiation events in human cells.” Mol Biol Cell 17(12): 5337-5345.
[0245] Leger, J., B. Larroque, et al. (2001). “Influence of severity of congenital hypothyroidism and adequacy of treatment on school achievement in young adolescents: a population-based cohort study.” Acta Paediatr 90(11): 1249-1256.
[0246] Liesegang, T. J. (1989). “Epidemiology of ocular herpes simplex. Natural history in Rochester, Minn., 1950 through 1982.” Arch Ophthalmol 107(8): 1160-1165.
[0247] Liesegang, T. J. (2001). “Herpes simplex virus epidemiology and ocular importance.” Cornea 20(1): 1-13.
[0248] Liesegang, T. J., L. J. Melton, 3rd, et al. (1989). “Epidemiology of ocular herpes simplex. Incidence in Rochester, Minn., 1950 through 1982.” Arch Ophthalmol 107(8): 1155-1159.
[0249] Lomholt, J. A., K. Baggesen, et al. (1995). “Recurrence and rejection rates following corneal transplantation for herpes simplex keratitis.” Acta Ophthalmol Scand 73(1): 29-32.
[0250] Lukashev, A. N. (2005). “Role of recombination in evolution of enteroviruses.” Rev Med Virol 15(3): 157-167.
[0251] Margolis, T. P., F. L. Elfman, et al. (2007). “Spontaneous reactivation of herpes simplex virus type 1 in latently infected murine sensory ganglia.” J Virol 81(20): 11069-11074.
[0252] Matsumoto, T., O. Yamada, et al. (1992). “Rapid DNA diagnosis of herpes simplex virus serotypes.” J Virol Methods 40(1): 119-125.
[0253] McGeoch, D. J., M. A. Dalrymple, et al. (1988). “The complete DNA sequence of the long unique region in the genome of herpes simplex virus type 1.” J Gen Virol 69 (Pt 7): 1531-1574.
[0254] McGeoch, D. J A. Dolan, et al. (1986). “Complete DNA sequence of the short repeat region in the genome of herpes simplex virus type 1.” Nucleic Acids Res 14(4): 1727-1745.
[0255] Metzner, K. J. (2006). “Detection and significance of minority quasispecies of drug-resistant HIV-1.” J HIV Ther 11(4): 74-81.
[0256] Michalet, X., R. Ekong, et al. (1997). “Dynamic molecular combing: stretching the whole human genome for high-resolution studies.” Science 277(5331): 1518-1523.
[0257] Mocarski, E. S. and B. Roizman (1982). “Structure and role of the herpes simplex virus DNA termini in inversion, circularization and generation of virion DNA.” Cell 31(1): 89-97.
[0258] Namvar, L., S. Olofsson, et al. (2005). “Detection and typing of Herpes Simplex virus (HSV) in mucocutaneous samples by TaqMan PCR targeting a gB segment homologous for HSV types 1 and 2.” J Clin Microbiol 43(5): 2058-2064.
[0259] Ou, C. Y., S. Kwok, et al. (1988). “DNA amplification for direct detection of HIV-1 in DNA of peripheral blood mononuclear cells.” Science 239(4837): 295-297.
[0260] Pan, X. P., L. J. Li, et al. (2007). “Differences of YMDD mutational patterns, precore/core promoter mutations, serum HBV DNA levels in lamivudine-resistant hepatitis B genotypes B and C.” J Viral Hepat 14(11): 767-774.
[0261] Pasero, P., A. Bensimon, et al. (2002). “Single-molecule analysis reveals clustering and epigenetic regulation of replication origins at the yeast rDNA locus.” Genes Dev 16(19): 2479-2484.
[0262] Patel, P. K., B. Arcangioli, et al. (2006). “DNA replication origins fire stochastically in fission yeast.” Mol Biol Cell 17(1): 308-316.
[0263] Pramod, N. P., P. Rajendran, et al. (1999). “Herpes simplex keratitis in South India: clinico-virological correlation.” Jpn J Ophthalmol 43(4): 303-307.
[0264] Pressing, J. and D. C. Reanney (1984). “Divided genomes and intrinsic noise.” J Mol Evol 20(2): 135-146.
[0265] Ramaswamy, M. and A. M. Geretti (2007). “Interactions and management issues in HSV and HIV coinfection.” Expert Rev Anti Infect Ther 5(2): 231-243.
[0266] Rao, V. A., C. Conti, et al. (2007). “Endogenous gamma-H2AX-ATM-Chk2 checkpoint activation in Bloom's syndrome helicase deficient cells is related to DNA replication arrested forks.” Mol Cancer Res 5(7): 713-724.
[0267] Reisinger, J., S. Rumpler, et al. (2006). “Visualization of episomal and integrated Epstein-Barr virus DNA by fiber fluorescence in situ hybridization.” Int J Cancer 118(7): 1603-1608.
[0268] Rodrigues, C., M. Deshmukh, et al. (2001). “Significance of HBV DNA by PCR over serological markers of HBV in acute and chronic patients.” Indian J Med Microbiol 19(3): 141-144.
[0269] Roizman, B. (1979). “The structure and isomerization of herpes simplex virus genomes.” Cell 16(3): 481-494.
[0270] Rowley, A. H., R. J. Whitley, et al. (1990). “Rapid detection of herpes-simplex-virus DNA in cerebrospinal fluid of patients with herpes simplex encephalitis.” Lancet 335(8687): 440-441.
[0271] Schurra, C. and A. Bensimon (2009). “Combing genomic DNA for structural and functional studies.” Methods Mol Biol 464: 71-90.
[0272] Severini, A., A. R. Morgan, et al. (1994). “Study of the structure of replicative intermediates of HSV-1 DNA by pulsed-field gel electrophoresis.” Virology 200(2): 428-435.
[0273] Shibata, D. K., N. Arnheim, et al. (1988). “Detection of human papilloma virus in paraffin-embedded tissue using the polymerase chain reaction.” J Exp Med 167(1): 225-230.
[0274] Sugita, S., N. Shimizu, et al. (2008). “Use of multiplex PCR and real-time PCR to detect human herpes virus genome in ocular fluids of patients with uveitis.” Br J Ophthalmol 92(7): 928-932.
[0275] Susloparov, M. A., I. M. Susloparov, et al. (2006). “[Herpes simplex virus type 1 and 2 (HSV-1,2) DNA detection by PCR during genital herpes].” Mol Gen Mikrobiol Virusol(1): 38-41.
[0276] Taylor, T. J., M. A. Brockman, et al. (2002). “Herpes simplex virus.” Front Biosci 7: d752-764.
[0277] Umene, K. (1999). “Mechanism and application of genetic recombination in herpesviruses.” Rev Med Virol 9(3): 171-182.
[0278] Vlazny, D. A., A. Kwong, et al. (1982). “Site-specific cleavage/packaging of herpes simplex virus DNA and the selective maturation of nucleocapsids containing full-length viral DNA.” Proc Natl Acad Sci USA 79(5): 1423-1427.
[0279] Wadsworth, S., R. J. Jacob, et al. (1975). “Anatomy of herpes simplex virus DNA. II. Size, composition, and arrangement of inverted terminal repetitions.” J Virol 15(6): 1487-1497.
[0280] Wang, K., T. Y. Lau, et al. (2005). “Laser-capture microdissection: refining estimates of the quantity and distribution of latent herpes simplex virus 1 and varicella-zoster virus DNA in human trigeminal Ganglia at the single-cell level.” J Virol 79(22): 14079-14087.
[0281] Whitley, R. J. and B. Roizman (2001). “Herpes simplex virus infections.” Lancet 357(9267): 1513-1518.
[0282] Wildy, P., W. C. Russell, et al. (1960). “The morphology of herpes virus.” Virology 12: 204-222.
[0283] Wilhelmus, K. R., D. J. Coster, et al. (1981). “Prognosis indicators of herpetic keratitis. Analysis of a five-year observation period after corneal ulceration.” Arch Ophthalmol 99(9): 1578-1582.
[0284] Worobey, M. and E. C. Holmes (1999). “Evolutionary aspects of recombination in RNA viruses.” J Gen Virol 80 (Pt 10): 2535-2543.
[0285] Yu, X., B. Shi, et al. (2009). “A random PCR screening system for the identification of type 1 human herpes simplex virus.” J Virol Methods 161(1): 91-97.
[0286] HIV-Related References
[0287] (2000). “Time from HIV-1 seroconversion to AIDS and death before widespread use of highly-active antiretroviral therapy: a collaborative re-analysis. Collaborative Group on AIDS Incubation and HIV Survival including the CASCADE EU Concerted Action. Concerted Action on SeroConversion to AIDS and Death in Europe.” Lancet 355(9210): 1131-1137.
[0288] Buchbinder, S. P., M. H. Katz, et al. (1994). “Long-term HIV-1 infection without immunologic progression.” AIDS 8(8): 1123-1128.
[0289] Carrillo-Infante, C., G. Abbadessa, et al. (2007). “Viral infections as a cause of cancer (review).” Int J Oncol 30(6): 1521-1528.
[0290] Chun, T. W., D. C. Nickle, et al. (2005). “HIV-infected individuals receiving effective antiviral therapy for extended periods of time continually replenish their viral reservoir.” J Clin Invest 115(11): 3250-3255.
[0291] Clouse, K. A., D. Powell, et al. (1989). “Monokine regulation of human immunodeficiency virus-1 expression in a chronically infected human T cell clone.” J Immunol 142(2): 431-438.
[0292] del Rio, C. (2006). “Current concepts in antiretroviral therapy failure.” Top HIV Med 14(3): 102-106.
[0293] Douek, D. C., J. M. Brenchley, et al. (2002). “HIV preferentially infects HIV-specific CD4+ T cells.” Nature 417(6884): 95-98.
[0294] Douek, D. C., M. Roederer, et al. (2009). “Emerging concepts in the immunopathogenesis of AIDS.” Annu Rev Med 60: 471-484.
[0295] Douglas, J. T. (2007). “Adenoviral vectors for gene therapy.” Mol Biotechnol 36(1): 71-80.
[0296] Espy, M. J., J. R. Uhl, et al. (2006). “Real-time PCR in clinical microbiology: applications for routine laboratory testing.” Clin Microbiol Rev 19(1): 165-256.
[0297] Fischer, M., B. Joos, et al. (2004). “Cellular viral rebound after cessation of potent antiretroviral therapy predicted by levels of multiply spliced HIV-1 RNA encoding nef ” J Infect Dis 190(11): 1979-1988.
[0298] Frenkel, L. M., Y. Wang, et al. (2003). “Multiple viral genetic analyses detect low-level human immunodeficiency virus type 1 replication during effective highly active antiretroviral therapy.” J Virol 77(10): 5721-5730.
[0299] Grizot, S., J. Smith, et al. (2009). “Efficient targeting of a SCID gene by an engineered single-chain homing endonuclease.” Nucleic Acids Res 37(16): 5405-5419.
[0300] Havlir, D. V., M. C. Strain, et al. (2003). “Productive infection maintains a dynamic steady state of residual viremia in human immunodeficiency virus type 1-infected persons treated with suppressive antiretroviral therapy for five years.” J Virol 77(20): 11212-11219.
[0301] Hermankova, M., J. D. Siliciano, et al. (2003). “Analysis of human immunodeficiency virus type 1 gene expression in latently infected resting CD4+ T lymphocytes in vivo.” J Virol 77(13): 7383-7392.
[0302] Herrick, J., C. Conti, et al. (2005). “Genomic organization of amplified MYC genes suggests distinct mechanisms of amplification in tumorigenesis.” Cancer Res 65(4): 1174-1179.
[0303] Huser, D. and R. Heilbronn (2003). “Adeno-associated virus integrates site-specifically into human chromosome 19 in either orientation and with equal kinetics and frequency.” J Gen Virol 84(Pt 1): 133-137.
[0304] Ishida, T., A. Hamano, et al. (2006). “5′ long terminal repeat (LTR)-selective methylation of latently infected HIV-1 provirus that is demethylated by reactivation signals.” Retrovirology 3: 69.
[0305] Lawn, S. D. (2004). “AIDS in Africa: the impact of coinfections on the pathogenesis of HIV-1 infection.” J Infect 48(1): 1-12.
[0306] Morgan, D., C. Mahe, et al. (2002). “HIV-1 infection in rural Africa: is there a difference in median time to AIDS and survival compared with that in industrialized countries?” AIDS 16(4): 597-603.
[0307] Parsonnet, J. (1999). Microbes and malignancy : infection as a cause of human cancers. New York; Oxford, Oxford University Press.
[0308] Ramratnam, B., R. Ribeiro, et al. (2004). “Intensification of antiretroviral therapy accelerates the decay of the HIV-1 latent reservoir and decreases, but does not eliminate, ongoing virus replication.” J Acquir Immune Detic Syndr 35(1): 33-37.
[0309] Schneider, M. F., S. J. Gange, et al. (2005). “Patterns of the hazard of death after AIDS through the evolution of antiretroviral therapy: 1984-2004.” AIDS 19(17): 2009-2018.
[0310] Schurra, C. and A. Bensimon (2009). “Combing genomic DNA for structural and functional studies.” Methods Mol Biol 464: 71-90.
[0311] Siliciano, J. D., J. Kajdas, et al. (2003). “Long-term follow-up studies confirm the stability of the latent reservoir for HIV-1 in resting CD4+ T cells.” Nat Med 9(6): 727-728.
[0312] Thomas, C. E., A. Ehrhardt, et al. (2003). “Progress and problems with the use of viral vectors for gene therapy.” Nat Rev Genet 4(5): 346-358.
[0313] Tobin, N. H., G. H. Learn, et al. (2005). “Evidence that low-level viremias during effective highly active antiretroviral therapy result from two processes: expression of archival virus and replication of virus.” J Virol 79(15): 9625-9634.
[0314] Weiss, R. A. (1993). “How does HIV cause AIDS?” Science 260(5112): 1273-1279.
[0315] Zhou, H. S., N. Zhao, et al. (2007). “Site-specific transfer of an intact beta-globin gene cluster through a new targeting vector.” Biochem Biophys Res Commun 356(1): 32-37.
INCORPORATION BY REFERENCE
[0316] Each document, patent, patent application or patent publication cited by or referred to in this disclosure is incorporated by reference in its entirety, especially with respect to the specific subject matter surrounding the citation of the reference in the text. However, no admission is made that any such reference constitutes background art and the right to challenge the accuracy and pertinence of the cited documents is reserved.