Method for modifying carotenoid biosynthesis in plants

Abstract

Methods are provided for modifying and screening for carotenoid biosynthesis in a plant. The methods are useful for enhancing plant adaptation to climate change and food security, providing increased carotenoid content to a plant, improving stress resistance to climate changes in a plant, and for selecting plants having improved stress resistance to climate changes.

Claims

1. A method for providing increased carotenoid content to a plant comprising expressing an allelic variant of phytoene synthase 1 (PSY1) in non-photosynthetic plastids of said plant, wherein said non-photosynthetic plastid does not naturally comprise said variant or does not naturally express said variant and the allelic variant has amino acid residues N and P at the respective positions corresponding to amino acid positions 168 and 257 of SEQ ID NO: 1.

2. A method for providing improved stress resistance to climate changes to a plant comprising expressing an allelic variant of phytoene synthase 1 (PSY1) in non-photosynthetic plastids of said plant, wherein said non-photosynthetic plastid does not naturally comprise said variant or does not naturally express said variant and the allelic variant has amino acid residues N and P at the respective positions corresponding to amino acid positions 168 and 257 of SEQ ID NO: 1.

3. A method for selecting plants with increased carotenoid content comprising selecting a plant in which an allelic variant of phytoene synthase 1 (PSY1) is expressed are in non-photosynthetic plastids of said plant, wherein said non-photosynthetic plastid does not naturally comprise said variant or does not naturally express said variant and the allelic variant has amino acid residues N and P at the respective positions corresponding to amino acid positions 168 and 257 of SEQ ID NO: 1.

4. A method for selecting plants having improved stress resistance to climate changes comprising selecting a plant in which an allelic variant of phytoene synthase 1 (PSY1) is expressed are in non-photosynthetic plastids of said plant, wherein said non-photosynthetic plastid does not naturally comprise said variant or does not naturally express said variant and the allelic variant has amino acid residues N and P at the respective positions corresponding to amino acid positions 168 and 257 of SEQ ID NO: 1.

Description

BRIEF DESCRIPTION OF THE FIGURES

(1) FIG. 1. Transient expression of various PSY-GFP fusion constructs in leaf mesophyll protoplasts.

(2) A. Expression in etiolated maize protoplasts. All PSYs from maize and rice, except .sub.zmPSY1, are localized to specific speckles. .sub.zmPSY1 is localized to stroma and associated to prolamellar bodies. Chl: chlorophyll autofluorescence, concentrated in a partial area of an etioplast.

(3) B. Expression of .sub.zmPSYs and .sub.osPSYs in green maize protoplasts and of .sub.atPSY-RFP in green bean protoplasts. All PSY from maize, rice and Arabidopsis, except .sub.zmPSY1, are localized to specific speckles. .sub.zmPSY1 is localized to stroma. Chl: chlorophyll autofluorescence, occupying the entire area of a chloroplast. Bar=10 m.

(4) FIG. 2. Plastoglobuli localization of various proteins in mesophyll protoplasts.

(5) A. Transient expression of .sub.zmPG2-RFP, suggesting localization to plastoglobuli.

(6) 1. Expression in bean cotyledon protoplasts.

(7) 2. Expression in green maize protoplasts.

(8) 3. Expression in etiolated maize protoplasts.

(9) **1 and 2 show plastoglobular localization, 3 shows stromal localization.

(10) B. Transient co-expression of .sub.zmPSY2-GFP (1) and .sub.zmPSY3-GFP (2) with .sub.zmPG2-RFP. .sub.zmPSYs and .sub.zmPG2 are co-localized, as seen on merged image, indicating plastoglobular localization of .sub.zmPSY2 and .sub.zmPSY3. Chl: chlorophyll autofluorescence. Bar=10 m.

(11) FIG. 3. Import of proteins into chloroplasts. Protein precursors were made by in vitro transcription/translation. Protein precursors were incubated with isolated chloroplasts for import and processing to the mature forms. Mature proteins were resistant to thermolysin treatment of chloroplasts post-import and of smaller mass compared to the unimported precursors.

(12) A. import of proteins with known localization used as a control for fraction purity: 16/EGFP (a transit peptide of spinach OE16 of oxygen evolution system from thylakoid lumen, fused with EGFP), LHCP (light-harvesting chlorophyll a/b binding pea protein localized in thylakoid membranes), and Toc34 (a component of the protein transport complex from the outer envelope membrane).

(13) B. import of maize PSYs. Arrowmature processed protein. Star20 kDa band.

(14) kDamolecular weight marker

(15) Pprecursor (1 l of the translation mix)

(16) Iimport of radiolabelled precursor protein into intact chloroplasts

(17) Tthermolysin treated chloroplasts

(18) Mmembrane fraction

(19) MApurified membrane fraction (after alkaline treatment)

(20) Ssoluble fraction

(21) FIG. 4. Alignment of PSY aminoacids for all enzymes used in experiments adjusted to secondary SQS structure. #168: aminoacid represented by asparagine (N) in .sub.zmPSY1 and serine (S) in all other PSYs. #257: aminoacid represented by threonine (T) in .sub.zmPSY1 and proline (P) in all other PSYs. #174, 190: respective aminoacids were shown to affect the activity of PSY in cassava and tomato. #285: mutation at this site inactivates SQS (Gu et al, 1998). S-putative cleavage site for chloroplast transit sequence, predicted by ChloroP. XXXXXpsy and sqs signature motif 1 and 2 (conserved pattern). XXXXXa-helix, predicted by Metaserver based on SQS structure. BoxDXXXD putative active site, mutagenesis of D.sub.285 inactivates the enzyme. (*)62 aa of C-terminus of SQS sequence were truncated. FIG. 4 discloses SEQ ID NOS 1-7, respectively, in order of appearance.

(22) FIG. 5. Alignment of phytoene synthase amino acid sequences. BLAST alignment of .sub.zmPSY1 to all PSY sequences available from NCBI. BoxDXXXD putative active site, based on SQS alignment. Highlightamino acids 168 and 257. Amino acid numbers refer to .sub.zmPSY1 sequence. FIG. 5 discloses SEQ ID NOS 8-50 and 101-143, respectively, in order of appearance (top to bottom, left to right)

(23) FIG. 6. Transient expression of .sub.zmPSY1-NP-GFP and its mutagenized variants in etiolated maize protoplasts. .sub.zmPSY1-NP is forming characteristic spikes in 30% of cases (see central protoplast), the rest 70% it is soluble (top left corner). .sub.zmPSY1-SP, .sub.zmPSY1-NS and .sub.zmPSY1-ST are localized evenly inside plastids, suggesting soluble stromal localization. Chl: chlorophyll autofluorescence. Bar=10 m.

(24) FIG. 7. Sequence of .sub.zmPSY1s with transit peptide removed threaded onto crystal structure of squalene synthase.

(25) A. Graphical representation of RMSD data on .sub.zmPSY1 modeling. Blue: .sub.zmPSY1, green: .sub.zmPSY1-NP. Star: amino acid #257. Red arrow: perturbed region. Black double arrow: regions .sub.159DELVD.sub.163 (SEQ ID NO: 144) and .sub.285DVGED.sub.289 (SEQ ID NO: 145) as putative active site.

(26) B. RMSD data showing mean distance (y-axis, in angstroms) between atoms of the three superimposed .sub.zmPSY structures (numbered .sub.zmPSY amino acids shown on x-axis). Red: .sub.zmPSY1-NP, green: .sub.zmPSY1-SP, blue: marker to show location in sequence of amino acids 168, 174, 190 and 257.

(27) FIG. 8. Overexpression of proteins with known location in etiolated maize protoplasts.

(28) A. soluble GFP (protoplasts transformed with pUC35S-sGFP-Nos), GFP is localized to cell cytoplasm.

(29) B. LHCP-GFP (protoplasts transformed with pUC35S-LHCP-sGFP-Nos), LHCP is an integral protein from thylakoid membrane and colocalized with chlorophyll fluorescence.

(30) C. AtAPG1 (protoplasts transformed with pFB70),

(31) D. AtTic40 (protoplasts transformed with pFB71). AtAPG1 and AtTic40 are proteins from chloroplast inner envelope membrane and demonstrate half-moon or circle pattern correspondingly.

(32) Chlchlorophyll autofluorescence. Bar=10 m.

(33) FIG. 9. Hidden 3D (third eye) stereogram of transiently expressed .sub.zmPSY1-NP-GFP in etiolated maize protoplasts. .sub.zmPSY1-NP-GFP is forming characteristic spikes. Stereogram prepared from original microscopic image by Hidden 3D studio, USA. It can be viewed by unfocusing the eyes and looking through the image.

(34) FIG. 10. Transient expression of .sub.zmPSY-GFP variants in etiolated maize protoplasts from PSY1 knockout line.

(35) FIG. 11. Spectral dye separation for transiently expressed GFP-fusion proteins in maize PSY1 knockout leaf protoplasts. Different fusion protein constructs were transiently expressed in protoplasts, isolated from etiolated leaves of maize PSY1 knockout plants. GFP and carotenoid fluorescent spectra were separated using Spectral Dye Separation tool in LAS AF software (Leica Microsystems). Carotenoids have a low fluorescence emission between 500 and 650 nm which can be excited by a 488 nm laser. The software separates the carotenoid emission from the GFP emission. To eliminate any background carotenoid fluorescence in the absence of a PSY transgene, we used protoplasts prepared form .sub.zmPSY1-knockout maize y1-8549 which are unable to produce carotenoids in the absence of the transgenically supplied PSY.

(36) A. Soluble GFP without any protein or transit peptide attached, localized to protoplast cytoplasm Soluble cytoplasmic GFP, used as a negative control and GFP spectrum reference, showed no carotenoid emission

(37) B. .sub.zmPSY1-NP-GFPFibrils formed by .sub.zmPSY1-NP have bright fluorescence in the carotenoid channel suggesting presence of concentrated carotenoids.

(38) C. .sub.zmPSY1-NP-E-GFPSuch fluorescence disappeared, showing no fibrils when non-active .sub.zmPSY1-NP-E was overexpressed in etioplasts.

(39) D. .sub.zmPSY1-NT-GFPA low level of carotenoid fluorescence was observed in etioplasts carrying overexpressed .sub.zmPSY1-NT which might be due to a basal level of carotenoid biosynthesis in leaves due to inactivity of .sub.zmPSY when not attached to membranes.

(40) E. .sub.zmPSY2-GFPpunctuated dots, formed in etioplasts by .sub.zmPSY2-GFP show bright fluorescence in the carotenoid channel suggesting presence of concentrated carotenoids

(41) F. .sub.zmPSY3-GFPPunctuated dots, formed in etioplasts by .sub.zmPSY3-GFP show bright fluorescence in the carotenoid channel suggesting presence of concentrated carotenoids.

(42) G. LHCP-GFP (negative control of plastid protein fused with GFP; LHCP is a not involved in carotenoid biosynthesis). In contrast, only background level of fluorescence is observed when a control chloroplast-localized noncarotenoid protein is introduced (integral thylakoid membrane protein LHCP.

(43) GFP, Carotenoidsmaximum projection of corresponding isolated fluorescent spectra;

(44) Bright fieldbright field image of the protoplast. Bar=10 m.

(45) FIG. 12. E. coli complementation test. E. coli Top 10 with pACCAR25crtB carrying carotenoid biosynthetic enzymes for zeaxanthin production, but lacking the PSY enzyme, was transformed with different mutagenized variants of .sub.zmPSY1. Active PSY enzymes were able to complement the pathway which resulted in zeaxanthin production. Zeaxanthin was extracted from pelleted cells by methanol and then analyzed by HPLC to detect the relative amount produced, which was calculated as peak area divided by OD of the E. coli culture. .sub.zmPSY1, .sub.zmPSY1-NP were active in this test, .sub.zmPSY1-D.sub.285E was inactive. An empty expression vector was used as a negative control.

SUMMARY OF THE INVENTION

(46) The present invention related to a method for providing increased carotenoid content to a plant and for improving stress resistance to climate changes in a plant comprising. The method involves overexpressing naturally occurring allelic variants of phytoene synthase (PSY) in the plant.

(47) In one embodiment, the allelic variant is the NP variant of phytoene synthase 1 (PSY1).

(48) In another aspect, the invention provides a method for selecting plants with increased carotenoid content and/or having improved stress resistance to climate changes. The method involves selecting plants in which naturally occurring allelic variants of phytoene synthase (PSY) are overexpressed in said plant.

(49) In another embodiment, the allelic variant is the NP variant of phytoene synthase 1 (PSY1).

DETAILED DESCRIPTION OF THE INVENTION

(50) As a rate-controlling enzyme of the pathway, PSY has been used extensively for metabolic engineering of the carotenoid biosynthetic pathway in plants despite limited understanding of its plastid suborganellar location. Confocal microscopy of fluorescently tagged PSYs provided a glimpse into the carotenoid biosynthetic microenvironment in leaf mesophyll cells.

(51) PSYs are highly conserved in their amino acid sequence (See FIG. 4). Yet, small variations in a region that must be important for activity have been discovered. This region lies adjacent to a common signature motif found in isoprenoid synthases. These natural variants include variations in amino acid residues at positions 168 and 257 of PSY. See Example 3 and Table 1 below.

(52) As will be discussed below, .sub.zmPSY1 of B73 has the allele in yellow endosperm N.sub.168T.sub.257 or NT. If T.sub.257 is changed to proline, an NP variation is produced. If T.sub.257 is changed to a serine an NS variation is produced.

(53) It has been discovered that the effect of the NP variation on fibril formation occurred in etioplasts from a subpopulation of protoplasts found among the complex population of cell-types shown to exist in leaves. Whole-tissue carotenoid or proteomic extraction would otherwise have masked these perturbations on enzyme location and carotenoid accumulation taking place in subpopulations of cells.

(54) The present invention elucidates the physical location of a key pathway enzyme that must interface with a complex and dynamic metabolon in the context of the suborganellar architecture that is unique to plastid type in specific tissues. More importantly, it has been discovered that not all PSYs localize identically. This discovery serves as a source of caution and also opportunity for improving carotenoid targets needed, for example, to improve seed nutritional quality or plant stress resistance to address challenges of food security and biofuels in the face of global climate change.

(55) It has been discovered that PSY isozymes target to unique chloroplast suborganellar sites and small sequence variation and enzyme activity of PSY1 alters enzyme localization. This is the first time that PSYs have been localized to plastoglobules. Plastoglobuli are found in all plastids although their specific function is not well understood. Plastoglobuli range in size from 60-4000 nm and their composition varies depending on plastid type and plant source. In chloroplasts, plastoglobuli associate with thylakoids, while details of plastoglobular association in non-photosynthetic plastids are sparse.

(56) In general, plastoglobuli contain carotenoids, plastoquinones, tocopherols, and various proteins surrounded by a distinctively-composed lipid monolayer that is contiguous with the outer layer of the thylakoid lipid bilayer. Fibrilins, the major proteins of plastoglobuli, maintain the structure of the globules and assist in the globular-fibril transition to store high amounts of carotenoids synthesized during chromoplast development. Plastoglobuli also enlarge and proliferate in response to abiotic stress (e.g. high light, drought, salt, heat and nitrogen starvation). These stress conditions induce accumulation of carotenoids and/or their apocarotenoid products, and the expression of core plastoglobuli protein genes correlates with the expression of several enzymes from the carotenoid pathway. The importance of plastoglobuli in modulating plant metabolism is beginning to gain attention. Overexpression of the tocopherol cyclase VTE1, a plastoglobular enzyme, resulted in proliferation of plastoglobuli and an increased level of tocopherols.

(57) As a result of the herein invention, it has been discovered that activity of the overexpressed PSY1, with the naturally-occurring NP sequence variation, may exert an effect on fibrillar plastoglobule architecture, since the active enzyme caused plastoglobular fibril formation, which disappeared when the PSY active site was mutated. In both VTE1 and PSY1 cases, overexpression of plastoglobular-associated enzymes caused physical changes in the site of carotenoid sequestration. Taken together, increased levels of rate-controlling plastoglobule-located vitamin E and carotenoid biosynthesis enzymes might drive plastid structural changes needed to provide a sink for the hydrophobic biosynthetic pathway products.

(58) Establishment of PSY localization leads to the question of how and where the entire pathway is reconstituted. Carotenoids are found on envelope and thylakoid membranes, implying that either the pathway forms on two membrane sites or that carotenoids are transported by an unknown mechanism. Carotenoid metabolons (enzyme complexes) are predicted to exist on the basis of high molecular weight complexes containing PSY or other carotenoid enzymes. A recent study showed that the capacity for enzymes to interact was associated with enhanced carotenoid pathway activity. Metabolon-associated enzymes could facilitate substrate channeling, as has been suggested by the absence of carotenoid pathway intermediates, except in cases where the pathway is artificially blocked.

(59) It is significant that PSY1 with NT or SP combinations behaved similarly in localization, in contrast to NP which was shown to have a dramatic effect on plastid architecture.

(60) The present invention indicates that use of the NP variation may be more effective in enhancing production of carotenoids in certain tissues. For example, PSY1 is naturally expressed in etiolated tissue and known to provide thermal tolerance which is lost in plants that are unable to make PSY1. Indeed, if the NP variant is more effective in promoting carotenoids in etioplasts, this allelic variant could be valuable in selecting plants that are more resilient to climate change.

(61) As a result of the herein invention, it has been discovered that Arabidopsis PSY is localized to plastoglobules. Based on proteomics studies of Arabidopsis chloroplasts, PDS is on the envelope and thylakoid and ZDS is in the stroma. Together with PSY, it is possible to form a complex to produce prolycopene, a pathway intermediate. The absence of detectable prolycopene suggests that additional enzymes are recruited, but these are not detected by proteomics which may be due to limitations of the proteomics methodologies. In contrast to the enzyme localization seen in Arabidopsis chloroplasts, in chromoplasts, which exhibit an exaggerated developmental induction of carotenoid accumulation, the proteomics analysis revealed that most of the enzymes were found in plastoglobules. Therefore, the possibility exists that the complexes are forming in a dynamic fashion and recruited as needed.

(62) The present invention provides methods for increasing nutritional value in a plant or enhancing stress resistance to climate change in a plant by metabolic engineering of carotenoids in plants. There are known connections between induction of carotenoid enzymes and physical changes at the subcellular level. For example, morphological changes associated with carotenogenesis in development of chromoplasts include increases in fibrillins, plastoglobules, and biosynthetic enzymes. The different suborganellar localizations exhibited by allelic variants suggest that PSYs might be involved in mobilization of carotenoid pathway enzymes to mediate carotenogenesis at distinct locations, may control carotenogenesis by altered localization of PSY, and that localization of an active PSY may influence plastid ultrastructure. Clearly, not all PSYs behave identically, representing an opportunity for metabolic engineering or breeding with specific allelic variants.

Example 1: PSY Isozymes Exhibited Differential Locations in Maize Chloroplasts

(63) To investigate localization of phytoene synthase isozymes, PSYs from two cereal crops, maize and rice, and a classical model plant Arabidopsis were chosen. Both maize and rice have three PSY isozymes and .sub.zmPSY1, .sub.zmPSY2, .sub.zmPSY3 of Z. mays var. B73, and .sub.osPSY1, .sub.osPSY2 of O. sativa var. IR36 (Indica), and .sub.osPSY3 of O. sativa var TP309 were tested. Maize variety B73 has yellow colored kernels due to carotenoid accumulation in the endosperm mediated by .sub.zmPSY1 activity encoded by the maize yellow1 (y1) locus. Rice does not accumulate endosperm carotenoids. Arabidopsis has only one .sub.atPSY.

(64) The localization of PSYs was studied by transient expression of fluorescent protein fusions in plant leaf protoplasts. Protoplasts retain their tissue specificity after isolation, thereby reflecting in vivo conditions to observe localization of transiently expressed PSY proteins.

(65) The above approach provides a great advantage for studying PSY, a low abundance protein that otherwise escapes detection in proteomic studies. Protoplast sources were chosen in consideration of different stages of plastid development. Protoplasts both from dark-grown tissues (etiolated protoplasts), or light-grown tissues (green protoplasts) were isolated. Also, monocot maize leaves as a protoplast source for expression of PSYs from monocotyledonous species maize and rice, and dicot beans for experiments on PSY from dicotyledonous Arabidopsis were chosen. Each PSY protein together with its chloroplast target peptide was C-terminally fused to synthetic green fluorescent (sGFP) or red fluorescent (RFP) protein, and transient expression was monitored by confocal microscopy.

(66) To confirm reliability of the approach, proteins of known localization using protoplasts prepared from etiolated maize leaves were tested (FIG. 8). It was discovered that most, but not all, PSYs of all species studied were distributed in plastids the same way in both etiolated protoplasts (FIG. 1A), and green protoplasts (FIG. 1B), whether from monocots or dicots. These PSYs localized to chloroplasts in specific fixed speckles, distributed inside the plastid and attached to areas that displayed red chlorophyll fluorescence indicative of prolamellar bodies or thylakoids. The size and distribution of the speckles were suggestive of plastoglobuli: spherical lipid structures attached to thylakoid membranes of chloroplasts or distributed in chromoplast stroma. To define the nature of the speckles, transient expression with a protein from the fibrillin family was performed, since fibrillins are structural proteins of plastoglobuli. Maize plastoglobulin-2 (.sub.zmPG2) was identified by BLAST search as a homolog to several fibrillins from Arabidopsis (AT4G04020, AT4G22240, AT2G35490, 80%-90% sequence similarity). .sub.zmPG2 has a PAP-fibrillin domain, and is also homologous to the other Arabidopsis fibrillins of the superfamily (50-60% similarity). The isoelectric point (5.4) and hydrophobicity (GRAVY index, 0.142) of .sub.zmPG2 were similar to Arabidopsis fibrillin FBN4, which is a core protein of plastoglobuli, although minor amounts of FBN4 are also identified by proteomic studies in chloroplast stroma. .sub.zmPG2 was fused to RFP and expressed in bean and maize protoplasts (FIG. 2A). Indeed, in bean and maize green tissue protoplasts, the speckled pattern of .sub.zmPG2-RFP was identical to the speckled pattern of the majority of PSYs. However, in etioplasts .sub.zmPG2-RFP was distributed evenly throughout, suggesting a stromal localization for this fibrillin in dark-grown tissue. .sub.zmPSY2-GFP and .sub.zmPSY3-GFP along with .sub.zmPG2-RFP in green protoplasts was also expressed (FIG. 2B). The GFP signal of the PSYs was distributed in speckles together with the RFP signal of .sub.zmPG2. Merging of both signals confirmed co-localization of PSYs with .sub.zmPG2; thus, the speckles are considered to be plastoglobuli.

(67) .sub.zmPSY1-GFP stood alone from the group of other PSYs. In etioplasts, .sub.zmPSY1-GFP was distributed throughout, together with small bright (punctate) spots attached to membranes of red-fluorescent prolamellar bodies, very different in appearance from plastoglobuli in the case of all other PSYs. Homogeneous filling of plastids indicated a soluble, stromal location of .sub.zmPSY1. In light-grown tissue, .sub.zmPSY1-GFP was evenly distributed throughout the chloroplast. In chloroplasts, the association with membranes could not be seen, but should not be excluded due to limitations of image resolution.

Example 2: Import Experiments Confirmed Peripheral Membrane Binding of Chloroplast-Localized PSYs

(68) It has been discovered that by using transient expression, .sub.zmPSY2 and .sub.zmPSY3, as well as rice and Arabidopsis PSYs, localized to plastoglobuli structures, mostly attached to the surface of thylakoid membranes. Therefore, phytoene synthases were expected to associate with lipids/membranes. To confirm this, the three maize PSY isozymes were tested by chloroplast import assay. In vitro translated .sup.35S labeled .sub.zmPSY precursor proteins were imported into isolated pea chloroplasts, followed by chloroplast fractionation into three parts: soluble, membrane, and alkaline treated membrane (to purify from peripherally bound proteins) (FIG. 3).

(69) After import, chloroplasts were treated with thermolysin to remove unimported proteins. The unimported protein, seen in the import samples of .sub.zmPSY2 and .sub.zmPSY3 as an upper band, completely disappeared after thermolysin treatment, and only the imported mature protein remained, being protected by the envelope membrane (FIG. 3B, arrow). Fractionation of these chloroplasts revealed that .sub.zmPSY2 and .sub.zmPSY3 were peripherally bound to chloroplast membranes. These results are consistent with association of these proteins with plastoglobuli, as was suggested by transient expression in protoplasts.

(70) The results of chloroplast import of .sub.zmPSY2 and .sub.zmPSY3 were similar to .sub.osPSYs. In import experiments with pea chloroplasts, .sub.osPSYs are known to be associated with the membrane fraction (although alkaline treatment of the membrane fraction was not performed, the lack of integral membrane helices in the reported structural predictions of .sub.osPSYs suggested that they were likely to be peripherally bound).

(71) Compared to other PSYs, .sub.zmPSY1 from yellow endosperm maize behaved uniquely in the import experiments, just as we found for .sub.zmPSY1 localization in protoplasts. After thermolysin treatment, the envelope-associated precursor band disappeared as expected, leaving an undigested band of a mature protein 42 kDa (FIG. 3B, arrow). However, a smaller band 20 kDa appeared (FIG. 3B, star). This smaller peptide might be a part of .sub.zmPSY1 that is located within the membrane and therefore is protected from protease treatment. The pattern after the thermolysin treatment looked similar to one of the integral proteins from the outer chloroplast membrane, Toc34. The inter-membrane and periplasm facing domains of Toc34 remained untouched by thermolysin. Fractionation of chloroplasts showed that .sub.zmPSY1 is peripherally associated with membranes as found for the other PSYs.

(72) Altogether, the results indicate that .sub.zmPSY1 was somehow localized to chloroplasts in two forms. One form of .sub.zmPSY1 is bound to the envelope membrane. A second form of .sub.zmPSY1 is peripherally bound to thylakoids. The peripheral membrane association of .sub.zmPSY1 agrees with the results of transient expression in etiolated protoplasts, where punctate spots of .sub.zmPSY1-GFP were observed around prolamellar bodies.

Example 3: Single Amino Acid Variants Displayed Altered PSY1 Localization and Transformed Plastid Architecture

(73) Transient expression and import experiments suggested that almost all investigated PSYs were localized to plastoglobuli, regardless of whether the plants were grown in light or dark. .sub.zmPSY1 was unique and exhibited dual localization to stroma and attached to membranes, as clearly seen in etioplasts (FIG. 1). Next, protein features responsible for differences in localization were identified. PSYs (FIG. 4), and searched for amino acids that are shared by all PSYs except for .sub.zmPSY1 from yellow endosperm maize were aligned. A striking difference was found in the highly conserved coding region, at amino acid residue 257 which was a threonine (T.sub.257) in .sub.zmPSY1, as compared to proline (P) in other PSYs. Another position, 168, was occupied by asparagine in .sub.zmPSY1 (N.sub.168), in contrast with serine (S) in all other PSYs. BLAST alignment of .sub.zmPSY1 from yellow endosperm maize line B73 used in the experiments, against other PSY sequences available from the NCBI database, showed that T.sub.257 was characteristic for .sub.zmPSY1 from 99% of the 79 maize varieties with yellow endosperm. In addition, T.sub.257 was found in 30% of the 50 maize lines with white endosperm and two species of teosinte, the wild ancestor of maize which has the ancestral characteristic of white endosperm. 70% of white maize varieties had either P.sub.257 or S.sub.257; PSYs from all other plants carried proline at the corresponding position. N.sub.168 was found in .sub.zmPSY1 from all maize varieties, as well as in PSY of teosinte and some grass species; PSYs from other plants carried serine at the corresponding position (FIG. 5).

(74) More detailed analysis of PSY1 sequences from maize and other grasses revealed that indeed, the only difference between .sub.zmPSY1 amino acid sequences from yellow and white endosperm varieties and teosinte, was T/P/S.sub.257. We also found some sequence differences within the chloroplast transit peptide around positions 52-55 (not shown). Since the transit peptide is processed after chloroplast import and does not affect enzyme activity, it was not included in this study.

(75) To test if amino acids in positions 168 and 257 are important for localization, a set of variants was generated from .sub.zmPSY1 of B73 (for which the allele in yellow endosperm is N.sub.168T.sub.257 or NT): with one amino acid change of N.sub.168 to serine (.sub.zmPSY1-ST) and an independent or additional change of T.sub.257 to proline or serine (.sub.zmPSY1-NP, .sub.zmPSY1-NS, and .sub.zmPSY1-SP). In addition, sites corresponding to 168 and 257, in .sub.zmPSY2 and .sub.osPSY1 (see Table 1 for explanation of all PSY variants) were mutated. PSY variant cDNAs were fused with GFP and expressed in maize protoplasts from both etiolated (FIG. 6) and green tissues (not shown). With the exception of .sub.zmPSY1-NP, the stromal location of .sub.zmPSY1 GFP-fusions was unchanged. Also, all .sub.zmPSY2 and .sub.osPSY1 variants retained localization phenotype to plastoglobuli (not shown) as seen for the progenitor maize PSY2 or rice PSY1 proteins.

(76) The striking exception was seen in etiolated protoplasts, where .sub.zmPSY1-NP, naturally found in some white varieties and teosinte, showed a surprising localization phenotype. In plastids of 30% of transformed protoplasts, .sub.zmPSY1-NP-GFP formed unusual spikes, which stretched chloroplasts from inside causing a remarkable morphological change of plastid shape, from round elliptical to diamond with sharp corners where spikes touched the envelope membrane (FIG. 6 and FIG. 9). In the remaining 70% of protoplasts, .sub.zmPSY1-NP-GFP was localized to stroma, similar to the phenotype exhibited by the progenitor yellow endosperm .sub.zmPSY1. That is, a single residue change in the PSY1 protein altered PSY localization and plastid morphology. Remarkably, the double mutation of .sub.zmPSY1-SP-GFP (where both 168 and 257 sites were mutated) restored stromal localization as exhibited by the progenitor .sub.zmPSY1. The secondary mutation N.sub.168 to S.sub.168 appeared to counteract the effect of the single mutation T.sub.257 to P.sub.257. Interestingly, when .sub.zmPSY1-NP-GFP was expressed in protoplasts from green seedlings, no fluorescent spikes or drastic morphological change in plastid shape was observed; the phenotype was the same as found with .sub.zmPSY1 (FIG. 1B). The dramatic effect of the single residue change was only apparent in non-photosynthetic plastids.

(77) To exclude the possible effect of the endogenous parent .sub.zmPSY1 on localization pattern of overexpressed .sub.zmPSY1, different PSY-GFP constructs in protoplasts of the y1-8549 maize line which lacks PSY1 were also expressed, and found no difference in localization of proteins to compare to ones in the B73 maize line (FIG. 10).

(78) The fluorescent spikes observed in .sub.zmPSY1-NP-GFP expression experiments were similar to fibrils seen in carotenoid-rich chromoplasts of Solanum capsicastrum. In Solanum, such fibrillar plastoglobuli initiate from globular plastoglobuli. This morphogenic change is observed together with an increase in carotenoid concentration, although it is unknown what triggers fibril formation. Capacity to accumulate large quantities of carotenoids is characteristic of non-photosynthetic plastids. For example, constitutive overexpression of .sub.atPSY in Arabidopsis resulted in carotenoid bar-shaped crystals (spikes) formed in non-photosynthetic plastids of roots, while no changes were observed in photosynthetic tissues. Similarly, fibrils in green protoplasts were not observed, which might be explained by alternative mechanisms of carotenoid sequestration in chloroplasts as compared to non-photosynthetic plastids. Thus, the results indicate that .sub.zmPSY1-NP was located in fibrillar plastoglobuli, which initiate from globular plastoglobuli in the presence of high concentrations of carotenoids. The presence of carotenoids in fibrils was supported by the use of Spectral Dye Separation tool in LAS AF software (Leica), applied to the fluorescence intensity spectra of .sub.zmPSYs-GFP constructs expressed in protoplasts prepared from etiolated leaves of .sub.zmPSY1-knockout maize (FIG. 11). The Spectral Dye Separation tool extracted fluorescence of carotenoids from total fluorescence in fibrils (or plastoglobuli, as positive control) of transformed protoplasts, suggesting the presence of carotenoids in those locations.

(79) If fibrils formed as a consequence of high carotenoid production from over-expressed PSY, then inactivation of .sub.zmPSY1-NP-GFP would be predicted to eliminate fibril formation. To test this, the enzyme was inactivated by mutagenesis of the active site. The choice of the active site was based on structural homology of .sub.zmPSY1 to squalene synthase (SQS), as predicted online by Structure Prediction Meta Server. SQS has a similar catalytic mechanism to PSY and a known crystal structure. The PSY active site and other regions critical for enzyme activity are highly conserved among PSY/SQS family members. Meta Server gave a significant 3D-Jury score of 211 (>50 is considered significant) regarding structural similarity between PSY and SQS.

(80) Predicted structural similarities between PSYs and SQS are presented in FIG. 4. Mutagenesis of either of two highly conserved aspartate residues 219 and 223 to glutamate inactivates SQS. Thus, the corresponding aspartate residue 285 to glutamate was mutagenized and .sub.zmPSY1 (Table 1) was inactivated, which was confirmed by testing for functional complementation in E. coli. When the inactive enzyme .sub.zmPSY1-NP-E-GFP was inactivated in etiolated protoplasts, the plastid morphology was now normal, fibrils no longer formed, and the inactive enzyme showed a stromal localization as found for the active, progenitor enzyme, .sub.zmPSY1 (FIG. 6).

(81) The Spectral Dye separation tool showed no carotenoid fluorescence signal when protoplasts expressed the inactive enzyme .sub.zmPSY-NP-E as compared to the positive signal obtained from protoplasts expressing the active enzyme .sub.zmPSY-NP (FIG. 11). Thus, it is concluded that increased local carotenoid concentration, causing fibril spikes and plastid morphological change, was due to PSY1 enzyme activity.

Example 4: Computer Modeling of PSY Structures Provided Insight into Localization Phenotypes of Mutant Enzymes

(82) It was expected that changes in the localization phenotype of .sub.zmPSY1-NP (compared to .sub.zmPSY1 and .sub.zmPSY1-NP-E) were related to structural changes in the protein. To study the effect of various residues at positions 168 and 257 on structure of .sub.zmPSY1, we used the computational methods of structural homology modeling and molecular modeling. Homology modeling provided initial structural predictions for .sub.zmPSY1 (NT), .sub.zmPSY1-NP and .sub.zmPSY1-SP. Selected structural predictions resulting from our homology modeling calculations were then subjected to minimization and molecular dynamics techniques (see methods) to derive our final predicted structures. We aligned the latter two structural predictions against that of our predicted structure of .sub.zmPSY1. The aligned structures of the T.sub.257 and P.sub.257 variants of .sub.zmPSY1 (FIG. 7A) clearly showed that the overall structure of the enzyme is preserved, in particular the length and relative positions of alpha helices, with some perturbations in a few of the loop domains. The overall root mean square deviation (RMSD) between the two structures was 3.8 angstroms (FIG. 7B, red line). Most notable was the large variation in the loop region around residue 184. The loop is located in close proximity to the .sub.159DELVD.sub.163 (SEQ ID NO: 144) region of the enzyme (FIG. 7A), which together with .sub.285DVGED.sub.289 (SEQ ID NO: 145) is a conserved sequence among isoprenoid synthases, and forms an active site to bind phosphate groups of a substrate. The deviation between RMSD values of .sub.zmPSY1 and .sub.zmPSY1-NP at this region was noted to be significantly larger than 3.8 angstroms. The difference between .sub.zmPSY1 and .sub.zmPSY1-SP (FIG. 7B, green line) in the same region, however, was not significant when taking into account the overall average RMSD values difference across the entire protein. This observation suggested that the structure of .sub.zmPSY1-SP was similar to .sub.zmPSY1. The similar structure was consistent with the common stromal localization of these two proteins.

(83) This modeling predicted that a change of threonine to proline at position 257 will cause remote structural alterations in PSY1 in the loop region around residue 184, where several mutations were shown to affect PSY activity. For example, a change of the amino acid corresponding to A174 to D increased PSY activity in cassava, while mutagenesis of the amino acid corresponding to P190 to L decreased the activity of PSY1 in tomato (all residue numbers are relative to .sub.zmPSY1, and shown in FIG. 4 and FIG. 7B in blue).

(84) Thus, as a result of the present invention, it has been shown that a single specific amino acid alteration could have functional and/or localization consequences. The change in residue at critical locations such as at position 257 could change protein folding at a location remote and thus either affect activity of the enzyme by altering substrate affinity, or affect interaction with an upstream enzyme that provides the PSY substrate. Indeed, the T.sub.257 to P.sub.257 mutation in the PSY1-GFP fusion caused formation of spikes and altered plastid morphology. A second amino acid change at S.sub.168 (S.sub.168P.sub.257), however, was able to counteract the structural perturbations caused by P.sub.257, restoring the structure and specific features of the progenitor .sub.zmPSY1. Therefore, PSYs with NT or SP are predicted to be structurally similar whereas NP is predicted to cause a structural perturbation.

(85) TABLE-US-00001 TABLE 1 PSY variants used in transient expression experiments. Numbers of amino acids are actual numbers in PSY amino acid sequences. Plastid localization is based on the PSY GFP-fusion experiments. Abbreviations: zm, maize; os, rice; at,Arabidopsis. PSY Amino Test of variant acid Is this a naturally found activity in Plastid name variation variant? E. coli localization Maize .sub.zmPSY1 N.sub.168; T.sub.257 Yes, yellow endosperm active Stroma/spots lines including B73, and some white endosperm lines .sub.zmPSY1-NP N.sub.168; P.sub.257 Yes, white endosperm lines active fibrils .sub.zmPSY1-NS N.sub.168; S.sub.257 Yes, white endosperm lines stroma .sub.zmPSY1-NP-E N.sub.168; P.sub.257; no inactive stroma E.sub.285 .sub.zmPSY1-SP S.sub.168; P.sub.257 no stroma .sub.zmPSY1-ST S.sub.168; T.sub.257 no stroma .sub.zmPSY2 S.sub.168; P.sub.257 yes active.sup.1 plastoglobuli .sub.zmPSY2-ST S.sub.168; T.sub.257 no plastoglobuli .sub.zmPSY2-NP N.sub.168; P.sub.257 no plastoglobuli .sub.zmPSY2-NT N.sub.168; T.sub.257 no plastoglobuli .sub.zmPSY3 S.sub.176; P.sub.265 yes active.sup.3 plastoglobuli Rice .sub.osPSY1 S.sub.179; P.sub.268 yes active.sup.1 plastoglobuli .sub.osPSY1-ST S.sub.179; T.sub.268 no plastoglobuli .sub.osPSY2 S.sub.163; P.sub.253 yes active.sup.1 plastoglobuli Arabidopsis .sub.atPSY S.sub.181; P.sub.270 yes active.sup.2 plastoglobuli

(86) TABLE-US-00002 TABLE2 Plasmidsandprimersusedforcloning SEQID Restrictionsites Plasmid NO: Primersusedforcloning usedforcloning pTnT-.sub.zmPSY1 51 F5 TCTCGAGATGGCCATCATACTCGTACGAG XhoI/XbaI 52 R5 ATCTAGACTAGGTCTGGCCATTTCTCAATG pTnT-.sub.zmPSY2 53 F5 ACTCGAGAATGGCTGCGGGCTCGTCCG XhoI/NotI 54 R5 GATGTGATCTACGGATGGTTCAT pTnT-.sub.zmPSY3 55 F5 AAGAATTCGCCACCATGATGTCTACGAGC EcoRI+ Kozak 56 R5 AAGCGGCCGCCTATGTTAGGGTGGAATAGC sequence, NotI pUC35S-.sub.zmPSY1-sGFP-Nos 57 F5 TTCTAGAATGGCCATCATACTCGTACGAG XbaI/BamHI 58 R5 AGGATCCGGTCTGGCCATTTCTCAATGAA pUC35S-.sub.zmPSY2-sGFP-Nos 59 F5 ATCTAGAATGGCTGCGGGCTCGTCC XbaI/BamHI 60 R5 AGGATCCTGGTGCAACCGCAGCCCTTGCA pUC35S-.sub.zmPSY3-sGFP-Nos 61 F5 ATCTCTAGAATGATGTCTACGAGCCGCGCGGTGAAGTCG XbaI/BamHI 62 R5 ATCGGATCCTGTTAGGGTGGAATAGCGTCTCCGGCTC pUC35S-.sub.osPSY1-sGFP-Nos 63 F5 ATCTAGAATGGCCCATCACGCTCCTAC XbaI/BgII 64 R5 AAGATCTCTTCTGGCTATTTCTCAGTGAG pUC35S-.sub.osPSY2-sGFP-Nos 65 FS AACTAGTTCCACACGAACACACAACCCCAA SpeI/BgII 66 R5 AAGATCTTGATGCAACTGCCGCTCTTGCATA pUC35S-LHCP-sGFP-Nos 67 F5 ATCTCTAGAATGGCCGCTTCATCC XbaI/BamHI 68 R5 ATCGGATCCCTTTCCGGGAACAAAGTTGGTAGC pSAT-.sub.atPSY-RFP 69 F5 ATCGAATTCATGTCTTCTTCTGTAGCAGTG EcoRI/BamHI 70 R5 ATTGGATCCGTATCGATAGTCTTGAACTTG pSAT-.sub.zmPG2-RFP 71 F5 ATCGAATTCATGGCMCCTCCGCGTTCCTCAACG EcoRI/BcII 72 R5 ATCTGATCAGGTATAGAAGAGTACTTCCC pUC35S-.sub.zmPSY1-NP-sGFP-Nos 73 F5 CCTGTGATGGGCATCGCACCCGAGTCTAAAG 74 R5 CTTTAGACTCGGGTGCGATGCCCATCACAGG pUC35S-.sub.zmPSY1-SP-sGFP-Nos 75 F5 CCTGTGATGGGCATCGCACCCGAGTCTAAAG 76 R5 CTTTAGACTCGGGTGCGATGCCCATCACAGG 77 F5 GATGGGCCAAACGCCAGCTACATTACACCAACAG 78 R5 CTGTTGGTGTAATGTAGCTSGCGTTTGGCCCATC pUC35S-.sub.zmPSY1-NS-sGFP-Nos 79 F5 CCTGTGATGGGCATCGCATCCGAGTCTAAAG 80 R5 CTTTAGACTCGGATGCGATGCCCATCACAGG pUC35S-.sub.zmPSY1-ST-sGFP-Nos 81 F5 GATGGGCCAAACGCCAGCTACATTACACCAACAG 82 R5 CTGTTGGTGTAATMAGOGGCGTTTGGCCCATC pUC35S-.sub.zmPSY2-ST-sGFP-Nos 83 F5 CCTGTCATGGGCATCGCTACCGACTCCAA 84 R5 TTGGAGTCGGTAGCGATGCCCATGACAGG pUC35S-.sub.zmPSY2-NT-sGFP-Nos 85 F5 CCTGTCATGGGCATCGCTACCGACTCCAA 86 R5 TTGGAGTCGGTAGCGATGCCCATGACAGG 87 F5 GACGGTCCCAACGCGAACTACATCACGCCGAC 88 R5 GTCGGCGTGATGTAGTTCGCGTTGGGACCGTC pSAT-.sub.zmPSY2-NP-RFP 89 F5 GACGGTCCCAACGCGAACTACATCACGCCGAC 90 R5 GTCGGCGTGATGTAGTTCGCGTTGGGACCGTC pUC35S-.sub.osPSY1-NT-sGFP-Nos 91 F5 GTTCCTGTGATGGGTATTGCAACCGAGTCGAAG 92 R5 5 CTTCGACTCGGTTGCAATACCCATCACAGGAAC pBS-.sub.zmPSY1-NP 93 F5 CCTGTGATGGGCATCGCACCCGAGTCTAAAG 94 R5 CTTTAGACTCGGGTGCGATGCCCATCACAGG pBS-.sub.zmPSY1-D.sub.285E 95 F5 CGAACATACTCCGGGAGGTTGGAGAGGATGCTA 96 R5 TAGCATCCTCTCCAACCTCCCGGAGTATGTTCG pUC35S-.sub.zmPSY1-NP-E-sGFP-Nos 97 F5 CGAACATACTCCGGGAGGTTGGAGAGGATGCTA 98 R5 TAGCATCCTCTCCAACCTCCCGGAGTATGTTCG 99 F5 CCTGTGATGGGCATCGCACCCGAGTCTAAAG 100 R5 CTTTAGACTCGGGTGCGATGCCCATCACAGG

SEQUENCE LISTING

(87) The instant application contains a Sequence Listing which has been submitted electronically in computer-readable ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on Jul. 16, 2015, is named 1038-77PCT0US_SL.txt and is 64,198 bytes in size.