PRODUCTS AND METHODS FOR INHIBITION OF EXPRESSION OF DYNAMIN-1 VARIANTS
20220333115 · 2022-10-20
Inventors
Cpc classification
C12N2320/32
CHEMISTRY; METALLURGY
A61K31/713
HUMAN NECESSITIES
C12N2750/14143
CHEMISTRY; METALLURGY
C12N15/1138
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
International classification
C12N15/113
CHEMISTRY; METALLURGY
A61K31/713
HUMAN NECESSITIES
Abstract
RNA interference-based methods and products for inhibiting the expression of pathogenic dynamin-1 variants are provided. Delivery vehicles such as recombinant adeno-associated viruses deliver DNAs encoding RNAs that inhibit the expression of the dynamin-1 variants. The methods treat, for example, developmental and epileptic encephalopathies.
Claims
1. A nucleic acid comprising (a) a nucleic acid comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the dynamin-1 (DNM1) artificial inhibitory RNA-encoding polynucleotide sequence set forth in any one of SEQ ID NOs: 1-17; (b) a nucleic acid encoding a DNM1 artificial inhibitory RNA comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the artificial inhibitory RNA polynucleotide sequence set forth in any one of SEQ ID NOs: 18-34, or (c) a nucleic acid encoding a DNM1 antisense guide strand comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the antisense guide strand polynucleotide sequence set forth in any one of SEQ ID NO: 35-51.
2. A viral vector comprising the nucleic acid of claim 1 or a combination of any one or more thereof.
3. The viral vector of claim 2, wherein the viral vector is an adeno-associated virus (AAV), adenovirus, lentivirus, retrovirus, poxvirus, baculovirus, herpes simplex virus, vaccinia virus, or a synthetic virus.
4. The viral vector of claim 3, wherein the viral vector is an AAV.
5. The viral vector of claim 4, wherein the AAV lacks rep and cap genes.
6. The viral vector of claim 4, wherein the AAV is a recombinant AAV (rAAV) or a self-complementary recombinant AAV (scAAV).
7. The viral vector of claim 4, wherein the AAV has a capsid serotype of: AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, AAV-13, AAV-anc80, or AAV rh.74.
8. The viral vector of claim 7, wherein the AAV has a capsid serotype of AAV-9.
9. The viral vector of claim 4, wherein the AAV is a pseudotyped AAV.
10. The viral vector of claim 9, wherein the AAV is AAV2/8 or AAV2/9.
11. The viral vector of claim 2, wherein expression of the nucleic acid encoding the DNM1 artificial inhibitory RNA is under the control of a U6 promoter.
12. A composition comprising the nucleic acid of claim 1 and a pharmaceutically acceptable carrier.
13. A composition comprising the viral vector of claim 2 and a pharmaceutically acceptable carrier.
14. A composition comprising a delivery vehicle capable of delivering agents to a neuron and a nucleic acid encoding an artificial inhibitory RNA, wherein the artificial inhibitory RNA binds a segment of a messenger RNA (mRNA) encoded by a dynamin-1 (DNM1) gene, and, optionally, a pharmaceutically acceptable carrier.
15. The composition of claim 14, wherein the DNM1 gene comprises the human exon sequence of SEQ ID NO: 52 or 53, or a variant thereof comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, identity to the sequence of SEQ ID NO: 52 or 53.
16. The composition of claim 14, wherein the delivery vehicle is a viral vector.
17. The composition of claim 16, wherein the viral vector is an adeno-associated virus (AAV), adenovirus, lentivirus, retrovirus, poxvirus, baculovirus, herpes simplex virus, vaccinia virus, or a synthetic virus.
18. The composition of claim 17, wherein the viral vector is an AAV.
19. The composition of claim 18, wherein the AAV lacks rep and cap genes.
20. The composition of claim 19, wherein the AAV is a recombinant AAV (rAAV), a recombinant single-stranded AAV (ssAAV), or a self-complementary recombinant AAV (scAAV).
21. The composition of claim 18, wherein the AAV has a capsid serotype selected from the group consisting of: AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, AAV-13, AAV-anc80, and AAV rh.74.
22. The composition of claim 21, wherein the AAV has a capsid serotype of AAV-9.
23. The composition of claim 18, wherein the AAV is a pseudotyped AAV.
24. The composition of claim 23, wherein the AAV is AAV2/8 or AAV2/9.
25. The composition of claim 12, wherein expression of the nucleic acid encoding the DNM1 artificial inhibitory RNA is under the control of a U6 promoter.
26. A method of delivery to a neuron with a dynamin-1 (DNM1) gene, the method comprising administering to a subject with the neuron: (a) the nucleic acid of claim 1; (b) the vector of claim 2; or (c) the composition of claim 12.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0031] This patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the United States Patent and Trademark Office upon request and payment of the necessary fee.
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
STATISTICAL ANALYSIS RELATING TO THE FIGURES
[0041] Statistical analysis was done using either Prism 8 software (GraphPad, Inc), JMP 14 software (JMP, Inc), depending on the test. qPCR data (
DETAILED DESCRIPTION
[0042] The products and methods described herein are used in the treatment of diseases associated with a pathogenic DNM1 isoform. Diseases associated with DNM1 include, for example, DEEs. DEEs include, but are not limited to, Lennox-Gastout Syndrome and Infantile Spasms.
[0043] At least twenty heterozygous de novo variants identified in thirty-three patients predominantly in the critical GTPase and the middle domains of the DNM1 are described in EuroEPINOMICS-RES Consortium, Am. J. Hum. Genet., 100: 179 (2017); Asinof (2015), supra; von Spiczak, supra; Brereton et al., Mol. Genet. Genomic Med., 6: 294-300 (2018); Kolnikova et al., Seizure, 56: 31-33 (2018); and Li et al., Front. Pharmacol., 10: 1454, (2019).
[0044] A nucleic acid encoding human DNM1 exon 10a is set forth in SEQ ID NO: 52. A nucleic acid encoding human DNM1 exon 10b is set forth in SEQ ID NO: 53. Various products and methods of the disclosure can target variants of the human DNM1 nucleotide sequence set forth in SEQ ID NO: 52 or 53. The variants can exhibit 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71%, and 70% identity to the nucleotide sequence set forth in SEQ ID NO: 52 or 53.
[0045] A nucleic acid encoding mouse DNM1 exon 10a is set forth in SEQ ID NO: 54. A nucleic acid encoding mouse DNM1 exon 10b is set forth in SEQ ID NO: 54. Various products and methods of the disclosure can target variants of the nucleotide sequence set forth in SEQ ID NO: 54 or 55. The variants can exhibit 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71%, and 70% identity to the nucleotide sequence set forth in SEQ ID NO: 54 or 55.
[0046] The disclosure includes the use of RNA interference to inhibit or interfere with the expression of DNM1 to ameliorate and/or treat subjects with diseases or disorders resulting from overexpression of DNM1. RNA interference (RNAi) is a mechanism of gene regulation in eukaryotic cells that has been considered for the treatment of various diseases. RNAi refers to post-transcriptional control of gene expression mediated by inhibitory RNAs. The inhibitory RNAs are small (21-25 nucleotides in length), noncoding RNAs that share sequence homology and base-pair with cognate messenger RNAs (mRNAs). The interaction between the inhibitory RNAs and mRNAs directs cellular gene silencing machinery to prevent the translation of the mRNAs. The RNAi pathway is summarized in Duan (Ed.), Section 7.3 of Chapter 7 in Muscle Gene Therapy, Springer Science+Business Media, LLC (2010).
[0047] As an understanding of natural RNAi pathways has developed, researchers have designed artificial inhibitory RNAs for use in regulating expression of target genes for treating disease. Several classes of small RNAs are known to trigger RNAi processes in mammalian cells [Davidson et al., Nat. Rev. Genet., 12:329-40 (2011); Harper, Arch. Neurol., 66:933-938 (2009)]. Artificial inhibitory RNAs expressed in vivo from plasmid- or virus-based vectors and may achieve long term gene silencing with a single administration, for as long as the vector is present within target cell nuclei and the driving promoter is active [Davidson et al., Methods Enzymol., 392:145-73, (2005)]. Importantly, this vector-expressed approach leverages the decades-long advancements already made in the muscle gene therapy field, but instead of expressing protein coding genes, the vector cargo in RNAi therapy strategies are artificial inhibitory RNAs targeting disease genes-of-interest.
[0048] An shRNA is an artificial RNA molecule with a tight hairpin turn that can be used to silence target gene expression via RNA interference (RNAi). shRNA is an advantageous mediator of RNAi in that it has a relatively low rate of degradation and turnover, but it requires use of an expression vector. Once the vector has transduced the host genome, the shRNA is then transcribed in the nucleus by polymerase II or polymerase III, depending on the promoter choice. The product mimics pri-microRNA (pri-miRNA) and is processed by Drosha. The resulting pre-shRNA is exported from the nucleus by Exportin 5. This product is then processed by Dicer and loaded into the RNA-induced silencing complex (RISC). The sense (passenger) strand is degraded. The antisense (guide) strand directs RISC to mRNA that has a complementary sequence. In the case of perfect complementarity, RISC cleaves the mRNA. In the case of imperfect complementarity, RISC represses translation of the mRNA. In both of these cases, the shRNA leads to target gene silencing.
[0049] The disclosure includes the production and administration of viral vectors expressing artificial DMN1 inhibitory RNAs. The expression of the artificial DMN1 inhibitory RNAs is regulated by the use of various promoters. The disclosure contemplates use of polymerase III promoters, such as U6 and H1 promoters, or polymerase II promoters.
[0050] The products and methods provided herein can comprise miRNA shuttles to modify DNM1 expression (e.g., knockdown or inhibit expression). Like shRNAs, miRNA shuttles are expressed intracellularly from DNA transgenes. miRNA shuttles typically contain natural miRNA sequences required to direct correct processing, but the natural, mature miRNA duplex in the stem is replaced by the sequences specific for the intended target transcript (e.g., as shown in
[0051] The disclosure provides sequences encoding miDNM1s to inhibit the expression of the DNM1 gene. The disclosure provides a nucleic acid encoding a miDNM1 comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the full length miDNM! polynucleotide sequence set forth in any one of SEQ ID NOs: 18-34. The disclosure provides a nucleic acid encoding a miDNM1 processed antisense guide strand comprising at least about 70%, 75, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the antisense guide strand polynucleotide sequence set forth in any one of SEQ ID NOs: 35-51.
[0052] The disclosure provides a nucleic acid encoding a miDNM1 comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the polynucleotide sequence set forth in any one of SEQ ID NOs: 1-17.
[0053] Exemplary miDNM1s comprise the polynucleotide sequence set out in any one or more of SEQ ID NOs: 18-34, or a variant thereof comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to any one of SEQ ID NOs 18-34. Final processed guide strand sequences corresponding to SEQ ID NOs: 18-34 are respectively set out in SEQ ID NOs: 35-51. The disclosure additionally provides the antisense guide strands set out in Figure ? and contemplates variants of each of those antisense guide strands that are at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical.
[0054] The disclosure contemplates polynucleotides encoding one or more copies of these sequences are combined into a single delivery vehicle, such as a vector. Thus, the disclosure includes vectors comprising a nucleic acid of the disclosure or a combination of nucleic acids of the disclosure. Provided are viral vectors (such as adeno-associated virus (AAV), adenovirus, retrovirus, lentivirus, equine-associated virus, alphavirus, pox virus, herpes virus, herpes simplex virus, polio virus, sindbis virus, vaccinia virus or a synthetic virus, e.g., a chimeric virus, mosaic virus, or pseudotyped virus, and/or a virus that contains a foreign protein, synthetic polymer, nanoparticle, or small molecule) to deliver the nucleic acids disclosed herein. AAV vectors are exemplified.
[0055] Adeno-associated virus (AAV) is a replication-deficient parvovirus, the single-stranded DNA genome of which is about 4.7 kb in length including 145 nucleotide inverted terminal repeat (ITRs). There are multiple serotypes of AAV. The nucleotide sequences of the genomes of the AAV serotypes are known. For example, the complete genome of AAV-1 is provided in GenBank Accession No. NC_002077; the complete genome of AAV-2 is provided in GenBank Accession No. NC_001401 and Srivastava et al., J. Virol., 45: 555-564 (1983); the complete genome of AAV-3 is provided in GenBank Accession No. NC_1829; the complete genome of AAV-4 is provided in GenBank Accession No. NC_001829; the AAV-5 genome is provided in GenBank Accession No. AF085716; the complete genome of AAV-6 is provided in GenBank Accession No. NC_001862; at least portions of AAV-7 and AAV-8 genomes are provided in GenBank Accession Nos. AX753246 and AX753249, respectively; the AAV-9 genome is provided in Gao et al., J. Virol., 78: 6381-6388 (2004); the AAV-10 genome is provided in Mol. Ther., 13(1): 67-76 (2006); the AAV-11 genome is provided in Virology, 330(2): 375-383 (2004); portions of the AAV-12 genome are provided in Genbank Accession No. DQ813647; portions of the AAV-13 genome are provided in Genbank Accession No. EU285562. The sequence of the AAV rh.74 genome is provided in see U.S. Pat. No. 9,434,928, incorporated herein by reference. The sequence of the AAV-B1 genome is provided in Choudhury et al., Mol. Ther., 24(7): 1247-1257 (2016). Cis-acting sequences directing viral DNA replication (rep), encapsidation/packaging and host cell chromosome integration are contained within the AAV ITRs. Three AAV promoters (named p5, p19, and p40 for their relative map locations) drive the expression of the two AAV internal open reading frames encoding rep and cap genes. The two rep promoters (p5 and p19), coupled with the differential splicing of the single AAV intron (at nucleotides 2107 and 2227), result in the production of four rep proteins (rep 78, rep 68, rep 52, and rep 40) from the rep gene. Rep proteins possess multiple enzymatic properties that are ultimately responsible for replicating the viral genome. The cap gene is expressed from the p40 promoter and it encodes the three capsid proteins VP1, VP2, and VP3. Alternative splicing and non-consensus translational start sites are responsible for the production of the three related capsid proteins. A single consensus polyadenylation site is located at map position 95 of the AAV genome. The life cycle and genetics of AAV are reviewed in Muzyczka, Current Topics in Microbiology and Immunology, 158: 97-129 (1992).
[0056] AAV possesses unique features that make it attractive as a vector for delivering foreign DNA to cells, for example, in gene therapy. AAV infection of cells in culture is noncytopathic, and natural infection of humans and other animals is silent and asymptomatic. Moreover, AAV infects many mammalian cells allowing the possibility of targeting many different tissues in vivo. Moreover, AAV transduces slowly dividing and non-dividing cells, and can persist essentially for the lifetime of those cells as a transcriptionally active nuclear episome (extrachromosomal element). The AAV proviral genome is infectious as cloned DNA in plasmids which makes construction of recombinant genomes feasible. Furthermore, because the signals directing AAV replication, genome encapsidation and integration are contained within the ITRs of the AAV genome, some or all of the internal approximately 4.3 kb of the genome (encoding replication and structural capsid proteins, rep-cap) may be replaced with foreign DNA. The rep and cap proteins may be provided in trans. Another significant feature of AAV is that it is an extremely stable and hearty virus. It easily withstands the conditions used to inactivate adenovirus (56 to 65° C. for several hours), making cold preservation of AAV less critical. AAV may even be lyophilized. Finally, AAV-infected cells are not resistant to superinfection.
[0057] As exemplified herein, the AAV vector lacks rep and cap genes. The AAV can be a recombinant AAV (rAAV) or a self-complementary recombinant AAV (scAAV). The AAV has a capsid serotype can be from, for example, AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, AAV-13, AAV-anc80, AAV rh.74, AAV rh.8, or AAVrh.10.
[0058] Viral vectors provided include, for example, AAV1 (i.e., an AAV containing AAV1 inverted terminal repeats (ITRs) and AAV1 capsid proteins), AAV2 (i.e., an AAV containing AAV2 ITRs and AAV2 capsid proteins), AAV3 (i.e., an AAV containing AAV3 ITRs and AAV3 capsid proteins), AAV4 (i.e., an AAV containing AAV4 ITRs and AAV4 capsid proteins), AAV5 (i.e., an AAV containing AAV5 ITRs and AAV5 capsid proteins), AAV6 (i.e., an AAV containing AAV6 ITRs and AAV6 capsid proteins), AAV7 (i.e., an AAV containing AAV7 ITRs and AAV7 capsid proteins), AAV8 (i.e., an AAV containing AAV8 ITRs and AAV8 capsid proteins), AAV9 (i.e., an AAV containing AAV9 ITRs and AAV9 capsid proteins), AAVrh74 (i.e., an AAV containing AAVrh74 ITRs and AAVrh74 capsid proteins), AAVrh.8 (i.e., an AAV containing AAVrh.8 ITRs and AAVrh.8 capsid proteins), AAVrh.10 (i.e., an AAV containing AAVrh.10 ITRs and AAVrh.10 capsid proteins), AAV11 (i.e., an AAV containing AAV11 ITRs and AAV11 capsid proteins), AAV12 (i.e., an AAV containing AAV12 ITRs and AAV12 capsid proteins), or AAV13 (i.e., an AAV containing AAV13 ITRs and AAV13 capsid proteins).
[0059] DNA plasmids of the disclosure comprise recombinant AAV (rAAV) genomes of the disclosure. The DNA plasmids are transferred to cells permissible for infection with a helper virus of AAV (e.g., adenovirus, E1-deleted adenovirus or herpes virus) for assembly of the rAAV genome into infectious viral particles. Techniques to produce rAAV particles, in which an AAV genome to be packaged, rep and cap genes, and helper virus functions are provided to a cell are standard in the art. Production of rAAV requires that the following components are present within a single cell (denoted herein as a packaging cell): a rAAV genome, AAV rep and cap genes separate from (i.e., not in) the rAAV genome, and helper virus functions. The AAV rep genes may be from any AAV serotype for which recombinant virus can be derived and may be from a different AAV serotype than the rAAV genome ITRs, including, but not limited to, AAV serotypes AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, AAV-13, AAV-anc80, and AAV rh.74. IAAV DNA in the rAAV genomes can be from any AAV serotype for which a recombinant virus can be derived including, but not limited to, AAV serotypes AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, AAV-13, AAV-anc80, and AAV rh.74. Other types of rAAV variants, for example rAAV with capsid mutations, are also included in the disclosure. See, for example, Marsic et al., Molecular Therapy 22(11): 1900-1909 (2014). As noted above, the nucleotide sequences of the genomes of various AAV serotypes are known in the art. Use of cognate components is specifically contemplated. Production of pseudotyped rAAV is disclosed in, for example, WO 01/83692 which is incorporated by reference herein in its entirety.
[0060] The AAV vector can be a pseudotyped AAV, containing ITRs from one AAV serotype and capsid proteins from a different AAV serotype. The pseudo-typed AAV can be AAV2/9 (i.e., an AAV containing AAV2 ITRs and AAV9 capsid proteins). The pseudotyped AAV can be AAV2/8 (i.e., an AAV containing AAV2 ITRs and AAV8 capsid proteins). The pseudotyped AAV can be AAV2/1 (i.e., an AAV containing AAV2 ITRs and AAV1 capsid proteins).
[0061] The AAV vector can contain a recombinant capsid protein, such as a capsid protein containing a chimera of one or more of capsid proteins from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrh74, AAVrh.8, or AAVrh.10, AAV10, AAV11, AAV12, or AAV13. Other types of rAAV variants, for example rAAV with capsid mutations, are also contemplated. See, for example, Marsic et al., Molecular Therapy, 22(11): 1900-1909 (2014). As noted above, the nucleotide sequences of the genomes of various AAV serotypes are known in the art.
[0062] The disclosure provides AAV to deliver miDNM1s which target DNM1 mRNA to inhibit DNM1 expression. AAV can be used to deliver miDNM1s under the control of an RNA polymerase III (Pol III)-based promoter. AAV is used to deliver miDNM1s under the control of a U6 promoter. AAV is used to deliver miDNM1s under the control of a H1 promoter. AAV is used to deliver miDNM1s under the control of an RNA polymerase II (Pol II)-based promoter. AAV is used to deliver miDNM1s under the control of an U7 promoter. AAV is used to deliver miDNM1s under the control of a neuron-specific promoter. For example, AAV is used to deliver miDNM1s under the control of a neuron-specific synapsin promoter. AAV is used to deliver miDNM1s under the control of a DNM1 promoter.
[0063] In nature, the U6 promoter controls expression of the U6 RNA, a small nuclear RNA (snRNA) involved in splicing, and which has been well-characterized [Kunkel et al., Nature, 322(6074):73-77 (1986); Kunkel et al., Genes Dev. 2(2):196-204 (1988); Paule et al., Nuc. Acids Res., 28(6):1283-1298 (2000)]. The U6 promoter is used to control vector-based expression in mammalian cells [Paddison et al., Proc. Natl. Acad. Sci. USA, 99(3):1443-1448 (2002); Paul et al., Nat. Biotechnol., 20(5):505-518 (2002)] because (1) the promoter is recognized by RNA polymerase III (poly III) and controls high-level, constitutive expression of RNA; and (2) the promoter is active in most mammalian cell types. The disclosure includes use of both murine and human U6 promoters.
[0064] AAV vectors herein lack rep and cap genes. The AAV can be a recombinant AAV, a recombinant single-stranded AAV (ssAAV), or a recombinant self-complementary AAV (scAAV).
[0065] rAAV genomes of the disclosure comprise one or more AAV ITRs flanking a polynucleotide encoding, for example, one or more miDNM1s. Commercial providers such as Ambion Inc. (Austin, Tex.), Darmacon Inc. (Lafayette, Colo.), InvivoGen (San Diego, Calif.), and Molecular Research Laboratories, LLC (Herndon, Va.) generate custom inhibitory RNA molecules. In addition, commercial kits are available to produce custom siRNA molecules, such as SILENCER™ siRNA Construction Kit (Ambion Inc., Austin, Tex.) or psiRNA System (InvivoGen, San Diego, Calif.).
[0066] A method of generating a packaging cell is to create a cell line that stably expresses all the necessary components for AAV particle production. For example, a plasmid (or multiple plasmids) comprising a rAAV genome lacking AAV rep and cap genes, AAV rep and cap genes separate from the rAAV genome, and a selectable marker, such as a neomycin resistance gene, are integrated into the genome of a cell. AAV genomes have been introduced into bacterial plasmids by procedures such as GC tailing [Samulski et al., Proc. Natl. Acad. S6. USA, 79:2077-2081 (1982)], addition of synthetic linkers containing restriction endonuclease cleavage sites [Laughlin et al., Gene, 23:65-73 (1983)] or by direct, blunt-end ligation [Senapathy & Carter, J. Biol. Chem., 259:4661-4666 (1984)]. The packaging cell line is then infected with a helper virus such as adenovirus. The advantages of this method are that the cells are selectable and are suitable for large-scale production of rAAV. Other examples of suitable methods employ adenovirus or baculovirus rather than plasmids to introduce rAAV genomes and/or rep and cap genes into packaging cells.
[0067] General principles of rAAV production are reviewed in, for example, Carter, Current Opinions in Biotechnology, 1533-1539 (1992); and Muzyczka, Curr. Topics in Microbiol. and Immunol., 158: 97-129 (1992). Various approaches are described in Ratschin et al., Mol. Cell. Biol. 4:2072 (1984); Hermonat et al., Proc. Natl. Acad. Sci. USA, 81: 6466 (1984); Tratschin et al., Mol. Cell. Biol. 5: 3251 (1985); McLaughlin et al., J. Virol., 62: 1963 (1988); and Lebkowski et al., Mol. Cell. Biol., 7: 349 (1988). Samulski et al., J. Virol., 63: 3822-3828 (1989); U.S. Pat. No. 5,173,414; WO 95/13365 and corresponding U.S. Pat. No. 5,658,776; WO 95/13392; WO 96/17947; PCT/US98/18600; WO 97/09441 (PCT/US96/14423); WO 97/08298 (PCT/US96/13872); WO 97/21825 (PCT/US96/20777); WO 97/06243 (PCT/FR96/01064); WO 99/11764; Perrin et al., Vaccine, 13:1244-1250 (1995); Paul et al., Hum. Gene Ther., 4:609-615 (1993); Clark et al., Gene Ther., 3: 1124-1132 (1996); U.S. Pat. Nos. 5,786,211; 5,871,982; 6,258,595; and McCarty, Mol. Ther., 16(10): 1648-1656 (2008). The foregoing documents are hereby incorporated by reference in their entirety herein, with particular emphasis on those sections of the documents relating to rAAV production. The production and use of self-complementary (sc) rAAV are specifically contemplated and exemplified.
[0068] The disclosure further provides packaging cells that produce AAV vectors. Packaging cells may be stably transformed cancer cells such as HeLa cells, 293 cells and PerC.6 cells (a cognate 293 line). In another embodiment, packaging cells are cells that are not transformed cancer cells, such as low passage 293 cells (human fetal kidney cells transformed with E1 of adenovirus), MRC-5 cells (human fetal fibroblasts), WI-38 cells (human fetal fibroblasts), Vero cells (monkey kidney cells) and FRhL-2 cells (rhesus fetal lung cells).
[0069] Recombinant AAV (rAAV) (i.e., infectious encapsidated rAAV particles) are thus provided herein. The genomes of the rAAV lack AAV rep and cap DNA, that is, there is no AAV rep or cap DNA between the ITRs of the genomes of the rAAV.
[0070] The rAAV may be purified by methods standard in the art such as by column chromatography or cesium chloride gradients. Methods for purifying rAAV vectors from helper virus are known in the art and include methods disclosed in, for example, Clark et al., Hum. Gene Ther., 10(6): 1031-1039 (1999); Schenpp and Clark, Methods Mol. Med., 69: 427-443 (2002); U.S. Pat. No. 6,566,118 and WO 98/09657.
[0071] Compositions comprising the nucleic acids and viral vectors of the disclosure are provided. Compositions comprising delivery vehicles (such as rAAV) described herein are provided. Such compositions also comprise a pharmaceutically acceptable carrier. The compositions may also comprise other ingredients such as diluents and adjuvants. Acceptable carriers, diluents and adjuvants are nontoxic to recipients and are preferably inert at the dosages and concentrations employed, and include buffers such as phosphate, citrate, or other organic acids; antioxidants such as ascorbic acid; low molecular weight polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; and/or nonionic surfactants such as Tween, pluronics or polyethylene glycol (PEG).
[0072] For CSF delivery including but not limited to intrathecal delivery, compositions provided herein can comprise a pharmaceutically acceptable aqueous excipient containing a non-ionic, low-osmolar compound or contrast agent such as iobitridol, iohexol, iomeprol, iopamidol, iopentol, iopromide, ioversol, or ioxilan, where the aqueous excipient containing the non-ionic, low-osmolar compound can have one or more of the following characteristics: about 180 mgl/mL, an osmolality by vapor-pressure osmometry of about 322 mOsm/kg water, an osmolarity of about 273 mOsm/L, an absolute viscosity of about 2.3 cp at 20° C. and about 1.5 cp at 37° C., and a specific gravity of about 1.164 at 37° C. Exemplary compositions comprise about 20 to 40% non-ionic, low-osmolar compound or about 25% to about 35% non-ionic, low-osmolar compound. An exemplary composition comprises scAAV or rAAV viral particles formulated in 20 mM Tris (pH8.0), 1 mM MgCl.sub.2, 200 mM NaCl, 0.001% poloxamer 188 and about 25% to about 35% non-ionic, low-osmolar compound. Another exemplary composition comprises scAAV formulated in and 1× PBS and 0.001% Pluronic F68.
[0073] Titers of rAAV to be administered in methods of the invention will vary depending, for example, on the particular rAAV, the mode of administration, the treatment goal, the individual, and the cell type(s) being targeted, and may be determined by methods standard in the art. Titers of rAAV may range from about 1×10.sup.6, about 1×10.sup.7, about 1×10.sup.8, about 1×10.sup.9, about 1×10.sup.10, about 1×10.sup.11, about 1×10.sup.12, about 1×10.sup.13, about 1×10.sup.14, about 1×10.sup.16, or more DNase resistant particles (DRP) per ml. Dosages may be expressed in units of viral genomes (vg). Dosages contemplated herein include about 1×10.sup.7 vg, about 1×10.sup.5 vg, about 1×10.sup.9 vg, about 5×10.sup.9 vg, about 6×10.sup.9 vg, about 7×10.sup.9 vg, about 8×10.sup.9 vg, about 9×10.sup.9 vg, about 1×10.sup.10 vg, about 2×10.sup.10 vg, about 3×10.sup.10 vg, about 4×10.sup.10 vg, about 5×10.sup.10 vg, about 1×10.sup.11 vg, about 1.1×10.sup.11 vg, about 1.2×10.sup.11 vg, about 1.3×10.sup.11 vg, about 1.2×10.sup.11 vg, about 1.3×10.sup.11 vg, about 1.4×10.sup.11 vg, about 1.5×10.sup.11 vg, about 1.6×10.sup.11 vg, about 1.7×10.sup.11 vg, about 1.8×10.sup.11 vg, about 1.9×10.sup.11 vg, about 2×10.sup.11 vg, about 3×10.sup.11 vg, about 4×10.sup.11 vg, about 5×10.sup.11 vg, about 1×10.sup.12 vg, about 1×10.sup.13 vg, about 1.1×10.sup.13 vg, about 1.2×10.sup.13 vg, about 1.3×10.sup.13 vg, about 1.5×10.sup.13 vg, about 2×10.sup.13 vg, about 2.5×10.sup.13 vg, about 3×10.sup.13 vg, about 3.5×10.sup.13 vg, about 4×10.sup.13 vg, about 4.5×10.sup.13 vg, about 5×10.sup.13 vg, about 6×10.sup.13 vg, about 1×10.sup.14 vg, about 2×10.sup.14 vg, about 3×10.sup.14 vg, about 4×10.sup.14 vg, about 5×10.sup.14 vg, about 1×10.sup.15 vg, to about 1×10.sup.16 vg, or more total viral genomes. Dosages of about 1×10.sup.9 vg to about 1×10.sup.10 vg, about 5×10.sup.9 vg to about 5×10.sup.10 vg, about 1×10.sup.10 vg to about 1×10.sup.11 vg, about 1×10.sup.11 vg to about 1×10.sup.15 vg, about 1×10.sup.12 vg to about 1×10.sup.15 vg, about 1×10.sup.12 vg to about 1×10.sup.14 vg, about 1×10.sup.13 vg to about 6×10.sup.14 vg, and about 6×10.sup.13 vg to about 1.0×10.sup.14 vg, 2.0×10.sup.14 vg, 3.0×10.sup.14 vg, 5.0×10.sup.14 are also contemplated. For example, CSF doses can range between about 1×10.sup.13 vg/patient to about 1×10.sup.15 vg/patient based on age groups. For example, intravenous delivery doses can range between 1×10.sup.13 vg/kilogram (kg) body weight and 2×10.sup.14 vg/kg.
[0074] Methods of transducing a target cell with a delivery vehicle (such as rAAV), in vivo or in vitro, are contemplated. The in vivo methods comprise the step of administering an effective dose, or effective multiple doses, of a composition comprising a delivery vehicle (such as rAAV) to an subject (including a human patient) in need thereof. If the dose is administered prior to development of a disorder/disease, the administration is prophylactic. If the dose is administered after the development of a disorder/disease, the administration is therapeutic. An effective dose is a dose that alleviates (eliminates or reduces) at least one symptom associated with the disorder/disease state being treated, that slows or prevents progression to a disorder/disease state, that slows or prevents progression of a disorder/disease state, that diminishes the extent of disease, that results in remission (partial or total) of disease, and/or that prolongs survival. An example of a disease contemplated for prevention or treatment with methods of the invention is a DEE. DEE include, but are not limited to, Lennox-Gastaut Syndrome and Infantile Spasms. In families known to carry pathological DNM1 gene variants, the methods can be carried out before the onset of disease. In other patients, the methods are carried out after diagnosis.
[0075] For intrathecal administration, the subject can be held in the Trendelenburg position (head down position) after injection of the rAAV (e.g., for about 5, about 10, about 15 or about 20 minutes). For example, the patient may be tilted in the head down position at about 1 degree to about 30 degrees, about 15 to about 30 degrees, about 30 to about 60 degrees, about 60 to about 90 degrees, or about 90 to about 180 degrees.
[0076] Molecular, biochemical, histological, and functional outcome measures demonstrate the therapeutic efficacy of the methods. Outcome measures are described, for example, in Aimiuwu et al., Mol. Ther., 28(7): 1706-1716 (2020). Outcome measures include, but are not limited to, one or more of the reduction or elimination of mutant DNM1 mRNA or protein in affected tissues, DNM1 gene knockdown, increased survival, increased growth, and decreased seizures. Others include, but are not limited to, improved nerve histology (axon number, axon size and myelination), improved motor function, improved grip strength, reduction in gliosis and neurodegeneration in the brain, and improved metabolic activity.
[0077] In the methods of the disclosure, expression of variant DNM1 in a subject is inhibited by at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 95, at least 98 percent, at least 99 percent, or 100 percent compared to expression in the subject before treatment.
[0078] Combination therapies are also contemplated by the invention. Combination as used herein includes both simultaneous treatment and sequential treatments. Combinations of methods described herein with standard medical treatments and supportive care are specifically contemplated.
[0079] Administration of an effective dose of a nucleic acid, viral vector, or composition of the disclosure may be by routes standard in the art including, but not limited to, intramuscular, parenteral, intravascular, intravenous, oral, buccal, nasal, pulmonary, intracranial, intracerebroventricular, intrathecal, intraosseous, intraocular, rectal, or vaginal. An effective dose can be delivered by a combination of routes. For example, an effective dose is delivered intravenously and intramuscularly, or intravenously and intracerebroventricularly, and the like. An effective dose can be delivered in sequence or sequentially. An effective dose can be delivered simultaneously. Route(s) of administration and serotype(s) of AAV components of the rAAV (in particular, the AAV ITRs and capsid protein) of the invention are chosen and/or matched by those skilled in the art taking into account the infection and/or disease state being treated and the target cells/tissue(s) that are to express the miRNAs.
[0080] In particular, actual administration of delivery vehicle (such as rAAV) may be accomplished by using any physical method that will transport the delivery vehicle (such as rAAV) into a target cell of an subject. Administration includes, but is not limited to, injection into muscle, the bloodstream and/or directly into the nervous system or liver. Simply resuspending a rAAV in phosphate buffered saline has been demonstrated to be sufficient to provide a vehicle useful for muscle tissue expression, and there are no known restrictions on the carriers or other components that can be co-administered with the rAAV (although compositions that degrade DNA should be avoided in the normal manner with rAAV). Capsid proteins of a rAAV may be modified so that the rAAV is targeted to a particular target tissue of interest such as neurons. See, for example, WO 02/053703, the disclosure of which is incorporated by reference herein. Pharmaceutical compositions can be prepared as injectable formulations or as topical formulations to be delivered to the muscles by transdermal transport. Numerous formulations for both intramuscular injection and transdermal transport have been previously developed and can be used in the practice of the invention. The delivery vehicle (such as rAAV) can be used with any pharmaceutically acceptable carrier for ease of administration and handling.
[0081] A dispersion of delivery vehicle (such as rAAV) can also be prepared in glycerol, sorbitol, liquid polyethylene glycols and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. In this connection, the sterile aqueous media employed are all readily obtainable by standard techniques well-known to those skilled in the art.
[0082] The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases the form must be sterile and must be fluid to the extent that easy syringeability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating actions of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol, sorbitol and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of a dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal and the like. In many cases it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by use of agents delaying absorption, for example, aluminum monostearate and gelatin.
[0083] Sterile injectable solutions are prepared by incorporating rAAV in the required amount in the appropriate solvent with various other ingredients enumerated above, as required, followed by filter sterilization. Generally, dispersions are prepared by incorporating the sterilized active ingredient into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and the freeze drying technique that yield a powder of the active ingredient plus any additional desired ingredient from the previously sterile-filtered solution thereof.
[0084] Transduction of cells such as neurons with rAAV provided herein results in sustained expression of DNM1 miRNAs. The present invention thus provides methods of administering/delivering rAAV which express DNM1 miRNAs to a subject, preferably a human being. These methods include transducing cells and tissues (including, but not limited to, central nervous system neurons) with one or more rAAV described herein. Transduction may be carried out with gene cassettes comprising cell-specific control elements.
[0085] The term “transduction” is used to refer to, as an example, the administration/delivery of miDNM1s to a target cell either in vivo or in vitro, via a replication-deficient rAAV described herein resulting in the expression of miDNM1s by the target cell (e.g., neurons).
[0086] Thus, methods are provided of administering an effective dose (or doses, administered essentially simultaneously or doses given at intervals) of rAAV described herein to subject in need thereof.
EXAMPLES
[0087] Aspects and exemplary embodiments of the invention are illustrated by the following examples.
Example 1
Design and In Vitro Testing of miDNM1 Targeting Murine DNM1
[0088] To knock down Dnm1.sup.Ftfl, microRNAs were designed that specifically and efficiently target the murine Dnm1a isoform that harbors the fitful mutation.
[0089] Artificial miRNAs are based on the natural mir-30, maintaining important structural and sequence elements required for normal miRNA biogenesis but replacing the mature mir-30 sequences with 22-nt of complementarity with the DNM1 gene. See
[0090] Four microRNAs targeting Dnm1a (termed miDnm1a-1 through miDnm1a-4) were designed and cloned into a mir-30 based construct with expression driven by the U6 promoter, as previously described in Wallace et al., Mol. Ther. J. Am. Soc. Gene Ther., 20: 1417-1423 (2012). The miDNM1 sequences were generally designed according to Boudreau et al., Chapter 2 of Harper (Ed.), RNA Interference Techniques, Neuromethods, Vol. 58, Springer Science+Business Media, LLC (2011). Qualifying miRNAs were 22 nt long, with the first four and last four nucleotides being at least 75% GC rich and AU rich respectively. Additionally, the string of 22 nucleotides were 40% AU rich. miRNA specific targeting of Dnm1a capitalized on the 42 nt difference between Dnm1a and Dnm1b.
[0091] The activity of the miRNAs was tested in vitro using a dual luciferase reporter assay. The luciferase assay requires development of a dual reporter plasmid containing 2 different luciferase genes from firefly and Renilla reniformis, respectively. DNM1 gene sequences are inserted as the 3′ UTR of Renilla luciferase, while firefly luciferase serves as an internal control. U6.miDNM1 plasmids are co-transfected into HEK293 cells with the dual luciferase plasmid. DNM1 gene knockdown is determined by measuring activity of Renilla luciferase tagged with DNM1 sequences, relative to the control firefly luciferase activity. miDnm1a-1 exhibited about 84% knockdown, while miDnm1a-2 exhibited about 64% knockdown and miDnm1a-3 exhibited about 80% knockdown. miDnm1a-4 was the most effective at reducing the amount of Dnm1a mRNA (
TABLE-US-00005 (SEQ ID NO: 19) 5′ CUCGAGUGAGCGAACCAUCAGAAAGUGUAGUGAACUGUAAAGCCAC AGAUGGGUUCACUACACUUUCUGAUGGUGUGCCUACUAGA 3′
The antisense strand of the mature miRNA (underlined) binds Dnm1a mRNA.
Example 2
Production of scAAV9 Encoding miDNM1s
[0092] Next, miDnm1a-4 template DNA was cloned into a scAAV9 virus vector (scAAV9-miDnm1a) for in vivo validation (
[0093] The miDNM1 template sequences were cloned into the scAAV9 construct generically named “scAAV9-NP vectors” for in vivo delivery. The scAAV9 also contained a CMV promoter-driven eGFP reporter gene. The scAAV9 comprised a mutant AAV2 inverted terminal repeat (ITR) and a wild type AAV2 ITR that enable packaging of self-complementary AAV genomes. The resulting scAAV9 are referred to as “scAAV9-NP vectors”. A non-targeting scAAV referred to as “AAV9-miRLacZ” (short for a scAAV construct scAAV-NP.U6.miRLacZ.CMV.eGFP).
[0094] The scAAV9 were produced by transient transfection procedures using a double-stranded AAV2-ITR-based vector, with a plasmid encoding Rep2Cap9 sequence as previously described [Gao et al., J. Virol., 78: 6381-6388 (2004)] along with an adenoviral helper plasmid pHelper (Stratagene, Santa Clara, Calif.) in 293 cells. The scAAV9 were produced in three separate batches for the experiments and purified by two cesium chloride density gradient purification steps, dialyzed against PBS and formulated with 0.001% Pluronic-F68 to prevent virus aggregation and stored at 4° C. All vector preparations were titered by quantitative PCR using Taq-Man technology. Purity of vectors was assessed by 4-12% sodium dodecyl sulfate-acrylamide gel electrophoresis and silver staining (Invitrogen, Carlsbad, Calif.). scAAV9 viruses were generated and titered by the Viral Vector Core at The Research Institute at Nationwide Children's Hospital.
Example 3
In Vivo Quantification of Transduction and Dnm1a Knockdown
[0095] Mice were either administered the treatment (scAAV9-miDnm1a) or control (scAAV9-eGFP) AAV via a one-time bilateral intracerebroventricular (ICV) injection at postnatal day zero (PND 0).
[0096] For ICV delivery of scAAV9-miDnm1a, PND 0 Dnm1.sup.+/+ mice were anesthetized using hypothermia by being placed on a chilled metal block until properly anesthetized. The injection site was approximately ⅖.sup.th the distance from the lambda suture to each eye. All injections were executed free hand using a point style 4, 33-gauge needle and a 104 or 254 Hamilton syringe (Cat #65460-06 and Cat #65460-10). Control scAAV9-eGFP injections were matched to miDnm1a dosage, and saline controls were matched to the volume of virus injected.
[0097] Whole brain was isolated from six eGFP and eight miDnm1a injected mice at PND 14. The tissues were flash frozen with 2-Methylbutane and stored at −80° C. Samples were homogenized using a dounce and RNA was isolated using TRIzol Reagent (ThermoFisher, Waltham, Mass., Cat #15596018). RNA was converted to cDNA using Invitrogen SuperScript III First-Strand Synthesis System (Carlsbad, Calif., Cat #18080051). Dnm1a knock down was assessed using the primers 5′-CTCGCTTTTGAAGCCACAGT-3′ (SEQ ID NO: 56) and 3′-TTTCTGATGGTGGACGTGAG-5′ (SEQ ID NO: 57). Dnm1b expression was evaluated using the primers 5′-GGCCTTTGAAACCATTGTGA-3′ (SEQ ID NO: 58), and 3′-GCACTGTCTAACCGTGCTGA-5′ (SEQ ID NO: 59). SYBR™ Select Master Mix (Applied Biosystems, Waltham, Mass., Cat #4472903) was used for qPCR which was run using Applied Biosystems-Quant Studio 5.
[0098] Results are shown in
Example 4
Pilot Study
[0099] To assess the efficacy of scAAV9-miDnm1a in extending survival, a pilot study was conducted in the C57BL/6J (B6J) mouse strain background. Dnm1.sup.Ftfl/Ftfl mice experience severe and fully-penetrant tonic-clonic seizures and comorbidities resulting in lethality by the third postnatal week, irrespective of mouse strain background..sup.11 B6J-Dnm1.sup.Ftfl/Ftfl mice were treated with three doses of miDnm1a: 1×10.sup.10, 1.85×10.sup.11, 3.25×10.sup.11 vector genomes (vg).
[0100] Treatment of Dnm1.sup.Ftfl/Ftfl mutants extended survival in a dose-dependent manner: 30% (p=0.0001) and 50% (p=0.01) of mice treated with the latter two doses respectively, survived to PND 30 and showed growth improvements (p=0.003;
Example 5
Expanded Study
[0101] To further evaluate the effectiveness of miDnm1a, (B6J×FVB/NJ)F.sub.2 hybrid background mice were used because of their large litter size, animal size and good maternal care. Dnm1.sup.Ftfl/Ftfl and Dnm1.sup.+/+ F.sub.2 hybrids were either treated (scAAV9-miDnm1a) or control-injected (i.e., scAAV9-eGFP or saline;
Study Design
[0102] Experiments were performed blinded to genotype and treatment, and randomized as appropriate. Postnatal day (PND) 30 was selected prospectively as the adult endpoint because pups are typically weaned between PND 22 and PND 28, marking the end of the developmental period. To conform with institutional compliance data collection from live Dnm1.sup.Ftfl/Ftfl mice was stopped upon moribundity. For 95% confidence in detecting improvement from inhibition of mutant Dnm1a, at least 12 animals per group (genotype x treatment, sexes combined) was necessary to detect an effect with 80% power. For the primary study, to assess a possible dose effect two experiments were executed in the F2 hybrid background, representing two viral doses: 5.2×10.sup.11 vg; 6.0×10.sup.11 vg. Mice were randomly assigned to either miDnm1a treatment or control condition which included eGFP or saline administration; in analysis for simplicity the two control conditions were combined since they did not differ in effect. Thus, for analysis when modeling treated vs. control-injected groups we combined as covariates the two dose-experiments and sexes (using categorical indicator variables for each) and litter size. Cellular analysis was executed at PND 18, because that is the timepoint by which almost all untreated or control-injected mice become moribund, and PND 30, the endpoint of the study. For this study, we show three representative replicates for the cellular characterization of the effect of miDnm1a treatment.
Animals and Genotyping
[0103] C57BL/6J-Dnm1.sup.Ftfl-flox mice used for these studies (hereafter termed B6J-Dnm1.sup.Ftfl) were generated in Dnm1.sup.Δ1a/Δ1a mice by The Jackson Laboratory's Genetic Engineering Technology core, introducing the Dnm1.sup.Ftfl mutation using CRISPR/Cas9. To generate interstrain F2 hybrid mice, B6J-Dnm1.sup.Ftfl/+ mice were mated to FVB/NJ females (JAX, Bar Harbor, Me., stock 004624), and F1 hybrid mice mated inter se. Mice were genotyped with a PCR protocol designed to detect the presence of loxP sites in the fitful allele. The genotyping primers 5′-CCTCTCTGTCCACTTGTAGCCATT-3′ (SEQ ID NO: 60) and 3′-ACTGGGTGATGCTCACTAGAACCT-5′ (SEQ ID NO: 61) produce a 321 bp mutant allele and a 215 bp wildtype allele. Mice for this study were between 0 and 30 days old. To identify individual pups, they were tattooed at PND 0 according to the AIMS pup tattoo identification system (Budd Lake, N.J.) using Ketchum Animal Tattoo Ink (Cat #329AA). Mice were also ear notched at PND 10. Post weaning at PND 21, mice had access to food and water in their home cages ad libitum. Pups were never separated from their home cage for more than 10 mins at a time. Lights were maintained on a 12 h light/dark cycle with behavioral testing occurring during the light portion of the cycle. All procedures were approved by Columbia University's Institutional Animal Care and Use Committee and were performed in accordance with the National Institute of Health Guide for the care and use of laboratory animals.
Example 6
Evaluation of Growth, Development and Seizures in Treated Mice
Growth and Survival Monitoring
[0104] Between PND 4 and PND 30, Example 5 mice were weighed every other day. In addition, general health and survival were monitored every day from PND 0 to PND 30 (study endpoint).
[0105] As shown from prior studies [Boumil, supra], control-injected Dnm1.sup.Ftfl/Ftfl mice started showing growth deficits from PND 8 until moribundity or a terminal seizure event by PND 18-19 (
Seizure Quantification
[0106] To determine the effect of miDnm1a on seizure phenotypes, treated and control-injected Dnm1.sup.Ftfl/Ftfl homozygotes were assessed for overt seizure and seizure-associated activity. Each litter of pups were monitored for approximately 5 mins during weighing. Seizure activity was characterized by wild runs, Straub tail, vertical jumps that lasted more than 10 sec with subsequent facial grooming, continuous jerking of the forelimbs and hindlimbs and tonic-clonic seizures. All seizures within the observation window were counted as one event. The assessments were done on alternate days, starting at PND 14 during weight examination sessions.
TABLE-US-00006 TABLE 1 Observed seizure or seizure associated behaviors in treated or control-injected Dnm1.sup.Ftfl/Ftfl mice Postnatal day Group Positive Negative total % positive p-value.sup.a 14 Control 25 19 44 56.8% 0.017 miDnm1a 8 21 29 27.6% 16 Control 24 19 43 55.8% 0.156 miDnm1a 11 18 29 37.9% 18 Control 39 3 42 92.9% 2 × 10.sup.−6 miDnm1a 12 17 29 41.4% 20 miDnm1a 5 19 24 20.8% n.a. 22 miDnm1a 9 12 21 20.8% n.a. 24 miDnm1a 7 13 20 35.0% n.a. 26 miDnm1a 3 17 20 15.0% n.a. 28 miDnm1a 1 19 20 5.0% n.a. 30 miDnm1a 1 19 20 5.0% n.a. .sup.aFisher exact test, 2-tail, 2 × 2 contingency analysis.
[0107] While both treated and control-injected Dnm1.sup.Ftfl/Ftfl mice exhibited seizure behaviors, treated mice had fewer overall observed events between PND 14-18 (
Development
[0108] Developmental milestones in pups are important readouts of developmental delays. To begin the test, each pup was gently removed from the nest and placed on a clean piece of bench protector. The cage lid was immediately and gently placed back, to reduce agitation in the nest. All assessment was completed by a deft experimenter within 3 min. At the end of the session, the pup was quickly returned to the nest. For all behaviors, mice from both groups (genotype x treatment) were handled every day from PND 4-12. On all even days (PND 4 to PND 12) they were weighed and on odd days (PND 5 to PND 11), they were assessed for strength and sensorimotor development. From PND 14 to PND 30 mice were weighed on every other day on even days. Testing was executed blind.
[0109] Vertical Screen Hold
[0110] To evaluate strength, mice were placed on a vertical mesh screen and their latency to fall off the screen was recorded. Mice were observed for 30 sec and were allowed two attempts to complete the task. The scores from both trials were averaged. Mice were tested at PND 9 and PND 11 because the average age of a rodent to perform this task is PND 8.
[0111] Treated Dnm1.sup.Ftfl/Ftfl mice (n=30) showed improved grip strength compared to control-injected Dnm1.sup.Ftfl/Ftfl mice (n=28) at PND 11 (p=0.0009;
[0112] Negative Geotaxis
[0113] Possible sensorimotor impairment was evaluated using the negative geotaxis assay, which challenges the innate behavior in mice to utilize vestibular cues for motor coordination. Mice are placed head down on a mesh screen set at a 45° angle. The latency for the pups to turn 90° (sideways) and 180° (heads up) from a downward facing start position was recorded. Mice were given 30 sec to perform the task and were allowed two attempts. Both attempts were averaged for the analysis.
[0114] Unlike control-injected Dnm1.sup.Ftfl/Ftfl mice, treated Dnm1.sup.Ftfl/Ftfl mice like wildtype controls, tended to exhibit a shorter latency to turn 90° and 180° at PND 11, but only the more challenging 180° turn was statistically significant compared with control-injected Dnm1.sup.Ftfl/Ftfl mice (p=0.0004;
[0115] Open Field
[0116] To quantify the ataxic phenotype, we observed PND 14 pups in the open field using the EthoVision XT video tracking software (Noldus). Mice were tested in a 28.5 cm arena with luminescence of 100 lux. Mice were recorded for 10 minutes. Videos were subsequently scored blind by counting the number of times each mouse wobbled or fell during movement over a 10-min window. Mice that moved less than 100 cm were excluded. Additionally, distance travelled and velocity of each mouse was quantified.
[0117] As expected, control-injected Dnm1.sup.Ftfl/Ftfl mice had numerous ataxic events (overtly wobbly gait and falls), but miDnm1a treatment completely abolished this ataxic phenotype observed in the control-injected Dnm1.sup.Ftfl/Ftfl mice (p<0.0001;
[0118] These results show that miDnm1a treatment improved the developmental outcomes of Dnm1.sup.Ftfl/Ftfl mice.
Summary
[0119] Treated Dnm1.sup.Ftfl/Ftfl mice showed extended survival, improved growth, decreased lethal seizures, improved developmental outcomes, and an absence of ataxia. These data together show the effectiveness of miDnm1a at curbing or eliminating the most severe fitful behavioral phenotypes including seizures, growth and ataxia, culminating in an overall improvement in their quality of life and survival to the endpoint.
Example 7
Histology
[0120] The significant mitigating effect of Dnm1.sup.Ftfl mRNA silencing on severe seizures and impaired neurodevelopment prompted examination of the extent to which treatment impacts underlying cellular pathology. Gliosis and neuronal cell death are hallmarks of neuronal insults and recurrent seizure activity, features not previously examined in the published studies on Dnm1.sup.Ftfl mouse model. Here the presence of gliosis and cell degeneration was investigated via immunolabeling using glial fibrillary acidic protein (GFAP) and Fluoro-Jade C (FJC).
[0121] At least 3-5 mice from each group (genotype: Dnm1.sup.Ftfl/Ftfl and Dnm1.sup.+/+ X treatment: miDnm1a and eGFP) were perfused with 4% PFA for immunohistochemical assessment at PND 18. We also evaluated Dnm1.sup.Ftfl/Ftfl miDnm1a mice surviving until PND 30 and Dnm1.sup.+/+ controls. All animals were handled in the same way prior to euthanasia. Brains were dissected from the skull and postfixed in 4% PFA overnight at 4° C. Brains were transferred to gradient concentrations of sucrose (15% and 30%) overnight at 4° C. Once saturated, the brains were embedded in OCT (Fisher Healthcare Cat #4585) and frozen. Free floating 40 μm sections were collected using a cryostat (Leica CM3050S). The sections were permeabilized with 0.1% Triton X in PBS for 30 minutes and blocked with 5% normal goat serum in PBS (blocking buffer) for 1 h at room temperature. Slices were incubated with either anti-NPY (1:500, ImmunoStar, Hudson, Wis. Cat #22940), anti-c-Fos (1:250, Abcam, Cambridge, UK, Cat #ab190289), anti-GFP (1:250, Invitrogen, Carlsbad, Calif., Cat #A11120) or anti-GFAP (1:750, Sigma, Saint Louis, Mo., Cat. #M4403) in blocking buffer overnight at 4° C. Afterwards, sections were washed in PBST for 10 min and incubated in AlexaFluor secondary 555 (1:1000, Thermo Fisher Scientific, Waltham, Mass., Ref #A31428 and Ref #A32727) for 2 h at room temperature. Sections were incubated in DAPI for 5 mins before washing with PBS. Sections were finally mounted on slides and cover slipped with Fluoromount-G (Southern Biotech, Birmingham, Ala., Cat #0100-01).
[0122] For FJC labeling, 3-5 PND 18 and PND 30 mice (genotype x treatment) were euthanized, and their brains dissected and flash frozen. 20 μm thick sections were collected with a cryostat and mounted on gelatin coated slides (FD NeuroTechnologies, Inc. Columbia, Md., Cat #P0101). Sections were post fixed with 2% PFA and washed in PBS. Slides were air dried on a 50° C. heating block for 20-30 mins and subsequently placed in 80% ethanol solution consisting of 1% NAOH for 5 mins. Slides were moved to 70% ethanol for 2 mins, rinsed in deionized water for 2 mins, incubated in 0.06% potassium permanganate in deionized water for 10 mins, rinsed for 2 mins in deionized water, and finally incubated in FJC working solution consisting of 0.0001% FJC in 0.1% acetic acid for 10 mins. Finally, slides were washed 3 times for 2 mins each in deionized water, air dried completely and cleared in xylene for at least 1 min before they were cover slipped with mounting media (DPX, Saint Louis, Mo., Cat #06522)..sup.30 Slides were imaged using a Zeiss LSM-800 confocal microscope and Zen v2.3. Tiled images of 10× magnification were acquired of the hippocampus for each section keeping the laser and gain settings constant. For FJC, the Axio X-Cite series 120 Q epifluorescence microscope was used and images of 10× magnification were acquired. Post processing of images was carried out with Adobe Photoshop. All image processing was kept consistent.
[0123] IHC images were quantified blind using ImageJ (Fiji; nih.gov). Images were converted to 8-bit and brightness and contrast keep constant. The cell counter plugin was used to count aberrant NPY and c-Fos positive cells in the whole hippocampal CA3 and to count FJC positive cells in the hippocampal CA1. GFAP fluorescence intensity was determined using the measure tool with the region of interest (ROI) in the CA1. Measurements were set to include area, min and max gray value and integrated density. For fluorescence intensity measurement, background intensity was collected. Relative fluorescence was calculated by first subtracting the integrated intensity of the background from the integrated intensity of the CA1 ROI to yield a background corrected intensity. Area was kept constant across all intensity measures. The corrected intensities of the wildtype control group was then averaged. Each corrected intensity was divided by the average of the wildtype control corrected intensity and multiplied by 100.
[0124] At PND 18, control-injected Dnm1.sup.Ftfl/Ftfl mice showed intense fibrillary gliosis (GFAP) in the hippocampus, specifically around CA1, compared to treated Dnm1.sup.Ftfl/Ftfl mice (p=0.018), indicative of a hippocampus under stress (
[0125] Given the increased gliosis and cellular degeneration observed in the hippocampus of control-injected Dnm1.sup.Ftfl/Ftfl mice, hippocampal involvement was further examined by using cellular footprints of metabolic activity typically associated with recurrent limbic seizure behavior. Neuropeptide Y (NPY) was examined, as upregulation of NPY in the hippocampus is a known method of evidencing hyperexcitability in rodent models of epilepsy. Aberrant cellular NPY expression was observed in the hippocampal cornu ammonis areas, specifically in CA3, of control-injected Dnm1.sup.Ftfl/Ftfl mice compared to treated Dnm1.sup.Ftfl/Ftfl mice at PND 18 (p=0.0012;
[0126] Overall, unlike control-injected Dnm1.sup.Ftfl/Ftfl mice, treated Dnm1.sup.Ftfl/Ftfl mice showed a decrease in gliosis, cell death, and aberrant neuronal activity at PND 18 which persisted and led to their survival until the PND 30 endpoint. These results together show that miDnm1a treatment diminished the cellular pathology associated with the Dnm1.sup.Ftfl mutation.
[0127] While the present invention has been described in terms of specific embodiments, it is understood that variations and modifications will occur to those skilled in the art. Accordingly, only such limitations as appear in the claims should be placed on the invention.
[0128] All documents referred to in this application are hereby incorporated by reference in their entirety.