METHODS AND COMPOSITIONS FOR THE SPECIFIC INHIBITION OF GENE EXPRESSION BY DOUBLE-STRANDED RNA
20170159054 ยท 2017-06-08
Assignee
Inventors
Cpc classification
A61P1/04
HUMAN NECESSITIES
A61P29/00
HUMAN NECESSITIES
A61P1/02
HUMAN NECESSITIES
C12N2310/51
CHEMISTRY; METALLURGY
A61P1/16
HUMAN NECESSITIES
C12N2320/51
CHEMISTRY; METALLURGY
A61P35/00
HUMAN NECESSITIES
C12N15/113
CHEMISTRY; METALLURGY
A61P7/04
HUMAN NECESSITIES
C12N15/111
CHEMISTRY; METALLURGY
C12N2320/50
CHEMISTRY; METALLURGY
A61P1/00
HUMAN NECESSITIES
A61P37/06
HUMAN NECESSITIES
International classification
C12N15/113
CHEMISTRY; METALLURGY
Abstract
The invention is directed to compositions and methods for selectively reducing the expression of a gene product from a desired target gene in a cell, as well as for treating diseases caused by the expression of the gene. More particularly, the invention is directed to compositions that contain double stranded RNA (dsRNA), and methods for preparing them, that are capable of reducing the expression of target genes in eukaryotic cells. The dsRNA has a first oligonucleotide sequence that is between 25 and about 30 nucleotides in length and a second oligonucleotide sequence that anneals to the first sequence under biological conditions. In addition, a region of one of the sequences of the dsRNA having a sequence length of at least 19 nucleotides is sufficiently complementary to a nucleotide sequence of the RNA produced from the target gene to trigger the destruction of the target RNA by the RNAi machinery.
Claims
1. An isolated nucleic acid molecule capable of reducing expression of a target gene in a human comprising: a first oligonucleotide strand 25-30 nucleotides in length comprising RNA, a 3 terminus and a 5 terminus, and a second oligonucleotide strand at least 26 nucleotides in length comprising RNA, a 3 terminus, and a 5 terminus, wherein said second strand is annealed to said first strand under biological conditions to form a duplex region of at least 25 nucleotides in length, wherein the 5 terminus of said second strand and the 3 terminus of said first strand form a blunt end, wherein the 3 terminus of said second strand comprises 1-4 single-stranded nucleotides, wherein said second oligonucleotide strand is sufficiently complementary to a target mRNA encoded by said target gene to reduce expression of said target gene when said nucleic acid molecule is introduced to a human, wherein said nucleic acid molecule reduces expression of said target gene.
2. A method for reducing expression of a target gene in a human comprising: contacting a human with an isolated double stranded nucleic acid in an amount sufficient to reduce expression of a target gene in said human, wherein said double stranded nucleic acid comprises RNA and comprises a first oligonucleotide strand having a 5 terminus and a 3 terminus and a second oligonucleotide strand having a 5 terminus and a 3 terminus, wherein said first strand has a length which is at least 25 and at most 30 nucleotides and wherein said second strand is 1-4 nucleotides longer at its 3 terminus than said first strand and forms a base-paired blunt end at its 5 terminus with said 3 terminus of said first strand, wherein said double-stranded nucleic acid comprises a duplex region of at least 25 nucleotides in length, wherein said second oligonucleotide strand is sufficiently complementary to a target mRNA along at least 19 nucleotides of said second oligonucleotide strand length to reduce target gene expression when said double stranded nucleic acid is introduced into a mammalian cell, thereby reducing expression of the target gene in said mammalian cell.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
DETAILED DESCRIPTION OF THE INVENTION
[0036] The present invention is directed to compositions that contain double stranded RNA (dsRNA), and methods for preparing them, that are capable of reducing the expression of target genes in eukaryotic cells. One of the strands of the dsRNA contains a region of nucleotide sequence that has a length that ranges from about 19 to about 30 nucleotides that can direct the destruction of the RNA transcribed from the target gene.
[0037] In a first aspect, the present invention provides novel compositions for RNA interference (RNAi). The compositions comprise dsRNA which is a precursor molecule, i.e., the dsRNA of the present invention is processed in vivo to produce an active siRNA. The dsRNA is processed by Dicer to an active siRNA which is incorporated into the RISC complex. The precursor molecule is also termed a precursor RNAi molecule herein. As used herein, the term active siRNA refers to a double stranded nucleic acid in which each strand comprises RNA, RNA analog(s) or RNA and DNA. The siRNA comprises between 19 and 23 nucleotides or comprises 21 nucleotides. The active siRNA has 2 bp overhangs on the 3 ends of each strand such that the duplex region in the siRNA comprises 17-21 nucleotides, or 19 nucleotides. Typically, the antisense strand of the siRNA is sufficiently complementary with the target sequence of the target gene.
[0038] The phrase duplex region refers to the region in two complementary or substantially complementary oligonucleotides that form base pairs with one another, either by Watson-Crick base pairing or any other manner that allows for a duplex between oligonucleotide strands that are complementary or substantially complementary. For example, an oligonucleotide strand having 21 nucleotide units can base pair with another oligonucleotide of 21 nucleotide units, yet only 19 bases on each strand are complementary or substantially complementary, such that the duplex region consists of 19 base pairs. The remaining base pairs may, for example, exist as 5 and 3 overhangs. Further, within the duplex region, 100% complementarity is not required; substantial complementarity is allowable within a duplex region. Substantial complementarity refers to complementarity between the strands such that they are capable of annealing under biological conditions. Techniques to empirically determine if two strands are capable of annealing under biological conditions are well know in the art. Alternatively, two strands can be synthesized and added together under biological conditions to determine if they anneal to one another.
[0039] As used herein, an siRNA having a sequence sufficiently complementary to a target mRNA sequence means that the siRNA has a sequence sufficient to trigger the destruction of the target mRNA by the RNAi machinery (e.g., the RISC complex) or process. The siRNA molecule can be designed such that every residue of the antisense strand is complementary to a residue in the target molecule. Alternatively, substitutions can be made within the molecule to increase stability and/or enhance processing activity of said molecule. Substitutions can be made within the strand or can be made to residues at the ends of the strand.
[0040] In one embodiment of the first aspect of the present invention, the dsRNA, i.e., the precursor RNAi molecule, has a length sufficient such that it is processed by Dicer to produce an siRNA. According to this embodiment, a suitable dsRNA contains one oligonucleotide sequence, a first sequence, that is at least 25 nucleotides in length and no longer than about 30 nucleotides. This sequence of RNA can be between about 26 and 29 nucleotides in length. This sequence can be about 27 or 28 nucleotides in length or 27 nucleotides in length. The second sequence of the dsRNA can be any sequence that anneals to the first sequence under biological conditions, such as within the cytoplasm of a eukaryotic cell. Generally, the second oligonucleotide sequence will have at least 19 complementary base pairs with the first oligonucleotide sequence, more typically the second oligonucleotides sequence will have about 21 or more complementary base pairs, or about 25 or more complementary base pairs with the first oligonucleotide sequence. In one embodiment, the second sequence is the same length as the first sequence, and the dsRNA is blunt ended. In another embodiment, the ends of the dsRNA have overhangs.
[0041] In certain aspects of this first embodiment, the first and second oligonucleotide sequences of the dsRNA exist on separate oligonucleotide strands that can be and typically are chemically synthesized. In some embodiments, both strands are between 26 and 30 nucleotides in length. In other embodiments, both strands are between 25 and 30 nucleotides in length. In one embodiment, both strands are 27 nucleotides in length, are completely complementary and have blunt ends. The dsRNA can be from a single RNA oligonucleotide that undergoes intramolecular annealing or, more typically, the first and second sequences exist on separate RNA oligonucleotides. In one embodiment, one or both oligonucleotide strands are capable of serving as a substrate for Dicer. In other embodiments, at least one modification is present that promotes Dicer to bind to the double-stranded RNA structure in an orientation that maximizes the double-stranded RNA structure's effectiveness in inhibiting gene expression. The dsRNA can contain one or more deoxyribonucleic acid (DNA) base substitutions.
[0042] Suitable dsRNA compositions that contain two separate oligonucleotides can be chemically linked outside their annealing region by chemical linking groups. Many suitable chemical linking groups are known in the art and can be used. Suitable groups will not block Dicer activity on the dsRNA and will not interfere with the directed destruction of the RNA transcribed from the target gene. Alternatively, the two separate oligonucleotides can be linked by a third oligonucleotide such that a hairpin structure is produced upon annealing of the two oligonucleotides making up the dsRNA composition. The hairpin structure will not block Dicer activity on the dsRNA and will not interfere with the directed destruction of the RNA transcribed from the target gene.
[0043] The first and second oligonucleotides are not required to be completely complementary. In fact, in one embodiment, the 3-terminus of the sense strand contains one or more mismatches. In one aspect, about two mismatches are incorporated at the 3terminus of the sense strand. In another embodiment, the dsRNA of the invention is a double stranded RNA molecule containing two RNA oligonucleotides each of which is 27 nucleotides in length and, when annealed to each other, have blunt ends and a two nucleotide mismatch on the 3-terminus of the sense strand (the 5-terminus of the antisense strand). The use of mismatches or decreased thermodynamic stability (specifically at the 3-sense/5-antisense position) has been proposed to facilitate or favor entry of the antisense strand into RISC (Schwarz et al., 2003; Khvorova et al., 2003), presumably by affecting some rate-limiting unwinding steps that occur with entry of the siRNA into RISC. Thus, terminal base composition has been included in design algorithms for selecting active 21mer siRNA duplexes (Ui-Tei et al., 2004; Reynolds et al., 2004). With Dicer cleavage of the dsRNA of this embodiment, the small end-terminal sequence which contains the mismatches will either be left unpaired with the antisense strand (become part of a 3-overhang) or be cleaved entirely off the final 21-mer siRNA. These mismatches, therefore, do not persist as mismatches in the final RNA component of RISC. It was surprising to find that base mismatches or destabilization of segments at the 3-end of the sense strand of Dicer substrate improved the potency of synthetic duplexes in RNAi, presumably by facilitating processing by Dicer.
[0044] It has been found empirically that these longer dsRNA species of from 25 to about 30 nucleotides give unexpectedly effective results in terms of potency and duration of action. Without wishing to be bound by the underlying theory of the invention, it is thought that the longer dsRNA species serve as a substrate for the enzyme Dicer in the cytoplasm of a cell. In addition to cleaving the dsRNA of the invention into shorter segments, Dicer is thought to facilitate the incorporation of a single-stranded cleavage product derived from the cleaved dsRNA into the RISC complex that is responsible for the destruction of the cytoplasmic RNA derived from the target gene. The studies described herein have shown that the cleavability of a dsRNA species by Dicer corresponds with increased potency and duration of action of the dsRNA species.
[0045] In a second embodiment of the first aspect of the present invention, the dsRNA, i.e., the precursor RNAi molecule, has several properties which enhance its processing by Dicer. According to this embodiment, the dsRNA has a length sufficient such that it is processed by Dicer to produce an active siRNA and at least one of the following properties: (i) the dsRNA is asymmetric, e.g., has a 3 overhang on the antisense strand and (ii) the dsRNA has a modified 3 end on the sense strand to direct orientation of Dicer binding and processing of the dsRNA to an active siRNA. According to this embodiment, the longest strand in the dsRNA comprises 24-30 nucleotides. In one embodiment, the dsRNA is asymmetric such that the sense strand comprises 22-28 nucleotides and the antisense strand comprises 24-30 nucleotides. Thus, the resulting dsRNA has an overhang on the 3 end of the antisense strand. The overhang is 1-3 nucleotides, for example 2 nucleotides. The sense strand may also have a 5 phosphate.
[0046] In another embodiment, the sense strand is modified for Dicer processing by suitable modifiers located at the 3 end of the sense strand, i.e., the dsRNA is designed to direct orientation of Dicer binding and processing. Suitable modifiers include nucleotides such as deoxyribonucleotides, dideoxyribonucleotides, acyclonucleotides and the like and sterically hindered molecules, such as fluorescent molecules and the like. Acyclonucleotides substitute a 2-hydroxyethoxymethyl group for the 2-deoxyribofuranosyl sugar normally present in dNMPs. Other nucleotides modifiers could include 3-deoxyadenosine (cordycepin), 3-azido-3-deoxythymidine (AZT), 2,3-dideoxyinosine (ddI), 2,3-dideoxy-3-thiacytidine (3TC), 2,3-didehydro-2,3-dideoxythymidine (d4T) and the monophosphate nucleotides of 3-azido-3-deoxythymidine (AZT), 2,3-dideoxy-3-thiacytidine (3TC) and 2,3-didehydro-2,3-dideoxythymidine (d4T). In one embodiment, deoxynucleotides are used as the modifiers. When nucleotide modifiers are utilized, 1-3 nucleotide modifiers, or 2 nucleotide modifiers are substituted for the ribonucleotides on the 3 end of the sense strand. When sterically hindered molecules are utilized, they are attached to the ribonucleotide at the 3 end of the antisense strand. Thus, the length of the strand does not change with the incorporation of the modifiers. In another embodiment, the invention contemplates substituting two DNA bases in the dsRNA to direct the orientation of Dicer processing of the antisense strand. In a further embodiment of the present invention, two terminal DNA bases are substituted for two ribonucleotides on the 3-end of the sense strand forming a blunt end of the duplex on the 3 end of the sense strand and the 5 end of the antisense strand, and a two-nucleotide RNA overhang is located on the 3-end of the antisense strand. This is an asymmetric composition with DNA on the blunt end and RNA bases on the overhanging end.
[0047] The sense and antisense strands anneal under biological conditions, such as the conditions found in the cytoplasm of a cell. In addition, a region of one of the sequences, particularly of the antisense strand, of the dsRNA has a sequence length of at least 19 nucleotides, wherein these nucleotides are in the 21-nucleotide region adjacent to the 3 end of the antisense strand and are sufficiently complementary to a nucleotide sequence of the RNA produced from the target gene.
[0048] Further in accordance with this embodiment, the dsRNA, i.e., the precursor RNAi molecule, may also have one or more of the following additional properties: (a) the antisense strand has a right shift from the typical 21mer, (b) the strands may not be completely complementary, i.e., the strands may contain simple mismatch pairings and (c) base modifications such as locked nucleic acid(s) may be included in the 5 end of the sense strand. A typical 21mer siRNA is designed using conventional techniques. In one technique, a variety of sites are commonly tested in parallel or pools containing several distinct siRNA duplexes specific to the same target with the hope that one of the reagents will be effective (Ji et al., 2003). Other techniques use design rules and algorithms to increase the likelihood of obtaining active RNAi effector molecules (Schwarz et al., 2003; Khvorova et al., 2003; Ui-Tei et al., 2004; Reynolds et al., 2004; Krol et al., 2004; Yuan et al., 2004; Boese et al., 2005). High throughput selection of siRNA has also been developed (U.S. published patent application No. 2005/0042641 A1, incorporated herein by reference). Potential target sites can also be analyzed by secondary structure predictions (Heale et al., 2005). This 21mer is then used to design a right shift to include 3-9 additional nucleotides on the 5 end of the 21mer. The sequence of these additional nucleotides may have any sequence. In one embodiment, the added ribonucleotides are based on the sequence of the target gene. Even in this embodiment, full complementarity between the target sequence and the antisense siRNA is not required.
[0049] The first and second oligonucleotides are not required to be completely complementary. They only need to be substantially complementary to anneal under biological conditions and to provide a substrate for Dicer that produces an siRNA sufficiently complementary to the target sequence. Locked nucleic acids, or LNA's, are well known to a skilled artisan (Elman et al., 2005; Kurreck et al., 2002; Crinelli et al., 2002; Braasch and Corey, 2001; Bondensgaard et al., 2000; Wahlestedt et al., 2000). In one embodiment, an LNA is incorporated at the 5 terminus of the sense strand. In another embodiment, an LNA is incorporated at the 5 terminus of the sense strand in duplexes designed to include a 3 overhang on the antisense strand.
[0050] In one embodiment, the dsRNA has an asymmetric structure, with the sense strand having a 25-base pair length, and the antisense strand having a 27-base pair length with a 2 base 3-overhang. In another embodiment, this dsRNA having an asymmetric structure further contains 2 deoxynucleotides at the 3end of the sense strand in place of two of the ribonucleotides.
[0051] Suitable dsRNA compositions that contain two separate oligonucleotides can be linked by a third structure. The third structure will not block Dicer activity on the dsRNA and will not interfere with the directed destruction of the RNA transcribed from the target gene. In one embodiment, the third structure may be a chemical linking group. Many suitable chemical linking groups are known in the art and can be used. Alternatively, the third structure may be an oligonucleotide that links the two oligonucleotides of the dsRNA is a manner such that a hairpin structure is produced upon annealing of the two oligonucleotides making up the dsRNA composition. The hairpin structure will not block Dicer activity on the dsRNA and will not interfere with the directed destruction of the RNA transcribed from the target gene.
[0052] In a third embodiment of the first aspect of the present invention, the dsRNA, i.e., the precursor RNAi molecule, has several properties which enhances its processing by Dicer. According to this embodiment, the dsRNA has a length sufficient such that it is processed by Dicer to produce an siRNA and at least one of the following properties: (i) the dsRNA is asymmetric, e.g., has a 3 overhang on the sense strand and (ii) the dsRNA has a modified 3 end on the antisense strand to direct orientation of Dicer binding and processing of the dsRNA to an active siRNA. According to this embodiment, the longest strand in the dsRNA comprises 24-30 nucleotides. In one embodiment, the sense strand comprises 24-30 nucleotides and the antisense strand comprises 22-28 nucleotides. Thus, the resulting dsRNA has an overhang on the 3 end of the sense strand. The overhang is 1-3 nucleotides, such as 2 nucleotides. The antisense strand may also have a 5 phosphate.
[0053] In another embodiment, the antisense strand is modified for Dicer processing by suitable modifiers located at the 3 end of the antisense strand, i.e., the dsRNA is designed to direct orientation of Dicer binding and processing. Suitable modifiers include nucleotides such as deoxyribonucleotides, dideoxyribonucleotides, acyclonucleotides and the like and sterically hindered molecules, such as fluorescent molecules and the like. Acyclonucleotides substitute a 2-hydroxyethoxymethyl group for the 2-deoxyribofuranosyl sugar normally present in dNMPs. Other nucleotide modifiers could include 3-deoxyadenosine (cordycepin), 3-azido-3-deoxythymidine (AZT), 2,3-dideoxyinosine (ddI), 2,3-dideoxy-3-thiacytidine (3TC), 2,3-didehydro-2,3-dideoxythymidine (d4T) and the monophosphate nucleotides of 3-azido-3-deoxythymidine (AZT), 2,3-dideoxy-3-thiacytidine (3TC) and 2,3-didehydro-2,3-dideoxythymidine (d4T). In one embodiment, deoxynucleotides are used as the modifiers. When nucleotide modifiers are utilized, 1-3 nucleotide modifiers, or 2 nucleotide modifiers are substituted for the ribonucleotides on the 3 end of the antisense strand. When sterically hindered molecules are utilized, they are attached to the ribonucleotide at the 3 end of the antisense strand. Thus, the length of the strand does not change with the incorporation of the modifiers. In another embodiment, the invention contemplates substituting two DNA bases in the dsRNA to direct the orientation of Dicer processing. In a further invention, two terminal DNA bases are located on the 3 end of the antisense strand in place of two ribonucleotides forming a blunt end of the duplex on the 5 end of the sense strand and the 3 end of the antisense strand, and a two-nucleotide RNA overhang is located on the 3-end of the sense strand. This is an asymmetric composition with DNA on the blunt end and RNA bases on the overhanging end.
[0054] The sense and antisense strands anneal under biological conditions, such as the conditions found in the cytoplasm of a cell. In addition, a region of one of the sequences, particularly of the antisense strand, of the dsRNA has a sequence length of at least 19 nucleotides, wherein these nucleotides are adjacent to the 3 end of antisense strand and are sufficiently complementary to a nucleotide sequence of the RNA produced from the target gene.
[0055] Further in accordance with this embodiment, the dsRNA, i.e., the precursor RNAi molecule, may also have one or more of the following additional properties: (a) the antisense strand has a right shift from the typical 21mer and (b) the strands may not be completely complementary, i.e., the strands may contain simple mismatch pairings. A typical 21mer siRNA is designed using conventional techniques, such as described above. This 21mer is then used to design a right shift to include 1-7 additional nucleotides on the 5 end of the 21mer. The sequence of these additional nucleotides may have any sequence. Although the added ribonucleotides may be complementary to the target gene sequence, full complementarity between the target sequence and the antisense siRNA is not required. That is, the resultant antisense siRNA is sufficiently complementary with the target sequence. The first and second oligonucleotides are not required to be completely complementary. They only need to be substantially complementary to anneal under biological conditions and to provide a substrate for Dicer that produces an siRNA sufficiently complementary to the target sequence.
[0056] In one embodiment, the dsRNA has an asymmetric structure, with the antisense strand having a 25-base pair length, and the sense strand having a 27-base pair length with a 2 base 3-overhang. In another embodiment, this dsRNA having an asymmetric structure further contains 2 deoxynucleotides at the 3 end of the antisense strand.
[0057] Suitable dsRNA compositions that contain two separate oligonucleotides can be linked by a third structure. The third structure will not block Dicer activity on the dsRNA and will not interfere with the directed destruction of the RNA transcribed from the target gene. In one embodiment, the third structure may be a chemical linking group. Many suitable chemical linking groups are known in the art and can be used. Alternatively, the third structure may be an oligonucleotide that links the two oligonucleotides of the dsRNA is a manner such that a hairpin structure is produced upon annealing of the two oligonucleotides making up the dsRNA composition. The hairpin structure will not block Dicer activity on the dsRNA and will not interfere with the directed destruction of the RNA transcribed from the target gene.
[0058] One feature of the dsRNA compositions of the present invention is that they can serve as a substrate for Dicer. Typically, the dsRNA compositions of this invention will not have been treated with Dicer, other RNases, or extracts that contain them. In the current invention this type of pretreatment can prevent Dicer annealing. Several methods are known and can be used for determining whether a dsRNA composition serves as a substrate for Dicer. For example, Dicer activity can be measured in vitro using the Recombinant Dicer Enzyme Kit (GTS, San Diego, Ca) according to the manufacturer's instructions. Dicer activity can be measured in vivo by treating cells with dsRNA and maintaining them for 24 h before harvesting them and isolating their RNA. RNA can be isolated using standard methods, such as with the RNeasy Kit (Qiagen) according to the manufacturer's instructions. The isolated RNA can be separated on a 10% PAGE gel which is used to prepare a standard RNA blot that can be probed with a suitable labeled deoxyoligonucleotide, such as an oligonucleotide labeled with the Starfire Oligo Labeling System (Integrated DNA Technologies, Inc., Coralville, Iowa).
[0059] The effect that a dsRNA has on a cell can depend upon the cell itself. In some circumstances a dsRNA could induce apoptosis or gene silencing in one cell type and not another. Thus, it is possible that a dsRNA could be suitable for use in one cell and not another. To be considered suitable a dsRNA composition need not be suitable under all possible circumstances in which it might be used, rather it need only be suitable under a particular set of circumstances.
[0060] Modifications can be included in the dsRNA, i.e., the precursor RNAi molecule, of the present invention so long as the modification does not prevent the dsRNA composition from serving as a substrate for Dicer. In one embodiment, one or more modifications are made that enhance Dicer processing of the dsRNA. In a second embodiment, one or more modifications are made that result in more effective RNAi generation. In a third embodiment, one or more modifications are made that support a greater RNAi effect. In a fourth embodiment, one or more modifications are made that result in greater potency per each dsRNA molecule to be delivered to the cell. Modifications can be incorporated in the 3-terminal region, the 5-terminal region, in both the 3-terminal and 5-terminal region or in some instances in various positions within the sequence. With the restrictions noted above in mind any number and combination of modifications can be incorporated into the dsRNA. Where multiple modifications are present, they may be the same or different. Modifications to bases, sugar moieties, the phosphate backbone, and their combinations are contemplated. Either 5-terminus can be phosphorylated.
[0061] Examples of modifications contemplated for the phosphate backbone include phosphonates, including methylphosphonate, phosphorothioate, and phosphotriester modifications such as alkylphosphotriesters, and the like. Examples of modifications contemplated for the sugar moiety include 2-alkyl pyrimidine, such as 2-O-methyl, 2-fluoro, amino, and deoxy modifications and the like (see, e.g., Amarzguioui et al., 2003). Examples of modifications contemplated for the base groups include abasic sugars, 2-O-alkyl modified pyrimidines, 4-thiouracil, 5-bromouracil, 5-iodouracil, and 5-(3-aminoallyl)-uracil and the like. Locked nucleic acids, or LNA's, could also be incorporated. Many other modifications are known and can be used so long as the above criteria are satisfied. Examples of modifications are also disclosed in U.S. Pat. Nos. 5,684,143, 5,858,988 and 6,291,438 and in U.S. published patent application No. 2004/0203145 A1, each incorporated herein by reference. Other modifications are disclosed in Herdewijn (2000), Eckstein (2000), Rusckowski et al. (2000), Stein et al. (2001) and Vorobjev et al. (2001).
[0062] Additionally, the dsRNA structure can be optimized to ensure that the oligonucleotide segment generated from Dicer's cleavage will be the portion of the oligonucleotide that is most effective in inhibiting gene expression. For example, in one embodiment of the invention a 27-bp oligonucleotide of the dsRNA structure is synthesized wherein the anticipated 21 to 22-bp segment that will inhibit gene expression is located on the 3-end of the antisense strand. The remaining bases located on the 5-end of the antisense strand will be cleaved by Dicer and will be discarded. This cleaved portion can be homologous (i.e., based on the sequence of the target sequence) or non-homologous and added to extend the nucleic acid strand.
[0063] RNA may be produced enzymatically or by partial/total organic synthesis, and modified ribonucleotides can be introduced by in vitro enzymatic or organic synthesis. In one embodiment, each strand is prepared chemically. Methods of synthesizing RNA molecules are known in the art, in particular, the chemical synthesis methods as described in Verma and Eckstein (1998) or as described herein.
[0064] As is known, RNAi methods are applicable to a wide variety of genes in a wide variety of organisms and the disclosed compositions and methods can be utilized in each of these contexts. Examples of genes which can be targeted by the disclosed compositions and methods include endogenous genes which are genes that are native to the cell or to genes that are not normally native to the cell. Without limitation these genes include oncogenes, cytokine genes, idiotype (Id) protein genes, prion genes, genes that expresses molecules that induce angiogenesis, genes for adhesion molecules, cell surface receptors, proteins involved in metastasis, proteases, apoptosis genes, cell cycle control genes, genes that express EGF and the EGF receptor, multi-drug resistance genes, such as the MDR1 gene.
[0065] More specifically, the target mRNA of the invention specifies the amino acid sequence of a cellular protein (e.g., a nuclear, cytoplasmic, transmembrane, or membrane-associated protein). In another embodiment, the target mRNA of the invention specifies the amino acid sequence of an extracellular protein (e.g., an extracellular matrix protein or secreted protein). As used herein, the phrase specifies the amino acid sequence of a protein means that the mRNA sequence is translated into the amino acid sequence according to the rules of the genetic code. The following classes of proteins are listed for illustrative purposes: developmental proteins (e.g., adhesion molecules, cyclin kinase inhibitors, Wnt family members, Pax family members, Winged helix family members, Hox family members, cytokines/lymphokines and their receptors, growth/differentiation factors and their receptors, neurotransmitters and their receptors); oncogene-encoded proteins (e.g., ABLI, BCLI, BCL2, BCL6, CBFA2, CBL, CSFIR, ERBA, ERBB, EBRB2, ETSI, ETSI, ETV6, FGR, FOS, FYN, HCR, HRAS, JUN, KRAS, LCK, LYN, MDM2, MLL, MYB, MYC, MYCLI, MYCN, NRAS, PIM I, PML, RET, SRC, TALI, TCL3, and YES); tumor suppressor proteins (e.g., APC, BRCA1, BRCA2, MADH4, MCC, NF I, NF2, RB I, TP53, and WTI); and enzymes (e.g., ACC synthases and oxidases, ACP desaturases and hydroxylases, ADP-glucose pyrophorylases, ATPases, alcohol dehydrogenases, amylases, amyloglucosidases, catalases, cellulases, chalcone synthases, chitinases, cyclooxygenases, decarboxylases, dextriinases, DNA and RNA polymerases, galactosidases, glucanases, glucose oxidases, granule-bound starch synthases, GTPases, helicases, hernicellulases, integrases, inulinases, invertases, isomerases, kinases, lactases, lipases, lipoxygenases, lysozymes, nopaline synthases, octopine synthases, pectinesterases, peroxidases, phosphatases, phospholipases, phosphorylases, phytases, plant growth regulator synthases, polygalacturonases, proteinases and peptidases, pullanases, recombinases, reverse transcriptases, RUBISCOs, topoisomerases, and xylanases).
[0066] In one aspect, the target mRNA molecule of the invention specifies the amino acid sequence of a protein associated with a pathological condition. For example, the protein may be a pathogen-associated protein (e.g., a viral protein involved in immunosuppression of the host, replication of the pathogen, transmission of the pathogen, or maintenance of the infection), or a host protein which facilitates entry of the pathogen into the host, drug metabolism by the pathogen or host, replication or integration of the pathogen's genome, establishment or spread of infection in the host, or assembly of the next generation of pathogen. Pathogens include RNA viruses such as flaviviruses, picornaviruses, rhabdoviruses, filoviruses, retroviruses, including lentiviruses, or DNA viruses such as adenoviruses, poxviruses, herpes viruses, cytomegaloviruses, hepadnaviruses or others. Additional pathogens include bacteria, fungi, helminths, schistosomes and trypanosomes. Other kinds of pathogens can include mammalian transposable elements. Alternatively, the protein may be a tumor-associated protein or an autoimmune disease-associated protein.
[0067] The target gene may be derived from or contained in any organism. The organism may be a plant, animal, protozoa, bacterium, virus or fungus. See e.g., U.S. Pat. No. 6,506,559, incorporated herein by reference.
[0068] In another aspect, the present invention provides for a pharmaceutical composition comprising the dsRNA of the present invention. The dsRNA sample can be suitably formulated and introduced into the environment of the cell by any means that allows for a sufficient portion of the sample to enter the cell to induce gene silencing, if it is to occur. Many formulations for dsRNA are known in the art and can be used so long as dsRNA gains entry to the target cells so that it can act. See, e.g., U.S. published patent application Nos. 2004/0203145 A1 and 2005/0054598 A1, each incorporated herein by reference. For example, dsRNA can be formulated in buffer solutions such as phosphate buffered saline solutions, liposomes, micellar structures, and capsids. Formulations of dsRNA with cationic lipids can be used to facilitate transfection of the dsRNA into cells. For example, cationic lipids, such as lipofectin (U.S. Pat. No. 5,705,188, incorporated herein by reference), cationic glycerol derivatives, and polycationic molecules, such as polylysine (published PCT International Application WO 97/30731, incorporated herein by reference), can be used. Suitable lipids include Oligofectamine, Lipofectamine (Life Technologies), NC388 (Ribozyme Pharmaceuticals, Inc., Boulder, Colo.), or FuGene 6 (Roche) all of which can be used according to the manufacturer's instructions.
[0069] It can be appreciated that the method of introducing dsRNA into the environment of the cell will depend on the type of cell and the make up of its environment. For example, when the cells are found within a liquid, one preferable formulation is with a lipid formulation such as in lipofectamine and the dsRNA can be added directly to the liquid environment of the cells. Lipid formulations can also be administered to animals such as by intravenous, intramuscular, or intraperitoneal injection, or orally or by inhalation or other methods as are known in the art. When the formulation is suitable for administration into animals such as mammals and more specifically humans, the formulation is also pharmaceutically acceptable. Pharmaceutically acceptable formulations for administering oligonucleotides are known and can be used. In some instances, it may be preferable to formulate dsRNA in a buffer or saline solution and directly inject the formulated dsRNA into cells, as in studies with oocytes. The direct injection of dsRNA duplexes may also be done. For suitable methods of introducing dsRNA see U.S. published patent application No. 2004/0203145 A1, incorporated herein by reference.
[0070] Suitable amounts of dsRNA must be introduced and these amounts can be empirically determined using standard methods. Typically, effective concentrations of individual dsRNA species in the environment of a cell will be about 50 nanomolar or less 10 nanomolar or less, or compositions in which concentrations of about 1 nanomolar or less can be used. In other embodiment, methods utilize a concentration of about 200 picomolar or less and even a concentration of about 50 picomolar or less can be used in many circumstances.
[0071] The method can be carried out by addition of the dsRNA compositions to any extracellular matrix in which cells can live provided that the dsRNA composition is formulated so that a sufficient amount of the dsRNA can enter the cell to exert its effect. For example, the method is amenable for use with cells present in a liquid such as a liquid culture or cell growth media, in tissue explants, or in whole organisms, including animals, such as mammals and especially humans
[0072] Expression of a target gene can be determined by any suitable method now known in the art or that is later developed. It can be appreciated that the method used to measure the expression of a target gene will depend upon the nature of the target gene. For example, when the target gene encodes a protein the term expression can refer to a protein or transcript derived from the gene. In such instances the expression of a target gene can be determined by measuring the amount of mRNA corresponding to the target gene or by measuring the amount of that protein. Protein can be measured in protein assays such as by staining or immunoblotting or, if the protein catalyzes a reaction that can be measured, by measuring reaction rates. All such methods are known in the art and can be used. Where the gene product is an RNA species expression can be measured by determining the amount of RNA corresponding to the gene product. Several specific methods for detecting gene expression are described in Example 1. The measurements can be made on cells, cell extracts, tissues, tissue extracts or any other suitable source material.
[0073] The determination of whether the expression of a target gene has been reduced can be by any suitable method that can reliably detect changes in gene expression. Typically, the determination is made by introducing into the environment of a cell undigested dsRNA such that at least a portion of that dsRNA enters the cytoplasm and then measuring the expression of the target gene. The same measurement is made on identical untreated cells and the results obtained from each measurement are compared.
[0074] The dsRNA can be formulated as a pharmaceutical composition which comprises a pharmacologically effective amount of a dsRNA and pharmaceutically acceptable carrier. A pharmacologically or therapeutically effective amount refers to that amount of a dsRNA effective to produce the intended pharmacological, therapeutic or preventive result. The phrases pharmacologically effective amount and therapeutically effective amount or simply effective amount refer to that amount of an RNA effective to produce the intended pharmacological, therapeutic or preventive result. For example, if a given clinical treatment is considered effective when there is at least a 20% reduction in a measurable parameter associated with a disease or disorder, a therapeutically effective amount of a drug for the treatment of that disease or disorder is the amount necessary to effect at least a 20% reduction in that parameter.
[0075] The phrase pharmaceutically acceptable carrier refers to a carrier for the administration of a therapeutic agent. Exemplary carriers include saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. For drugs administered orally, pharmaceutically acceptable carriers include, but are not limited to pharmaceutically acceptable excipients such as inert diluents, disintegrating agents, binding agents, lubricating agents, sweetening agents, flavoring agents, coloring agents and preservatives. Suitable inert diluents include sodium and calcium carbonate, sodium and calcium phosphate, and lactose, while corn starch and alginic acid are suitable disintegrating agents. Binding agents may include starch and gelatin, while the lubricating agent, if present, will generally be magnesium stearate, stearic acid or talc. If desired, the tablets may be coated with a material such as glyceryl monostearate or glyceryl distearate, to delay absorption in the gastrointestinal tract. The pharmaceutically acceptable carrier of the disclosed dsRNA composition may be micellar structures, such as a liposomes, capsids, capsoids, polymeric nanocapsules, or polymeric microcapsules.
[0076] Polymeric nanocapsules or microcapsules facilitate transport and release of the encapsulated or bound dsRNA into the cell. They include polymeric and monomeric materials, especially including polybutylcyanoacrylate. A summary of materials and fabrication methods has been published (see Kreuter, 1991). The polymeric materials which are formed from monomeric and/or oligomeric precursors in the polymerization/nanoparticle generation step, are per se known from the prior art, as are the molecular weights and molecular weight distribution of the polymeric material which a person skilled in the field of manufacturing nanoparticles may suitably select in accordance with the usual skill.
[0077] Suitably formulated pharmaceutical compositions of this invention can be administered by any means known in the art such as by parenteral routes, including intravenous, intramuscular, intraperitoneal, subcutaneous, transdermal, airway (aerosol), rectal, vaginal and topical (including buccal and sublingual) administration. In some embodiments, the pharmaceutical compositions are administered by intravenous or intraparenteral infusion or injection.
[0078] In general a suitable dosage unit of dsRNA will be in the range of 0.001 to 0.25 milligrams per kilogram body weight of the recipient per day, or in the range of 0.01 to 20 micrograms per kilogram body weight per day, or in the range of 0.01 to 10 micrograms per kilogram body weight per day, or in the range of 0.10 to 5 micrograms per kilogram body weight per day, or in the range of 0.1 to 2.5 micrograms per kilogram body weight per day. Pharmaceutical composition comprising the dsRNA can be administered once daily. However, the therapeutic agent may also be dosed in dosage units containing two, three, four, five, six or more sub-doses administered at appropriate intervals throughout the day. In that case, the dsRNA contained in each sub-dose must be correspondingly smaller in order to achieve the total daily dosage unit. The dosage unit can also be compounded for a single dose over several days, e.g., using a conventional sustained release formulation which provides sustained and consistent release of the dsRNA over a several day period. Sustained release formulations are well known in the art. In this embodiment, the dosage unit contains a corresponding multiple of the daily dose. Regardless of the formulation, the pharmaceutical composition must contain dsRNA in a quantity sufficient to inhibit expression of the target gene in the animal or human being treated. The composition can be compounded in such a way that the sum of the multiple units of dsRNA together contain a sufficient dose.
[0079] Data can be obtained from cell culture assays and animal studies to formulate a suitable dosage range for humans. The dosage of compositions of the invention lies within a range of circulating concentrations that include the ED.sub.50 (as determined by known methods) with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For any compound used in the method of the invention, the therapeutically effective dose can be estimated initially from cell culture assays. A dose may be formulated in animal models to achieve a circulating plasma concentration range of the compound that includes the IC.sub.50 (i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels of dsRNA in plasma may be measured by standard methods, for example, by high performance liquid chromatography.
[0080] In a further aspect, the present invention relates to a method for treating a subject having a disease or at risk of developing a disease caused by the expression of a target gene. In this embodiment, the dsRNA can act as novel therapeutic agents for controlling one or more of cellular proliferative and/or differentiative disorders, disorders associated with bone metabolism, immune disorders, hematopoietic disorders, cardiovascular disorders, liver disorders, viral diseases, or metabolic disorders. The method comprises administering a pharmaceutical composition of the invention to the patient (e.g., human), such that expression of the target gene is silenced. Because of their high specificity, the dsRNAs of the present invention specifically target mRNAs of target genes of diseased cells and tissues.
[0081] In the prevention of disease, the target gene may be one which is required for initiation or maintenance of the disease, or which has been identified as being associated with a higher risk of contracting the disease. In the treatment of disease, the dsRNA can be brought into contact with the cells or tissue exhibiting the disease. For example, dsRNA substantially identical to all or part of a mutated gene associated with cancer, or one expressed at high levels in tumor cells, e.g. aurora kinase, may be brought into contact with or introduced into a cancerous cell or tumor gene.
[0082] Examples of cellular proliferative and/or differentiative disorders include cancer, e.g., carcinoma, sarcoma, metastatic disorders or hematopoietic neoplastic disorders, e.g., leukemias. A metastatic tumor can arise from a multitude of primary tumor types, including but not limited to those of prostate, colon, lung, breast and liver origin. As used herein, the terms cancer, hyperproliferative, and neoplastic refer to cells having the capacity for autonomous growth, i.e., an abnormal state of condition characterized by rapidly proliferating cell growth. These terms are meant to include all types of cancerous growths or oncogenic processes, metastatic tissues or malignantly transformed cells, tissues, or organs, irrespective of histopathologic type or stage of invasiveness. Proliferative disorders also include hematopoietic neoplastic disorders, including diseases involving hyperplastic/neoplatic cells of hematopoictic origin, e.g., arising from myeloid, lymphoid or erythroid lineages, or precursor cells thereof.
[0083] The present invention can also be used to treat a variety of immune disorders, in particular those associated with overexpression of a gene or expression of a mutant gene. Examples of hematopoietic disorders or diseases include, without limitation, autoimmune diseases (including, for example, diabetes mellitus, arthritis (including rheumatoid arthritis, juvenile rheumatoid arthritis, osteoarthritis, psoriatic arthritis), multiple sclerosis, encephalomyelitis, myasthenia gravis, systemic lupus erythematosis, automimmune thyroiditis, dermatitis (including atopic dermatitis and eczematous dermatitis), psoriasis, Sjogren's Syndrome, Crohn's disease, aphthous ulcer, iritis, conjunctivitis, keratoconjunctivitis, ulcerative colitis, asthma, allergic asthma, cutaneous lupus erythematosus, scleroderma, vaginitis, proctitis, drug eruptions, leprosy reversal reactions, erythema nodosum leprosum, autoimmune uveitis, allergic encephalomyclitis, acute necrotizing hemorrhagic encephalopathy, idiopathic bilateral progressive sensorineural hearing, loss, aplastic anemia, pure red cell anemia, idiopathic thrombocytopenia, polychondritis, Wegener's granulomatosis, chronic active hepatitis, Stevens-Johnson syndrome, idiopathic sprue, lichen planus, Graves' disease, sarcoidosis, primary biliary cirrhosis, uveitis posterior, and interstitial lung fibrosis), graft-versus-host disease, cases of transplantation, and allergy.
[0084] In another embodiment, the invention relates to a method for treating viral diseases, including but not limited to human papilloma virus, hepatitis C, hepatitis B, herpes simplex virus (HSV), HIV-AIDS, poliovirus, and smallpox virus. dsRNAs of the invention are prepared as described herein to target expressed sequences of a virus, thus ameliorating viral activity and replication. The molecules can be used in the treatment and/or diagnosis of viral infected tissue, both animal and plant. Also, such molecules can be used in the treatment of virus-associated carcinoma, such as hepatocellular cancer.
[0085] The dsRNA of the present invention can also be used to inhibit the expression of the multi-drug resistance 1 gene (MDR1). Multi-drug resistance (MDR) broadly refers to a pattern of resistance to a variety of chemotherapeutic drugs with unrelated chemical structures and different mechanisms of action. Although the etiology of MDR is multifactorial, the overexpression of P-glycoprotein (Pgp), a membrane protein that mediates the transport of MDR drugs, remains the most common alteration underlying MDR in laboratory models (Childs and Ling, 1994). Moreover, expression of Pgp has been linked to the development of MDR in human cancer, particularly in the leukemias, lymphomas, multiple myeloma, neuroblastoma, and soft tissue sarcoma (Fan et al.). Recent studies showed that tumor cells expressing MDR-associated protein (MRP) (Cole et al., 1992), lung resistance protein (LRP) (Scheffer et al., 1995) and mutation of DNA topoisomerase II (Beck, 1989) also may render MDR.
[0086] The practice of the present invention employs, unless otherwise indicated, conventional techniques of chemistry, molecular biology, microbiology, recombinant DNA, genetics, immunology, cell biology, cell culture and transgenic biology, which are within the skill of the art. See, e.g., Maniatis et al., 1982, Molecular Cloning (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.); Sambrook et al., 1989, Molecular Cloning, 2nd Ed. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.); Sambrook and Russell, 2001, Molecular Cloning, 3rd Ed. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.); Ausubel et al., 1992), Current Protocols in Molecular Biology (John Wiley & Sons, including periodic updates); Glover, 1985, DNA Cloning (IRL Press, Oxford); Anand, 1992; Guthrie and Fink, 1991; Harlow and Lane, 1988, Antibodies, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.); Jakoby and Pastan, 1979; Nucleic Acid Hybridization (B. D. Hames & S. J. Higgins eds. 1984); Transcription And Translation (B. D. Hames & S. J. Higgins eds. 1984); Culture Of Animal Cells (R. I. Freshney, Alan R. Liss, Inc., 1987); Immobilized Cells And Enzymes (IRL Press, 1986); B. Perbal, A Practical Guide To Molecular Cloning (1984); the treatise, Methods In Enzymology (Academic Press, Inc., N.Y.); Gene Transfer Vectors For Mammalian Cells (J. H. Miller and M. P. Calos eds., 1987, Cold Spring Harbor Laboratory); Methods In Enzymology, Vols. 154 and 155 (Wu et al. eds.), Immunochemical Methods In Cell And Molecular Biology (Mayer and Walker, eds., Academic Press, London, 1987); Handbook Of Experimental Immunology, Volumes I-IV (D. M. Weir and C. C. Blackwell, eds., 1986); Riott, Essential Immunology, 6th Edition, Blackwell Scientific Publications, Oxford, 1988; Hogan et al., Manipulating the Mouse Embryo, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1986); Westerfield, M., The zebrafish book. A guide for the laboratory use of zebrafish (Danio rerio), (4th Ed., Univ. of Oregon Press, Eugene, 2000).
EXAMPLES
[0087] The present invention is described by reference to the following Examples, which are offered by way of illustration and are not intended to limit the invention in any manner Standard techniques well known in the art or the techniques specifically described below were utilized.
Example 1
Preparation of Double-Stranded RNA Oligonucleotides
[0088] Oligonucleotide Synthesis and Purification
[0089] RNA oligonucleotides were synthesized using solid phase phosphoramidite chemistry, deprotected and desalted on NAP-5 columns (Amersham Pharmacia Biotech, Piscataway, N.J.) using standard techniques (Damha and Olgivie, 1993; Wincott et al., 1995). The oligomers were purified using ion-exchange high performance liquid chromatography (IE-HPLC) on an Amersham Source 15Q column (1.0 cm25 cm) (Amersham Pharmacia Biotech, Piscataway, N.J.) using a 15 min step-linear gradient. The gradient varied from 90:10 Buffers A:B to 52:48 Buffers A:B, where Buffer A was 100 mM Tris pH 8.5 and Buffer B was 100 mM Tris pH 8.5, 1 M NaCl. Samples were monitored at 260 nm and peaks corresponding to the full-length oligonucleotide species were collected, pooled, desalted on NAP-5 columns, and lyophilized
[0090] The purity of each oligomer was determined by capillary electrophoresis (CE) on a Beckman PACE 5000 (Beckman Coulter, Inc., Fullerton, Calif.). The CE capillaries had a 100 m inner diameter and contained ssDNA 100R Gel (Beckman-Coulter). Typically, about 0.6 nmole of oligonucleotide was injected into a capillary, ran in an electric field of 444 V/cm and detected by UV absorbance at 260 nm. Denaturing Tris-Borate-7 M-urea running buffer was purchased from Beckman-Coulter. Oligoribonucleotides were at least 90% pure as assessed by CE for use in experiments described below. Compound identity was verified by matrix-assisted laser desorption ionization time-of-flight (MALDI-TOF) mass spectroscopy on a Voyager DE Biospectometry Work Station (Applied Biosystems, Foster City, Calif.) following the manufacturer's recommended protocol. Relative molecular masses of all oligomers were within 0.2% of expected molecular mass.
[0091] Preparation of Duplexes
[0092] Single-stranded RNA (ssRNA) oligomers were resuspended at 100 M concentration in duplex buffer consisting of 100 mM potassium acetate, 30 mM HEPES, pH 7.5. Complementary sense and antisense strands were mixed in equal molar amounts to yield a final solution of 50 M duplex. Samples were heated to 95 C. for 5 and allowed to cool to room temperature before use. Double-stranded RNA (dsRNA) oligomers were stored at 20 C. Single-stranded RNA oligomers were stored lyophilized or in nuclease-free water at 80 C.
[0093] Nomenclature
[0094] For consistency, the following nomenclature has been employed throughout the specification and Examples. Names given to duplexes indicate the length of the oligomers and the presence or absence of overhangs. A 21+2 duplex contains two RNA strands both of which are 21 nucleotides in length, also termed a 21mer siRNA duplex, and having a 2 base 3-overhang. A 21-2 design is a 21mer siRNA duplex with a 2 base 5-overhang. A 21-0 design is a 21mer siRNA duplex with no overhangs (blunt). A 21+2UU is a 21mer duplex with 2-base 3-overhang and the terminal 2 bases at the 3-ends are both U residues (which may result in mismatch with target sequence). A 25/27 is an asymmetric duplex having a 25 base sense strand and a 27 base antisense strand with a 2-base 3-overhang. A 27/25 is an asymmetric duplex having a 27 base sense strand and a 25 base antisense strand.
Example 2
Increased Potency of 25mers
[0095] This example demonstrates that dsRNAs having strands that are 25 nucleotides in length or longer have surprisingly increased potency in mammalian systems than known 21mer to 23mer siRNAs.
[0096] During investigations of the effects of different 5 and 3 end structures of dsRNAs made through bacteriophage T7 in vitro transcription (Kim et al., 2004), we observed that some seemed to have greater potency than synthetic 21mer siRNAs directed to the same target site, and that this property seemed to correlate with length. To further explore this phenomenon, we systematically studied the silencing properties of chemically synthesized duplex RNAs of different lengths and designs.
[0097] Cell Culture, Transfection, and EGFP Assays
[0098] HEK 293 cells were split in 24-well plates to 60% confluency in DMEM medium 1 d before transfection. After adding the aliquot of each RNA, 50 l of Opti Media containing the reporter vectors was added. Next, 50 l of Opti Media containing 1.5 l of Lipofectamine 2000 (Invitrogen) was mixed and incubated for 15 min. The cells were then added in 0.4 ml of DMEM medium. To normalize for transfection efficiency, each assay included cotransfection of the target and/or duplex RNAs with either firefly luciferase or a red fluorescent protein (RFP) reporter plasmid (all other assays). For the luciferase assay, the Steady Glo Luciferase assay kit was used according to manufacturer's instructions (Promega). For RFP cotransfection, the indicated amount of EGFP reporter plasmid (pLEGFP-C1 vector, Clontech) was transfected with 20 ng of RFP reporter plasmid (pDsRed2-C1, BD Sciences). After 24 h, RFP expression was monitored by fluorescence microscopy. Only experiments where transfection efficiency was >90% (as assessed by RFP expression) were evaluated. EGFP expression was measured 24 h later. EGFP expression was determined either from the median number of EGFP-fluorescent cells determined by FACS (live cells) or by fluorometer readings (cell extracts).
[0099] For EGFP assays using NIH3T3 cells stably expressing EGFP, measurements were determined using a VersaFluor Fluorometer (Bio-Rad) using excitation filter D490 and emission filter D520. Before transfections, cells were seeded to approximately 30% confluency in a 24-well plate. On day 0, cells were transfected as described above and the medium was changed on day 1 after transfection. The first EGFP assay was carried out on day 3. For extract preparation 110.sup.5 cells were taken and 110.sup.4 cells were further propagated for the day 6 EGFP assays. On days 6 and 9 the same procedure was repeated.
[0100] Extract measurements of EGFP were obtained as follows: 110.sup.5 cells were suspended in 300 l of PBS and sonicated for 10 s followed by a 2-min microcentrifugation. The supernatants were used for fluorescence measurements. Percentages of EGFP expression were determined relative to extracts prepared from untreated NIH3T3 cells.
[0101] Nucleic Acid Reagents
[0102] The reporter system employed EGFP either as a transfection plasmid vector pEGFP-C1 (Clontech, Palo Alto, Calif.) or as a stable transformant in an NIH 3T3 cell line. The coding sequence of EGFP is shown in Table 1, from Genbank accession #U55763. The ATG start codon and TAA stop codons are highlighted in bold font and sites target by siRNA reagents in this Example and other Examples are underscored.
TABLE-US-00001 TABLE1 NucleotideSequenceofEGFP atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggcca caagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccg gcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgac cacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaagga cgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggca tcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatg gccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgc cgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagt ccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcact ctcggcatggacgagctgtacaagtaa(SEQIDNO:1)
[0103] Site-1 used for siRNA targeting in EGFP for this example was:
TABLE-US-00002 SITE1: (SEQIDNO:2) 5 GCAAGCUGACCCUGAAGUUCAUCUGCACCACCGGCAAGC3.
[0104] RNA duplexes were synthesized and prepared as described in Example 1. RNA duplexes targeting EGFP Site-1 are summarized in Table 2. Some sequences had the dinucleotide sequence UU placed at the 3-end of the sense strand (Elbashir et al., 2001c; Hohjoh, 2002). Mismatches that resulted from including 3-terminal UU or where a mismatch was intentionally positioned are highlighted in bold and underscored.
TABLE-US-00003 TABLE2 SummaryofOligonucleotideReagents,EGFPSite-1 Sequence Name SEQIDNO. 5 GCAAGCUGACCCUGAAGUUCAUCUGCACCACCGGCAAGC3 EGFPSite-1 SEQIDNO:2 5 GCAAGCUGACCCUGAAGUUCA EGFPS1-21-2 SEQIDNo:3 3 UUCGACUGGGACUUCAAGUAG SEQIDNO:4 5 AAGCUGACCCUGAAGUUCAUC EGFPS1-21+ 0 SEQIDNo:5 3 UUCGACUGGGACUUCAAGUAG SEQIDNo:6 5 CCUGAAGUUCAUCUGCACCAC EGFPS1-21+ 2(1) SEQIDNo:7 3 UGGGACUUCAAGUAGACGUGG SEQIDNo:8 5 CCCUGAAGUUCAUCUGCACCA EGFPS1-21+ 2(2) SEQIDNo:9 3 CUGGGACUUCAAGUAGACGUG SEQIDNo:10 5 ACCCUGAAGUUCAUCUGCACC EGFPS1-21+ 2(3) SEQIDNo:11 3 ACUGGGACUUCAAGUAGACGU SEQIDNo:12 5 GACCCUGAAGUUCAUCUGCAC EGFPS1-21+ 2(4) SEQIDNo:13 3 GACUGGGACUUCAAGUAGACG SEQIDNo:14 5 UGACCCUGAAGUUCAUCUGCA EGFPS1-21+ 2(5) SEQIDNo:15 3 CGACUGGGACUUCAAGUAGAC SEQIDNo:16 5 CUGACCCUGAAGUUCAUCUGC EGFPS1-21+ 2(6) SEQIDNo:17 3 UCGACUGGGACUUCAAGUAGA SEQIDNo:18 5 GCUGACCCUGAAGUUCAUCUG EGFPS1-21+ 2(7) SEQIDNo:19 3 UUCGACUGGGACUUCAAGUAG SEQIDNo:20 5 GCAAGCUGACCCUGAAGUUCAUU EGFPS1-23-2UU SEQIDNo:21 3 UUCGACUGGGACUUCAAGUAGAC SEQIDNo:22 5 GCUGACCCUGAAGUUCAUCUGUU EGFPS1-23+ 2UU SEQIDNo:23 3 UUCGACUGGGACUUCAAGUAGAC SEQIDNo:24 5 GCAAGCUGACCCUGAAGUUCAUUU EGFPS1-24-2UU SEQIDNo:25 3 UUCGACUGGGACUUCAAGUAGACG SEQIDNo:26 5 GCUGACCCUGAAGUUCAUCUGCUU EGFPS1-24+ 2UU SEQIDNo:27 3 UUCGACUGGGACUUCAAGUAGACG SEQIDNo:28 5 GCAAGCUGACCCUGAAGUUCAUCUU EGFPS1-25-2UU SEQIDNo:29 3 UUCGACUGGGACUUCAAGUAGACGU SEQIDNo:30 5 GCUGACCCUGAAGUUCAUCUGCAUU EGFPS1-25+ 2UU SEQIDNo:31 3 UUCGACUGGGACUUCAAGUAGACGU SEQIDNo:32 5 AAGCUGACCCUGAAGUUCAUCUGCAC EGFPS1-26+ 0 SEQIDNo:33 3 UUCGACUGGGACUUCAAGUAGACGUG SEQIDNo:34 5 AAGCUGACCCUGAAGUUCAUCUGCUU EGFPS1-26+ 0UU SEQIDNo:35 3 UUCGACUGGGACUUCAAGUAGACGUG SEQIDNo:36 5 GCAAGCUGACCCUGAAGUUCAUCUUU EGFPS1-26-2UU SEQIDNo:37 3 UUCGACUGGGACUUCAAGUAGACGUG SEQIDNo:38 5 GCUGACCCUGAAGUUCAUCUGCACUU EGFPS1-26+ 2UU SEQIDNo:39 3 UUCGACUGGGACUUCAAGUAGACGUG SEQIDNo:40 5 AAGCUGACCCUGAAGUUCAUCUGCACC EGFPS1-27+ 0 SEQIDNo:41 3 UUCGACUGGGACUUCAAGUAGACGUGG SEQIDNo:42 5 F-AAGCUGACCCUGAAGUUCAUCUGCACC EGFPS1-27+ 0 SEQIDNo:43 3 UUCGACUGGGACUUCAAGUAGACGUGG-F FAM#1 SEQIDNo:44 5 AAGCUGACCCUGAAGUUCAUCUGCACC-F EGFPS1-27+ 0 SEQIDNo:45 3 UUCGACUGGGACUUCAAGUAGACGUGG-F FAM#2 SEQIDNo:44 5 F-AAGCUGACCCUGAAGUUCAUCUGCACC EGFPS1-27+ 0 SEQIDNo:43 3 F-UUCGACUGGGACUUCAAGUAGACGUGG FAM#4 SEQIDNo:46 5 AAGCUGACCCUGAAGUUCAUCUGCACC-F EGFPS1-27+ 0 SEQIDNo:45 3 F-UUCGACUGGGACUUCAAGUAGACGUGG FAM#5 SEQIDNo:46 5 AAGCUGACCCUGAAGUUCAUCUGCAUU EGFPS1-27+ 0UU SEQIDNo:47 3 UUCGACUGGGACUUCAAGUAGACGUGG SEQIDNo:48 5 GCAAGCUGACCCUGAAGUUCAUCUGUU EGFPS1-27-2UU SEQIDNo:49 3 UUCGACUGGGACUUCAAGUAGACGUGG SEQIDNo:50 5 GCUGACCCUGAAGUUCAUCUGCACAUU EGFPS1-27+ 2UU/ SEQIDNo:51 3 UUCGACUGGGACUUCAAGUAGACGUGG 25 SEQIDNo:52 5 AAGCUGACCCUGAAGAUCAUCUGCAUU EGFPS1-27+ 0UU/ SEQIDNo:53 3 UUCGACUGGGACUUCUAGUAGACGUGG 16 SEQIDNo:54 5 AAGCUGACCCUGAAGAACAUCUGCAUU EGFPS1-27+ 0UU/ SEQIDNo:55 3 UUCGACUGGGACUUCUUGUAGACGUGG 16,17 SEQIDNo:56 5 AAGCUGACCCUGAACAACAUCUGCAUU EGFPS1-27+ 0UU/ SEQIDNo:57 3 UUCGACUGGGACUUGUUGUAGACGUGG 15,16,17 SEQIDNo:58 5 AAGCUGACCCUGUUCAUCAUCUGCACC EGFPS1-27+ 0-mut SEQIDNo:59 3 UUCGACUGGGACAAGUAGUAGACGUGG SEQIDNo:60 5 AAGCUGACCCUGAAGUUCAUCUGCACCA EGFPS1-28+ 0 SEQIDNo:61 3 UUCGACUGGGACUUCAAGUAGACGUGGU SEQIDNo:62 5 AAGCUGACCCUGAAGUUCAUCUGCACCAC EGFPS1-29+ 0 SEQIDNo:63 3 UUCGACUGGGACUUCAAGUAGACGUGGUG SEQIDNo:64 5 AAGCUGACCCUGAAGUUCAUCUGCACCACC EGFPS1-30+ 0 SEQIDNo:65 3 UUCGACUGGGACUUCAAGUAGACGUGGUGG SEQIDNo:66 5 AAGCUGACCCUGAAGUUCAUCUGCACCACCGGCAA EGFPS1-35+ 0 SEQIDNO:67 3 UUCGACUGGGACUUCAAGUAGACGUGGUGGCCGUU SEQIDNO:68 5 AAGCUGACCCUGAAGUUCAUCUGCACCACCGGCAAGCUGC EGFPS1-40+ 0 SEQIDNO:69 3 UUCGACUGGGACUUCAAGUAGACGUGGUGGCCGUUCGACG SEQIDNO:70 5 AAGCUGACCCUGAAGUUCAUCUGCACCACCGGCAAGCUGCCCGUG EGFPS1-45+ 0 SEQIDNO:71 3 UUCGACUGGGACUUCAAGUAGACGUGGUGGCCGUUCGACGGGCAC SEQIDNO:72
[0105] Results
[0106] An expanded set of synthetic RNA duplexes of varying length containing 3 overhangs, 5 overhangs or blunt ends were tested for their relative potency in a model system targeting site 1 in EGFP (Kim et al., 2003). We carried out our initial transfections using 50 nM of the various RNA duplexes (
Example 3
Dicer Substrates
[0107] This example demonstrates a method for determining whether a dsRNA serves as a substrate for Dicer.
[0108] In vitro Dicer Cleavage Assays
[0109] RNA duplexes (100 pmol) were incubated in 20 l of 20 mM Tris pH 8.0, 200 mM NaCl, 2.5 mM MgCl.sub.2 with 1 unit of recombinant human Dicer (Stratagene) for 24 h. A 3 l aliquot of each reaction (15 pmol RNA) was separated in a 15% nondenaturing polyacrylamide gel, stained with GelStar (Ambrex) and visualized using UV excitation.
[0110] Results
[0111] Incubation of 21-bp to 27-bp RNA duplexes with recombinant human Dicer resulted in cleavage of the 23mer, 25mer and 27mer duplexes, but not the 21mer duplex (
Example 4
Effect of End-Modification on Dicer Activity
[0112] The effect of end-modification of dsRNA was tested using the in vitro Dicer cleavage assay described in Example 3.
[0113] For the 27mer duplexes, we tested the effects of fluorescein end-modification on Dicer activity and the ability to trigger RNAi silencing. RNA oligonucleotides were synthesized for the EGFPS1 site with 6-carboxyfluorescein (6FAM) attached to the 5 end of the sense (S) strand, 3 end of the S-strand, 5 end of the antisense (AS) strand and 3 end of the AS strand. Pairwise combinations were used to make duplex RNAs (
Example 5
In Vivo Processing by Dicer
[0114] This example confirms that the 27mer dsRNA are processed in vivo by Dicer.
[0115] Assay for Intracellular Processing of 27mer RNAs
[0116] RNA duplexes were transfected as described above into HEK293 cells in a six-well plate at 10 nM. After 14 h, total RNA was prepared as described below. First, 20 g of total RNA was heated for 10 mM at 75 C. and mixed with .sup.32P 5-end-labeled oligonucleotide probe (5-ACCCTGAAGTTCATCTGCACC-3; SEQ ID NO:73) and hybridized in 150 mM NaCl, 50 mM Tris-HCl, pH. 7.4, 1 mM EDTA) at 24 C. Samples were loaded on 7.5% nondenaturing polyacrylamide gel and separated at 200 V for 3 h at 4 C., and the gel was exposed to X-ray film. .sup.32P-end-labeled 27mer and 21mer duplex RNA oligos were used as size standards.
[0117] Results
[0118] To confirm that the 27mer dsRNAs are processed by Dicer in vivo, we transfected HEK293 cells with 10 nM of the duplex 3 (unmodified) or duplex 5 (both 3 ends modified with 6FAM). After 14 h, total RNA was isolated and hybridized with a .sup.32P end labeled 21mer probe oligo (S strand). RNA was separated by nondenaturing PAGE and visualized by autoradiography (
Example 6
Potency of dsRNAs
[0119] This example examines the potency of potential cleavage products of the 27mer by Dicer.
[0120] Cleavage of a 27mer by Dicer could result in a variety of distinct 21mers depending on where cleavage occurs; it is possible that one or a mix of these possible 21mers is significantly more potent than the specific 21mer that we used as our standard for comparison. To test this possibility we synthesized seven different 21mers that could be derived from the EGFPS1 27+0 duplex, walking in single-base steps along the antisense strand, using the traditional 21+2 design. These seven duplexes were tested for RNAi activity in the HEK293 cell cotransfection assay individually and as a pool (
Example 7
Analysis of Dicer Cleavage Products
[0121] This example analyzed the in vitro Dicer cleavage products by mass spectroscopy.
[0122] Electrospray-Ionization Liquid Chromatography Mass Spectroscopy
[0123] Electrospray-ionization liquid chromatography mass spectroscopy (ESI-LCMS) of duplex RNAs before and after treatment with Dicer were done using an Oligo HTCS system (Novatia), which consisted of ThermoFinnigan TSQ7000, Xcalibur data system, ProMass data processing software and Paradigm MS4 HPLC (Michrom BioResources). The liquid chromatography step used before injection into the mass spectrometer (LC-MS) removes most of the cations complexed with the nucleic acids; some sodium ions can remain bound to the RNA and are visualized as minor +22 or +44 species, reflecting the net mass gain seen with substitution of sodium for hydrogen.
[0124] Results
[0125] The species that are actually produced by incubation of the EGFPS1 27+0 duplex with recombinant Dicer in vitro were identified using electrospray ionization mass spectrometry (ESI MS) (
TABLE-US-00004 TABLE3 MolecularWeightsofPossible21merDuplexes Derivedfromthe27merDuplexbyDicerProcessing Sequence(SEQIDNO:) Name MolWt* 5 AAGCUGACCCUGAAGUUCAUCUGCACC(41) EGFPS1-27+ 0 8552 3 UUCGACUGGGACUUCAAGUAGACGUGG(42) 8689 5 ACCCUGAAGUUCAUCUGCACC(11) EGFPS1-21+ 2(3) 6672** 3 ACUGGGACUUCAAGUAGACGU(12) 6816** 5 GACCCUGAAGUUCAUCUGCAC(13) EGFPS1-21+ 2(4) 6712** 3 GACUGGGACUUCAAGUAGACG(14) 6855 5 UGACCCUGAAGUUCAUCUGCA(15) EGFPS1-21+ 2(5) 6713** 3 CGACUGGGACUUCAAGUAGAC(16) 6815** 5 CUGACCCUGAAGUUCAUCUGC(17) EGFPS1-21+ 2(6) 6689 3 UCGACUGGGACUUCAAGUAGA(18) 6816** 5 GCUGACCCUGAAGUUCAUCUG(19) EGFPS1-21+ 2(7) 6729 3 UUCGACUGGGACUUCAAGUAG(20) 6793 *Molecular weight of 27 mer is the original chemically synthesized duplex with hydroxyl ends. Calculated weights of 21 mers assume 5phosphate on each strand after Dicer Processing. **Indicates masses that were consistent with visualized peaks in FIG. 4B.
Example 8
Further Characterization of Inhibitory Properties of 27mer dsRNA
[0126] To further characterize the inhibitory properties of the 27mer dsRNA in cells stably expressing the EGFP target, stably transfected NIH3T3 cells expressing EGFP were transfected with 21+2 and 27+0 dsRNA duplexes (both at 5 nM). To obtain a quantitative estimate of the duration of gene suppression, we carried out a time-course experiment, observing EGFP expression on days 2, 4, 6, 8 and 10 after transfection. Cell extracts were prepared and measured for EGFP fluorescence using a fluorometer (
Example 9
Effect of 27mer dsRNA on Site Selection
[0127] A frequent problem in using RNAi as a tool to systematically inhibit the expression of any gene is that not all target sites are equally susceptible to suppression by siRNAs (Sherer and Rossi, 2004), necessitating complex design algorithms to predict effective sites (Reynolds et al., 2004; Ui-Tei et al., 2004; Amarzguioui and Prydz, 2004). We therefore asked whether the increased potency of the 27mer dsRNA permits effective targeting at sites that are not active using traditional 21mer siRNAs. Duplex RNAs were made having 21+2 and 27+0 designs to two sites in EGFP (EGFP-S2 and EGFP-S3) both previously shown to be refractory to RNAi using standard siRNAs (Kime and Rossi, 2003).
[0128] Nucleic Acid Reagents
[0129] The reporter system employed EGFP as in SEQ ID NO:1 above. Site-2 (also termed bad site I) and Site-3 (also termed bad site 2) in EGFP were targeted. RNA duplexes were synthesized and prepared as described in Example 1. Site-2 and Site 3 used for siRNA targeting in EGFP for this example were:
TABLE-US-00005 (SEQIDNO:74) SITE2:5 UGAAGCAGCACGACUUCUUCAAGUCCGCCAUG3 and (SEQIDNO:75) SITE3:5 UGAAGUUCGAGGGCGACACCCUGGUGAACCGCAU3.
[0130] RNA duplexes targeting EGFP Site-2 and EGFP Site-3 are summarized in Table 4.
TABLE-US-00006 TABLE4 SummaryofOligonucleotideReagents,EGFPSite-2 Sequence Name SEQIDNO: 5 UGAAGCAGCACGACUUCUUCAAGUCCGCCAUG3 EGFPSite-2 SEQIDNO:74 5 GCAGCACGACUUCUUCAAGUU EGFPS2-21+ 2 SEQIDNO:76 3 UUCGUCGUGCUGAAGAAGUUC SEQIDNO:77 5 AAGCAGCACGACUUCUUCAAGUCCGCC EGFPS2-27+ 0 SEQIDNO:78 3 UUCGUCGUGCUGAAGAAGUUCAGGCGG SEQIDNO:79 5 UGAAGUUCGAGGGCGACACCCUGGUGAACCGCAU3 EGFPSite-3 SEQIDNO:75 5 GUUCGAGGGCGACACCCUGUU EGFPS3-21+ 2 SEQIDNO:80 3 UUCAAGCUCCCGCUCUGGGAC SEQIDNO:81 5 GUUCGAGGGCGACACCCUGGUGAACUU EGFPS3-27+ 0UU SEQIDNO:82 3 UUCAAGCUCCCGCUCUGGGACCACUUGGC SEQIDNO:83
[0131] Results
[0132] The duplexes were transfected into HEK293 cells using the cotransfection assay format (
[0133] This example demonstrates that dsRNAs of the invention can efficiently target sites within the EGFP gene that were previously considered poor targets by previously known methods. Use of the method of the invention will therefore simplify site selection and design criteria for RNAi. This example also shows that the intentional placement of mismatches at the 3-terminus of the sense strand increases the potency of the 27mer duplex.
Example 10
Effect of 27mer dsRNA on Other Genes
[0134] To ensure that the increased potency of the 27mer dsRNAs was not an artifact of targeting a reporter construct, we targeted two endogenous transcripts, human hnRNP H mRNA (Markovtsov et al., 2000) and mRNA encoding the La protein (Wolin and Cedervall, 2002).
[0135] RNAi Assays Against hnRNP H and La
[0136] HEK293 cells were plated to 30% confluency in a six-well plate. The next day, the cells were transfected with the indicated amount of dsRNA, and the medium was changed on the following day. The cells were harvested in 300 l PBS 72 h after transfection. Extracts were prepared as described above for the EGFP assays. For western blots, 2 l of cell extract was loaded on a 10% SDS-PAGE gel. Endogenous hnRNP H was detected using a rabbit polyclonal anti-hnRNP H antibody (Markovtsov et al., 2000) and anti-rabbit antibody conjugated to alkaline phosphatase (Sigma). -Actin was detected with a mouse-derived anti-actin antibody (Sigma) and anti-mouse antibody conjugated to alkaline phosphatase (Sigma). For northern blot analyses, harvested cells were mixed with RNA STAT-60 (Tel-Test B) and total RNA was extracted according to the manufacturer's protocol. RNA was electrophoresed in a 6% denaturing polyacrylamide gel, transferred to a nylon membrane and probed with .sup.32P-end-labeled oligos (La, 5-CCAAAGGTACCCAGCCTTCATCCAGTT-3 (SEQ ID NO:84); -actin, 5-GTGAGGATGCCTCTCTTGCTCTGGGCCTCG-3 (SEQ ID NO:85)). Hybridizations were carried out in 10 ml of hybridization solution (1 ml 50Denhardt's, 3 ml 20SSPE, 0.5 ml 10% SDS) for 3 h at 37 C. After hybridization, the blot was washed three times with 2SSPE at 37 C.
[0137] Nucleic Acid Reagents
[0138] The coding sequence of Homo sapiens heterogeneous nuclear ribonucleoprotein H (hnRPH) mRNA (Genbank accession No. NM_005520) is shown in Table 5. The ATG start codon and TAA stop codons are highlighted in bold font and site target by siRNA reagents is underscored.
TABLE-US-00007 TABLE5 NucleotideSequenceofHNRPH ttttttttttcgtcttagccacgcagaagtcgcgtgtctagtttgtttcgacgccggaccgcgtaagagacgatgat gttgggcacggaaggtggagagggattcgtggtgaaggtccggggcttgccctggtcttgctcggccgatgaagtgc agaggtttttttctgactgcaaaattcaaaatggggctcaaggtattcgtttcatctacaccagagaaggcagacca agtggcgaggcttttgttgaacttgaatcagaagatgaagtcaaattggccctgaaaaaagacagagaaactatggg acacagatatgttgaagtattcaagtcaaacaacgttgaaatggattgggtgttgaagcatactggtccaaatagtc ctgacacggccaatgatggctttgtacggcttagaggacttccctttggatgtagcaaggaagaaattgttcagttc ttctcagggttggaaatcgtgccaaatgggataacattgccggtggacttccaggggaggagtacgggggaggcctt cgtgcagtttgcttcacaggaaatagctgaaaaggctctaaagaaacacaaggaaagaatagggcacaggtatattg aaatctttaagagcagtagagctgaagttagaactcattatgatccaccacgaaagcttatggccatgcagcggcca ggtccttatgacagacctggggctggtagagggtataacagcattggcagaggagctggctttgagaggatgaggcg tggtgcttatggtggaggctatggaggctatgatgattacaatggctataatgatggctatggatttgggtcagata gatttggaagagacctcaattactgtttttcaggaatgtctgatcacagatacggggatggtggctctactttccag agcacaacaggacactgtgtacacatgcggggattaccttacagagctactgagaatgacatttataattttttttc accgctcaaccctgtgagagtacacattgaaattggtcctgatggcagagtaactggtgaagcagatgtcgagttcg caactcatgaagatgctgtggcagctatgtcaaaagacaaagcaaatatgcaacacagatatgtagaactcttcttg aattctacagcaggagcaagcggtggtgcttacgaacacagatatgtagaactcttcttgaattctacagcaggagc aagcggtggtgcttatggtagccaaatgatgggaggcatgggcttgtcaaaccagtccagctacgggggcccagcca gccagcagctgagtgggggttacggaggcggctacggtggccagagcagcatgagtggatacgaccaagttttacag gaaaactccagtgattttcaatcaaacattgcataggtaaccaaggagcagtgaacagcagctactacagtagtgga agccgtgcatctatgggcgtgaacggaatgggagggttgtctagcatgtccagtatgagtggtggatggggaatgta attgatcgatcctgatcactgactcttggtcaacctttttttttttttttttttctttaagaaaacttcagtttaac agtttctgcaatacaagcttgtgatttatgcttactctaagtggaaatcaggattgttatgaagacttaaggcccag tatttttgaatacaatactcatctaggatgtaacagtgaagctgagtaaactataactgttaaacttaagttccagc ttttctcaagttagttataggatgtacttaagcagtaagcgtatttaggtaaaagcagttgaattatgttaaatgtt gccctttgccacgttaaattgaacactgttttggatgcatgttgaaagacatgcttttattttttttgtaaaacaat ataggagctgtgtctactattaaaagtgaaacattttggcatgtttgttaattctagtttcatttaataacctgtaa ggcacgtaagtttaagctttttttttttttaagttaatgggaaaaatttgagacgcaataccaatacttaggatttt ggtcttggtgtttgtatgaaattctgaggccttgatttaaatctttcattgtattgtgatttccttttaggtatatt gcgctaagtgaaacttgtcaaataaatcctccttttaaaaactgc(SEQIDNO:86)
[0139] The coding sequence of the La protein mRNA (Genbank accession No. NM_005520) is shown in Table 6. The ATG start codon and TAA stop codons are highlighted in bold font and site target by siRNA reagents is underscored.
TABLE-US-00008 TABLE6 NucleotideSequenceofLaProtein ccggcggcgctgggaggtggagtcgttgctgttgctgtttgtgagcctgtggcgcggcttctgtgggccggaacctt aaagatagccgtaatggctgaaaatggtgataatgaaaagatggctgccctggaggccaaaatctgtcatcaaattg agtattattttggcgacttcaatttgccacgggacaagtttctaaaggaacagataaaactggatgaaggctgggta cctttggagataatgataaaattcaacaggttgaaccgtctaacaacagactttaatgtaattgtggaagcattgag caaatccaaggcagaactcatggaaatcagtgaagataaaactaaaatcagaaggtctccaagcaaacccctacctg aagtgactgatgagtataaaaatgatgtaaaaaacagatctgtttatattaaaggcttcccaactgatgcaactctt gatgacataaaagaatggttagaagataaaggtcaagtactaaatattcagatgagaagaacattgcataaagcatt taagggatcaatttttgttgtgtttgatagcattgaatctgctaagaaatttgtagagacccctggccagaagtaca aagaaacagacctgctaatacttttcaaggacgattactttgccaaaaaaaatgaagaaagaaaacaaaataaagtg gaagctaaattaagagctaaacaggagcaagaagcaaaacaaaagttagaagaagatgctgaaatgaaatctctaga agaaaagattggatgcttgctgaaattttcgggtgatttagatgatcagacctgtagagaagatttacacatacttt tctcaaatcatggtgaaataaaatggatagacttcgtcagaggagcaaaagaggggataattctatttaaagaaaaa gccaaggaagcattgggtaaagccaaagatgcaaataatggtaacctacaattaaggaacaaagaagtgacttggga agtactagaaggagaggtggaaaaagaagcactgaagaaaataatagaagaccaacaagaatccctaaacaaatgga agtcaaaaggtcgtagatttaaaggaaaaggaaagggtaataaagctgcccagcctgggtctggtaaaggaaaagta cagtttcagggcaagaaaacgaaatttgctagtgatgatgaacatgatgaacatgatgaaaatggtgcaactggacc tgtgaaaagagcaagagaagaaacagacaaagaagaacctgcatccaaacaacagaaaacagaaaatggtgctggag accagtagtttagtaaaccaattttttattcattttaaataggttttaaacgacttttgtttgcggggcttttaaaa ggaaaaccgaattaggtccacttcaatgtccacctgtgagaaaggaaaaatttttttgttgtttaacttgtcttttt gttatgcaaatgagatttctttgaatgtattgttctgtttgtgttatttcagatgattcaaatatcaaaaggaagat tcttccattaaattgcctttgtaatatgagaatgtattagtacaaactaactaataaaatatatactatatgaaaag agc(SEQIDNO:87)
[0140] RNA duplexes were synthesized and prepared as described in Example 1. RNA duplexes targeting HNRPH1 are summarized in Table 7.
TABLE-US-00009 TABLE7 SummaryofOligonucleotideReagents Sequence Name SEQIDNO: 5 GUUGAACUUGAAUCAGAAGAUGAAGUCAAAUUGGC3 HNRPH1Site-1 SEQIDNo:88 5 CUUGAAUCAGAAGAUGAAGUU HNRPH1-21+ 2 SEQIDNo:89 3 UUGAACUUAGUCUUCUACUUC SEQIDNo:90 5 AACUUGAAUCAGAAGAUGAAGUCAAAU HNRPH1-27+ 0 SEQIDNo:91 3 UUGAACUUAGUCUUCUACUUCAGUUUA SEQIDNo:92 5 AUAAAACUGGAUGAAGGCUGGGUACCUUUGGAGAU3 LaSite-1 SEQIDNO:93 5 CUGGAUGAAGGCUGGGUACUU La-21+ 2 SEQIDNO:94 3 UUGACCUACUUCCGACCCAUG SEQIDNO:95 5 AACUGGAUGAAGGCUGGGUACCUUUUU La-21+ 2 SEQIDNO:96 3 UUGACCUACUUCCGACCCAUGGAAACC SEQIDNO:97
[0141] Results
[0142] RNA duplexes were synthesized to target randomly chosen sites in the human hnRNP H mRNA (analyzed by western blotting) and the mRNA encoding the La protein (analyzed by northern blotting (
Example 11
Sequence Specificity of 27mer
[0143] As a test for the sequence specificity of the 27mer dsRNA, a series of 27+0 dsRNAs with one, two or three mismatches to the EGFP target mRNA were synthesized and tested at concentrations of 0 nM, 1 nM and 200 pM in the cotransfection assay (
Example 12
Lack of Interferon Response
[0144] This example demonstrates that the dsRNA duplexes of the invention do not activate the interferon response.
[0145] Interferon and PKR Assays
[0146] After transfection of 293 cells with 20 nM of each RNA as described previously, medium was collected after 24 h and used for ELISA assays of interferon and as previously described (Kim et al., 2004). The PKR activation assay was done as previously described (Gunnery and Mathews, 1998). PKR in the lysate was first activated by co-incubation of the indicated RNAs and radiolabeled by its auto-kinase reaction. The radiolabeled PKR was then immunoprecipitated for analysis. To determine the activity of PKR in the cell lysate without prior activation, dsRNA was omitted. The reaction was incubated at 30 C. for 20 min PKR from the reaction was immunoprecipitated using polyclonal antibody. The polyclonal antibody was added to the reaction, which was then placed on ice for 1 h, followed by addition of 50 l of 10% protein A-Sepharose in IPP500 (10 mM Tris, pH 8, 500 mM NaCl, 0.1% Nonidet P-40). This mixture was rocked for 30 min at 4 C. The protein A-Sepharose beads were washed with 1 ml IPP100 buffer (10 mM Tris, pH 8, 100 mM NaCl, 0.1% Nonidet P-40) five times. After the last wash, the beads were boiled in protein sample buffer and loaded onto an SDS-polyacrylamide gel followed by autoradiography.
[0147] Results
[0148] A potential problem in the use of the longer dsRNAs is activation of PKR and induction of interferons (Manche et al., 1992). We therefore assessed whether a transfected 27mer dsRNA activates interferon- (
Example 13
Asymmetric 27Mer Duplex Design and Base Modifications can Influence Dicing Patterns and Allow Intelligent Design of 27Mer
[0149] This examples demonstrates that multiple species are produced by Dicer action on the 27mer and that design of the 27mer and/or inclusion of base modifications can be employed to direct these degradation patterns, limit heterogeneity, and predict end products.
[0150] It was demonstrated in Example 6,
[0151] Electrospray Mass Spectrometry Assay of In Vitro Dicing Reactions
[0152] RNA duplexes (100 pmoles) were incubated in 20 l of 20 mM Tris pH 8.0, 200 mM NaCl, 2.5 mM MgCl.sub.2 with 1 unit of recombinant human Dicer (Stratagene, La Jolla, Calif.) for 12-24 hours. Electrospray-ionization liquid chromatography mass spectroscopy (ESI-LCMS) of duplex RNAs pre- and post-treatment with Dicer were done using an Oligo HTCS system (Novatia, Princeton, N.J.), which consisted of ThermoFinnigan TSQ7000, Xcalibur data system, ProMass data processing software and Paradigm MS4 HPLC (Michrom BioResources, Auburn, Calif.). The liquid chromatography step employed before injection into the mass spectrometer (LC-MS) removes most of the cations complexed with the nucleic acids; some sodium ion can remain bound to the RNA and are visualized as minor +22 or +44 species, which is the net mass gain seen with substitution of sodium for hydrogen. Accuracy of this assay is around +/2 Daltons for oligonucleotides of this size.
[0153] Results
[0154] The EGFPS1-27+0 duplex was digested with Dicer and mass spectra were obtained pre-digestion (
TABLE-US-00010 TABLE8 MolecularWeightsofPossibleDuplexes Derivedfromthe27merDuplexbyDicerProcessing Sequence(SEQIDNO:) Name MolWt 5 AAGCUGACCCUGAAGUUCAUCUGCACC(41) EGFPS1-27+ 0L 8552 3 UUCGACUGGGACUUCAAGUAGACGUGG(42) 8689 5 pACCCUGAAGUUCAUCUGCACC(11) EGFPS1-21+ 2(3) 6672 3 ACUGGGACUUCAAGUAGACGUp(12) 6816 5 pGACCCUGAAGUUCAUCUGCACC(98) EGFPS1-22+ 2(3) 7017 3 GACUGGGACUUCAAGUAGACGUp(99) 7161 5 pUGACCCUGAAGUUCAUCUGCA(15) EGFPS1-21+ 2(5) 6713 3 CGACUGGGACUUCAAGUAGACp(16) 6815 5 pCUGACCCUGAAGUUCAUCUGCA(100) EGFPS1-22+ 2(5) 7018 3 UCGACUGGGACUUCAAGUAGACp(101) 7121
[0155] It was demonstrated in Example 2,
[0156] The double-stranded RNA binding domains of many enzymes often specifically recognize RNA and not DNA or some modified RNAs. Insertion of DNA residues into the ends of blunt 27mer duplexes was studied. Asymmetric designs with DNA residues in the 3-end of one strand resulted in fewer diced products (less heterogeneity) and generally produced a predicable pattern which was opposite that of the asymmetric 3-overhang designs.
[0157] The EGFPS1-27+0 duplex was modified to have an asymmetric 3-overhang on one side and 2 DNA bases at the 3-end of the other side. A 5-phosphate was placed on the recessed strand at the 3-overhang to mimic dicer processing. The final duplex of this design is show below aligned with the original blunt 27mer. Lower case t represents DNA dT base and lower case p represents a phosphate group. Calculated masses are shown in Table 9.
TABLE-US-00011 TABLE9 MolecularWeightsofDuplexes Sequence(SEQIDNO:) Name MolWt 5 AAGCUGACCCUGAAGUUCAUCUGCACC(41) EGFPS1-27+ 0L 8552 3 UUCGACUGGGACUUCAAGUAGACGUGG(42) 8689 5 AAGCUGACCCUGAAGUUCAUCUGCACC(41) EGFPS1-27/25L 8552 3 ttCGACUGGGACUUCAAGUAGACGUp(102) 8075
[0158] Mass spectra were obtained pre-digestion (
TABLE-US-00012 TABLE10 MolecularWeightsofPossibleDuplexes Derivedfromthe27mer/25merDuplexbyDicerProcessing Sequence(SEQIDNO:) Name MolWt 5 AAGCUGACCCUGAAGUUCAUCUGCACC(41) EGFPS1-27/25L 8552 3 ttCGACUGGGACUUCAAGUAGACGUp(102) 8075 5 pACCCUGAAGUUCAUCUGCACC(11) EGFPS1-21+ 2(3) 6672 3 ACUGGGACUUCAAGUAGACGUp(12) 6816 3 GACUGGGACUUCAAGUAGACGUp(99) 7161
[0159] Use of asymmetric design with a single 2-base 3-overhang and selective incorporation of DNA residues simplifies the dicing reaction to yield a single major cleavage product. This design additionally permits prediction of the dicing pattern and allows for intelligent design of 27mers such that specific, desired 21mers can be produced from dicing. As demonstration, a second 27mer duplex, EGFPS1-27-R was studied which overlaps the EGFPS1-27-L sequence. Calculated masses are shown in Table 11.
TABLE-US-00013 TABLE11 MolecularWeightsofDuplexes Sequence(SEQIDNO:) Name MolWt 5 AAGCUGACCCUGAAGUUCAUCUGCACC(41) EGFPS1-27+ 0L 8552 3 UUCGACUGGGACUUCAAGUAGACGUGG(42) 8689 5 UGACCCUGAAGUUCAUCUGCACCACCG(103) EGFPS1-27+ 0R 8528 3 ACUGGGACUUCAAGUAGACGUGGUGGC(104) 8728
[0160] Mass spectra were obtained pre-digestion (
TABLE-US-00014 TABLE12 MolecularWeightsofPossibleDuplexes Derivedfromthe27merDuplexbyDicerProcessing Sequence(SEQIDNO:) Name MolWt 5 UGACCCUGAAGUUCAUCUGCACCACCG(103) EGFPS1-27+ 0R 8528 3 ACUGGGACUUCAAGUAGACGUGGUGGC(104) 8728 5 pUGAAGUUCAUCUGCACCACCG(105) EGFPS1-21(1)R 6712 5 pCCUGAAGUUCAUCUGCACCACC(106) EGFPS1-22(3)R 6977 3 UGGGACUUCAAGUAGACGUGGUp(107) 7178 5 pACCCUGAAGUUCAUCUGCACCACC(108) EGFPS1-27+ 0R 6672 3 ACUGGGACUUCAAGUAGACGUGGUp(109) 6816 3 ACUGGGACUUCAAGUAGACGUGp(110) EGFPS1-22(5)R 7161
[0161] The EGFPS1-27+0-R duplex was converted to a DNA-modified, asymmetric 25/27mer duplex as shown below and this duplex was studied in the in vitro dicing assay. Lower case cg represents DNA dCdG base and lower case p represents a phosphate group. Calculated masses are shown in Table 13.
TABLE-US-00015 TABLE13 MolecularWeightsofDuplexes Sequence(SEQIDNO:) Name MolWt 5 UGACCCUGAAGUUCAUCUGCACCACCG(103) EGFPS1-27+ 0R 8528 3 ACUGGGACUUCAAGUAGACGUGGUGGC(104) 8728 5 pACCCUGAAGUUCAUCUGCACCACcg(111) EGFPS1-25/27R 7925 3 ACUGGGACUUCAAGUAGACGUGGUGGC(112) 8728
[0162] Mass spectra were obtained pre-digestion (
TABLE-US-00016 TABLE14 MolecularWeightofPossibleDuplex Derivedfromthe25mer/27merDuplexbyDicerProcessing Sequence(SEQIDNO:) Name MolWt 5 pACCCUGAAGUUCAUCUGCACCACcg(111) EGFPS1-25/27R 7925 3 ACUGGGACUUCAAGUAGACGUGGUGGC(112) 8728 5 pACCCUGAAGUUCAUCUGCACC(11) EGFPS1-21+ 2(3) 6672 3 ACUGGGACUUCAAGUAGACGUp(12) 6816
[0163] If the results of
TABLE-US-00017 TABLE15 MolecularWeightsofDuplexes Sequence(SEQIDNO:) Name MolWt 5 AAGCUGACCCUGAAGUUCAUCUGCACC(41) EGFPS1-27/25L 8552 3 ttCGACUGGGACUUCAAGUAGACGUp(102) 8075 5 pACCCUGAAGUUCAUCUGCACCACcg(111) EGFPS1-25/27R 7925 3 ACUGGGACUUCAAGUAGACGUGGUGGC(112) 8728 5 pACCCUGAAGUUCAUCUGCACC(11) EGFPS1-21+ 2(3) 6672 3 ACUGGGACUUCAAGUAGACGUp(12) 6816
[0164] Therefore use of the DNA-modified asymmetric duplex design as taught by the invention reduces complexity of the dicing reaction for 27mer RNA species and permits intelligent design of 27mers for use in RNAi such that it is possible to specifically target a desired location. Cleavage of the substrate 27mer by Dicer results in a unique, predictable 21mer wherein one end of the 21mer coincides with the 3-overhang end of the substrate 27mer.
Example 14
Asymmetric 27Mer Duplex Designs with Base Modifications can Improve Potency Over Blunt 27Mers
[0165] This examples demonstrates that the new asymmetric RNA duplexes as taught by the invention, having a 2-base 3-overhang on one side and blunt with 3-base 3-DNA modification on the other side, can improve potency over blunt 27mer duplexes.
[0166] It was demonstrated in Example 13,
[0167] RNA duplexes targeting EGFPS2 were co-transfected into HEK293 cells with an EGFP expression plasmid and assayed for EGFP activity after 24 hours incubation according to methods described above. Transfected duplexes are shown in Table 16. Lower case p represents a phosphate group and lower case bases cc and gt represent DNA bases while uppercase bases represent RNA.
TABLE-US-00018 TABLE16 TransfectedDuplexes Sequence Name SEQIDNO: 5 GCAGCACGACUUCUUCAAGUU EGFPS2-21+ 2 SEQIDNO:76 3 UUCGUCGUGCUGAAGAAGUUC SEQIDNO:77 5 AAGCAGCACGACUUCUUCAAGUCCGCC EGFPS2-27+ 0 SEQIDNO:78 3 UUCGUCGUGCUGAAGAAGUUCAGGCGG SEQIDNO:79 5 CAUGAAGCAGCACGACUUCUUCAAGUC EGFPS2-27/25L SEQIDNO:113 3 gtACUUCGUCGUGCUGAAGAAGUUCp SEQIDNO:114 5 pGCAGCACGACUUCUUCAAGUCCGcc EGFPS2-25/27R SEQIDNO:115 3 UUCGUCGUGCUGAAGAAGUUCAGGCGG SEQIDNO:79
[0168] The EGFPS2-21+2 and EGFPS2-27+0 RNA duplexes were employed previously in Example 9. The EGFPS2-27/25 L and EGFPS2-25/27 R duplexes are new asymmetric dsRNAs designed according to the present invention and target the same site, site II of EGFP. In the in vitro dicing electrospray mass spectrometry assay as described in Example 13, both the EGFPS2-27/25 L and EGFPS2-25/27 R duplexes yield the same 21mer product after digestion by Dicer, similar to the EGFPS2-21+2 duplex.
[0169] Transfection results are shown in
[0170] Similar transfections were done using the EGFPS1 duplexes 27/25 L and 25/27 R. These duplexes produce the same 21mer product, the EGFPS1-21(3) duplex, after dicing (Example 13). Transfected duplexes are shown in Table 17. Lower case p represents a phosphate group and lower case bases tt represent DNA bases while uppercase bases represent RNA.
TABLE-US-00019 TABLE17 TransfectedDuplexes Sequence Name SEQIDNO: 5 AAGCUGACCCUGAAGUUCAUCUGCACC EGFPS1-27/25L SEQIDNO:41 3 ttCGACUGGGACUUCAAGUAGACGUp SEQIDNO:102 5 pACCCUGAAGUUCAUCUGCACCACcg EGFPS1-25/27R SEQIDNO:111 3 ACUGGGACUUCAAGUAGACGUGGUGGC SEQIDNO:112
[0171] EGFP expression after transfection is shown in
[0173] 27mer duplex RNAs can show significantly higher potency than 21mer duplexes in suppressing targeted gene expression. The blunt 27mers can result in a variety of 21mer species after dicing, so precise performance of a blunt 27mer duplex cannot always be predicted. The novel asymmetric duplexes of the present invention wherein one side of the duplex has a 2-base 3-overhang and the other side is blunt and has base modifications, such as DNA, at the 3-end, force dicing to occur in a predictable way so that precise 21mers result. These asymmetric duplexes, i.e., 27/25 L and 25/27 R, are each also more potent than the 21mers. The asymmetric 25/27 R design is the most potent embodiment of the present invention.
[0174]
Example 15
Determination of Effective Dose
[0175] This example demonstrates a method for determining an effective dose of the dsRNA of the invention in a mammal. A therapeutically effective amount of a composition containing a sequence that encodes a dsRNA, (i.e., an effective dosage), is an amount that inhibits expression of the product of the target gene by at least 10 percent. Higher percentages of inhibition, e.g., 20, 50, 90 95, 99 percent or higher may be desirable in certain circumstances. Exemplary doses include milligram or microgram amounts of the molecule per kilogram of subject or sample weight (e.g., about 1 microgram per kilogram to about 5 milligrams per kilogram, about 100 micrograms per kilogram to about 0.5 milligrams per kilogram, or about 1 microgram per kilogram to about 50 micrograms per kilogram). The compositions can be administered one or more times per week for between about 1 to 10 weeks, e.g., between 2 to 8 weeks, or between about 3 to 7 weeks, or for about 4, 5, or 6 weeks, as deemed necessary by the attending physician. Treatment of a subject with a therapeutically effective amount of a composition can include a single treatment or a series of treatments.
[0176] Appropriate doses of a particular dsRNA composition depend upon the potency of the molecule with respect to the expression or activity to be modulated. One or more of these molecules can be administered to an animal, particularly a mammal, and especially humans, to modulate expression or activity of one or more target genes. A physician may, for example, prescribe a relatively low dose at first, subsequently increasing the dose until an appropriate response is obtained. In addition, it is understood that the specific dose level for any particular subject will depend upon a variety of other factors including the severity of the disease, previous treatment regimen, other diseases present, off-target effects of the active agent, age, body weight, general health, gender, and diet of the patient, the time of administration, the route of administration, the rate of excretion, any drug combination, and the degree of expression or activity to be modulated.
[0177] The efficacy of treatment can be monitored by measuring the amount of the target gene mRNA (e.g. using real time PCR) or the amount of product encoded by the target gene such as by Western blot analysis. In addition, the attending physician can monitor the symptoms associated with the disease or disorder afflicting the patient and compare with those symptoms recorded prior to the initiation of treatment.
[0178] It is clear from recent studies that the effects of RNAi are not entirely specific and that undesired off-target effects can occur of a magnitude dependent on the concentration of siRNA (Persengiev et al., 2004). The new Dicer substrate dsRNA approach may facilitate use of lower concentrations of duplex RNA than are needed with traditional 21mer siRNAs. It is clear from published data that off-target effects can occur in certain cell lines using 21mer siRNAs (Persengiev et al., 2004; Jackson et al., 2003), but these also can be minimized by using reagents that have efficacy in the low to subnanomolar range (Persengiev et al., 2004). To examine the potential for off-target effects using Dicer substrate dsRNAs, we carried out microarray analyses comparing an siRNA 21mer with the 27mer, each targeting EGFP site 1. NIH3T3 cells that stably express EGFP were transfected with concentrations of siRNA that give effective target knockdowns (
[0179] Given the increase in potency of the 27mer dsRNAs relative to 21+2 siRNAs, it is of interest that this observation has not been previously reported. Although others have used dsRNAs of up to 27 bp for RNAi studies in mammalian cells (Bohula et al., 2003; Caplen et al., 2001), no differences in efficacy were reported as compared with traditional 21+2 duplexes. This discrepancy between previous studies and our own may simply be due to differences in the concentration of dsRNAs tested. Good sites for 21mer siRNAs can have potencies in the nanomolar range (Reynolds et al., 2004). When good sites are tested at high concentrations of transfected RNA, differences between 21mer siRNAs and 27mer dsRNAs will most likely be small and easily overlooked. Marked differences in potency are best shown by testing at low nanomolar or picomolar concentrations, something that is not routinely done in most laboratories.
[0180] Thus far, the 27mer dsRNA design has shown increased RNAi potency relative to 21+2 siRNAs at every site examined. Within the set of 27mers studied here, however, a range of potencies is nevertheless seen between different target sites within the same gene (
[0181] The use of the terms a and an and the and similar referents in the context of describing the invention (especially in the context of the following claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. The terms comprising, having, including, and containing are to be construed as open-ended terms (i.e., meaning including, but not limited to,) unless otherwise noted. Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., such as) provided herein, is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention.
[0182] Embodiments of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Variations of those embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventors expect skilled artisans to employ such variations as appropriate, and the inventors intend for the invention to be practiced otherwise than as specifically described herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.
BIBLIOGRAPHY
[0183] Amarzguioui, M. and Prydz (2004). An algorithm for selection of functional siRNA sequences. Biochem Biophys Res Commun 316:1050-1058. [0184] Amarzguioui, M. et al. (2003). Tolerance for Mutation and Chemical Modifications in a siRNA. Nucleic Acids Research 31:589-595. [0185] Beale, S. E. et al. (2005). siRNA target site secondary structure predictions using local stable substructures. Nucl Acids Res 33:e30 (pp1-10). [0186] Beck, W. T. (1989). Unknotting the complexities of multidrug resistance: the involvement of DNA topoisomerases in drug action and resistance. J Natl Cancer Inst 81:1683-1685. [0187] Bernstein, E. et al. (2001) Role for a bidentate ribonuclease in the initiation step of RNA interference. Nature 409:363-366. [0188] Boese, Q. et al. (2005). Mechanistic insights aid computational short intervening RNA design. Methods Enzymol 392:73-96. [0189] Bondensgaard, K. et al. (2000). Structural studies of LNA:RNA duplexes by NMR: conformations and implications for RNase H activity. Chemistry 6:2687-2695. [0190] Braasch, D. A. and Corey, D. R. (2001). Locked nucleic acid (LNA): fine-tuning the recognition of DNA and RNA. Chem Biol 8:1-7. [0191] Braasch et al. (2003). RNA Interference in Mammalian Cells by Chemically-Modified RNA. Biochemistry 42:7967-7975. [0192] Bohula, E. A. et al. (2003). The efficacy of small interfering RNAs targeted to the type 1 insulin-like growth factor receptor (IGF1R) is influenced by secondary structure in the IGF1R transcript. J Biol Chem 278:15991-15997. [0193] Bridge et al. (2003). Induction of an Interferon Response by RNAi Vectors in Mammalian Cells. Nature Genetics 34:263-264. [0194] Caplen, N.J. et al. (2001). Specific inhibition of gene expression by small double-stranded RNAs in invertebrate and vertebrate systems. Proc Natl Acad Sci USA 98:9742-9747. [0195] Chang et al. (1985). Gene Expression from Both Intronless and Intron-Containing Rous Sarcoma Virus Clones is Specifically Inhibited by Anti-Sense RNA. Molecular and Cellular Biology 5:2341-2348. [0196] Check (2003). RNA to the Rescue? Nature 425:10-12. [0197] Childs, S. and V. Ling (1994). The MDR superfamily of genes and its biological implications. Important Adv Oncol, pp. 21-36. [0198] Chiu et al. (2003). siRNA Function in RNAi: A Chemical Modification Analysis. RNA 9:1034-1048. [0199] Chiu, Y. L., and Rana, T. R. (2002). RNAi in human cells: basic structural and functional features of small interfering RNA. Mol Cell 10:549-561. [0200] Cole, S. P. et al. (1992). Overexpression of a transporter gene in a multidrug-resistant human lung cancer cell line. Science 258:1650-1654. [0201] Crinelli, R. et al. (2002). Design and characterization of decoy oligonucleotides containing locked nucleic acids. Nucleic Acids Res 30:2435-2443. [0202] Czauderna et al. (2003). Structural Variations and Stabilising Modifications of Synthetic siRNAs in Mammalian Cells. Nucleic Acids Research 31:2705-2716. [0203] Damha, M. J., and Ogilvie, K. K. (1993). Oligoribonucleotide synthesis. The silyl-phosphoramidite method. Methods Mol Biol 20:81-114. [0204] Eckstein, F. (2000). Phosphorothioate oligodeoxynucleotides: what is their origin and what is unique about them? Antisense Nucleic Acid Drug Dev 10:117-21. [0205] Elbashir, S. M. et al. (2001a). Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature 411:494-498. [0206] Elbashir, S. M. et al. (2001b). RNA interference is mediated by 21- and 22-nucleotide RNAs. Genes & Dev 15:188-200. [0207] Elbashir, S. M. et al. (2001c). Functional Anatomy of siRNAs for Mediating Efficient RNAi in Drosophila melanogaster Embryo Lysate. EMBO J 20:6877-6888. [0208] Elman, J. et al. (2005). Locked nucleic acid (LNA) mediated improvements in siRNA stability and functionality. Nucleic Acids Res 33:439-447. [0209] Fan., D. et al., (1994). Reversal of multidrug resistance In Reversal of Multidrug Resistance in Cancer, Kellen, J. A., ed., CRC Press, Boca Raton, Fla., pp. 93-125. [0210] Fire, A. et al. (1998). Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 391:806-811. [0211] Graessmann, M. et al. (1991). Inhibition of SV40 gene expression by microinjected small antisense RNA and DNA molecules. Nucleic Acids Res 19:53-59. [0212] Gunnery, S., and Mathews, M. B. (1998) RNA binding and modulation of PKR activity. Methods 15:189-98. [0213] Hamada et al. (2002). Effects on RNA Interference in Gene Expression (RNAi) in Cultured Mammalian Cells of Mismatches and the Introduction of Chemical Modifications at the 3-Ends of siRNAs. Antisense and Nucleic Acid Drug Development 12:301-309. [0214] Hannon (2002). RNA Interference. Nature 418:244-251. [0215] Harborth, J. et al. (2003). Sequence, chemical, and structural variation of small interfering RNAs and short hairpin RNAs and the effect on mammalian gene silencing. Antisense Nucleic Acid Drug Dev 13:83-105. [0216] Herdewijn, P. (2000). Heterocyclic modifications of oligonucleotides and antisense technology. Antisense Nucleic Acid Drug Dev 10:297-310. [0217] Hohjoh, J. (2002) RNA interference (RNAi) induction with various types of synthetic oligonucleotide duplexes in cultured human cells. FEBS Lett 521:195-199. [0218] Holen, T. (2002). Positional effects of short interfering RNAs targeting the human coagulation trigger tissue factor. Nucleic Acids Res 30:1757-1766. [0219] Jackson, A. L. et al. (2003). Expression profiling reveals off-target gene regulation by RNAi. Nat Biotechno. 21:635-637. [0220] Ji, J. et al. (2003). Enhanced gene silencing by the application of multiple specific small interfering RNAs. FEBS Lett 552:247-252. [0221] Khvorova, A. et al. (2003). Functional siRNAs and miRNAs exhibit strand bias. Cell 115:209-216. [0222] Kim, D. H., and J. J. Rossi (2003). Coupling of RNAi-mediated target downregulation with gene replacement. Antisense Nucleic Acid Drug Dev 13:151-155. [0223] Kim, D. H. et al. (2004). Interferon induction by siRNAs and ssRNAs synthesized by phage polymerase. Nat Biotechnol 22:321-325. [0224] Kretshmer-Kazemi Far et al. (2003). The Activity of siRNA in Mammalian Cells is Related to Structural Target Accessibility: A Comparison with Antisense Oligonucleotides. Nucleic Acids Research 31: 4417-4424. [0225] Krol, J. et al. (2004). Structural features of microRNA (miRNA) precursors and their relevance to miRNA biogenesis and small interfering RNA/short hairpin RNA design. J Biol Chem 279:42230-42239. [0226] Kreuter, J. (1991) Nanoparticles-preparation and applications. In: Microcapsules and nanoparticles in medicine and pharmacy, Donbrow M., ed, CRC Press, Boca Raton, Fla., pp. 125-14. [0227] Kurreck, J. et al. (2002). Design of antisense oligonucleotides stabilized by locked nucleic acids. Nucleic Acids Res 30:1911-1918. [0228] Liu, et al. (2003). R2D2, a Bridge Between the Initiator and Effector Steps of the Drosophila RNAi Pathway. Science 301:1921-1925. [0229] Manche, L. et al. (1992). Interactions between double-stranded RNA regulators and the protein kinase DAI. Mol Cell Biol 12:5238-5248. [0230] Markovtsov, V. et al. (2000). Cooperative assembly of an hnRNP complex induced by a tissue specific homolog of polypyrimidine tract binding protein. Mol Cell Biol 20:7463-79. [0231] Martinez, J. et al. (2002). Single-stranded antisense siRNAs guide target RNA cleavage in RNAi. Cell 110:563-574. [0232] McManus et al. (2002). Gene Silencing in Mammals by Small Interfering RNAs. Nature Reviews Genetics 3:737-747. [0233] Melton, D. A. (1985). Injected anti-sense RNAs specifically block messenger RNA translation in vivo. Proc Natl Acad Sci USA 82:144-148. [0234] Minks, M. A. et al. (1979). Structural requirements of double-stranded RNA for the activation of the 2-5-oligo(A) polymerase and protein kinase of interferon-treated HeLa cells. J Biol Chem 254:10180-10183. [0235] Napoli, C. et al. (1990). Introduction of a chimeric chalcone synthase gene intopetunia results in reversible co-suppression of homologous genes in trans. Plant Cell 2:279-289. [0236] Ngo et al. (1998). Double-Stranded RNA Induces mRNA Degradation in Trypanosoma brucei. Proc Natl Acad Sci USA 95:14687-14692. [0237] Parrish, S. et al. (2000). Functional anatomy of a dsRNA trigger: differential requirements for the two trigger strands in RNA interference. Mol Cell 6:1077-1087. [0238] Pellino et al. (2003). R2D2 Leads the Silencing Trigger to mRNA's Death Star. Cell 115:132-133. [0239] Persengiev, S. P. et al. (2004). Nonspecific, concentration-dependent stimulation and repression of mammalian gene expression by small interfering RNAs (siRNAs). RNA 10:12-18. [0240] Reynolds, A. et al. (2004). Rational siRNA design for RNA interference. Nat Biotechnol 22:326-330. [0241] Romano, N. and G. Macino (1992). Quelling: transient inactivation of gene expression in Neurospora crassa by transformation with homologous sequences. Mol Microbiol 6:3343-53. [0242] Rusckowski, M. et al. (2000). Biodistribution and metabolism of a mixed backbone oligonucleotide (GEM 231) following single and multiple dose administration in mice. Antisense Nucleic Acid Drug Dev 10:333-345. [0243] Scheffer, G. L. et al. (1995). The drug resistance-related protein LRP is the human major vault protein. Nat Med 1:578-582. [0244] Scherer, L. and J. J. Rossi (2004). RNAi applications in mammalian cells. Biotechniques 36:557-561. [0245] Scherer et al. (2003). Approaches for the Sequence-Specific Knockdown of mRNA, Nature Biotechnology 21:1457-1465. [0246] Schwarz, D. S. et al. (2003). Asymmetry in the assembly of the RNAi enzyme complex. Cell 115:199-208. [0247] Siolas, D. et al. (2005). Synthetic shRNAs as potent RNAi triggers. Nat Biotechnol 23:227-231. [0248] Skipper, (2003). Elegant Tour de Force. Nature Reviews Genetics 4: 79-80. [0249] Sledz et al. (2003). Activation of the Interferon System by Short-Interfering RNAs. Nature Cell Biology 5:834-839. [0250] Stark, G. R. et al. (1998). How cells respond to interferons. Annu Rev Biochem 67:227-264. [0251] Stein, D. A. et al. (2001). Inhibition of Vesivirus infections in mammalian tissue culture with antisense morpholino oligomers. Antisense Nucleic Acid Drug Dev 11:317-25. [0252] Tuschl, T. et al. (1999). Targeted mRNA degradation by double-stranded RNA in vitro. Genes & Dev 13:3191-3197. [0253] Ui-Tei, K. et al. (2004). Guidelines for the selection of highly effective siRNA sequences for mammalian and chick RNA interference. Nucleic Acids Res 32:936-948. [0254] Verma, S. and F. Eckstein (1998). Modified oligonucleotides: synthesis and strategy for users. Annu Rev Biochem 67:99-134. [0255] Vorobjev, P. E. et al. (2001). Nuclease resistance and RNase H sensitivity of oligonucleotides bridged by oligomethylenediol and oligoethylene glycol linkers. Antisense Nucleic Acid Drug Dev 11:77-85. [0256] Wahlestedt, C. et al. (2000). Potent and nontoxic antisense oligonucleotides containing locked nucleic acids. Proc Natl Acad Sci USA 97:5633-5638. [0257] Waterhouse et al. (2003). Exploring Plant Genomes by RNA-Induced Gene Silencing. Nature Reviews Genetics 4: 29-38. [0258] Wincott, F. et al. (1995). Synthesis, deprotection, analysis and purification of RNA and ribozymes. Nucleic Acids Res 23:2677-84. [0259] Wolin, S. L. and T. Cedervall (2002). The La protein. Annu Rev Biochem 71:375-403. [0260] Xu et al. (2003). Effective Small Interfering RNAs and Phosphorothioate Antisense DNAs Have Different Preferences for Target Sites in the Luciferase mRNAs. Biochemical and Biophysical Research Communications 306:712-717. [0261] Yuan, B. et al. (2004). siRNA Selection Server: an automated siRNA oligonucleotide prediction server. Nucl Acids Res 32(Webserver issue):W130-134. [0262] Zamore, P. D. et al. (2000). RNAi: double-stranded RNA directs the ATP-dependent cleavage of mRNA at 21 to 23 nucleotide intervals. Cell 101:25-33.