Nucleic acid complexes

09669101 ยท 2017-06-06

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to complexes of transcription factor decoys, their delivery to bacteria and their formulation. In particular, the present invention resides in an antibacterial complex comprising a nucleic acid sequence and one or more delivery moieties selected from quaternary amine compounds; bis-aminoalkanes and unsaturated derivatives thereof, wherein the amino component of the aminoalkane is an amino group forming part of a heterocyclic ring; and an antibacterial peptide.

Claims

1. A method of treating a bacterial infection comprising administering an antibacterial complex to an individual in need thereof, wherein the antibacterial complex comprises: a double stranded nucleic acid sequence comprising the sequence of a native cellular binding site for a bacterial transcription factor; and one or more delivery moieties represented by the formula: ##STR00010## wherein: A is a bond; p and q are the same or different and each is an integer from 1 to 12; provided that the sum of p and q is in the range from 8 to 18; R.sup.8 and R.sup.8a are each selected from hydrogen; C.sub.1-4 alkoxy; nitro; amino; mono- and di-C.sub.1-4 alkylamino; and guanidinyl; R.sup.9 is hydrogen; R.sup.9a is hydrogen; R.sup.10 is selected from hydrogen; amino; and C.sub.1-4 alkyl optionally substituted with one or more fluorine atoms; R.sup.10a is selected from hydrogen; amino; and C.sub.1-4 alkyl optionally substituted with one or more fluorine atoms; or R.sup.9 and R.sup.10 link together to form an alkylene chain (CH.sub.2).sub.w wherein w is 3 to 5: and/or R.sup.9a and R.sup.10a link together to form an alkylene chain (CH.sub.2).sub.w wherein w is 3 to 5 provided that the compound of the formula is other than dequalinium, wherein the nucleic acid sequence is complexed with the one or more delivery moieties.

2. The method of claim 1, wherein the native cellular binding site comprises the sequence of a bacterial SigB binding site.

3. The method according to claim 2, wherein the bacterial SigB binding site is represented by SEQ ID NOS: 9, 10, 30 and 31, 39, 40 or 41.

4. The method of claim 1, wherein the native cellular binding site comprises the sequence of a bacterial Fur binding site.

5. The method of claim 4, wherein the bacterial Fur binding site is represented by SEQ ID NOS: 11, 12 or 13.

6. The method of claim 1, wherein the bacterial infection is methicillin resistant.

7. The method of claim 1, wherein the bacterial infection causes sepsis.

8. The method of claim 7, wherein the native cellular binding site comprises SEQ ID NO: 9.

9. The method of claim 1, wherein the alkyl chain has 12 or 14 methyl groups.

10. The method of claim 9, wherein the delivery moiety has the formula: ##STR00011##

Description

(1) The invention will now be further described by way of non-limiting examples and figures, in which:

(2) FIG. 1. Chemical structure of Dequalinium.

(3) FIG. 2. Chemical structure of 10,10-(decane-1,10-diyl)bis(9-amino-1,2,3,4-tetrahydroacridinium) dichloride.

(4) FIG. 3. Chemical structure of 10,10-(dodecane-1,12-diyl)bis(9-amino-1,2,3,4-tetrahydroacridinium) dichloride.

(5) FIG. 4. Size distribution of 100 M sC7 bolasomes as measured by dynamic light scattering.

(6) FIG. 5. Size distribution of 100 M sC7_12 bolasomes as measured by dynamic light scattering.

(7) FIG. 6. SYBR Green-DNA binding assay to measure binding of Compound 7 bolasomes to TFDs.

(8) FIG. 7. SYBR Green-DNA binding assay to measure binding of Compound 7_12 bolasomes to TFDs.

(9) FIG. 8. SYBR Green-DNA binding assay to quantify the stability of complexes formed with Compound 7 bolasomes and Sig_TFD.

(10) FIGS. 9A & 9B. Electron micrographs of TFD complexes formed with Compound 7 bolasomes and Sig_TFD.

(11) FIG. 10. In vitro bioassays demonstrating growth retardation of EMRSA-15 with Sig complexes formed with Compound 7.

(12) FIG. 11. In vitro bioassays demonstrating growth retardation of E. coli with EC_Fur complexes formed with Compound 7.

(13) FIG. 12. In vitro bioassays demonstrating growth retardation of EMRSA-15 with Sig complexes formed with Compound 7_12.

(14) FIG. 13. Graphs of time elapsed against optical density showing the effect of a hairpin Sig TFD/Compound 7_12 complex vs a Scrambled complex and an Empty control on the growth of the MRSA strain.

(15) FIG. 14. Graphs of time elapsed against optical density showing the effect of a hairpin Sig TFD/Dequalinium complex vs a Scrambled complex and an Empty control on the growth of the MRSA strain.

(16) FIG. 15. Graph illustrating the weight gain of mice treated with SA_Sig TFD/Compound 7 complex, SA_Sig_TFD/Compound 7_12 complex, or saline solution. a) and b) denote independent repeats of the experiment.

(17) FIG. 16. Bar chart showing kidney tissue burden following treatment of mice with Compound 7_12, SA_Sig TFD/Compound 7_12 complex, SA_Sig_Scr TFD/Compound 7_12 complex, SA_Sig_TFD, Vancomycin, or Vehicle.

(18) FIG. 17. In vitro bioassays demonstrating growth retardation of EMRSA-15 with Sig_TFD mixed with Gramicidin.

(19) FIG. 18. In vitro bioassays demonstrating growth retardation of EMRSA-15 with Sig TFD mixed with Buforin II.

(20) FIG. 19. Fluorescent microscopy confirms delivery of dye-labelled oligonucleotide to MRSA by Buforin II-derivatised complexes formed with Compound 7.

(21) FIG. 20. In vitro bioassays demonstrating growth retardation of E. coli with EC_Fur TFD mixed with Polymyxin.

(22) FIGS. 21A and 21 B. Fluorescent microscopy confirms delivery of dye-labelled oligonucleotide to MRSA by Buforin II-derivatised complexes formed with Compound 7.

(23) FIG. 22. In vitro bioassays demonstrating growth retardation of EMRSA-15 with Buforin II-derivatised Sig TFD complexes formed with compound 7.

BRIEF DESCRIPTION OF THE SEQUENCES

(24) SEQ ID NO: 1a native WhiB7 binding site in M. smegmatis str MC2 155

(25) SEQ ID NO: 2WhiB7 transcription factor decoy

(26) SEQ ID NO: 3a native FadR binding site in E. coli K12

(27) SEQ ID NO: 4FadR transcription factor decoy

(28) SEQ ID NO: 5a native binding site for YycF/YycG in S. aureus

(29) SEQ ID NO: 6a native binding site for YycF/YycG in S. aureus

(30) SEQ ID NO: 7LytM decoy

(31) SEQ ID NO: 8SsaA decoy

(32) SEQ ID NO: 9a native binding site for Sig.sup.B in S. aureus

(33) SEQ ID NO: 10a native binding site for Sig.sup.B in K. pneumoniae

(34) SEQ ID NO: 11a consensus sequence for Fur binding in S. aureus

(35) SEQ ID NO: 12a consensus sequence for Fur binding in E. coli

(36) SEQ ID NO: 13a native binding sequence for Fur in H. pylori

(37) SEQ ID NO: 14a consensus binding site for TcdR in C. difficile

(38) SEQ ID NO: 15a consensus binding site for Vfr in P. aeruginosa

(39) SEQ ID NO: 16a native binding site for Vfr in P. aeruginosa

(40) SEQ ID NO: 17a native binding site for Vfr in P. aeruginosa

(41) SEQ ID NO: 18a native binding site for NtrC in K. pneumoniae

(42) SEQ ID NO: 19a native binding sequence for ArsR in H. pylori

(43) SEQ ID NO: 20a native binding sequence for ArsR in H. pylori

(44) SEQ ID NO: 21a glycopeptide-resistant consensus sequence in S. aureus

(45) SEQ ID NO: 22an Agr binding motif in S. aureus

(46) SEQ ID NO: 23an Agr binding motif in S. aureus

(47) SEQ ID NO: 24 & 25forward and reverse primer sequences for PCR preparation of the SAsigB TFD

(48) SEQ ID NO: 26 & 27forward and reverse primer sequences for PCR preparation of the SAfhu TFD

(49) SEQ ID NO: 28 & 29forward and reverse primer sequences for PCR preparation of the SsaA TFD

(50) SEQ ID NO: 30phosphorylated Sig dumbbell TFD oligonucleotide sequence

(51) SEQ ID NO: 31phosphorylated Sig dumbbell TFD oligonucleotide sequence

(52) SEQ ID NO: 32phosphorylated oligonucleotide incorporating the binding site for WaIR

(53) SEQ ID NO: 33phosphorylated oligonucleotide incorporating the binding site for WaIR

(54) SEQ ID NO: 34 & 35forward and reverse primers for FabB promoter

(55) SEQ ID NO: 36 & 37forward and reverse primers for TFD containing the

(56) recognition sequence for the 54 factor of K. pneumoniae

(57) SEQ ID NO: 38WaIR TFD consensus sequence

(58) SEQ ID NO: 39SigB TFD consensus sequence

(59) SEQ ID NO: 40KP_Sig TFD sequence

(60) SEQ ID NO: 41KP_Sig TFD consensus sequence

(61) SEQ ID NO: 42Gram negative Sig TFD hairpin sequence

(62) SEQ ID NO: 43 & 44forward and reverse primers for scrambled S. aureus Sig binding site

(63) SEQ ID NO: 45 & 46forward and reverse primers used for amplification of a target sequence from the pGEMT-Easy vector

(64) SEQ ID NO: 47 & 48forward and reverse primers for WhiB7 TFD

(65) SEQ ID NO: 49SA SIG hairpin TFD sequence

(66) SEQ ID NO: 50SA SIG scrambled hairpin TFD sequence

(67) SEQ ID NO: 51Buforin II peptide sequence

(68) SEQ ID NO: 52Tef-derivatised SASig TFD

Example 1. Formation of Complexes with Dequalinium Analogues and TFDs

(69) Weissig et al have shown (WO99/013096) that dequaliniurn (DQA) can be used to deliver DNA to mitochondria. With sonication, DQA forms spheric-appearing aggregates with a diameter of between about 70 and 700 mm, which is similar to phospholipids vesicles. These aggregates were termed DQAsomes' in WO99/013096 and bolasomes' in Weissig and Torchilin ((2001) Adv. Drug Delivery Rev. 49: 127-149). The term bolasome is used in this specification to describe vesicles of DQA and its analogues after the compounds have been subjected to sonication.

(70) Complexes consist of a Transcription Factor Decoy (TFD) oligonucleotide self-assembled with a suitable delivery compound. A TFD oligonucleotide is 40 to 100 nucleotides in length and has a natural phosphate backbone. It self anneals to form a binding site for the targeted transcription factor and has a naturally-forming hairpin to protect the 5 and 3 ends, an example of which is shown below (GN_SIG_HP):

(71) TABLE-US-00030 SEQIDNO:42 -agc-gtg-ata-atc-att-atc-g- agcg5 g 3-cac-tat-tag-taa-tag-a-

(72) In an alternative configuration, small hairpin loops at either end of the TFD act to protect the molecule from degradation and give the TFD a dumbbell (DB) shape.

(73) Materials and Methods.

(74) Preparation of Delivery Compounds.

(75) 15 mg of each compound (Sygnature Ltd.) was dissolved in 10 ml methanol and dried to completion using a rotary evaporator and re-suspended in 5 mM Hepes pH7.4 to a final concentration of 10 mM. Compound 7 dissolved readily to give a clear, light yellow solution. Compound 7_12 dissolved after being place in a sonicator bath for 1 h, forming an opaque, light yellow solution. Both solutions were subjected to probe sonication on ice using an MSE Soniprep 150. The conditions used were: 60 cycles of 30 s on (amplitude 10 microns) and 60 s off. Following this treatment, the Compound 7_12 sample was entirely clear. Both samples were centrifuged to remove debris and are referred to as sC7 (sonicated Compound 7) or sC7_12 (sonicated Compound 7_12). This step formed vesicles or tolasomes.

(76) Preparation of Dumbbell TFD Complexes.

(77) 2 g of TFD (a 32 by oligonucleotide which has been ligated to form a monomeric circle) was mixed with 1 ml of either 5 mM Hepes pH7.4 buffer or LB broth (Luria Bertani broth: 1% (w/v) Bacto-tryptone, 5% (w/v) Bacto-Yeast Extract, 5% (w/v) NaCl) which was then mixed with between 1 and 10 l of either sC7 or sC7_12 at room temperature.

(78) Preparation of Hairpin TFD Complexes.

(79) Oligonucleotides were suspended in water at a concentration of 1 mM (i.e. 180 nmoles in 180 l). The suspension was diluted to 10 M in water and heated to 95 C. for 2 mins in dry heating block, after which the suspension was removed from the heat and allowed to cool to room temperature. To confirm that the TFD had annealed properly, 1 l TFD was mixed with 1 l 10NEB Buffer 1, 6 l water and 1 l Exonuclease I (NEB). A control mixture excludes the 1 l TED. The mixture was incubated at 37 C. for 30 min before being separated on a 3% Low Melting Point agarose gel/TAE stained with 0.5SYBR Green. Correct TFD conformation was confirmed by resistance to exonuclease digestion.

(80) To prepare delivery complexes, 10 mg of compound was suspend in 12.5 ml of 5 mM Hepes pH7.5 (final concentration 0.8 mg/ml) and dissolved by sonication (3030 s on, 30 s off, on ice at 10). Absorbance of the resulting solution was measured at 327 nm to establish an accurate concentration. 12.5 l delivery compound was mixed with 40 l 10 M TFD and 447.5 l 5 mM Hepes (pH7.5) and sonicated in an ice bath using an MSE 150 Soniprep attached with a microprobe. Thirty cycles of sonication were performed with 30 s on (with 50% power, approximately 10) and 30 s off.

(81) DNA Binding Assays.

(82) To determine the proportion of TFDs being bound by the vesicles, a SYBR-green binding assay was used. TFD complexes were formed as described above in Hepes buffer with the adaptation that the buffer contained 5 l of a 1 in 10 dilution of SYBR Green I dye (Invitrogen, 10,000 stock prepared in DMSO). Fluorescence was measured (.sub.Ex 497 nm, .sub.EM 520 nm) to determine how much bolasome needed to be added to quench the binding of SYBR Green to the TFDs.

(83) Size Determination.

(84) The size of the bolasomes was determined by Dynamic Light Scattering using a Dynapro Titan DLS Instrument.

(85) Visualisation of Particles.

(86) The size of the particles was measured using electron microscopy. Samples were directly stained with uranyl acetate before imaging.

(87) Results.

(88) 1.1 Size Distribution of sC7 Bolasomes

(89) sC7 bolasomes were prepared in 5 mM Hepes buffer at a concentration of 10 mM. Prior to measurement of their size distribution by dynamic light scattering the bolasomes were diluted in the same buffer 1000-fold. The majority of the material by mass had a diameter in excess of 3 m and was caused by non-specific aggregates or dust. The remaining particles had an average diameter of 68 nm (FIG. 4). This is somewhat different to the published size distribution of the vesicles (Weissig et al. 2001 S. T. P. Pharma Sci. 11: 91-96: Table I, see Compound 7) which estimated the size distribution to be 169 nm+/50 nm and commented that the distribution was tight. The values for sC7 bolasomes are closer to the published values, although the difference may reflect different experimental parameters and measurement instruments. Indeed, the fact that the sC7 bolasomes were stable despite dilution indicates that they have increased stability over bolasomes formed by sonication of dequalinium solutions, as these revert to the monomer on dilution (which has a diameter of less than 10 nm).

(90) The diameters of sC7 and sC7.sub. 12 bolasomes (see 1.2) are tabulated in Table 2:

(91) TABLE-US-00031 TABLE 2 Calculated values of minimum concentrations of sC7 and sC7_12 bolasomes needed to quench SYBR Green-binding to a fixed concentration of TFD. Item Diameter (nm) % Mass sC7 bolasomes Peak 1 68.0 100 sC7_12 bolasomes Peak 1 48.4 27.2 Peak 2 197.7 72.8

(92) 1.2 Size Distribution of sC7_12 Bolasomes

(93) sC7_12 bolasomes were prepared in 5 mM Hepes buffer at a concentration of 10 mM. Prior to measurement of their size distribution by dynamic light scattering the bolasomes were diluted in the same buffer 1000-fold. As described in 1.1, the signal from the large material was discounted. The remaining particles had average diameters of either 48.4 nm or 197.7 nm and were present in a ratio of 1:2.5 (FIG. 5). This was markedly different from the diameters of the sC7 bolasomes. However, the particles had a better size distribution than reported by others for those formed with similar concentrations of dequalinium and were comparable to those obtained by Weissig for bolasmomes formed from Compound 7 (Weissig et al. (2001) S. T. P. Pharma Sci. 11: 91-96).

(94) 1.3 Establishing Optimum Binding Conditions of sC7 and sC7_12 to TFD with DNA-Binding Assay

(95) SYBR-Green I dye binds specifically to double-stranded DNA and, as it does, gives a strong fluorescent signal. By measuring the change in signal in the presence of different concentrations and types of bolasome, it was possible to calculate the minimum amount of bolasome needed to quench the SYBR-Green binding, due to the dye being excluded by the bolasomes. This was achieved by extrapolation from the linear portion of a titration curve that plotted amount of bolasome added to fluorescent signal. Using a fixed concentration of 2 g TFD/ml, the minimum concentration of sC7 bolasome was found to be 6.13 g/ml (FIG. 6). At these concentrations no quenching was seen by the monomeric C7.

(96) The minimum concentration for the sC7_12 bolasomes was found to be 9.26 g/ml (FIG. 7).

(97) The minimum amount of bolasome required was used in the preparation of TFD complexes. Such concentration was also used to ensure that there was as little sample to sample variation as possible between the preparations of bolasomes. In general, variation of approximately 20% was seen and had no observable affect on biological function.

(98) The stability of the complexes was measured by monitoring the normalised fluorescence due to SYBR Green dye binding. The titration curves for TFD complexes formed with sC7 bolasomes remained constant for excess of 72 h when stored at 4 C. (FIG. 8), showing that the conditions illustrated here provide a substantial improvement in the stability of the complexes formed.

(99) 1.4 Electron Micrograph Imaging of sC7 Bolasomes and TFD Complexes

(100) The TFD complexes formed between the sC7 bolasome and a TFD were visualised by electron microscopy by negative staining with uranyl acetate. Two examples are shown in FIGS. 9A and 9B. Round particles of between 50 and 100 nm were clearly seen with densely staining interiors with granules evident in the interior that may be condensed bodies of DNA.

Example 2. Delivery of TFD in Compound 7 Bolasome Kills MRSA

(101) Materials and Methods

(102) Preparation of TFD Dumbbells by Ligation (DB-TFD)

(103) Two oligonucleotides were synthesised, each containing one strand of the recognition site for the S. aureus alternative sigma protein. At either end of the molecule a small hairpin loop acted to protect the molecule from degradation. Each oligonucleotide was re-suspended in dH.sub.2O at a concentration of 250 pmol/l. To form the Sig dumbbell TFD (referred to as Sig TFD) the following phosphorylated oligonucleotides were synthesised:

(104) TABLE-US-00032 SigDB1: SEQIDNO:30 CTTGGTTTTTCCAAGGAAGATTAGAAATTA TTTCGATGGGTATATAATA SigDB2: SEQIDNO:31 P-CCGTCTTTTTGACGGTATTATATACCCATC GAAATAATTTCTAATCTTC

(105) When annealed, these formed the following molecule:

(106) TABLE-US-00033 TCCAAGgaagattagaaattatttcgatgggtatataataPCCGTCT TTTTTT TGGTTCPCTTCTAATCTTTAATAAAGCTACCCATATATTATGGCAGT

(107) 30 l of each oligonucleotide was mixed with 27 l of dH.sub.2O and annealed using the following PCR programme: ANNEAL: 95 C. 3 min, cool at 0.1 C./s to 8 C., end. Following which, 10 l of 10NEB Ligase buffer and 3 l HC T4 DNA ligase (NEB) were added. The mixture was incubated overnight at 16 C. The material was then extensively digested with T7 exonuclease (NEB) to remove any unligated oligonucleotides and then recovered by two rounds of ethanol precipitation. A DB_TFD was also prepared containing a scrambled version of the Sig binding site, referred to as Scr TFD. In this instance the phosphorylated primers used were:

(108) TABLE-US-00034 SigScr_SA1: SEQIDNO:43 CTTGGTTTTTCCAAGTAGAAAGAAGAT TTAGGGCGATTTTATAATATAT SigScr_SA2: SEQIDNO:44 CCGTCTTTTTGACGGATATATTATAAA ATCGCCCTAAATCTTCTTTCTA

(109) Formation of Complexes

(110) The minimum amount of sC7 bolasome needed to bind 2 g of either TFD was established empirically and the appropriate amount of bolasome was mixed with the TFDs in 5 mM Hepes, pH7.4, to form complexes. Dilutions of the TFD nanoparticle were used in subsequent bioassays.

(111) Performing Growth Studies in 96-Well Plates

(112) A growth assay was performed using complexes consisting of either the Sig TFD or Scr TFD mixed with sC7 bolasomes, to determine the effect on growth of a clinically-isolated MRSA strain. The assays to determine the effect on growth of bacterial cells were performed using 96 well plates, each well containing 200 l of broth consisting of LB media. 1 l of various concentrations of TFD complexes was added to each well and the effect on bacterial growth of S. aureus was monitored by measuring absorbance of the broth at intervals during incubation. The plates were incubated at 37 C. with shaking and absorbance readings (at 450 nM) were taken using a plate reader.

(113) Results

(114) 2.1 TFD Complexes can Efficiently Kill MRSA In Vitro

(115) TFD complexes were prepared with sC7 bolasomes using a TFD known to kill MRSA cells called Sig TFD or a scrambled version as a control, Scr TFD. The MRSA strain, EMRSA15, was used to inoculate LB broth to provide a final concentration of cells of 510.sup.5/ml. 200 l aliquots were dispensed into wells in a 96 well plate. Wells were supplemented with varying concentrations of Sig TFD complex, Scr TFD complex, equivalent concentrations of the sC7 bolasomes as a control for any antibacterial effect of the dequalinium analogue (sC7 control) or the wells were untreated (FIG. 10). Both TFD complexes contained sC7 at a concentration of 500 ng/ml and TFDs at 5 g/ml. The sC7 control consisted of bolasomes at a concentration of 500 ng/ml.

(116) Cell growth was essentially similar for the untreated sample, the sC7 control and the Control Complex (consisting of the Scr TFD). However, the Sig TFD complex prevented bacterial growth. Hence, the combination of the sC7 bolasome with the Sig TFD killed the MRSA strain, whereas the control TFD complex did not. This was due to the complexes effectively delivering the TFD therapeutic to the MRSA. The action of delivery alone, with concomitant membrane damage, did not kill the bacteria as neither the Control Complex nor an equivalent amount of sC7 bolasomes affected cell growth.

Example 3. Delivery of TFD by Compound 7 Bolasome Kills E. coli

(117) Materials and Methods

(118) Preparation of Fur TFDs by PCR

(119) Fur TFDs were designed to incorporate the binding site for the transcriptional regulator of fatty acid synthesis enzymes, FadR, which occurs upstream of the FabB gene in Escherichia coli. The FabB gene encodes an enzyme involved in fatty acid synthesis (J. Bacteriology (2005) 183:5292). The oligonucleotides used to amplify the promoter sequence were:

(120) TABLE-US-00035 fabBf SEQIDNO:34 5-tctttaaatggctgatcggacttg-3 fabBr SEQIDNO:35 5-agtaagtttcgaatgcacaatagcgta-3

(121) The resulting fragment was ligated into pGEMTEasy vector (Promega) and PCR TFDs were synthesized by PCR amplification using oligonucleotide primers designed to anneal to the backbone of the vector immediately flanking the insert, for example:

(122) TABLE-US-00036 TEf: SEQIDNO:45 5-ggccgccatggcggccgcgggaattc-3 TEr: SEQIDNO:46 5-aggcggccgcgaattcactagtg-3.

(123) The PCR product is ethanol precipitated and re-suspended in TE buffer (10 mM Tris.HCl, 1 mM EDTA pH8.0) at a concentration of 500-1000 ng/l.

(124) A control TFD having a the sequence that gave rise to a similar sized PCR fragment when used in an amplification reaction with genomic DNA isolated from Mycobacterium smegmatis was also generated. The sequences of these oligonucleotides were:

(125) TABLE-US-00037 WhiB7.f SEQIDNO:47 CACCAGCCGAAAAGGCCACGG WhiB7.r SEQIDNO:48 CAAAAATGGCCACGGATCCGGGTG

(126) Results

(127) 3.1 TFD Complexes can Efficiently Kill E. coli In Vitro

(128) TFD complexes were formed with a TFD known to be active against E. coli, EC Fur, and a control TFD, EC FurScr TFD. The experiment was performed as described in Example 2.1 and similar results were obtained (FIG. 11). Again, the results show that complexes formed with sC7 bolasomes and EC Fur TFD prevented growth of E. coli (strain DH10B) in an iron-limited media.

Example 4. Delivery of TFD by Compound 7_12 Bolasome Kills MRSA

(129) Materials and Methods

(130) TFD complexes were formed as described in Example 2 with Sig_TFD or Scr TFD, with the exception that sC7_12 bolasomes were used. The resultant TFD complexes were tested for their activity in preventing growth of MRSA strain EMRSA15.

(131) Results

(132) 4.1 TFD Complexes can Efficiently Kill MRSA In Vitro

(133) TFD complexes were prepared using a TFD known to kill MRSA cells called Sig TFD and a scrambled version, Scr TFD, as a control with sC7_12 bolasomes. The MRSA strain, EMRSA15, was used to inoculate LB broth to give a final concentration of cells of 510.sup.5/ml. 200 l aliquots were dispensed into wells in a 96 well plate. Wells were supplemented with varying concentrations of Sig TFD complexes, Scr TFD complexes, equivalent concentrations of the sC7_12 bolasomes as a control for any antibacterial effect of the dequalinium analogue (sC7_12 control) or the wells were untreated (FIG. 12). Both TFD complexes contained sC7_12 at a concentration of 800 ng/ml (1.3 M) and TFDs at 5 g/ml (153 nM). The sC7_12 control consisted of bolasomes at a concentration of 800 ng/ml.

(134) Cell growth was essentially similar for the untreated sample, the sC7_12 control and the control complex (including the Scr TFD). However, the Sig TFD complex prevented bacterial growth. Hence, the combination of the sC7_12 bolasome with the Sig TFD killed the MRSA strain, whereas the control TFD complex did not. This was due to the complexes effectively delivering the TFD therapeutic to the MRSA. The action of delivery alone, with concomitant membrane damage, did not kill the cells as neither the control complex nor an equivalent amount of sC7_12 bolasomes affected cell growth.

Example 5. Delivery of Hairpin TFD by Various Delivery Compounds Kills MRSA

(135) TFD complexes containing the hairpin TFD SA SIG and either dequalinium, Compound 7 or Compound 7_12 were prepared using the method set out in Example 1. The size distributions of the formed vesicles were measured using a Malvern Nanosizer using standard methodology and are set out in Table 3 below:

(136) TABLE-US-00038 TABLE 3 Delivery Compound Vesicle size distribution (nm) Concentration (M) Dequalinium 75-820 745 Compound 7 139 +/ 35 75 Compound 7_12 117 +/ 32 75

(137) The size distribution of the vesicles was found not to alter when TFDs of different sequences were used. The sequence of the SA SIG HP (targeted to bind to the alternative sigma factor in Staphylococcus aureus) is:

(138) TABLE-US-00039 SEQIDNO:49 5-gcgaagcgaagattagaaattatttccatgggtatataatacttggtt tttccaagtattatatacccatggaaataatttctaatcttc-3

(139) 5.1. Efficacy of SA_SIG_HP TFD Complexed with Compound 7_12

(140) The TFD complex was prepared as described in Example 1 (referred to as Sig) as were two control snares, one containing no TFD (Empty) and the other a scrambled version of SA SIG HP (Scrambled) that contained the TFD SA_SIG_Scr_HP, which has the following sequence:

(141) TABLE-US-00040 SEQIDNO:50 5-gcgaagcatcttgtatgcaaatagaatgaataatagtttgacttggtt tttccaagtcaaactattattcattctatttgcatacaagat-3

(142) 1 l of each delivery complex was added to 200 l of LB broth inoculated with 1 l of a glycerol stock of an MRSA strain, EMSRA15, at a concentration of 310.sup.6 colony forming units per l. The cultures were grown at 37 C. with mild shaking and the optical density of the cultures measured in a plate reader at half hour intervals.

(143) The plots of time elapsed against optical density shown in FIG. 13 demonstrate that the Sig complex effectively prevented growth of the MRSA strain with concentrations of 500 ng/ml Compound 7_12 and 20 pmol TFD. Bacteria treated with the Scr complex (with similar concentrations of both Compound 7_12 and TFD) grew slower than both Empty control and the untreated sample. This has been observed in previous experiments and is interpreted as being due to growth being slowed by the action of delivering the scrambled TFD into the cell. When that TFD inhibits stress response, as does SA_SIG_HP, the cells fail to recover. Growth of the Empty control and the untreated sample were indistinguishable.

(144) Hence, complexes containing the SIG_SA_HP TFD, designed to block essential pathways in S. aureus, are fatal to bacterial cells whereas delivery of a scrambled version of the TFD or the delivery vehicle alone is ineffective.

(145) 5.2. Efficacy of SA_SIG_HP Complexed with Dequalinium

(146) The TFD complex was prepared as described in the section 5.1 above with the exception that the concentration of dequalinium used was 6-fold higher than the concentration of Compound 7_12. Similarly two control snares were prepared, one containing no TFD (Empty) and the other a scrambled version of SA SIG HP (Scrambled) that contained the TFD SA_SIG_Scr_HP.

(147) 1 l of each delivery complex was added to 200 l of LB broth inoculated with 1 l of a glycerol stock of an MRSA strain, EMSRA15 at a concentration of 310.sup.6 colony forming units per l. The cultures were grown at 37 C. with mild shaking and the optical density of the cultures measured in a plate reader at half hour intervals. The plots of time elapsed against optical density shown in FIG. 14 demonstrate that the Sig antibacterial effectively prevented growth of the MRSA strain with concentrations of 3 g/ml Compound 7_12 and 10 pmol TFD. Bacteria treated with the Scr antibacterial (with similar concentrations of both Dequalinium and TFD) grew slower than both Empty control and the untreated sample. This has been observed in previous experiments and is interpreted as being due to growth being slowed by the action of delivering the scrambled TFD into the cell. When that TFD inhibits stress response, as does SA_SIG_HP, the cells fail to recover. Growth of the Empty control and the untreated sample were indistinguishable.

(148) Hence, complexes containing the SIG_SA_HP TFD, designed to block essential pathways in S. aureus, is fatal to the cells whereas delivery of a scrambled version of the TFD or the delivery vehicle alone are ineffective.

Example 6. Efficacy of SA Sig TFD by Compound C7_12 in Treatment of MRSA in a Mouse Sepsis Model

(149) Mice used in this study, male CD1 mice, were supplied by Charles River (Margate UK) and were specific pathogen free (16-18 g at delivery). All mice weighed 22-25 g at the beginning of the experiment.

(150) 6.1. Tolerability Study

(151) Animals were treated in groups of two mice per treatment group, therefore six animals were used in total for the study. All the mice were weighed on day 1 of the study and placed randomly into boxes. The mice had the following treatments administered intravenously at 10 ml/kg: 100 M SA Sig TFD (2 mg/ml; SEQ ID NO:9) and 525 M (0.315 mg/ml) Compound 7 in saline solution; 100 M SA Sig TFD (2 mg/ml; SEQ ID NO:9) and 525 M Compound 7_12 (0.315 mg/ml) in saline solution; and saline solution alone.

(152) The concentrations of TFD and delivery molecules were chosen to be approximately ten-fold greater than the predicted effective dose.

(153) The mice were weighed daily post-treatment over a 100 h period before they were euthanised. The lungs, liver, spleen and kidneys were removed and visually examined and weighed. FIG. 15 shows the weight gain of all three groups with indices a) and b) referring to independent experimental repeats.

(154) No significant difference was seen between the control treatments (saline) and those treated with combinations of TFD and delivery compounds. Thus, all treatments were well tolerated following intravenous administration. There were no acute events to report. Following treatment, mice fed and drank normally with no signs of distress. The weight increase of the treated mice was the same as the vehicle controls. Autopsy showed no gross abnormalities of kidneys, lungs, liver or GI tract. The weights of kidneys, lungs and liver were within the normal range. All test compounds are tolerated and suitable for further dosing up to the maximum dose used in this tolerability study.

(155) 6.2. Tissue Burden Study

(156) Animals were treated in groups of since mice per treatment group, therefore forty eight animals were used in total for the study. Two 10 ml cultures of Staphylococcus aureus EMRSA 16 were prepared and placed on orbital shaker (220 rpm) overnight at 37 C. The following day, the Staphylococcus aureus EMRSA 16 cultures were removed from shaker, pelleted and washed twice before being resuspended in saline to an OD of 0.132 (1.510.sup.8 cfu/ml). This stock solution of Staphylococcus aureus EMRSA 16 was then further diluted 1:1.5 in saline (110.sup.8 cfu/ml) i.e. 2.010.sup.7 bacteria per mouse.

(157) All forty eight mice were then infected with 0.2 ml of the 1.010.sup.8/ml suspension by intravenous injection into mouse tail vein. The number of Staphylococcus aureus EMRSA 16 bacteria per nil in the remainder of the suspensions after inoculation was also counted to confirm infection load.

(158) Mice were treated 1, 9 and 17 hours post infection with either compound or vehicle, though vancomycin was only administered after 1 h. The treatments were a combination of antibiotic complexes, prepared with Compound 7_12 and various TFDs, as tabulated in Table 3 below.

(159) TABLE-US-00041 TABLE 3 Compound SA Scr Sig Treatment C7_12 SA Sig TFD TFD Vancomycin C7_12 alone 15 ng/kg Sig complex 15 ng/kg 1 nM Scr complex 15 ng/kg 1 nM Sig TFD 1 nM Vancomycin 25 mg/kg Saline

(160) After 25 hours post infection, all animals were weighed and then euthanised. The kidneys were immediately removed and homogenised in ice-cold sterile phosphate buffered saline+0.05% Tween 80. Organ homogenates were quantitatively cultured onto CLED agar and incubated at 37 C. for up to 3 days and colonies counted. The data from the culture burdens was analysed by the Kruskal-Wallis test using Stats Direct.

(161) 6.3. Tissue Burden Study

(162) The infectious dose administered was targeted at 3.710.sup.7 bacteria per mouse to ensure that a relatively acute infection was established i.e. an infection that is sensitive to treatment. The mice were treated with systemic injection of either (A) the delivery compound alone (Compound C7_12), (B) 1 nM of SA_Sig/Compound 7_12 complex, (C) 1 nM of Scrambled control complex, (D) 1 nM of SA_Sig TFD alone, (E) vancomycin, used at a concentration sufficient to achieve a 2-fold reduction in colony forming units (cfu), or (F) vehicle. Following treatment, the mice were sacrificed and the burden found within the kidneys measured (see FIG. 16).

(163) Statistical analysis of the results showed that the Sig snare antibacterial-treated mice achieved a similar reduction in burden to that achieved by vancomycin. All other controls show similar burdens to the vehicle treatment (Table 4).

(164) TABLE-US-00042 TABLE 4 Statistical analysis of in vivo results. Kruskal-Wallis: all pairwise comparisons (Dwass-Steel-Chritchlow-Fligner) for Sig TFD complex Sig Scr Sig Treatment complex complex TFD Vancomycin Vehicle C7_12 0.0001 0.5490 0.4695 0.0004 0.4109 Sig snare 0.0008 <0.0001 0.7263 <0.0001 Scr snare 0.1894 0.0023 0.1588 Sig TFD <0.0001 0.9203 Vancomycin <0.0001

(165) The Sig complex in this experiment was found to have a rapid bacteriocidal activity at nanomolar concentrations against MRSA both in vitro and in vivo.

Example 7. Delivery of TFDs Mediated by Antibacterial Peptides

(166) Materials and Methods

(167) The following antibacterial peptides were assayed for their ability to deliver TFDs to bacterial cells: Gramicidin, Polymyxin nonapeptide (both purchased from Sigma Aldrich) and Buforin II (Park et al. (2000) Proc. Natl. Acad. Sci. USA 97: 8245-8250). Typically 1 g of the Sig DB-TFDs and SigScr DB-TFD as described in Example 1 were mixed with between 0.2 and 5 g of Gramicidin in a total volume of 5 l 50 mM NaCl. Of this, 1 l was added to 200 l of LB broth inoculated with a 1/100 dilution of a glycerol stock of EMRSA-15 at an original density of 0.3 OD (Absorbance at 600 nm) and aliquoted into a well of a 96 well plate. Experiments were performed in triplicate. The plates were incubated at 37 C. with shaking and absorbance readings (at 450 nM) were taken using a plate reader.

(168) Results

(169) 7.1. Gramicidin Effectively Delivers TFDs to S. aureus

(170) Adding 1 g of Sig DB-TFD to LB media inoculated with EMRSA-15 and with 150 ng/ul of Gramicidin resulted in no bacterial growth. In contrast the TFD alone, Gramicidin alone or Gramicidin mixed with the scrambled version of the DB-TFD grew as well as the untreated control (FIG. 17).

(171) 7.2. Buforin II Effectively Delivers TFDs to S. aureus

(172) The 21 amino acid Buforin II peptide consisted of the following sequence: TRSSRAGLQFPVGRVHRLLRK (SEQ ID NO:51). Sig TFDs mixed with Buforin II retarded growth of EMRSA-15 when mixed with the membrane-active antimicrobial peptide Buforin II and prevented growth of the bacteria in a 96 well plate in vitro assay. The control TFD, Scr, which was a scrambled version of the sequence in the Sig TFD, had no discernable effect on growth when compared to the untreated broth or the cells treated with peptide alone (FIG. 18).

(173) As an alternative, a fluorescently-labelled oligonucleotide was used as a substitute for the TFD. Though this has no predicted activity as a TFD molecule, the fluorescein-labelled oligonucleotide incorporates a fluorescent label so its uptake can be monitored by fluorescent light microscopy (FIG. 19).

(174) 7.3. Polymyxin Effectively Delivers TFDs to E. coli

(175) When mixed with the Gram-negative active antimicrobial cyclic glycopeptide polymyxin, EC Fur TFD retarded growth of DH5a and prevented growth of the bacteria in a 96 well plate in vitro assay using iron-limiting media. The control TFD, WhiB7 TFD which was an unrelated sequence of similar size as the Fur TFD, had no discernable effect on growth when compared to the untreated broth or the cells treated with peptide alone (FIG. 20).

Example 8. Delivery of TFD/Dequalinium Complexes Conjugated with Buforin II

(176) Materials and Methods

(177) Derivatisation of Complexes with Antimicrobial Peptide

(178) TFD complexes were derivatised with the antimicrobial peptide Buforin II using the cross-linker EDC (1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride; Thermo Scientific) and following an adaptation of the two-step coupling protocol as described by the manufacturer.

(179) The Buforin II peptide was synthesised and lyophilised and re-suspended at a concentration of 1 mg/ml in Activation Buffer (0.1 M MES [2-(N-morpholino)ethane sulfonic acid], 0.5 M NaCl, pH6.0). 1 ml of this solution was mixed with 0.4 mg EDC and 1.1 mg Sulfo-NHS (Thermo Scientific) and incubated for between 5 and 120 min at room temperature, most typically 30 min. After incubation, 1.4 l 2-mercaptoethanol was added to quench the EDC. Unincorporated EDC and Sulfo-NHS were removed from the peptide sample by dialysis using tubing with a low molecular weight cut-off (Pierce, Slide-A-Lyzer, 2K MWCO).

(180) Concentrated TFD complexes were prepared using techniques described in Examples 2 and 3. 35 l of TFD at a concentration of 1.5 mg/ml was mixed with 130 l PBS (Phosphate-buffered saline; 0.1 M sodium phosphate buffer pH7.2, 0.15 M NaCl) and 35 l of sonicated Compound 7 (bolasomes) at a concentration of 3.15 mg/ml. Typically 90 l of concentrated TFD complexes were mixed with 10 l of derivatised Buforin II and allowed to react for 2 hours at room temperature. The reaction was quenched by addition of 10 mM hydroxylamine. Prior to use in bioassays the derivatised TFD nanoparticle were diluted to the appropriate concentration.

(181) As an alternative, a fluorescein-labelled oligonucleotide was used as a substitute for the TFD. Though this has no predicted activity as a TFD molecule, the fluorescein-labelled oligonucleotide incorporates a fluorescent label so its uptake can be monitored by fluorescent light microscopy.

(182) Results

(183) 8.1. Buforin II-Derivatised TFD Complexes Effectively Deliver Oligonucleotides to S. aureus

(184) Derivatised TFD complexes were formed as described, with the exception that the TFD was substituted with a fluorescently labelled oligonucleotide, Tef, that contained a fluorescein dye at the 5 end. The sequence of the oligonucleotide was:

(185) TABLE-US-00043 SEQIDNO:52 Tef-Fluorescein-AGGCGGCCGCGAATTCACTAGTGA.

(186) The derivatised complexes are added to 200 l of LB broth inoculated with the MRSA strain, EMRSA-15, and grown overnight with shaking at 37 C. The following morning, cells were harvested by centrifugation and washed four times in an equal volume of PBS. A drop of the bacterial suspension was placed on a microscope slide and air dried. Cells were then heat-fixed by passing the slide through a Bunsen flame. The slide was then flooded with a solution of Loeffler's methylene blue (5 mg/ml methylene blue in 69:30:1 (v/v) solution of water:methanol:1% (w/v) KOH) and allowed to stand for 1 min, after which the excess solution was washed off with water and the cells visualised using a Cairn CCD Fluorescence Microscope.

(187) In the bright-field view (no fluorescence) the bacteria could be clearly seen clumped together (FIG. 21) and in the fluorescence view it could be seen that the labelled oligonucleotide had been internalised, consistent with the derivatised nanoparticle affecting delivery. Bacteria grown in broth without derivatised complexes showed no fluorescence.

(188) 8.2. Buforin II-Derivatised TFD Complexes can Prevent Bacterial Growth of MRSA

(189) Derivatised complexes were produced that contained either the Sig TFD or Scr TFD as a control (as in Example 2). The concentration of the TFD component in the stock of derivatised complexes was 8 M and the complexes were diluted to give a working concentration of 16 nM TFD and 1.8 M Compound 7.

(190) At this concentration the derivatised complexes containing the Sig TFD entirely prevented growth of the MRSA strain, while the derivatised complex containing the control TFD did not. Indeed, growth was similar to the untreated sample and the sC7 control broth containing 1.8 M Compound 7 bolasomes (FIG. 22).

(191) Hence, complexes derivatised with Buforin II deliver Sig TFDs to pathogenic bacteria to prevent growth. Furthermore, the effective concentration of the complexes used was lower than that for the non-derivatised complexes (section 4.1).

Example 9. Formation of Complexes with Other Dequalinium Analogues

(192) By following the general synthetic methods described herein, the following dequalinium analogues were prepared: 10,10-(octane-1,8-diyl)bis(9-amino-1,2,3,4-tetrahydroacridinium) diiodide; 10,10-(dodecane-1,12-diyl)bis(9-amino-1,2,3,4-tetrahydroacridinium) diiodide; 10,10-(tetradecane-1,14-diyl)bis(9-amino-1,2,3,4-tetrahydroacridinium) diiodide; 10,10-(octadecane-1,18-diyl)bis(9-amino-1,2,3,4-tetrahydroacridinium) diiodide; 5,5-(dodecane-1,12-diyl)bis(11-amino-7,8,9,10-tetrahydro-6H-cyclohepta[b]quinolinium) diiodide; 1,1-(decane-1,10-diyl)bis(4-aminoquinolinium) diiodide; 1,1-(dodecane-1,12-diyl)bis(4-aminoquinolinium) diiodide; 1,1-(decane-1,10-diyl)bis(4-methoxyquinolinium) diiodide; and 1,1-(decane-1,10-diyl)bis(2-aminoquinolinium) diiodide.

(193) The compounds listed above may be used in the methods described in Examples 1 to 8 to prepare further complexes according to the invention