Butyrogenic bacteria as probiotics to treat clostridium difficile
09669059 ยท 2017-06-06
Assignee
Inventors
Cpc classification
A61K35/744
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A61K35/744
HUMAN NECESSITIES
A23V2002/00
HUMAN NECESSITIES
International classification
A23L33/135
HUMAN NECESSITIES
A61K35/744
HUMAN NECESSITIES
Abstract
The subject invention pertains to the use of certain bacterial strains, particularly butyrogenic bacteria, for preparing a composition to treat and/or prevent Clostridium difficile infection. In particular, the invention relates to the use of butyrate-producing anaerobic fermenters of gut commensals in pharmaceutical or food compositions.
Claims
1. A method for treating Clostridium difficile infection (CDI) comprising the step of administering to a mammal an effective amount of a composition comprising at least one strain of bacteria from the genus Pseudobutryrivibrio and, optionally, at least one other strain from the following butyrogenic bacterial genera: Blautia, Roseburia, Dorea, and Coprococcus.
2. The method of claim 1, wherein the composition comprises more than one strain of bacteria.
3. The method of claim 1, wherein the composition further comprises at least one strain from the following additional bacterial taxa: Faecalibacterium, Anaerostipes, Subdoligranulum, Ruminoccocus, Streptococcus, and Lachnospiraceae.
4. The method of claim 3, wherein the composition further comprises more than one additional strain of bacteria.
5. The method of claim 1, further comprising the step of diagnosing the CDI in the mammal.
6. The method of claim 1, further comprising the step of monitoring the CDI in the mammal.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
DETAILED DISCLOSURE
(22) The present invention provides materials and methods for treating and/or preventing a CDI.
(23) In one embodiment, the subject invention provides a composition comprising at least one nonpathogenic, butyrogenic bacterial strain or a mixture of bacterial strains that include at least one butyrogenic bacterial strain. In another embodiment of the invention, a method for treating and/or preventing CDI is provided that comprises the step of administering to a mammal an effective amount of a composition comprising at least one nonpathogenic, butyrogenic bacterial strain or a mixture of bacterial strains that include at least one butyrogenic bacterial strain in treating and/or preventing the CDI.
(24) In one embodiment, a strain of bacteria of the Ruminococcaceae or Lachnospiraceae family is used. In a specific embodiment, the subject invention uses one or more of the following butyrogenic bacteria: Blautia, Pseudobutyrivibrio, Roseburia, Faecalibacterium, Anaerostipes, Subdoligranulum, Ruminococcus, Streptococcus, Dorea, and Coprococcus.
(25) According to the subject invention, 549,643 partial prokaryotic 16S rRNA gene sequences from C. difficile-positive, C. difficile-negative diarrheal samples and samples from healthy controls were examined, from which 3,531 bacterial phylotypes from 115 fecal specimens were identified. Microbiome analysis revealed significant alterations in microbial community structure associated with CDI, which was accompanied by markedly decreased microbial diversity and fewer bacterial phylotypes compared to healthy controls. Several essential butyrate and short-chain fatty acid (SCFA) producing bacteria were identified as being either absent or markedly depleted in CDI, all of which are members of the Clostridium clusters IV and XIVa. These results suggest a conserved set of core organisms in the human gut that are important against C. difficile infection. Based on these results, candidate organisms were identified for use in the subject probiotics-based therapeutic approaches for CDI.
(26) The term mammal according to the present invention refers to both monogastric mammals and polygastric mammals. Humans, felines and canines are particularly intended, especially domesticated mammals.
(27) The term nonpathogenic is intended to mean a microbial species for which no pathology of the host associated with its presence has been demonstrated (strain GRAS=Generally Recognized As Safe).
(28) A composition of the invention can be, for example, a nutritional composition or a pharmaceutical composition. A nutritional composition of the invention is one that may be enterally consumed in any form, such as a food product. A pharmaceutical composition of the invention comprises at least one bacterial strain of the invention that is useful in treating and/or preventing CDI. A pharmaceutical composition comprises at least one bacterial strain of the invention that is combined with a pharmaceutically acceptable carrier, which may comprise excipients. It is preferably administered orally or directly in situ, e.g., rectally via suppositories.
(29) The composition according to the invention may be administered orally, in the form of capsules, tablets, powders, granules, solutions, or suspensions. The at least one bacterial strain can be mixed with conventional excipients, such as gelatin, starch, lactose, magnesium stearate, talc, gum arabic and the like. It may also be advantageous to use less conventional excipients that, for example, make it possible to increase the ability of the at least one bacterial strain used to be active in the gut. For example, cellobiose, maltose, mannose, salicine, trehalose, amygdalin, arabinose, melobiose, rhamnose and/or xylose may be added. This list is not exhaustive and the substrates are chosen and adapted as a function of the strain considered. These substrates may promote growth of the at least one butyrogenic strain present in the composition.
(30) Thus, the composition preferably comprises at least one additive which promotes the activity of the at least one strain in the digestive environment.
(31) In a particular embodiment of the invention, the at least one nonpathogenic, butyrogenic bacterial strain present in the pharmaceutical and/or nutritional composition is administered in a form which allows it to be active in the gut (e.g., colon). In particular, it is necessary for the bacterial strain to be alive, or viable, in the digestive tract. After production of the bacterial strain and, depending on the methods of production, it is also possible to maintain this strain under anaerobic packaging conditions in order to enable it to remain viable.
(32) In a preferred embodiment, the at least one nonpathogenic, butyrogenic bacterial strain is packaged in an anaerobic environment, i.e., it is packaged in an oxygen-free atmosphere.
(33) According to the subject invention, a method is provided for preventing and/or treating CDI that comprises the step of administering to a mammal an affective amount of a composition comprising a selected bacterial strain or a mixture of selected bacterial strains. The method may include the step of: diagnosing the CDI in the mammal and/or monitoring the CDI in the mammal. Thus, according to one embodiment of the invention, the CDI bacterial strain can be isolated from the digestive system, in particular from the feces, of the mammal.
(34) In a particular embodiment, a method for specifically monitoring and/or diagnosing the C. difficile bacterial strain in the digestive tract of a mammal comprises the following steps: defining a nucleotide sequence (probe or primer) specific for the C. difficile strain; detecting and/or quantifying said strain by hybridization of the probe with nucleic acid extracted from the fecal flora, or with the fecal bacteria attached to a slide. For example, detection of nucleic acids (DNA or RNA) of C. difficile can be performed by PCR or RT-PCR or by hybridization with specific probes (Southern or Northern).
(35) In order to carry out such a diagnosing and/or monitoring step, diagnostic kits, which are also objects of the present invention, can be used. Such kits can contain a standard in order to be able to evaluate the amount of bacterial strain(s) in the feces.
(36) Preparation of Bacterial Strain
(37) Bacterial strains useful according to the subject invention may be obtained commercially and/or produced by a fermentation process and, optionally, drying.
(38) According to one embodiment, a method for producing a butyrogenic bacterial strain, for its use as defined above, comprises the following steps: the strain is grown on a suitable medium, under conditions of strict anaerobiosis, in the presence of a carbon-based substrate and/or of H.sub.2/CO.sub.2 as energy source; the bacterial cells are recovered; the bacterial cells are packaged.
(39) A preferred method for recovering the bacterial cells is centrifugation, for example between 10,000 g and 15,000 g, advantageously 12,000 g, for 15 to 20 minutes.
(40) The bacteria may be washed in, for example, an anaerobic phosphate buffer, by resuspension of the cells, agitation, and a further centrifugation step.
(41) Preparation of Compositions of the Invention
(42) The selected bacterial strain(s) may be in a dried form. The drying of bacterial strains after production by fermentation is known to the skilled person. See for example, EP 0 818 529 (SOCIETE DES PRODUITS NESTLE), which is incorporated by reference in its entirety, where a drying process of pulverisation is described, or WO 0144440 (INRA), which is also incorporated by reference in its entirety. Usually, bacterial microorganisms are concentrated from a medium and dried by spray drying, fluidised bed drying, lyophilisation (freeze drying) or other drying process. Micro-organisms can be mixed, for example, with a carrier material such as a carbohydrate such as sucrose, lactose or maltodextrin, a lipid or a protein, for example milk powder during or before the drying.
(43) The bacterial strain need not necessarily be present in a dried form. It may also be suitable to mix the bacteria directly after fermentation with a food product and, optionally, perform a drying process thereafter. Such an approach is disclosed in PCT/EP02/01504) (SOCIETE DES PRODUITS NESTLE), which is incorporated by reference in its entirety. Likewise, a probiotic composition of the subject invention may also be consumed directly after fermentation. Further processing, for example, for the sake of the manufacture of convenient food products, is not a precondition for the beneficial properties of the bacterial strains provided in the probiotic composition.
(44) The compositions according to the present invention may be enterally consumed in any form. They may be added to a nutritional composition, such as a food product. On the other hand, they may also be consumed directly, for example in a dried form or directly after production of the biomass by fermentation.
(45) According to the subject invention, the bacterial strain(s) can be provided in an encapsulated form in order to ensure a high survival rate of the micro-organisms during passage through the gastrointestinal tract or during storage or shelf life of the product.
(46) The compositions of the subject invention may, for example, be provided as a probiotic composition that is consumed in the form of a fermented, dairy product, such as a chilled dairy product, a yogurt, or a fresh cheese. In these later cases, the bacterial strain(s) may be used directly also to produce the fermented product itself and has therefore at least a double function: the probiotic functions within the context of the present invention and the function of fermenting a substrate such as milk to produce a yogurt.
(47) If the bacterial strain is added to a nutritional formula, the skilled person is aware of the possibilities to achieve this. Dried, for example, spray dried bacteria, such as obtainable by the process disclosed in EP 0 818 529 (which is incorporated herein by reference in its entirety) may be added directly to a nutritional formula in powdered form or to any other food product. For example, a powdered preparation of the bacterial strain(s) of the invention may be added to a nutritional formula, breakfast cereals, salads, a slice of bread prior to consumption.
(48) Bacterial strain(s) of the invention may be added to a liquid product, for example, a beverage or a drink. If it is intended to consume the bacteria in an actively-growing state, the liquid product comprising the bacterial strain(s) should be consumed relatively quickly upon addition of the bacteria. However, if the bacteria are added to a shelf-stable product, quick consumption may not be necessary, so long as the bacterial strain(s) are stable in the beverage or the drink.
(49) WO 98/10666, which is incorporated herein by reference in its entirety, discloses a process of drying a food composition and a culture of probiotic bacteria conjointly. Accordingly, the subject bacterial strain(s) may be dried at the same time with juices, milk-based products or vegetable milks, for example, yielding a dried product already comprising probiotics. This product may later be reconstituted with an aqueous liquid.
(50) Quantity of Probiotics
(51) Although it is not mandatory, probiotic bacteria may be consumed in the living state with the intention that the probiotic micro-organisms arrive intactly in the small and large intestines the latter of which may be colonized. If this is the case, a sufficient dose of bacteria is usually consumed per day in order to achieve successful colonization. The skilled person is aware of these daily doses, which depend on the micro-organisms but generally are in the range of 10.sup.6 to 10.sup.14, preferably 10.sup.7 to 10.sup.13 cfu per day.
(52) However, the teaching of the present invention may also be achieved with dead probiotics, with the fermented media or simply with the substrate for the probiotics, which usually is prebiotic fiber.
(53) Hence, the fermented media, even if essentially free of probiotics but comprising metabolites of probiotics, may be used to work the present invention.
(54) In other words, dead or living probiotics, their medium, substrate or metabolites may be directly added to food products in the same or a similar way as set forth above for living probiotics more specifically. The fermented medium, substrate or metabolites may be separated from the bacteria after fermentation by centrifugation or filtration, for example. The supernatant or the filtrate may then be concentrated, chilled, frozen, dried, for example, spray dried or directly used for enteral administration to an individual. If fermented medium is dried, it may be powdered and, as described above for the living bacterial strain(s), added to any food product.
(55) If supernatant or fermentation medium is to be administered to a human, the effective amount is in the range of 0.5 to 3 dl, preferably 1 to 2 dl of growth medium, harvested after 30 to 50 hrs, preferably 45 to 50 hrs of bacterial growth. When density of bacteria is estimated at an OD600 nm, an OD of 2 to 7 is routinely obtained, which represents the respective growth of 2 to 710.sup.8 bacteria per ml. The supernatant may be administered after removal of the bacteria by filtration, for example.
Example 1
(56) Methods
(57) Subjects and Sample Collection
(58) The University of Florida Institutional Review Board reviewed the study design. Stool samples positive (CDI) and negative (CDN) for C. difficile, defined based on results of ELISA (C. Diff Quik Chek Complete, Techlab, Blacksburg, Va.) or GeneXpert multiplex PCR for detection of toxin B gene (Cepheid, Sunnyvale, Calif.), were obtained from the Clinical Microbiology Laboratory at Shands Hospital at the University of Florida. Fecal samples from healthy individuals were collected from subjects undergoing screening colonoscopy and were analyzed in parallel as controls. Toxin B (tcdB gene) specific PCR (Kuhl, S. J., Tang, Y. J., Navarro, L., Gumerlock, P. H., and J., S., Jr. 1993. Diagnosis and monitoring of Clostridium difficile infections with the polymerase chain reaction. Clin Infect Dis 16 Suppl 4:S234-8; Gumerlock, P. H., Tang, Y. J., Meyers, F. J., and Silva, J., Jr. 1991. Use of the polymerase chain reaction for the specific and direct detection of Clostridium difficile in human feces. Rev. Infect. Dis. 13:1053-1060; Kato, N., Ou, C. Y., Kato, H., Bartley, S. L., Luo, C. C., Killgore, G. E., and Ueno, K. 1993. Detection of toxigenic Clostridium difficile in stool specimens by the polymerase chain reaction. J Infect Dis 167:455-8; and Alonso, R., Munoz, C., Gros, S., Garcia de Viedma, D., Pelaez, T., and Bouza, E. 1999. Rapid detection of toxigenic Clostridium difficile from stool samples by a nested PCR of toxin B gene. J. Hosp. Infect. 41:145-149.) was performed in all 115 samples (Example 2; Methods).
(59) DNA Extraction, Bacterial 16S rDNA Gene Amplification, and Sequence Analysis
(60) Genomic DNA was extracted from each fecal specimen using a bead-beating, solvent extraction method (MO-BIO PowerSoil DNA Isolation Kit, Mo Bio, Carlsbad, Calif.). The V1-V3 hypervariable region of bacterial 16S rRNA gene segments was amplified in 4 replicates using broad-range rRNA PCR primers 27F and 534R and the PCR products pooled. The reverse primer (534R) included a barcode sequence unique to each sample, allowing PCR amplicons to be multiplexed and sequenced simultaneously. The amplicons were gel purified, pooled, and subjected to pyrosequencing using the Titanium chemistry on the Roche/454 GS-FLX platform. Pyrosequence reads were filtered, trimmed, and aligned to the SILVA non-redundant 16S reference database, release 108 (Pruesse, E., Quast, C., Knittel, K., Fuchs, B. M., Ludwig, W., Peplies, J., and Glockner, F. O. 2007. SILVA: a comprehensive online resource for quality checked and aligned ribosomal RNA sequence data compatible with ARB. Nucleic Acids Res 35:7188-96.). Reads were assigned taxonomic classifications using USEARCH (version 5.1), and de-replicated to unique reference sequence-based operational taxonomic units (refOTU) using UCLUST (version 5.0) (
(61) Statistical Methods
(62) Weighted and Unweighted Unifrac (Lozupone, C., Lladser, M. E., Knights, D., Stombaugh, J., and Knight, R. UniFrac: an effective distance metric for microbial community comparison. Isme J.) was used to measure diversity between microbial communities and plotted using Principal Coordinate Analysis. Comparisons between phylogenetic taxa were calculated using unpaired t-test (Graphpad, La Jolla, Calif.) and Minitab v.15 at <0.05. Heat maps were generated using R and Matrix2png (Pavlidis, P., and Noble, W. S. 2003. Matrix2png: a utility for visualizing matrix data. Bioinformatics 19:295-296.). LEfSe (Segata, N., Izard, J., Waldron, L., Gevers, D., Miropolsky, L., Garrett, W. S., and Huttenhower, C. 2011. Metagenomic biomarker discovery and explanation. Genome Biol. 12:R60.) was used to identify bacteria taxa that are differentially abundant or depleted between sample groups.
(63) Results
(64) Samples and Acquisition of 16S Sequence Data
(65) As discussed above, microbial communities in 39 specimens positive for C. difficile (CDI group), 36 C. difficile-negative diarrheal samples (CDN group), and 40 stool samples from healthy controls (HC) were sampled (Table 1). Of the 39 samples in the CDI group, 29 were from subjects with initial episodes and 10 samples were from recurrences. Genomic DNA was extracted from each specimen and the V1-V3 hypervariable region of bacterial 16S rRNA gene segments was amplified using broad-range rRNA PCR primers 27F and 534R and the amplicons were pooled and deep sequenced. After trimming and quality control (Table 2;
(66) TABLE-US-00001 TABLE 1 Subject demographics and samples used in this study HC CDI CDN Number of samples 40 39 36 Median Age 60 y.o. 57 y.o. 61 y.o. % Female 70% 41% 52% Caucasian 27 28 24 African-American 3 9 9 Nursing Home 0 68% 72% HC: healthy controls, CDI: C. difficile infection, CDN: subjects with diarrhea but C. difficile negative
(67) TABLE-US-00002 TABLE 2 Pyrosequencing data analysis. The number of pyrosequence reads obtained and quality control filtering of raw reads. All HC CDI CDN Subjects Number of subjects 40 39 36 115 Total number of raw reads 246,765 178,910 191,891 617,566 Total reads after quality control 219,093 159,045 171,505 549,643 % reads retained 88.79% 88.90% 89.38% 89.00% Average post-filtered reads per subject 5,477 4,078 4,764 4,780 Quality-filtering Total reads(post-filter) matching refOTU 211,764 147,510 166,797 526,071 % reads matched to refOTU >97% post-filter 96.65% 92.74% 97.25% 95.71% Average post-filtered, refOTU matched 5,294 3,782 4,633 4,575 Average amplicon size(excluding primers) 490 492 495 492 Total number of refOTUs 2,986 1,392 1,582 3,531 Average refOTUs per subject 368 104 122 202 HC: healthy controls, CDI: C. difficile infection, CDN: subjects with diarrhea but C. difficile negative
Microbial Diversity and Richness of Gut Microbiota During C. difficile Infection
(68) A total of 3,531 refOTUs from 115 fecal samples, which belonged to 150 different genera in 15 different phyla, were identified. 2,986 of the 3,531 refOTUs (84.6%) identified were found in healthy controls. In contrast, only 1,392 (39.4%) and 1,582 (44.8%) refOTUs were detected in the CDI and the CDN group, respectively. Among the most abundant refOTUs (defined as >0.1% of all pyrosequencing reads), 124 were shared in more than half of the healthy controls but only 9 were detected in at least one-half of the samples in the CDI group. Species richness was significantly lower in the CDI and the CDN groups compared to healthy controls, and both the microbial diversity (as determined by Shannon diversity index) and species evenness were markedly reduced (
(69) Intestinal Dysbiosis in CDI
(70) To characterize the global changes in microbial community structure, the UniFrac method (Lozupone, C. et al. UniFrac: an effective distance metric for microbial community comparison. Isme J.) was applied to analyze phylogenetic relatedness of pyrosequence reads from all samples. In both weighted and unweighted UniFrac analysis, gut microbial communities associated with CDI clustered separately from healthy controls (
(71) Paucity of Firmicutes in the Aggregate Gut Microbiota Associated with CDI
(72) The Firmicutes phylum harbors the most numerous and diverse bacterial species in the human gut. In healthy controls, Firmicutes sequences were dominant at 74.9% of all reads (averaging 322 phylotypes per subject;
(73) At the family level, Lachnospiraceae (45.8%), Ruminococcaceae (17.4%) and Bacteroidaceae (16.1%) sequences dominated the healthy fecal microbiota, and sequences from other families constituted <3% of all pyrosequence reads (
(74) Depletion of Butyrate-Producing Bacteria in CDI
(75) The vast majority of Firmicutes sequences (68.4%) were assigned to the Clostridia class. The clostridia class has been divided into 19 clusters on the basis of growth, metabolic, and morphologic parameters (Johnson, J. L., and Francis, B. S. 1975. Taxonomy of the Clostridia: ribosomal ribonucleic acid homologies among the species. J. Gen. Microbiol. 88:229-244.), and includes members of the Lachnospiraceae and Ruminococcaceae family that were significantly depleted in CDI. To identify specific Clostridium clusters most depleted in CDI, an association table of full-length sequences from species previously assigned to Clostridium clusters was used (Claesson, M. J. et al. 2011. Composition, variability, and temporal stability of the intestinal microbiota of the elderly. Proc. Natl. Acad. Sci. U.S.A. 108 Suppl 1:4586-4591; and Collins, M. D. et al. 1994. The phylogeny of the genus Clostridium: proposal of five new genera and eleven new species combinations. Int. J. Syst. Bacteriol. 44:812-826.), and assigned 17.8% of all reads to 19 Clostridium clusters (
(76) Next, LEfSe was used [linear discriminant analysis coupled with effect size measurements] (Segata, N. et al. 2011. Metagenomic biomarker discovery and explanation. Genome Biol. 12:R60.) to determine specific bacteria taxa that were differentially abundant. Blautia, Pseudobutyrivibrio, Roseburia, Faecalibacterium, Anaerostipes, Subdoligranulum, Ruminococcus, Dorea, and Coprococcus were identified as the most differentially depleted genera associated with CDI (
(77) Since butyrate producers affect colonic health by supplying energy to gut epithelial cells and are generally thought to play a protective role against colitis, further consideration was given regarding whether the abundance of 16S reads assigned to genera known to produce butyrate as their main fermentation products differed between CDI and the controls. The relative abundance of butyrate-producing bacteria was significantly lower in subjects with CDI (6.3% vs. 17.2% in healthy controls; p=0.0002;
(78) Anaerobic gut bacteria can produce a variety of fermentation products, including butyrate and also acetate, lactate and other short-chain fatty acids (SCFA). Comparison of major acetogens (
(79) In this study, 16S genomic analysis of C. difficile associated gut microbiome revealed a profound alteration of gut microbiota, or dysbiosis, characterized by markedly decreased biodiversity and species richness. Importantly, this study identified a core set of normally abundant butyrate-producing anaerobic bacteria that are significantly depleted in CDI, implicating a potential role in C. difficile pathogenesis.
(80) Specifically, this study identified several members of the Ruminococcaceae and Lachnospiraceae family that are markedly depleted in CDI. A great majority of these species are bacterial phylotypes with the greatest similarity to butyrate-producing anaerobic bacteria.
(81) Although the data provided above revealed considerable inter-individual variation in C. difficile associated gut microbiome, their microbial communities clustered separately and were clearly distinguishable from those of healthy individuals. These observations suggest a common pathway induced by antibiotics that leads to an altered, albeit somewhat variable, susceptible flora depleted in butyrate-producing bacteria. This susceptible flora may in turn predispose individuals to C. difficile infection. One hypothesis is that asymptomatic individuals colonized with C. difficile may harbor a diverse set of organisms with a more robust gut microbiota similar to that of a healthy individual. In support of this hypothesis, one of the healthy subjects in this study harbored C. difficile 16S pyrosequence reads and had positive toxin B PCR, thus indicating likely colonization with C. difficile. Analysis of this individual's gut microbiota revealed a large number of bacterial phylotypes with a complex microbial community structure that clustered with microbial communities from the healthy cohort (
Example 2
(82) Material and Methods:
(83) Genomic DNA Isolation:
(84) Genomic DNA (gDNA) was isolated using mechanical agitation coupled with a bead beating technique (Salonen, A., Nikkila, J., Jalanka-Tuovinen, J., Immonen, O., Rajilic-Stojanovic, M., Kekkonen, R. A., Palva, A., and de Vos, W. M. Comparative analysis of fecal DNA extraction methods with phylogenetic microarray: effective recovery of bacterial and archaeal DNA using mechanical cell lysis. J Microbiol Methods 81:127-34.). A sterile Q-tip applicator (Whittaker General Medical, Richmond, Va.) was applied to the stool sample and immersed in tubes containing 0.1 mm glass beads and lysis buffer (MO-BIO PowerSoil DNA Isolation kit, Carlsbad, Calif.). Tubes were immersed in a 95 C. water bath for 10 min before vortex/agitation according to manufacturer's recommendation. DNA was eluted in 50 L elution buffer and concentrations were determined spectrophotometrically (Nanodrop 1000c, Thermo Scientific, Wilmington, Del.).
(85) 16S Barcoded PCR on Genomic DNA Template:
(86) PCR was performed according to the National Institutes of Health Human Microbiome Project protocol. The V1-V3 16S rRNA region was amplified in a 20 L reaction using 1 L (not exceeding 100 ng) of template genomic DNA (gDNA) (or 1 L of 1:10 diluted gDNA for concentrated sample), 0.75 U AccuPrime High Fidelity Taq DNA polymerase (Invitrogen, Carlsbad, Calif.), AccuPrime Buffer II (1.5 mM MgCl2, 0.2 mM of each dNTP), and 0.1 M 534R reverse (with 454 Adaptor A) and 27F forward primers (with 454 Adaptor B). The reverse primer (534R) also contained an 8-bp barcode unique to each sample which allowed for multiplex pyrosequencing.
(87) The oligonucleotide sequence for the 534R primer was:
(88) TABLE-US-00003 (SEQIDNO:1) 5-CCATCTCATCCCTGCGTGTCTCCGACTCAG- [8bpbarcode]-ATTACCGCGGCTGCTGG-3
(89) The sequence for the forward primer was:
(90) TABLE-US-00004 (SEQIDNO:2) 5CCTATCCCCTGTGTGCCTTGGCAGTCTCAGAGAGTTTGATCCTGGC TCAG-3
(91) PCR reactions were performed in quadruplicate using the following cycling condition: (I) 95 C. for 2 minutes (hot start); (II) 95 C. for 20 seconds, 56 C. for 30 seconds and 72 C. for 5 minutes (30 cycles); (III) maintain at 4 C. PCR products were resolved on 1% agarose gel stained with SYBR Safe (Invitrogen, Carlsbad, Calif.). PCR fragments of 500 bp were excised, and gel purified using the Qiagen gel extraction kit. The final barcoded PCR product was eluted in 32 L of the elution buffer pre-heated to 55 C. and stored at 20 C. until pooling for pyrosequencing.
(92) Amplicons were quantitated using a fluorometric assay (Qubit, Invitrogen, Carlsbad, Calif.) measured in triplicate, and pooled at equimolar concentrations for pyrosequencing at the University of Florida Interdisciplinary Center for Biotechnology Research (ICBR) using the Roche/454 GS-FLX platform with titanium based chemistry. Unidirectional sequencing was performed using the Library L reagents from adaptor side A. From a single run ( of a picoTiter plate), 617,566 reads were obtained (Table 2). After quality control and filtering (see below) which required 100% match to the barcodes, 549,643 (89%) were available for downstream analysis. Sequences from all 115 samples were equally represented with an average of 4,780 high quality reads per sample, and an average amplicon length of 492 base pairs after removal of primer, barcode, and 454 adapter sequences. Data for each pool are shown in
(93) PCR of C. difficile toxinB Gene:
(94) Toxin B (tcdB) specific PCR (Alonso, R., Munoz, C., Gros, S., Garcia de Viedma, D., Pelaez, T., and Bouza, E. 1999. Rapid detection of toxigenic Clostridium difficile from stool samples by a nested PCR of toxin B gene. J. Hosp. Infect. 41:145-149; Gumerlock, P. H., Tang, Y. J., Meyers, F. J., and Silva, J., Jr. 1991. Use of the polymerase chain reaction for the specific and direct detection of Clostridium difficile in human feces. Rev. Infect. Dis. 13:1053-1060; Kuhl, S. J., Tang, Y. J., Navarro, L., Gumerlock, P. H., and J., S., Jr. 1993. Diagnosis and monitoring of Clostridium difficile infections with the polymerase chain reaction. Clin Infect Dis 16 Suppl 4:S234-8; and Kato, N., Ou, C. Y., Kato, H., Bartley, S. L., Luo, C. C., Killgore, G. E., and Ueno, K. 1993. Detection of toxigenic Clostridium difficile in stool specimens by the polymerase chain reaction. J Infect Dis 167:455-8.) was performed for all 115 stool specimens using the following primers (2): CTDB1: 5-GTGGCCCTGAAGCATATG-3 (SEQ ID NO:3) (forward), and CTDB2: 5-TCCTCTCTCTGAACTTCTTGC-3 (SEQ ID NO:4) (reverse). PCR amplification of tcdB was performed in 25 L reactions in triplicate using 30 ng of gDNA template, 0.6 M of forward and reverse primers and GoTaq HotStart Polymerase Master Mix containing 200 M of each dNTP, 2 mM MgCl2 and GoTaq enzyme (Promega). The following cycling condition was used: (I) 95 C. for 5 minutes (hot start) (II) 94 C. for 45 seconds, 52 C. for 45 seconds, and 72 C. for 30 seconds [30 cycles] (III) final extension of 72 C. for 10 minutes and (IV) 4 C. hold. As expected, all 39 samples from the CDI group showed a strong amplification product of expected size of 300 bp. Representative 300 bp fragments were excised, gel-purified, cloned and sequenced. All sequences were confirmed as C. difficile tcdB gene (position 1,821 to 2,106). Samples from 7 subjects in the CDN group and 1 subject in the healthy controls repeatedly showed distinct, albeit faint, tcdB amplification. The one subject from the healthy control group likely represents C. difficile colonization (
(95) Bioinformatics Analysis of 16S Sequence Reads: (
(96) Trimming and refOTU Generation:
(97) Reads were removed from analysis if they did not conform to the following criteria: (1) >440 bp (prior to trimming of barcode and primer sequences), (2) 100% match to the barcode and primer sequences, (3) no ambiguous base pair calls, and (4) average per base quality score of 25. Reads were compared to the SILVA (Pruesse, E., Quast, C., Knittel, K., Fuchs, B. M., Ludwig, W., Peplies, J., and Glockner, F. O. 2007. SILVA: a comprehensive online resource for quality checked and aligned ribosomal RNA sequence data compatible with ARB. Nucleic Acids Res 35:7188-96.) 16S reference database v108 and were assigned a best match using >=97% identity criteria with at least 50% coverage in the alignment of the query.
(98) Reads were then counted and de-replicated to unique reference sequence-based operational taxonomic units (refOTU) with taxonomic information. These were further collapsed at a 97% clustering threshold (using the UCLUST and scripts written in R) to account for redundancies in the database. Further analysis such as tree construction employed representative full length refOTU sequences.
(99) Unifrac Principal Coordinate Analysis:
(100) For PCoA analysis, sequences from two or more communities were first arrayed on a common phylogenetic tree using the multiple sequence alignment from PyNAST (with a greengenes template as guide) and tree construction algorithm from FastTree. The fraction of the branch length unique to each community was determined. UniFrac distances between all communities were then calculated, and the resulting distance matrix was used for Principal Coordinates Analysis, taking into account the community membership alone (unweighted UniFrac), or both the community membership and the relative abundance (weighted UniFrac).
(101) Statistical Analysis
(102) All statistical comparisons between taxa at different phylogenetic levels were calculated using an unpaired Student's t-test (Graphpad, La Jolla, Calif.) and Minitab v.15 at <0.05. Heat maps comparing the abundance of different taxa and Clostridum clusters were generated using R. Box-plots comparing microbial diversity, OTU numbers, and species evenness were generated using R. LEfSe (Segata, N., Izard, J., Waldron, L., Gevers, D., Miropolsky, L., Garrett, W. S., and Huttenhower, C. 2011. Metagenomic biomarker discovery and explanation. Genome Biol. 12:R60.) was used to determine specific genera and species that were differentially abundant or depleted between groups.
(103) Metabolic Phenotypes:
(104) 137 major genera identified in our 16S deep sequencing data were classified according to their primary fermentation products as acetate, butyrate, lactate, or other producers (
Example 3
(105) A longitudinal study was performed to assess whether a persistent depletion of Lachnospiraceae, Ruminococcaceae and butyrogenic bacteria is associated with recurrent C. difficile infection (CDI).
(106) Methods
(107) Samples of microbial communities in 494 longitudinal specimens from 30 adults following CDI up to 1 year were taken, and compared to fecal microbiota from 14 healthy controls. Genomic DNA was extracted from each specimen and the V1-V3 hypervariable region of bacterial 16S rRNA gene segments was amplified using broad-range rRNA PCR primers 27F and 534R and the amplicons were pooled and deep sequenced using Roche/454 pyrosequencing.
(108) Results
(109) With the pyrosequencing data analysis, a total of 494 longitudinal fecal samples from 30 subjects were analyzed by 16S pyrosequencing where an average of 3,986 sequence reads were obtained per sample. Roughly 2 million partial V1-V3 16S rRNA sequences from 500 longitudinal fecal samples were analyzed, with identification of a total of 5,904 bacterial phylotypes. Phylogenetics-based analysis revealed that the gut microbiome undergoes a slow but steady recovery in microbial diversity and species richness over a period of a few months in response to C. difficile therapy. However, in patients who developed recurrent CDI, the recovery of gut microbial diversity and richness was slower and incomplete. There was a paucity of phylotypes within the Lachnospiraceae and Ruminococcaceae family in the Firmicutes Phylum prior to C. difficile recurrence (see Table 1). See also
(110) TABLE-US-00005 TABLE 1 Subjects analyzed in the Study C. difficile Outcome % Subjects Diarrheal Symptoms toxin B PCR Cure 44% No Negative Colonized 19% No Positive Relapse 30% Yes Positive Insufficient Data 7% Unknown N/A
(111) This study implicates members of the Lachnospiraceae and Ruminococcaceae family in the pathogenesis of recurrent C. difficile and suggests a potential role in colonization resistance against C. difficile. The organisms identified herein may lead to probiotic-based therapy for recurrent C. difficile and the development of a novel diagnostic test for predicting C. difficile recurrence.
(112) All patents, patent applications, provisional applications, and publications referred to or cited herein are incorporated by reference in their entirety, including all figures and tables, to the extent they are not inconsistent with the explicit teachings of this specification.
(113) It should be understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application.