Synthetic promoter construct for transgene expression
09670497 ยท 2017-06-06
Assignee
Inventors
Cpc classification
C07K2319/60
CHEMISTRY; METALLURGY
C12N15/8222
CHEMISTRY; METALLURGY
C12N15/8257
CHEMISTRY; METALLURGY
C12N15/8216
CHEMISTRY; METALLURGY
International classification
Abstract
The invention is directed to synthetic promoter constructs for enhanced transgene expression in plants and to expression cassettes comprising the synthetic promoter constructs. The expression cassettes may include various elements for improved expression, stability of the expressed protein or efficient purification of the expressed protein, including signal sequences, protease cleavage sites for release of the target protein, trafficking peptides for trafficking of the expressed protein to various plant compartments, and/or various tags. The invention further relates to methods of expression of transgenic proteins in plants with the use of the synthetic promoter constructs and expression cassettes.
Claims
1. An isolated polynucleotide comprising a regulatory nucleic acid sequence (a) having at least 95% or more sequence identity to a polynucleotide sequence set forth in any one of SEQ ID NOs: 1, 3, 4 or 18, wherein (A) the regulatory nucleic acid sequence contains the following motifs: ASF1MOTIFCAMV (TGACG), CTRMCAMV35S (TCTCTCTCT), MYCCONSENSUSAT (CANNTG), SORLIP1AT (GCCAC), BOXIIPCCHS (ACGTGGC), CCA1ATLHCB1 (AA(C/A)AATCT), GT1CONSENSUS (G(A/G)(A/T)AA(A/T), IBOXCORE (GATAA), GATABOX (GATA), and CACTFTPPCA1 ((T/C)ACT); and (B) wherein the regulatory nucleic acid sequence having at least 95% or more sequence identity to a polynucleotide sequence set forth in any one of SEQ ID NOs: 1, 4 or 18 further contains the following motifs: SORLIP5AT (GAGTGAG), and RBCSCONSENSUS (AATCCAA); and (C) wherein the regulatory nucleic acid sequence having at least 95% or more sequence identity to a polynucleotide sequence set forth in any one of SEQ ID NOs: 1, 3 or 4 further contains the following motifs: INRNTPSADB ((C/T)TCANT(C/T)(C/T)), ATRICHPSPETE (AATATACTAGTATTATTTACTAAAAAAAATC [SEQ ID NO: 39]), and LTRECOREATCOR15 (CCGAC); and (D) wherein the regulatory nucleic acid sequence having at least 95% or more sequence identity to a polynucleotide sequence set forth in any one of SEQ ID NOs: 1 or 4 further contains the following motifs: SORLREP2AT (ATAAAACGT), GT1MOTIFPSRBCS ((G/T)(A/T)GTG(A/G)(A/T)AA(A/T)(A/G)(A/T) [SEQ ID NO: 41]), 10PEHVPSBD (TATTCT), LTREATLTI78 (ACCGACA), CBFHV ((A/G)(C/T)CCGAC), and DRECRTCOREAT ((A/G)CCGAC); and (E) wherein the regulatory nucleic acid sequence having at least 95% or more sequence identity to a polynucleotide sequence set forth in SEQ ID NO: 4 further contains the motif AS1CAMV (CCACTGACGTAAGGGATGACGCACAATCC [SEQ ID NO: 37]); and (F) wherein the regulatory nucleic acid sequence having at least 95% or more sequence identity to a polynucleotide sequence set forth in SEQ ID NO: 18 further contains the following motifs: LRENPCABE (ACGTGGCA), SORLIP1AT (GCCAC), CGF1ATCAB2 (GATAAAGATTACTTCAGATATAACAAACGTTAC [SEQ ID NO 45]), and CIACADIANLELHC (CAANNNNATC [SEQ ID NO: 40]).
2. The isolated polynucleotide according to claim 1, further comprising one or more restriction enzyme sites for inserting a second nucleic acid sequence heterologous to the regulatory nucleic acid sequence into the polynucleotide, such that the inserted second nucleic acid sequence would be operably linked to the regulatory nucleic acid sequence, wherein the regulatory nucleic acid sequence is capable of directing transcription of the second operably linked nucleic acid sequence.
3. The isolated polynucleotide according to claim 2, comprising the second nucleic acid sequence, wherein the second nucleic acid sequence encodes a target protein heterologous to the regulatory nucleic acid sequence and is operably linked to the regulatory nucleic acid sequence.
4. The isolated polynucleotide according to claim 1, wherein the regulatory nucleic acid sequence has at least 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 1, 3, 4 or 18.
5. The isolated polynucleotide according to claim 3, wherein the second nucleotide sequence encodes a target protein useful in the food or beverage industries, the pharmaceutical industry, in agriculture, or in the chemical industry.
6. The isolated polynucleotide according to claim 3, wherein the second nucleotide sequence encodes a therapeutic protein.
7. The isolated polynucleotide according to claim 3, wherein the second nucleotide sequence encodes one or more copies of: (A) a pulmonary surfactant protein-B (SP-B) pre-proprotein or a functional fragment or analog thereof; (B) SP-B mature peptide or a functional fragment or analog thereof; or (C) both (A) and (B).
8. The isolated polynucleotide according to claim 1, further comprising a polynucleotide sequence encoding a signal peptide selected from the group consisting of the signal peptide region of equistatin and of Nicotiana tabacum thionin (NtSP).
9. The isolated polynucleotide according to claim 1, further comprising a polynucleotide sequence encoding a trafficking peptide selected from the group consisting of an endoplasmic reticulum (ER)-trafficking peptide; an oil body-trafficking peptide, a protein storage vacuole-trafficking peptide; and a plastid-trafficking peptide.
10. The isolated polynucleotide according to claim 1, further comprising a polynucleotide sequence encoding a tag selected from the group consisting of polyhistidine, Leptin, late embryogenesis abundant protein (LEA), Lectin, maltose binding protein (MBP) and glutathione S-transferase (GST).
11. The isolated polynucleotide according to claim 1, further comprising a polynucleotide sequence encoding a marker protein for detection, selected from the group consisting of yellow fluorescent protein (YPet), green fluorescent protein (GFP), chloramphenicol acetyl transferase (CAT), and luciferase.
12. The isolated polynucleotide according to claim 1, further comprising a polynucleotide sequence encoding a protease cleavage site, selected from the group consisting of an enterokinase, a chymosin and a Tobacco Etch Virus (TEV) protease cleavage site.
13. The isolated polynucleotide according to claim 1, further comprising a psbA regulatory 5-UTR and 3 UTR region for targeting a plastid.
14. An expression cassette for expression of a protein in a plant comprising the isolated polynucleotide according to claim 1.
15. The expression cassette according to claim 14, comprising one or more restriction enzyme sites for inserting a second nucleic acid sequence heterologous to the regulatory nucleic acid sequence into the polynucleotide, such that the inserted second nucleic acid sequence would be operably linked to the regulatory nucleic acid sequence, wherein the regulatory nucleic acid sequence is capable of directing transcription of the second operably linked nucleic acid sequence.
16. The expression cassette according to claim 15, wherein the expression cassette comprises the second nucleic acid sequence, and wherein the second nucleic acid sequence encodes a target protein heterologous to the regulatory nucleic acid sequence and is operably linked to the regulatory nucleic acid sequence.
17. The expression cassette according to claim 16, wherein the second nucleotide sequence encodes one or more copies of: (A) a pulmonary surfactant protein-B (SP-B) pre-proprotein or a functional fragment or analog thereof; (B) SP-B mature peptide or a functional fragment or analog thereof; or (C) both (A) and (B).
18. The expression cassette according to claim 14, further comprising any one or more elements from the group consisting of: (i) a polynucleotide sequence encoding a signal peptide from the group consisting of the signal peptide region of equistatin and of Nicotiana tabacum thionin (NtSP); (ii) a polynucleotide sequence encoding a trafficking peptide from the group consisting of an endoplasmic reticulum (ER)-trafficking peptide; an oil body-trafficking peptide, a protein storage vacuole-trafficking peptide; and a plastid-trafficking peptide; (iii) a polynucleotide sequence encoding a tag from the group consisting of polyhistidine, Leptin, late embryogenesis abundant protein (LEA), Lectin, maltose binding protein (MBP) and glutathione S-transferase (GST); (iv) a polynucleotide sequence encoding a marker protein for detection from the group consisting of yellow fluorescent protein (YPet), green fluorescent protein (GFP), chloramphenicol acetyl transferase (CAT), and luciferase; (v) a polynucleotide sequence encoding a protease cleavage site from the group consisting of an enterokinase, a chymosin and a Tobacco Etch Virus (TEV) protease cleavage site; and (vi) a psbA regulatory 5-UTR and 3 UTR region for targeting a plastid.
19. A plant cell comprising the isolated polynucleotide according to claim 3.
20. A method of expressing a target protein in a plant comprising introducing the isolated polynucleotide according to claim 3 into a plant cell, and expressing the target protein in the plant cell.
21. The method according to claim 20, further comprising a step of exposing the plant cell to one or more induction stimuli.
22. The method according to claim 21, wherein the one or more induction stimuli are selected from the group consisting of different intensities and periods of light exposure, cold shock, heat shock, induction of drought conditions and hormone induction.
23. The method of claim 22, wherein the hormone induction comprises induction with Abscisic Acid (ABA).
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
DETAILED DESCRIPTION OF THE INVENTION
(6) Provided herein are synthetic promoter constructs for enhanced transgene expression in plants; expression cassettes comprising the synthetic promoter constructs; and methods of expressing transgenic proteins in plants using the synthetic promoter constructs.
(7) Temporal and/or spatial control of transgene expression in plants is desirable in many agricultural and biopharmaceutical applications. One way of achieving such control is by rational design of the regulatory nucleic acid sequence, for example, the promoter. Promoters can be inducible, constitutive and/or tissue-specific. Promoter engineering applications for targeted control of transgene activity in plants include biotic and abiotic stress tolerance, high-level transgene expression and sensing environmental and/or chemical stimuli. Depending on the biotechnological application, e.g., crop improvement or commercially viable expression of a biopharmaceutical peptide, both high-level constitutive and targeted/inducible transgene expression systems are important.
(8) Strong constitutive transgene expression continues to be a desirable trait. The Cauliflower Mosaic Virus 35S (CaMV 35S) promoter [Benfey and Chua 1990], and recombinant modifications thereof, e.g. native CaMV 35S plus an additional 35S subdomain-B acting as an enhancer, have been used extensively for high level transgene expression in plants [Benfey et al 1990; Bhullar et al. 2003, 2007]. However, currently, the choice and availability of strong constitutive promoters with comparable or even better activity than CaMV 35S is still relatively limited.
(9) The challenges in plant genetic engineering studies, e.g., promoter availability, insufficient levels of transgene expression, and homology-dependent gene silencing (HDGS), necessitate the engineering and use of novel synthetic promoters [Venter and Botha 2010]. In addition to the design of novel synthetic strong constitutive promoters, specific cis-motif architecture within regulatory promoter modules, may allow for predictive applications to confer inducible expression in response to various environmental, physical or chemical stimuli [Venter 2007]. Compared to conventional wild-type promoters from viral and/or plant origin, well-designed synthetic promoters may offer superior transgene expression levels, refine control of transgene (or multiple transgene) expression and limit homology-dependent gene silencing in plant genetic engineering applications.
(10) The applicant has therefore developed 21 candidate synthetic promoters for testing in transgenic plant lines using a stepwise approach by: 1) identifying promoters of genes known to be highly expressed in plants (for example, by literature searches), 2) selecting specific regions in those promoters (regulatory modules) based on the presence of specific plant transcription factor (TF) binding sites (or cis-motifs), for example by using a database of known motifs such as PLACE (Higo et al., 1999) or PlantCARE (Lescot et al., 2002), 3) combining different and/or repeated promoter modules to construct synthetic promoters and 4) in vivo testing of the candidate synthetic promoter constructs in transgenic plant lines for efficient expression of a transgenic protein.
(11) Examples of regulatory modules selected for synthetic promoter design included: Promoters known for high-level transgene expression in plants; Genes known to be expressed at high levels in plants; Promoters associated with photosynthesis; and Plant transcription factor binding sites as detected with PLACE [Higo et al., 1999].
(12) Furthermore, cis-motif selections with the use of PLACE [Higo et al., 1999] were primarily based on: Light regulation, activation; Leaf specific expression; Motifs known to act as enhancers; Motifs associated with low temperature responsiveness; and Motifs from specific promoters, e.g., CaMV 35S and Ribulose-1,5-bisphosphate carboxylase small subunit promoter (RBCss) known to drive high-level transgene expression in plants.
(13) The candidate regulatory modules were designed and/or extended to comprise a majority selection of the above-mentioned cis-motifs, which include motifs that function as inducible elements. Accordingly, a person skilled in the art would appreciate that the method may comprise a step of exposing the plant cell to one or more induction stimuli, including different intensities and periods of light exposure, cold shock, heat shock, induction of drought conditions or hormone induction such as by Abscisic Acid (ABA).
(14) The 21 candidate synthetic promoters were then tested in transgenic tobacco plants with the use of a fluorescent reporter protein, YPet (Yellow Fluorescent Protein), although any other reporter protein known to those skilled in the art may be used, such as luciferase, green fluorescent protein (GFP), chloramphenicol acetyl transferase (CAT) and the like. Interestingly, most of the candidate synthetic promoters designed based using an in silico rational design strategy did not show marked improvement, or performed worse than the control CaMV 35S promoters. This demonstrates the necessity for performance of in vivo testing in order to determine the efficacy of a synthetic promoter construct. Evidence of efficacy in silico is not sufficient. However, several first generation transgenic plant lines from various synthetic promoter constructs did show enhanced YPet expression compared to the control CaMV 35S promoters and one of the synthetic promoter constructs in particular showed exceptionally improved protein expression: it increased protein expression about 5 times more than the highest performing control 2CaMV 35S promoter.
(15) Accordingly, provided herein are isolated polynucleotides comprising a regulatory nucleic acid sequence. The regulatory nucleic acid sequence can be or contain, a sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity) to any one of the polynucleotide sequences set forth in SEQ ID NOs: 1, 3, 4, or 18, or a functionally equivalent fragment thereof. In some embodiments, the regulatory nucleic acid sequence has 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 1, 3, 4 or 18 or a functionally equivalent fragment thereof. In some embodiments, the the regulatory nucleic acid sequence has 100% sequence identity to any one of SEQ ID NOs: 1, 3, 4 or 18 or a functionally equivalent fragment thereof.
(16) The regulatory nucleic acid sequence can also be or contain, a sequence that hybridises under stringent conditions to the complement of any one of SEQ ID NOs: 1, 3, 4 or 18. Hybridization conditions are well known to those skilled in the art. Stringent conditions or stringent hybridization conditions used herein refers to conditions under which a probe will hybridize to its target sequence to a detectably greater degree than to other sequences (e.g., at least 2-fold over background). Stringent conditions are sequence-dependent and will be different in different circumstances. By controlling the stringency of the hybridization and/or washing conditions, target sequences that are 100% complementary to the probe can be identified (homologous probing). Alternatively, stringency conditions can be adjusted to allow some mismatching in sequences so that lower degrees of similarity are detected (heterologous probing). Generally, a probe is less than about 1000 nucleotides in length, often less than 500 nucleotides in length.
(17) Typically, stringent conditions will be those in which the salt concentration is about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30 C. for short probes (e.g., 10 to 50 nucleotides) and at least about 60 C. for long probes (e.g., greater than 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. Exemplary stringent conditions include hybridization in 6 sodium chloride/sodium citrate (SSC) at 37 C., followed by a wash in 0.5 or 1SSC at 55 to 60 C. Exemplary high stringency conditions include hybridization in 6SSC at 45 C., followed by a wash in 0.2SSC, 0.1% SDS at 65 C. Duration of hybridization is generally less than about 24 hours, usually about 4 to about 12 hours.
(18) In some embodiments, the regulatory nucleic acid sequence or functionally equivalent fragment thereof may contain one or more motifs selected from the group consisting of SORLREP2AT, ASF1MOTIFCAMV, AS1CAMV (SEQ ID NO:37), ATRICHPSPETE (SEQ ID NO:39), GT1MOTIFPSRBCS (SEQ ID NO:41), INRNTPSADB, CTRMCAMV35S, 10PEHVPSBD, LTREATLTI78, CBFHV, DRECRTCOREAT, LTRECOREATCOR15, MYCCONSENSUSAT, LRENPCABE, SORLIP1AT, BOXIIPCCHS, CCA1ATLHCB1, CGF1ATCAB2 (SEQ ID NO: 45), GT1CONSENSUS, IBOXCORE, RBCSCONSENSUS, CIACADIANLELHC (SEQ ID NO:40), GATABOX, SORLIP5AT, and CACTFTPPCA1. It is noted that the motifs provided above are annotated as set out in the PLACE database (Higo et al., 1999), but may have a different annotation if using another database, such as PlantCARE (Lescot et al., 2002). It is also noted that the motifs shown by the sequences depicted in Table 1 can be in the 5-3 orientation (+) or the reverse 3-5 orientation ().
(19) The isolated polynucleotides can further comprise one or more restriction enzyme sites for inserting a second nucleic acid sequence that is heterologous to the regulatory nucleic acid sequence, such that the inserted second nucleic acid sequence would be operably linked to the regulatory nucleic acid sequence, and the regulatory nucleic acid sequence is capable of directing transcription of the second operably linked nucleic acid sequence. In some embodiments, the second nucleic acid sequence encodes a target protein heterologous to the regulatory nucleic acid sequence and is operably linked to the regulatory nucleic acid sequence.
(20) The promoters described herein can be used as strong constitutive promoters for high-level transgene expression in the food and beverage industries, the pharmaceutical industry (e.g., as vaccines or therapeutic proteins), the agriculture industry, or the chemical industry amongst others. It is recognized that any gene of interest can be operably linked to the promoter sequences disclosed herein and expressed in plants.
(21) In one embodiment of the invention, the expressed transgenic protein is a protein useful in the pharmaceutical industry, in particular, a therapeutic protein. A particular embodiment of the invention, the expressed transgenic protein is a pulmonary surfactant protein-B (SP-B) pre-proprotein, or SP-B mature peptide, functional fragment, or analog thereof [Pryhuber 1998].
(22) Accordingly, the second nucleotide sequence can encode a target protein useful in the food or beverage industries, the pharmaceutical industry, in agriculture, or in the chemical industry. In some embodiments, the second nucleotide sequence encodes a therapeutic protein. In some embodiments, the second nucleotide sequence encodes one or more copies of: (A) a pulmonary surfactant protein-B (SP-B) pre-proprotein or a functional fragment or analog thereof; (B) SP-B mature peptide or a functional fragment or analog thereof; or both (A) and (B).
(23) Apart from the target transgenic protein, the regulatory nucleic acid sequence or functionally equivalent fragment thereof can be operably linked to one or more elements known to those skilled in the art, including, but not limited to the following: (i) a polynucleotide sequence encoding a signal peptide such as the signal peptide region of equistatin or the signal peptide of Nicotiana tabacum thionin (NtSP); (ii) a polynucleotide sequence encoding a trafficking peptide such as an endoplasmic reticulum (ER)-trafficking peptide e.g., SEKDEL (SEQ ID NO:34), KDEL (SEQ ID NO:35), HDEL (SEQ ID NO:36); an oil body-trafficking peptide (e.g. oleosin), a protein storage vacuole-trafficking peptide (e.g., a Vacuolar Sorting Determinant (VSD) from for example, barley lectin, common bean phaseolin, or soybean -conglycinin subunit); a plastid, including a chloroplast, chromoplast or leucoplast-trafficking peptide (e.g., a peptide capable of interacting with the thylakoid membrane of a plastid such as the chloroplast targeting signal from the small subunit of Rubisco from Solanum); or another trafficking peptide known to those skilled in the art; (iii) a polynucleotide sequence encoding a tag such as polyhistidine, Leptin, late embryogenesis abundant protein (LEA), Lectin, maltose binding protein (MBP) or glutathione S-transferase (GST), or other tags known to those skilled in the art for improved protein expression, stability or purification; (iv) a polynucleotide sequence encoding a marker protein for detection, such as yellow fluorescent protein (YPet), green fluorescent protein (GFP), chloramphenicol acetyl transferase (CAT), luciferase, or others known to those skilled in the art; and (v) a polynucleotide sequence encoding a protease cleavage site flanking the target protein, such as any one or more of an enterokinase, chymosin or Tobacco Etch Virus (TEV) protease cleavage site, for release of the target protein of interest by proteolytic cleavage.
(24) Furthermore, the regulatory nucleic acid sequence or functionally equivalent fragment thereof of the invention can be operably linked to a psbA regulatory 5-UTR and 3 UTR region for targeting a plastid, in particular a chloroplast.
(25) In some embodiments, the isolated polynucleotides further comprise a terminator sequence, for example, a terminator sequence selected from a Nos poly A, a 35S poly A, a RbcS1 terminator or another terminator known to those skilled in the art. The regulatory nucleic acid sequence or functionally equivalent fragment thereof may be operably linked to the terminator sequence.
(26) Also provided herein are expression cassettes comprising the isolated polynucleotides described herein. The expression cassettes can be suitable for Agrobacterium tumefaciens-mediated transformation. The expression cassette can include a regulatory nucleic acid sequence that either (a) has at least 95% or more sequence identity to a polynucleotide sequence set forth in any one of SEQ ID NOs: 1, 3, 4 or 18, or a functionally equivalent fragment thereof, or (b) hybridises under stringent conditions to the complement of a polynucleotide sequence set forth in any one of SEQ ID NOs: 1, 3, 4 or 18. The expression cassette can further include a second nucleic acid sequence that is operably linked to the regulatory nucleic acid sequence and the regulatory nucleic acid sequence is capable of directing transcription of the second operably linked nucleic acid sequence. The second nucleic acid sequence can encode a target protein useful in the food or beverage industries, the pharmaceutical industry (e.g., as vaccines or therapeutic proteins), in agriculture, or in the chemical industry. In some embodiments, the second nucleotide sequence encodes a therapeutic protein, for example, a pulmonary surfactant protein-B (SP-B) pre-proprotein, or SP-B mature peptide, functional fragment, or analog thereof.
(27) The expression cassette can further comprise one or more of the following elements:
(28) (i) a polynucleotide sequence encoding a signal peptide such as the signal peptide region of equistatin or the signal peptide region of Nicotiana tabacum thionin (NtSP);
(29) (ii) a polynucleotide sequence encoding a trafficking peptide such as an endoplasmic reticulum (ER)-trafficking peptide e.g., SEKDEL (SEQ ID NO:34), KDEL (SEQ ID NO:35), HDEL (SEQ ID NO:36); an oil body-trafficking peptide (e.g. oleosin), a protein storage vacuole-trafficking peptide (e.g., a Vacuolar Sorting Determinant (VSD) from for example, barley lectin, common bean phaseolin, or soybean -conglycinin subunit); a plastid, including a chloroplast, chromoplast or leucoplast-trafficking peptide (e.g., a peptide capable of interacting with the thylakoid membrane of a plastid such as the chloroplast targeting signal from the small subunit of Rubisco from Solanum); or another trafficking peptide known to those skilled in the art;
(30) (iii) a polynucleotide sequence encoding a tag such as polyhistidine, Leptin, late embryogenesis abundant protein (LEA), Lectin, maltose binding protein (MBP) or glutathione S-transferase (GST), or other tags known to those skilled in the art;
(31) (iv) a polynucleotide sequence encoding a marker protein for detection, such as yellow fluorescent protein (YPet), green fluorescent protein (GFP), chloramphenicol acetyl transferase (CAT), luciferase, or others known to those skilled in the art;
(32) (v) a polynucleotide sequence encoding a protease cleavage site, such as any one or more of an enterokinase, chymosin or Tobacco Etch Virus (TEV) protease cleavage site; or
(33) (vi) a psbA regulatory 5-UTR or 3 UTR region for targeting a plastid, such as a chloroplast.
(34) Also provided are plant cells comprising any of the isolated polynucleotides or plant-based expression cassettes described herein. The plant cell may be a plurality of plant cells in suspension culture, plant cells in tissue culture, or plant cells in a leaf of a plant, a transgenic plant, or any part thereof. The plant cell may be from a monocot or dicot plant. In some embodiments, the plant is a Nicotiana tobacum plant. Also provided are plant progenies or seeds comprising any of the isolated polynucleotides or plant-based expression cassettes described herein.
(35) Also provided herein are methods of expressing a target protein in a plant by introducing the isolated polynucleotides described herein into a plant cell, and expressing the target protein in the plant cell. The methods can further include a step of exposing the plant cell to one or more induction stimuli. For example, such induction stimuli may be any one or more of different intensities and periods of light exposure, cold shock, heat shock, induction of drought conditions or hormone induction such as by Abscisic Acid (ABA).
(36) The invention will be described by way of the following examples which are not to be construed as limiting in any way the scope of the invention.
EXAMPLES
Example 1
(37) 1.1. Materials and Methods
(38) 1.1.1. Promoter Synthesis and Cloning in Plant Transformation Vector
(39) Synthesis and sub-cloning of all promoter expression cassettes were conducted by DNA2.0 (www.dna20.com) and Blue Heron Biotech (www.blueheronbio.com). Within ImpactVector 1.1 (Plant Research International, Wageningen; www.pri.wur.nl/UK/products/ImpactVector/) each promoter was synthesized between AscI/NcoI sites, replacing the RbcS1 promoter of Chrysanthemum morifolium. Each promoter expression cassette within ImpactVector 1.1 comprised of a promoter (synthetic or unmodified) driving a gene coding for YPet fluorescent protein, synthesized between NcoI/BglII sites, and a terminator of RbcS1 gene from C. morifolium between BglII/PacI sites (as illustrated in
(40) 1.1.2. Synthetic Promoter Design
(41) Regulatory modules for synthetic promoter designs were based on various factors including: Promoters known for high-level transgene expression in plants; Genes known to be expressed at high levels in plants; Promoters associated with photosynthesis; and Plant transcription factor binding sites as detected with PLACE [Higo et al., 1999].
(42) In addition, cis-motif selections with the use of PLACE [Higo et al., 1999] were primarily based on: Light regulation, activation; Leaf specific expression; Motifs known to act as enhancers; Motifs associated with low temperature responsiveness; and Motifs from specific promoters i.e. CaMV 35S and Ribulose-1,5-bisphosphate carboxylase small subunit promoter (RBCss) known to drive high-level transgene expression in plants.
(43) The candidate regulatory modules were designed and/or extended to comprise a majority selection of the above-mentioned type cis-motifs, which include motifs that function as inducible elements.
(44) Two promoters were chosen as control promoters for comparative analysis to 21 newly designed synthetic promoters. The control promoters were wild-type CaMV 35S promoter (Genbank Acc no. V00140) designated as C1 [SEQ ID NO:22] and a double enhancer CaMV 35S domain-B, also called 235S, that has an extension of 73 bp at Domain_B (Genbank AC: V00140.1) of the original 35S promoter, together with an additional Domain_B (with 73 bp extension) fused to it, and a 5-UTR designated as C2 [SEQ ID NO:23]. The synthetic promoters were designated as AZprom-1 to AZprom-21.
(45) Using the ImpactVector expression cassette and combining a binary vector such as pCAMBIA, specific restriction enzyme sites that should not cut in the promoters for sub-cloning purposes were identified. Where specific restriction enzyme sites were detected, revisions were proposed and sequences submitted to the PLACE database to revise the sequence in such a way that original putative transcription factor-binding sites remained identical to original sequence comprising restriction enzyme-site.
(46) Table 1 shows the various cis-motifs present in the promoters selected to drive high-level expression of transgenes in plants. Table 2 shows the various candidate synthetic promoters designed for testing, including their size and components.
(47) 1.1.3. Generation of transgenic plants and genomic PCR
(48) Tobacco plants (Nicotiana tabacum var Samsun) were maintained on MS medium in a temperature (22 C.) regulated growth room at a 16 hour light/8 hour dark photoperiod. Promoter expression cassettes sub-cloned in a binary vector were mobilized into Agrobacterium tumefaciens strain LBA4404 via electroporation and tobacco leaves were transformed using a standard leaf disc method [Horsch et al 1985]. Plantlets were regenerated under antibiotic selection on MS medium and primary transgenic tobacco plantlets were hardened off and grown in a containment glasshouse at 22 C. After approximately 12 weeks, plants were transferred to a growth room regulated at 24 C. with a 16 hour light/8 hour dark photoperiod at a light intensity of 316 mol.Math.m-2.s-1. To confirm transgenic status, genomic DNA was extracted from putative transgenic tobacco leaf material using the GeneJET Genomic DNA Purification Kit (Thermo Fisher Scientific Inc, USA). PCR was performed, using primers: YPet_frw (5-CTCAGTAAGTGGGGAAGGTGAAGGC-3) [SEQ ID NO: 27] and YPet_rev (5-TGCCAGCTGAACACCTCCATCCTCG-3) [SEQ ID NO: 28], at a predenaturation cycle of 94 C. for 2 min followed by 35 cycles of amplification (94 C. denaturation, 30 sec; 55 C. annealing, 30 sec; 72 C. polymerization, 30 sec) to amplify a 457 bp fragment using GoTaq DNA Polymerase (Promega Corporation, Madison, USA). All PCR reactions were carried out in a Perkin-Elmer GeneAmp Thermocycler 9700 (Perkin Elmer Corporation, Wellesley, USA) and PCR products were visualized in ethidium bromide-stained 1% (w/v) agarose gels.
(49) TABLE-US-00001 TABLE1 PLACEcis-motifanalysisforsyntheticpromoterdesign Associated MOTIF Function COREsequence Description -10PEHVPSBD Circadian/Light TATTCT lightregulation AS1CAMV Leaf CCACTGACGTAAGGGATGACGCACAATCC (activationsequence1) (SEQIDNO:37) inCaMV35S ASF1MOTIFCAMV Light/Leaf TGACG ASF-1bindingsitein CaMV35S AT1BOX Light/Leaf AATATTTTTATT(SEQIDNO:38) AT-richelement ATRICHPSPETE Enhancer AATATACTAGTATTATTTACTAAAAAAAATC AT-rich (SEQIDNO:39) BOXIIPCCHS Light ACGTGGC BoxII CACGTGMOTIF Light/Leaf CACGTG G-Box CACTFTPPCA1 Leaf (T/C)ACT mesophyll-specific(CACT) CCA1ATLHCB1 Leaf AA(C/A)AATCT Phytochrome CBFHV LowTemp/Drought (A/G)(C/T)CCGAC CRT/DRE CIACADIANLELHC Circadian/Light/ CAANNNNATC(SEQIDNO:40) Regionidentifiedfor Leaf circadianexpression CTRMCAMV35S Enhancer TCTCTCTCT CT-richmotifinCaMV35S DRECRTCOREAT LowTemp/Drought (A/G)CCGAC CRT/DRE GATABOX Leaf/Light GATA GATAmotifinCaMV35S GBOXLERBCS Leaf/Light (A/C)CACGTGGC rbcS/G-box GT1MOTIFPSRBCS Light/Leaf (G/T)(A/T)GTG(A/G)(A/T)AA(A/T) RBCS/BoxII/GT-1 (A/G)(A/T)(SEQIDNO:41) GT1CONSENSUS Light/Leaf G(A/G)(A/T)AA(A/T) GT-1 HY5AT Light TGACACGTGGCA(SEQIDNO:42) G-box IBOX Light/Leaf GATAAG I-box/rbcS IBOXCORE Light/Leaf GATAA I-box INRNTPSADB Light (C/T)TCANT(C/T)(C/T) Initiator-element/ TATA-lesspromoter LBOXLERBCS Light/Leaf AAATTAACCAA(SEQIDNO:43) rbcS LREBOXIPCCHS1 Light/Leaf AACCTAACCT(SEQIDNO:44) BoxI LRENPCABE Light/Leaf ACGTGGCA LRE-element LTREATLTI78 LowTemp/Leaf ACCGACA LTRE LTRE1HVBLT49 LowTemp/Leaf CCGAAA LTRE LTRECOREATCOR15 LowTemp/Leaf CCGAC LTRE MYCCONSENSUSAT Drought/Low CANNTG Leaf/ICE-1 Temp/Leaf RBCSCONSENSUS Leaf AATCCAA rbcS/G-box/I-box SORLIP1AT Light GCCAC Phytochrome-reg SORLIP5AT Light GAGTGAG Phytochrome-reg SORLREP2AT Light ATAAAACGT Phytochrome-reg SORLREP3AT Light TGTATATAT Phytochrome-reg SV40COREENHAN Enhancer GTGG(A/T)(A/T)(A/C/T)G SV40coreenhancer
(50) TABLE-US-00002 TABLE 2 Candidate synthetic promoters Name Size (bp)* Description of Components AZprom_1 [SEQ 951 Pea plastocyanin promoter region (784 to 176) ID NO: 1] (Genbank: X68313) Vacuolar Pyrophosphatase VPP (Grapevine) core promoter for PIC assembly (342 bp upstream from VPPase ATG-start codon) AZprom_2 [SEQ 1149 3x copies of the wheat cab-1 enhancer (357 to 89) ID NO: 2] (Genbank: X05823) plus 3 cytosine residue Vacuolar Pyrophosphatase VPP (Grapevine) core promoter for PIC assembly plus native grapevine VPP 5-UTR region AZprom_3 [SEQ 1039 2x copies of pea plastocyanin enhancer (original 268 bp ID NO: 3] extended to 445 bp) (Genbank: X68313) CaMV 35S minimal promoter (90 to +8) pea plastocyanin 5-UTR (52 bp, as calculated from pea plastocyanin TSS at 53 bp) AZprom_4 [SEQ 1232 2x copies of pea plastocyanin enhancer (original 268 bp ID NO: 4] extended to 445 bp) (Genbank: X68313) Vacuolar Pyrophosphatase VPP (Grapevine) core promoter for PIC assembly plus native grapevine VPP 5-UTR region AZprom_5 [SEQ 1149 3x copies of the wheat cab-1 enhancer (357 to 89) ID NO: 5] (Genbank: X05823) plus 3 cytosine residue in reverse orientation to AZprom_2 Vacuolar Pyrophosphatase VPP (Grapevine) core promoter for PIC assembly plus native grapevine VPP 5-UTR region AZprom_6 [SEQ 867 4x copies of the spinach plastocyanin enhancer (259 to ID NO: 6] 79) (Genbank: X52288) Core/minimal-promoter of spinach plastocyanin PLUS native 5-UTR region AZprom_7 [SEQ 1066 4x copies of the spinach plastocyanin enhancer (259 to ID NO: 7] 79) (Genbank: X52288) Vacuolar Pyrophosphatase VPP (Grapevine) core promoter for PIC assembly plus native grapevine VPP 5-UTR region AZprom_8 [SEQ 1405 1x copy of CaMV 35S Domain B (343 to 91) enhancer ID NO: 8] Arabidopsis Plastocyanin promoter region (includes 5- UTR region) (NC_003070.9_Ath Plastocyanin_NCBI) AZprom_9 [SEQ 1424 VPP (M10.A) promoter region plus ASF1MOTIFCAMV, ID NO: 9] CTRMCAMV35S and VPP promoter region: 1430 to 159 relative to start codon CaMV 35S minimal promoter (Domain A: 90 +8) Chrysanth rbcS 5-UTR (AY163904) AZprom_10 [SEQ 1004 2x copies of the spinach plastocyanin enhancer (259 to ID NO: 10] 79) (Genbank: X52288) VPP (M10.A) promoter region plus CBFHV, DRECRTCOREAT, LTREATLTI78, LTRE1HVBLT49, LTRECOREATCOR15, MYCCONSENSUSAT, ASF1MOTIFCAMV, CTRMCAMV35S and VPP promoter region: 642 to start codon AZprom_11 [SEQ 895 1x copy of CaMV 35S Domain B (343 to 91) enhancer ID NO: 11] VPP (M10.A) promoter region plus CBFHV, DRECRTCOREAT, LTREATLTI78, LTRE1HVBLT49, LTRECOREATCOR15, MYCCONSENSUSAT, ASF1MOTIFCAMV, CTRMCAMV35S and VPP promoter region: 642 to start codon AZprom_12 [SEQ 1415 VPP (M10.A) promoter region plus ASF1MOTIFCAMV, ID NO: 12] CTRMCAMV35S and VPP promoter region: 1430 to 159 relative to start codon Core/minimal-promoter of spinach plastocyanin PLUS native 5-UTR region AZprom_13 [SEQ 848 2x CaMV 35S Domain B (343 to 91) enhancer ID NO: 13] Vacuolar Pyrophosphatase VPP (Grapevine) core promoter for PIC assembly plus native grapevine VPP 5-UTR region AZprom_14 [SEQ 1148 2x CaMV 35S Domain B (343 to 91) enhancer ID NO: 14] VPP (M10.A) promoter region plus CBFHV, DRECRTCOREAT, LTREATLTI78, LTRE1HVBLT49, LTRECOREATCOR15, MYCCONSENSUSAT, ASF1MOTIFCAMV, CTRMCAMV35S and VPP promoter region: 642 to start codon AZprom_15 [SEQ 1049 1x CaMV 35S Domain B (343 to 91) enhancer ID NO: 15] Arabidopsis photosystem I subunit O (PSO-1) promoter region (Genbank: NM_100711) AZprom_16 [SEQ 977 1x copy of the spinach plastocyanin enhancer (259 to 79) ID NO: 16] (Genbank: X52288) Arabidopsis photosystem I subunit O (PSO-1) promoter region (Genbank: NM_100711) AZprom_17 [SEQ 743 1x CaMV 35S Domain B (343 to 91) enhancer ID NO: 17] 2x copies of the Ath PSBP-1 selected region (Genbank no. X98108) (241 to 76 relative to start codon) CaMV 35S Domain A minimal promoter (90 to +8) 5-UTR region of tobacco rbc_ss region (61 bp relative to start codon) (Tobacco_rbcss_EPD: X02353) AZprom_18 [SEQ 794 2x copies of the Ath cab2 selected region (115 relative ID NO: 18] to TATA-box) (Genbank: X15221) Ath cab2 promoter region (564 relative to start codon) AZprom_19 [SEQ 863 2x copies of VPP_mod promoter [SEQ ID NO: 24] ID NO: 19] 1x Tobacco core promoter + 5-UTR (131 bp relative to start codon) (Tobacco_rbcss_EPD: X02353) AZprom_20 [SEQ 934 2x copies of RBCss_mod promoter [SEQ ID NO: 25] ID NO: 20] (Tobacco_rbcss_EPD: X02353) VPP core promoter + 5-UTR (131 bp relative to start codon) AZprom_21 [SEQ 1400 1x copy of CaMV 35S Domain B (343 to 91) enhancer ID NO: 21] 1x inverted DR region of Ft-PEPc promoter [SEQ ID NO: 26] Proximal region (PR) of Ft-PEPc promoter *without YPet ATG
(51) 1.1.4. Fluorescence Screening
(52) The YPet reporter is a yellow fluorescent protein (YFP) modified for Forster resonance energy transfer (FRET) applications with an excitation at 517 nm and emission at 530 nm. Rapid visual screening was conducted using a handheld ROFIN Polilight FLARE PLUS 2 forensic flashlight (ROFIN forensics, Australia) with a Cyan LED output of 485 nm to 515 nm and orange filter goggles with a range of 190 nm to 545 nm. Plants transferred to the growth room were continuously screened for 8 to 12 weeks. Highest YPet fluorescence from 35S and 235S leaves was used as comparison to screen synthetic promoter plant lines. Plant lines, ranging from 20 cm to 40 cm in height, of which the top 3 leaves had a lower YPet fluorescence were discarded. Plants not discarded were analyzed using a nanodrop fluorospectrometer (Thermo Fisher Scientific Inc, USA).
(53) 1.1.5. Sampling
(54) Selected tobacco plants were at least 30 cm high (from top of soil in pot). A 10 mm diameter cork-bore tool was used to punch 10 mm leaf-discs out of tobacco leaves. Each 10 mm leaf-disc was punched near the middle of leaf next to, but not including the middle vein, but including a side vein. Five different leaves, designated as L1, L2, L3, L4 and L5 were sampled. The first leaf (L1) was the first leaf of at least 10 cm in length. The following leaves going down the plant were then sampled up until the fifth leaf. Each fifth leaf had 5 leaf-discs punched out of the middle of the leaf for analysis.
(55) 1.1.6. YPet Protein Extraction
(56) Extraction buffer used was 1PBS (Sigma 79383) with 2% 2-mercaptoethanol. Five 10 mm leaf-discs (per leaf) per extract were added to 1 mL of extraction buffer in 2 ml eppendorf tubes. Two 4 mm stainless steel balls were placed in each eppendorf tube. The tubes were placed in a tissue-lyzer and shaken at 15 min/30 rpm. Next, 500 l of chloroform was added. The tubes were then vortexed vigorously for 20 seconds and centrifuged for 10 min at maximum speed (13000 rpm). Supernatent was removed (300 mL to 500 mL) and used to measure fluorescence intensity.
(57) 1.1.7. Fluorescence Intensity Measurement
(58) The Nanodrop ND3300 protocol for YPet detection (White LED) was used with extraction buffer (1PBS) as the blank reading. The wild-type plant reading was performed and the blank reading was deducted as background fluorescence. 2 l of extracts were analysed and the reading was obtained as relative fluorescent unit (RFU) values.
(59) 1.1.8. Total Protein Quantification
(60) Proteins were extracted using the Quant-iT Protein Assay kit (Thermo Fisher Scientific Inc, USA) according to manufacturer's instructions. The Nanodrop ND3300 Quant-iT protocol at High-Range was used to produce the standard curve. Blank reading was performed using Quant-iT protein buffer.
(61) 2 l of extracts were analysed and the reading was obtained as protein quantification (g/mL). All promoter measurements were quantified as RFU/g protein.
(62) 1.2. Results
(63) Approximately 9 to 28 independent transgenic plant lines were generated for each promoter construct. Fluorometric measurements were made from wild-type tobacco and transgenic lines transformed with an empty expression cassette with YPet reporter gene but no promoter sequence. This was done to analyse background fluorescence and promoter leakage from the binary vector promoter expressing the antibiotic selection gene.
(64) 1.2.1. Fluorescence Screening with Handheld Flashlight
(65) First round screening (whole plant analysis) was conducted using the Polilight FLARE flashlight. We started screening all the C1 (35S) and C2 (235S) plant lines of which the brightest lines were kept for fluorometric analysis. Plant lines that showed no or very low fluorescence were discarded. Fluoroscence spectroscopy revealed that the threshold brightness for plants to be discarded was approximately at less than 2 RFU/g protein per transgenic line. Brightest C1 and C2 control plants were used for visual comparative analysis when transgenic plant lines of all the other promoter expression cassettes were screened with the Polilight.
(66) 1.3. Fluorescence Spectroscopy
(67) Initial results showed average promoter activity for each leaf position similar to Mitsuhara et al. 1996. All promoter constructs had similar expression profiles relative to leaf position (as illustrated in
(68) All promoters were screened and transgenic plant lines (TO primary transformants) with the brightest YPet fluorescence of each candidate synthetic promoter cassette is illustrated in
(69) Surprisingly, the AZprom-18 was found to have five times greater expression of the YPet transgene at the highest reporter gene value for a transgenic plant compared with the highest reporter gene value for a transgenic plant with the C2 control promoter. Furthermore, it was also one of the strongest overall synthetic promoters of which every transgenic plant tested had a YPet fluorescence level of above the 2 RFU/g protein cut-off (Table 4).
(70) Using the handheld Polilight flashlight, transgenic lines could be screened rapidly and lines from several synthetic promoters with overall low activity could be discarded after visual confirmation and comparison to the brightest fluorescence in C1 and C2 plant lines.
(71) The four synthetic promoters AZprom-1, AZprom-3, AZprom-4 and AZprom-18, in particular AZprom-18, identified therefore show utility for use in plant genetic engineering strategies and biopharming applications.
(72) TABLE-US-00003 TABLE 3 Motifs identified in selected promoter cassettes by PLACE database analysis POSITION from MOTIF 5-start to 3-end (orientation + or ) AZprom-1 PEA PLASTOCYANIN PROMOTER (609 bp) CACTFTPPCA1 19 (+) CACTFTPPCA1 78 () MYCCONSENSUSAT 108 (+) MYCCONSENSUSAT 108 () ASF1MOTIFCAMV1 68 () MYCCONSENSUSAT 171 (+) MYCCONSENSUSAT 171 () MYCCONSENSUSAT 224 (+) MYCCONSENSUSAT 224 () CACTFTPPCA1 254 () GATABOX 278 (+) GT1CONSENSUS 436 (+) GATABOX 441 () CACTFTPPCA1 455 (+) CACTFTPPCA1 481 () ATRICHPSPETE (SEQ ID NO: 39) 496 (+) CACTFTPPCA1 500 (+) CACTFTPPCA1 504 () CACTFTPPCA1 513 (+) CCA1ATLHCB1 520 (+) SORLIP1AT 530 (+) BOXIIPCCHS 530 () LTRECOREATCOR15 535 () GATABOX 542 (+) IBOXCORE 542 (+) IBOXCORE 581 (+) CACTFTPPCA1 588 (+) CACTFTPPCA1 603 (+) GRAPEVINE VPP PROMOTER (342 bp) RBCSCONSENSUS 634 () SORLIP1AT 658 () GT1CONSENSUS 689 (+) GT1CONSENSUS 695 (+) GT1CONSENSUS 699 () SORLREP2AT 720 () GT1MOTIFPSRBCS 741 () (SEQ ID NO: 41) GT1CONSENSUS 743 () INRNTPSADB 746 (+) CACTFTPPCA1 748 (+) ASF1MOTIFCAMV 759 () GT1CONSENSUS 763 () IBOXCORE 764 () GATABOX 765 () ASF1MOTIFCAMV 768 () CACTFTPPCA1 777 (+) CTRMCAMV35S 780 (+) CTRMCAMV35S 782 (+) CACTFTPPCA1 827 () CACTFTPPCA1 847 () INRNTPSADB 850 () SORLIP5AT 851 (+) CACTFTPPCA1 852 () -10PEHVPSBD 884 (+) GATABOX 905 (+) GT1CONSENSUS 913 () LTREATLTI78 931 () CBFHV 932 () DRECRTCOREAT 932 () LTRECOREATCOR15 932 () AZprom-3 PEA PLASTOCYANIN PROMOTER (445 bp) X2 ASF1MOTIFCAMV 4 () MYCCONSENSUSAT 7 (+) MYCCONSENSUSAT 7 () MYCCONSENSUSAT 60 (+) MYCCONSENSUSAT 60 () CACTFTPPCA1 90 () GATABOX 114 (+) GT1CONSENSUS 272 (+) GATABOX 277 () CACTFTPPCA1 291 (+) CACTFTPPCA1 317 () ATRICHPSPETE (SEQ ID NO: 39) 332 (+) CACTFTPPCA1 336 (+) CACTFTPPCA1 340 () CACTFTPPCA1 349 (+) CCA1ATLHCB1 356 (+) SORLIP1AT 366 (+) BOXIIPCCHS 366 () LTRECOREATCOR15 371 () GATABOX 378 (+) IBOXCORE 378 (+) IBOXCORE 417 (+) CACTFTPPCA1 424 (+) CACTFTPPCA1 439 (+) ASF1MOTIFCAMV 449 () MYCCONSENSUSAT 452 (+) MYCCONSENSUSAT 452 () MYCCONSENSUSAT 505 (+) MYCCONSENSUSAT 505 () CACTFTPPCA1 535 () GATABOX 559 (+) GT1CONSENSUS 717 (+) GATABOX 722 () CACTFTPPCA1 736 (+) CACTFTPPCA1 762 () ATRICHPSPETE (SEQ ID NO: 39) 777 (+) CACTFTPPCA1 781 (+) CACTFTPPCA1 785 () CACTFTPPCA1 794 (+) CCA1ATLHCB1 801 (+) SORLIP1AT 811 (+) BOXIIPCCHS 811 () LTRECOREATCOR15 816 () GATABOX 823 (+) IBOXCORE 823 (+) IBOXCORE 862 (+) CACTFTPPCA1 869 (+) CACTFTPPCA1 884 (+) CaMV 35S minimal promoter (98 bp) AS1CAMV (SEQ ID NO: 37) 894 (+) CACTFTPPCA1 895 (+) ASF1MOTIFCAMV 898 (+) ASF1MOTIFCAMV 910 (+) CACTFTPPCA1 923 (+) GATABOX 926 () INRNTPSADB 961 (+) MYCCONSENSUSAT 968 (+) MYCCONSENSUSAT 968 () Pea plastocyanin 5-UTR (52b) as calculated from pea plastocyanin Transcriptional Start Site at 53 bp) CACTFTPPCA1 1007 () CACTFTPPCA1 1025 (+) GT1CONSENSUS 1034 (+) AZprom-4 PEA PLASTOCYANIN PROMOTER (445 bp) X2 ASF1MOTIFCAMV 4 () MYCCONSENSUSAT 7 (+) MYCCONSENSUSAT 7 () MYCCONSENSUSAT 60 (+) MYCCONSENSUSAT 60 () CACTFTPPCA1 90 () GATABOX 114 (+) GT1CONSENSUS 272 (+) GATABOX 277 () CACTFTPPCA1 291 (+) CACTFTPPCA1 317 () ATRICHPSPETE (SEQ ID NO: 39) 332 (+) CACTFTPPCA1 336 (+) CACTFTPPCA1 340 () CACTFTPPCA1 349 (+) CCA1ATLHCB1 356 (+) SORLIP1AT 366 (+) BOXIIPCCHS 366 () LTRECOREATCOR15 371 () GATABOX 378 (+) IBOXCORE 378 (+) IBOXCORE 417 (+) CACTFTPPCA1 424 (+) CACTFTPPCA1 439 (+) ASF1MOTIFCAMV 449 () MYCCONSENSUSAT 452 (+) MYCCONSENSUSAT 452 () MYCCONSENSUSAT 505 (+) MYCCONSENSUSAT 505 () CACTFTPPCA1 535 () GATABOX 559 (+) GT1CONSENSUS 717 (+) GATABOX 722 () CACTFTPPCA1 736 (+) CACTFTPPCA1 762 () ATRICHPSPETE (SEQ ID NO: 39) 777 (+) CACTFTPPCA1 781 (+) CACTFTPPCA1 785 () CACTFTPPCA1 794 (+) CCA1ATLHCB1 801 (+) SORLIP1AT 811 (+) BOXIIPCCHS 811 () LTRECOREATCOR15 816 () GATABOX 823 (+) IBOXCORE 823 (+) IBOXCORE 862 (+) CACTFTPPCA1 869 (+) CACTFTPPCA1 884 (+) GRAPEVINE VPP PROMOTER (342 bp) RBCSCONSENSUS 915 () SORLIP1AT 939 () GT1CONSENSUS 970 (+) GT1CONSENSUS 976 (+) GT1CONSENSUS 980 () SORLREP2AT 1001 () GT1MOTIFPSRBCS 1022 () (SEQ ID NO: 41) GT1CONSENSUS 1024 () INRNTPSADB 1027 (+) CACTFTPPCA1 1029 (+) ASF1MOTIFCAMV 1040 () GT1CONSENSUS 1044 () IBOXCORE 1045 () GATABOX 1046 () ASF1MOTIFCAMV 1049 () CACTFTPPCA1 1058 (+) CTRMCAMV35S 1061 (+) CTRMCAMV35S 1063 (+) CACTFTPPCA1 1108 () CACTFTPPCA1 1128 () INRNTPSADB 1131 () SORLIP5AT 1132 (+) CACTFTPPCA1 1133 () -10PEHVPSBD 1165 (+) GATABOX 1186 (+) GT1CONSENSUS 1194 () LTREATLTI78 1212 () CBFHV 1213 () DRECRTCOREAT 1213 () LTRECOREATCOR15 1213 () AZprom-18 Ath cab2 selected region (115 bp) X2 LRENPCABE 18 () SORLIP1AT 19 (+) BOXIIPCCHS 19 () CACTFTPPCA1 31 (+) GATABOX 39 (+) GT1CONSENSUS 39 (+) IBOXCORE 39 (+) CCA1ATLHCB1 47 (+) RBCSCONSENSUS 58 (+) CGF1ATCAB2 (SEQ ID NO: 45) 75 (+) GATABOX 75 (+) GT1CONSENSUS 75 (+) IBOXCORE 75 (+) CACTFTPPCA1 84 (+) GATABOX 91 (+) GATABOX 110 () LRENPCABE 133 () SORLIP1AT 134 (+) BOXIIPCCHS 134 () CACTFTPPCA1 146 (+) GATABOX 154 (+) GT1CONSENSUS 154 (+) IBOXCORE 154 (+) CCA1ATLHCB1 162 (+) RBCSCONSENSUS 173 (+) CGF1ATCAB2 (SEQ ID NO: 45) 190 (+) GATABOX 190 (+) GT1CONSENSUS 190 (+) IBOXCORE 190 (+) CACTFTPPCA1 199 (+) GATABOX 206 (+) GATABOX 225 () Ath cab2 promoter region (564 relative to start codon) ASF1MOTIFCAMV 237 () GATABOX 254 (+) GATABOX 256 () CIACADIANLELHC 273 () (SEQ ID NO: 40) GATABOX 290 (+) GT1CONSENSUS 290 (+) IBOXCORE 290 (+) CACTFTPPCA1 295 () ASF1MOTIFCAMV 297 (+) CACTFTPPCA1 335 () GT1CONSENSUS 350 () GT1CONSENSUS 359 (+) GATABOX 368 (+) GT1CONSENSUS 382 (+) CACTFTPPCA1 403 (+) GT1CONSENSUS 438 () CACTFTPPCA1 453 (+) CACTFTPPCA1 510 () CACTFTPPCA1 514 () CACTFTPPCA1 528 () CACTFTPPCA1 535 () SORLIP1AT 536 () GT1CONSENSUS 576 (+) MYCCONSENSUSAT 589 (+) MYCCONSENSUSAT 589 () LRENPCABE 611 () SORLIP1AT 612 (+) BOXIIPCCHS 612 () CACTFTPPCA1 624 (+) GATABOX 632 (+) GT1CONSENSUS 632 (+) IBOXCORE 632 (+) CCA1ATLHCB1 640 (+) RBCSCONSENSUS 651 (+) CGF1ATCAB2 (SEQ ID NO: 45) 668 (+) GATABOX 668 (+) GT1CONSENSUS 668 (+) IBOXCORE 668 (+) CACTFTPPCA1 677 (+) GATABOX 684 (+) GATABOX 703 () RBCSCONSENSUS 714 (+) CIACADIANLELHC 718 (+) (SEQ ID NO: 40) CACTFTPPCA1 721 (+) GATABOX 724 () CACTFTPPCA1 742 (+) SORLIP5AT 746 () CACTFTPPCA1 748 (+)
(73) TABLE-US-00004 TABLE 4 Number and percentage of transgenic plant lines positive for YPet fluorescence above the 2 RFU/g protein cut-off Total No of Fluorescence plant lines Promoter spectroscopy +ve % 19 C1 (35S) 9 47 27 C2 (2 35S) 12 44 12 AZprom-1 4 33 9 AZprom-2 0 / 21 AZprom-3 14 67 27 AZprom-4 7 26 13 AZprom-5 0 / 27 AZprom-6 2 7 28 AZprom-7 0 / 11 AZprom-8 0 / 10 AZprom-9 0 / 24 AZprom-10 1 4 10 AZprom-11 0 / 25 AZprom-12 11 44 10 AZprom-13 0 / 10 AZprom-14 0 / 10 AZprom-15 1 10 25 AZprom-16 3 12 10 AZprom-17 2 20 12 AZprom-18 12 100 20 AZprom-19 1 5 10 AZprom-20 4 40 13 AZprom-21 6 46
Example 2
(74) 2.1. Materials and Methods
(75) 2.1.1. Expression of Two Fusion Proteins Using Synthetic Promoter AZprom 18
(76) The expression cassette within ImpactVector 1.1 comprising the AZprom_18 [SEQ NO. 18] synthetic promoter was modified by replacing the single gene coding for YPet fluorescent protein with cDNA coding for: (i) YPetlinker1TEV cleavage sitesingle copy of human mature (8 kDa) pulmonary surfactant protein SP-B peptide [SEQ ID NO: 29]TEV cleavage sitelinker2YPet (AZ18_1SP-B) [SEQ ID NO: 30]; or (ii) YPetlinker1TEV cleavage sitedouble copy of human mature (8 kDa) pulmonary surfactant protein SP-B peptide [SEQ ID NO: 29]TEV cleavage sitelinker2YPet (AZ18_2SP-B) [SEQ ID NO: 31]. The modified AZprom_18 promoter expression cassettes were then excised and sub-cloned in a binary vector, pCAMBIA, suitable for Agrobacterium-mediated plant transformation.
(77) 2.1.2. Generation of Transgenic Plants and Fluorescence Screening
(78) Tobacco plants (Nicotiana tabacum var Samsun) were maintained on MS medium in a temperature (22 C.) regulated growth room at a 16 h photoperiod. The pCAMBIA expression vectors comprising fusion cassettes AZ18_1SP-B and AZ18_2SP-B were introduced into Agrobacterium tumefaciens strain LBA4404 via electroporation [Mattanovich et al 1989] followed by plant transformation using a standard leaf disc method [Horsch et al 1985]. Tobacco plantlets were regenerated under kanamycin selection on MS medium and primary transgenic plantlets were hardened off and grown in a containment glasshouse under standard glasshouse conditions at 22 C. To evaluate transgenic status of tobacco plants, plantlets were screened using a handheld ROFIN Polilight FLARE PLUS 2 forensic flashlight (ROFIN forensics, Australia) with a Cyan LED output of 485 nm to 515 nm and orange filter goggles with a range of 190 nm to 545 nm. Plantlets showing fluorescence were transferred to the growth room and were continuously screened for 8 to 12 weeks.
(79) 2.1.3. Protein Extraction and Western Blot Analysis
(80) Proteins were extracted from the plant tissue with a buffer containing 1 phosphate buffered saline (PBS, Sigma-Aldrich, 79383) with 7M Urea, 2M Thiourea, 5% CHAPS and 5% 2-mercaptoethanol. 500 mg of plant leaf material that was ground up in liquid Nitrogen was extracted with 1 ml of extraction buffer. The extract was vortexed for 1 min and left on the bench for 10 minutes where after it was vortexed again and centrifuged for 10 min at 13000g. The supernatant was used directly to load into the gel for western blot analysis. SDS PAGE was performed with the Life technologies Bolt system (Life Technologies) using Bis-Tris MOPS buffer and 4-12% gradient gel. Transfer and western blot was performed with the Life technologies iBlot system according to the instructions of the manufacturer. Chromogenic detection was done using the iBlot chromogenic western detection kit (Life Technologies, IB7410-01). All transgenic plant lines from AZ18_1SP-B and AZ18_2SP-B were screened with an antibody specific for GFP mutants (Thermo Fischer Scientific, PA1-28521). To serve as a positive control, fluorescent protein (YPet) was extracted from transgenic plants transformed with promoter expression cassette C2 (235S).
(81) 2.2. Results & Discussion
(82) 2.2.1. Western Blot Analysis
(83) Western blot analysis showed positive detection of the GFP antibody in several transgenic plant lines for both AZ18_1SP-B and AZ18_2SP-B at the expected fusion protein size when compared to the SeeBlue Plus2 Pre-Stained protein standard (Life Technologies, LC5925) as noted in
Other Embodiments
(84) It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.
REFERENCES
(85) Benfey P N, Ren L, Chua N-H (1990) Combinatorial and synergistic properties of CaMV 35S enhancer subdomains. EMBO J 9:1685-1696 Bhullar S, Chakravarthy S, Advani S, Datta S, Pental D, Kumar Burma P (2003) Strategies for development of functionally equivalent promoters with minimum sequence homology for transgene expression in plants: cis-elements in a novel DNA context versus domain swapping. Plant Physiol 132:988-998 Bhullar S, Datta S, Advani S, Chakravarthy S, Gautam T, Pental D, Kumar Burma P (2007) Functional analysis of the cauliflower mosaic virus 35S promoter: re-evaluation of the role of subdomains B5, B4, and B2 in promoter activity. Plant Biotechnol J 5:696-708 Higo, K., Y. Ugawa, M. Iwamoto and T. Korenaga (1999) Plant cis-acting regulatory DNA elements (PLACE) database:1999. Nucleic Acids Research Vol. 27 No. 1 pp. 297-300. Horsch R, Fry J, Hofmann N, Eichhlotz D, Rogers S, Frayley R (1985) A simple and general method for transferring genes into plants. Science 227(4691): 1229-1231 Lescot M, Dhais P, Thijs G, Marchal K, Moreau Y, Van de Peer Y, Rous P and Rombauts S (2002) PlantCARE, a database of plant cis-acting refulatory elements and a portal to tools for in silico analysis of promoter sequences. Nucleic Acids Research 30(1):325-327 Mattanovich D, Ruker F, da Camara Machado A, Laimer M, Regner F, Steinkeliner H, Himmler G, Katinger H (1989) Efficient transformation of Agrobacterium spp. by eletroporation. Nucleic Acids Research 17(16):6747 Mitsuhara I, Ugaki M, Hirochika H, Ohshima M, Murakami T, Gotoh Y, Katayose Y, Nakamura S, Honkura R, Nishimiya S, Ueno K, Mochizuki A, Tanimoto H, Tsugawa H, Otsuki Y, Ohashi Y (1996) Efficient promoter cassettes for enhanced expression of foreign genes in dicotyledonous and monocotyledonous plants. Plant Cell Physiol 37:49-59. Benfey and Chua N-H (1990) The cauliflower mosaic virus 35S promoter: Combinatorial regulation of transcription in plants. Science 250: 959-966 Pryhuber G S (1998) Regulation and function of pulmonary surfactant protein B. Molecular Genetics and Metabolism 64: 217-228 Venter M (2007) Synthetic promoters: genetic control through cis engineering. Trends Plant Sci. 12, 118-124 Venter M & Botha F C (2010) in Plant Developmental BiologyBiotechnological Perspectives Vol. 2 (eds Pua, E. C. & Davey, M. R.) 393-408 (Springer).