RNA-EDITING OLIGONUCLEOTIDES AND USES THEREOF

20250066773 ยท 2025-02-27

    Inventors

    Cpc classification

    International classification

    Abstract

    The present disclosure features useful compositions and methods to treat disorders for which deamination of an adenosine in an mRNA produces a therapeutic result, e.g., in a subject in need thereof.

    Claims

    1. An oligonucleotide comprising the structure:
    [A.sub.m]-X.sup.1X.sup.2X.sup.3[B.sub.n] wherein each of A and B is a nucleotide; m and n are each, independently, an integer from 1 to 50, wherein at least 20% of the nucleotides of [A.sub.m] and [B.sub.n] combined are 2-O-methyl-nucleotides; X.sup.1, X.sup.2, and X.sup.3 are each, independently, a nucleotide, wherein X.sup.3 has the structure of Formula I: ##STR00010## wherein N.sup.1 is a nucleobase; and R.sup.1 is halogen.

    2. The oligonucleotide of claim 1, wherein at least 80% of the nucleotides of [A.sub.m] and/or [B.sub.n] include a nucleobase, a sugar, and an internucleoside linkage.

    3. The oligonucleotide of claim 1, wherein at least 90% of the nucleotides of [A.sub.m] and/or [B.sub.n] include a nucleobase, a sugar, and an internucleoside linkage.

    4. The oligonucleotide of claim 1, wherein at least 95% of the nucleotides of [A.sub.m] and/or [B.sub.n] include a nucleobase, a sugar, and an internucleoside linkage.

    5. The oligonucleotide of claim 1, wherein the halogen is fluoro.

    6. The oligonucleotide of claim 1, wherein each of X.sup.1 and X.sup.2 is, independently, a 2-O-C.sub.1-C.sub.6 alkyl-nucleotide, a 2-amino-nucleotide, an arabinonucleic acid-nucleotide, a bicyclic-nucleotide, a 2-F-nucleotide, 2-O-methoxyethyl-nucleotide, a constrained ethyl-nucleotide, a LNA-nucleotide, or a DNA-nucleotide.

    7. The oligonucleotide of claim 1, wherein each of X.sup.1 and X.sup.2 is, independently, a 2-O-C.sub.1-C.sub.6 alkyl-nucleotide, a 2-F-nucleotide, an arabinonucleic acid-nucleotide, or a DNA-nucleotide.

    8. The oligonucleotide of claim 1, wherein X.sup.1 includes a uracil or thymine nucleobase and X.sup.3 includes a hypoxanthine nucleobase.

    9. The oligonucleotide of claim 1, wherein X.sup.2 includes a cytosine nucleobase.

    10. The oligonucleotide of claim 9, wherein X.sup.1 and X.sup.2 are not 2-O-methyl-nucleotides.

    11. The oligonucleotide of claim 1, wherein [A.sub.m] comprises at least one 2-O-methyl-nucleotide, at least one 2-F-nucleotide, at least one 2-O-methoxyethyl-nucleotide, at least one cEt-nucleotide, at least one LNA-nucleotide, and/or at least one DNA-nucleotide.

    12. The oligonucleotide of claim 1, wherein [A.sub.m] comprises at least one phosphorothioate linkage.

    13. The oligonucleotide of claim 1, wherein [B.sub.n] comprises at least one 2-O-methyl-nucleotide, at least one 2-F-nucleotide, at least one 2-O-methoxyethyl-nucleotide, at least one cEt-nucleotide, at least one LNA-nucleotide, and/or at least one DNA-nucleotide.

    14. The oligonucleotide of claim 1, wherein [B.sub.n] comprises at least one phosphorothioate linkage.

    15. The oligonucleotide of claim 1, wherein at least 30% of the nucleotides of [A.sub.m] and [B.sub.n] combined are 2-O-methyl-nucleotides.

    16. The oligonucleotide of claim 1, wherein A and B combined consist of 27-71 nucleotides.

    17. The oligonucleotide of claim 1, wherein m is 12 to 32.

    18. The oligonucleotide of claim 17, wherein n is 7 to 17.

    19. The oligonucleotide of claim 1, wherein X.sup.1 includes a uracil or thymine nucleobase; X.sup.2 includes a cytosine nucleobase; and X.sup.3 includes a hypoxanthine nucleobase; and each of X.sup.1 and X.sup.2 is, independently, a 2-O-C.sub.1-C.sub.6 alkyl-nucleotide, a 2-F-nucleotide, an arabinonucleic acid-nucleotide, or a DNA-nucleotide.

    20. The oligonucleotide of claim 19, wherein at least 95% of the nucleotides of [A.sub.m] and [B.sub.n] include a nucleobase, a sugar, and an internucleoside linkage; each of [A.sub.m] and [B.sub.n] comprises at least one phosphorothioate linkage; each of [A.sub.m] and [B.sub.n] comprises at least one 2-O-methyl-nucleotide, at least one 2-F-nucleotide, at least one 2-O-methoxyethyl-nucleotide, at least one cEt-nucleotide, at least one LNA-nucleotide, and/or at least one DNA-nucleotide; and A and B combined consist of 27 to 71 nucleotides.

    21. A complex comprising: an oligonucleotide of claim 1; and an mRNA, wherein the oligonucleotide and mRNA are hybridized to each other and the complex comprises a first mismatch at an adenosine of the mRNA.

    22. The complex of claim 21, wherein the mRNA comprises an adenosine which may be deaminated to produce a therapeutic result.

    23. The complex of claim 21, wherein the mRNA comprises a guanosine to adenosine mutation compared to the corresponding natural mRNA.

    24. A method for deamination of an adenosine in an mRNA, the method comprising contacting a cell with an oligonucleotide of claim 1.

    25. A method of treating a disorder in a subject in need thereof, the method comprising administering to the subject an effective amount of an oligonucleotide of claim 1.

    26. The method of claim 25, wherein the disorder is alpha-1-antitrypsin deficiency.

    27. A method of treating a disorder in a subject in need thereof, the method comprising administering to the subject an effective amount of an oligonucleotide of claim 20.

    28. The method of claim 27, wherein the disorder is alpha-1-antitrypsin deficiency.

    Description

    DETAILED DESCRIPTION

    [0088] The present inventors have found modified oligonucleotides may be utilized to deaminate target adenosines in mRNAs. Accordingly, the invention features useful compositions and methods to deaminate target adenosines on mRNA, e.g., an adenosine which may be deaminated to produce a therapeutic result, e.g., in a subject in need thereof.

    I. Disorders

    [0089] The invention also provides an oligonucleotide of the invention for use in a method for making a change in a target RNA sequence in a mammalian, preferably human cell, as described herein. Similarly, the invention provides the use of an oligonucleotide construct of the invention in the manufacture of a medicament for making a change in a target RNA sequence in a mammalian, preferably human cell, as described herein.

    [0090] The invention also relates to a method for the deamination of at least one specific target adenosine present in a target RNA sequence in a cell, said method including the steps of: providing said cell with an oligonucleotide described herein; allowing uptake by the cell of the oligonucleotide; allowing annealing of the oligonucleotide to the target RNA sequence; allowing a mammalian ADAR enzyme including a natural dsRNA binding domain as found in the wild type enzyme to deaminate said target adenosine in the target RNA sequence to an inosine; and optionally identifying the presence of the inosine in the RNA sequence.

    [0091] Hence, the invention also relates to oligonucleotides and methods wherein two adenosines that are next to each other are co-deaminated by an RNA editing enzyme such as ADAR. In this particular case, the UAA stop codon is converted into a Ull Trp-encoding codon. Other examples of modifications resulting from deamination of target adenosines within a target codon are provided in Tables 1 and 2 below.

    TABLE-US-00014 TABLE 1 Target Amino Acid Encoded Modified Amino Acid Encoded Codon by Target Codon Codon by Modified Codon AAA Lys IAA Glu AIA Arg IIA Gly AII Arg IAI Glu III Gly AAC Asn IAC Asp AIC Ser IIC Gly AAG Lys IAG Glu AIG Arg IIG Gly AAU Arg IAU Asp AIU Ser IIU Gly ACA Thr ICA Ala ICI Ala ACC Thr ICC Ala ACG Thr ICG Ala ACU Thr ICU Ala AGA Arg IGA Gly IGI Gly AGC Ser IGC Gly AGG Arg IGG Gly AGU Ser IGU Gly AUA lle IUA Asp AUI Met IUI Val AUC lle IUC Val AUG Met IUG Val AUU lle IUU Val CAA Gln CIA Arg CII Arg CAC His CIC Arg CAG Gln CIG Arg CAU His CIU Arg GAA Glu GIA Gly GII Gly GAC Asp GIC Gly GAG Glu GIG Gly GAU Asp GIU Gly UAA Stop UII Trp UGA Stop UGI Trp UAC Tyr UIC Cys UAG Stop UIG Trp UAU Tyr UIU Cys

    TABLE-US-00015 TABLE 2 Target Codon Base Composition and Resulting Modified Codon Target Codon Modified Codon AAA AIA AAC AIC AAG AIG AAU AIU CAA CIA CAC CIC CAG CIG CAU CIU GAA GIA GAC GIC GAG GIG GAU GIU UAA UIA UAC UIC UAG UIG UAU UIU

    [0092] Because the deamination of the adenosine to an inosine may result in a protein that is no longer suffering from the mutated A at the target position, the identification of the deamination into inosine may be a functional read-out, for instance an assessment on whether a functional protein is present, or even the assessment that a disease that is caused by the presence of the adenosine is (partly) reversed. The functional assessment for each of the diseases mentioned herein will generally be according to methods known to the skilled person. When the presence of a target adenosine causes aberrant splicing, the read-out may be the assessment of whether the aberrant splicing is still taking place, or not, or less. On the other hand, when the deamination of a target adenosine is wanted to introduce a splice site, then similar approaches can be used to check whether the required type of splicing is indeed taking place. A very suitable manner to identify the presence of an inosine after deamination of the target adenosine is of course RT-PCR and sequencing, using methods that are well-known to the person skilled in the art.

    [0093] In general, mutations in any target RNA that can be reversed using oligonucleotide constructs according to the invention are G-to-A mutations, and oligonucleotide constructs can be designed accordingly. Mutations that may be targeted using oligonucleotide constructs according to the invention also include C to A, U to A (T to A on the DNA level) in the case of recruiting adenosine deaminases. Although RNA editing in the latter circumstances may not necessarily revert the mutation to wild-type, the edited nucleotide may give rise to an improvement over the original mutation. For example, a mutation that causes an in frame stop codongiving rise to a truncated protein, upon translationmay be changed into a codon coding for an amino acid that may not be the original amino acid in that position, but that gives rise to a (full length) protein with at least some functionality, at least more functionality than the truncated protein.

    [0094] The invention is particularly suitable for treating genetic diseases, such as cystic fibrosis, albinism, alpha-1-antitrypsin (A1AT) deficiency, Alzheimer disease, amyotrophic lateral sclerosis, asthma, 11-thalassemia, Cadasil syndrome, Charcot-Marie-Tooth disease, chronic obstructive pulmonary disease (COPD), distal spinal muscular atrophy (DSMA), Duchenne/Becker muscular dystrophy, dystrophic epidermolysis bullosa, epidermylosis bullosa, Fabry disease, Factor V Leiden associated disorders, familial adenomatous, polyposis, galactosemia, Gaucher's disease, glucose-6-phosphate dehydrogenase deficiency, haemophilia, hereditary hematochromatosis, Hunter syndrome, Huntington's disease, Hurler syndrome, inflammatory bowel disease (IBD), inherited polyagglutination syndrome, Leber congenital amaurosis, Lesch-Nyhan syndrome, Lynch syndrome, Marfan syndrome, mucopolysaccharidosis, muscular dystrophy, myotonic dystrophy types I and II, neurofibromatosis, Niemann-Pick disease type A, B and C, NY-ESO-1 related cancer, Parkinson's disease, Peutz-Jeghers syndrome, phenylketonuria, Pompe's disease, primary ciliary disease, prothrombin mutation related disorders (e.g., prothrombin G20210A mutation), pulmonary hypertension, retinitis pigmentosa, Sandhoff disease, severe combined immune deficiency syndrome (SCID), sickle cell anemia, spinal muscular atrophy, Stargardt's disease, Tay-Sachs disease, Usher syndrome, X-linked immunodeficiency, Sturge-Weber syndrome, Rett syndrome, and various forms of cancer (e.g. BRCA1 and 2 linked breast cancer and ovarian cancer).

    [0095] Oligonucleotides of the invention may deaminate the adenosine mutation resulting in an increase in protein activity.

    [0096] In certain embodiments, treatment is performed on a subject who has been diagnosed with a mutation in a gene, but does not yet have disease symptoms (e.g., an infant such as a subject that is 1 month to 12 months old or subject under the age of 2). In other embodiments, treatment is performed on an individual who has at least one symptom.

    [0097] Treatment may be performed in a subject of any age, starting from infancy to adulthood. Subjects may begin treatment, for example, at birth, six months, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, or 18 years of age.

    [0098] In certain embodiments, the oligonucleotide increases (e.g., an increase by 100%, 150%, 200%, 300%, 400%, 500%, 600%. 700%, 800%, 900%, 1000% or more, or an increase by more than 1.2-fold, 1.4-fold, 1.5-fold, 1.8-fold, 2.0-fold, 3.0-fold, 3.5-fold, 4.5-fold, 5.0-fold, 10-fold, 15-fold, 20-fold, 30-fold, 40-fold, 50-fold, 100-fold, 1000-fold, or more) protein activity in vitro and/or in vivo.

    [0099] In some embodiments, the oligonucleotide increases (e.g., an increase by 100%, 150%, 200%, 300%, 400%, 500%, 600%, 700%, 800%, 900%, 1000% or more, or an increase by more than 1.2-fold, 1.4-fold, 1.5-fold, 1.8-fold, 2.0-fold, 3.0-fold, 3.5-fold, 4.5-fold, 5.0-fold, 10-fold, 15-fold, 20-fold, 30-fold, 40-fold, 50-fold, 100-fold, 1000-fold, or more) protein activity in the brain.

    II. Oligonucleotide Agents

    [0100] The oligonucleotides of the invention are complementary to target mRNA with the exception of at least one mismatch capable of recruiting ADAR enzymes to deaminate selected adenosines on the target mRNA. In some embodiments, only one adenosine is deaminated. In some embodiments, 1, 2, or 3 adenosines is deaminated. The oligonucleotide includes a mismatch opposite the target adenosine, e.g., at X.sup.2. The oligonucleotides of the invention may further include modifications (e.g., alternative nucleotides) to increase stability and/or increase deamination efficiency.

    A. Alternative Oligonucleotides

    [0101] In one embodiment, one or more of the nucleotides of the oligonucleotide of the invention, is naturally-occurring, and does not include, e.g., chemical modifications and/or conjugations known in the art and described herein. In another embodiment, one or more of the nucleotides of an oligonucleotide of the invention, is chemically modified to enhance stability or other beneficial characteristics (e.g., alternative nucleotides). Without being bound by theory, it is believed that certain modification can increase nuclease resistance and/or serum stability, or decrease immunogenicity. For example, polynucleotides of the invention may contain nucleotides found to occur naturally in DNA or RNA (e.g., adenine, thymidine, guanosine, cytidine, uridine, or inosine) or may contain nucleotides which have one or more chemical modifications to one or more components of the nucleotide (e.g., the nucleobase, sugar, or phospho-linker moiety). Oligonucleotides of the invention may be linked to one another through naturally-occurring phosphodiester bonds, or may be modified to be covalently linked through phosphorothiorate, 3-methylenephosphonate, 5-methylenephosphonate, 3-phosphoamidate, 2-5 phosphodiester, guanidinium, S-methylthiourea, or peptide bonds.

    [0102] In some embodiments, one or more of the nucleotides of the oligonucleotide of the invention has the structure of any one of Formula I-V:

    ##STR00004##

    [0103] In some embodiments, one or more of the nucleotides of the oligonucleotide of the invention has the structure of any one of Formula I, e.g., has the structure:

    ##STR00005##

    [0104] In some embodiments, one or more of the nucleotides of the oligonucleotide of the invention has the structure of any one of Formula II, e.g., has the structure:

    ##STR00006##

    [0105] In some embodiments, one or more of the nucleotides of the oligonucleotide of the invention has the structure of any one of Formula III.

    [0106] In some embodiments, one or more of the nucleotides of the oligonucleotide of the invention has the structure of any one of Formula IV, e.g., has the structure:

    ##STR00007##

    [0107] In some embodiments, one or more of the nucleotides of the oligonucleotide of the invention has the structure of any one of Formula V, e.g., has the structure:

    ##STR00008##

    [0108] In certain embodiments of the invention, substantially all of the nucleotides of an oligonucleotide of the invention are alternative nucleotides. In other embodiments of the invention, all of the nucleotides of an oligonucleotide of the invention are alternative nucleotides. Oligonucleotides of the invention in which substantially all of the nucleotides are alternative nucleotides are largely but not wholly modified and can include no more than 5, 4, 3, 2, or 1 naturally-occurring nucleotides. In still other embodiments of the invention, oligonucleotides of the invention can include no more than 5, 4, 3, 2, or 1 alternative nucleotides.

    [0109] In some embodiments, the oligonucleotides of the instant invention include the structure:


    [A.sub.m]-X.sup.1X.sup.2X.sup.3[B.sub.n]

    wherein each of A and B is a nucleotide; m and n are each, independently, an integer from 5 to 40; at least one of X.sup.1, X.sup.2, and X.sup.3 has the structure of Formula I, wherein R.sup.1 is fluoro, hydroxy, or methoxy and N.sup.1 is a nucleobase, or the structure of Formula V, wherein R.sup.4 is hydrogen and R.sup.5 is hydrogen; each of X.sup.1, X.sup.2, and X.sup.3 that does not have the structure of Formula I is a ribonucleotide; [A.sub.m] and [B.sub.n] each include at least five terminal 2-O-methyl-nucleotides; at least four terminal phosphorothioate linkages, and at least 20% of the nucleotides of [A.sub.m] and [B.sub.n] combined are 2-O-methyl-nucleotides. In some embodiments, X.sup.1 includes an adenine nucleobase, X.sup.2 includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X.sup.3 includes an adenine nucleobase; X.sup.1 includes an adenine nucleobase, X.sup.2 includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X.sup.3 includes a guanine or hypoxanthine nucleobase; X.sup.1 includes an adenine nucleobase, X.sup.2 includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X.sup.3 includes a uracil or thymine nucleobase; X.sup.1 includes an adenine nucleobase, X.sup.2 includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X.sup.3 includes a cytosine or 5-methylcytosine nucleobase; X.sup.1 includes a guanine or hypoxanthine nucleobase, X.sup.2 includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X.sup.3 includes an adenine nucleobase; X.sup.1 includes a guanine or hypoxanthine nucleobase, X.sup.2 includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X.sup.3 includes a guanine or hypoxanthine nucleobase; X.sup.1 includes a guanine or hypoxanthine nucleobase, X.sup.2 includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X.sup.3 includes a uracil or thymine nucleobase; X.sup.1 includes a guanine or hypoxanthine nucleobase, X.sup.2 includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X.sup.3 includes a cytosine or 5-methylcytosine nucleobase; X.sup.1 includes a uracil or thymine nucleobase, X.sup.2 includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X.sup.3 includes an adenine nucleobase; X.sup.1 includes a uracil or thymine nucleobase, X.sup.2 includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X.sup.3 includes a guanine or hypoxanthine nucleobase; X.sup.1 includes a uracil or thymine nucleobase, X.sup.2 includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X.sup.3 includes a uracil or thymine nucleobase; X.sup.1 includes a uracil or thymine nucleobase, X.sup.2 includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X.sup.3 includes a cytosine or 5-methylcytosine nucleobase; X.sup.1 includes a cytosine or 5-methylcytosine nucleobase, X.sup.2 includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X.sup.3 includes an adenine nucleobase; X.sup.1 includes a cytosine or 5-methylcytosine nucleobase, X.sup.2 includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X.sup.3 includes a guanine or hypoxanthine nucleobase; X.sup.1 includes a cytosine or 5-methylcytosine nucleobase, X.sup.2 includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X.sup.3 includes a uracil or thymine nucleobase; or X.sup.1 includes a cytosine or 5-methylcytosine nucleobase, X.sup.2 includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X.sup.3 includes a cytosine or 5-methylcytosine nucleobase.

    [0110] Exemplary oligonucleotides of the instant invention are shown in Table 3 below. In Table 3, A, C, G and U are ribonucleosides; mA, mC, mG and mU are 2-O-methyl ribonucleosides; fC represents 2-deoxy-2-fluoroarabinocytidine; fA represents 2-deoxy-2-fluoroarabinoadenosine; aC represents arabinocytidine; aA represents arabinoadenosine; amC represents 2-O-methyl-arabinocytidine; amA represents 2-O-methyl-arabinoadenosine; aC represents -2-deoxycytidine; dS represents 2-deoxyribose (abasic DNA); rS represents ribose (abasic RNA); mS represents 2-O-methyl-ribose (abasic 2-OMe-RNA); and asterisks indicate phosphorothioate linkages (the remaining linkages are phosphodiester linkages).

    TABLE-US-00016 TABLE3 ExemplaryOligonucleotidesoftheInvention 5-mC*mA*mU*mA*mAUUCUUGUGUCUACUGUACAGAAUACUGCC SEQIDNO.51 GCCAGCUGGAUmU*mU*mC*mC*mC-3 5-mC*mA*mU*mA*mAUUCUUGUGUCUACUGUACAGAAUACUGCC SEQIDNO.52 GfCCAGCUGGAUmU*mU*mC*mC*mC-3 5-mC*mA*mU*mA*mAUUCUUGUGUCUACUGUACAGAAUACUGCC SEQIDNO.53 GCfCAGCUGGAUmU*mU*mC*mC*mC-3 5-mC*mA*mU*mA*mAUUCUUGUGUCUACUGUACAGAAUACUGCC SEQIDNO.54 GCCfAGCUGGAUmU*mU*mC*mC*mC-3 5-mC*mA*mU*mA*mAUUCUUGUGUCUACUGUACAGAAUACUGCC SEQIDNO.55 GCfCfAGCUGGAUmU*mU*mC*mC*mC-3 5-mC*mA*mU*mA*mAUUCUUGUGUCUACUGUACAGAAUACUGCC SEQIDNO.56 GfCfCAGCUGGAUmU*mU*mC*mC*mC-3 5-mC*mA*mU*mA*mAUUCUUGUGUCUACUGUACAGAAUACUGCC SEQIDNO.57 GfCfCfAGCUGGAUmU*mU*mC*mC*mC-3 5-mC*mA*mU*mA*mAUUCUUGUGUCUACUGUACAGAAUACUGCC SEQIDNO.58 GaCCAGCUGGAUmU*mU*mC*mC*mC-3 5-mC*mA*mU*mA*mAUUCUUGUGUCUACUGUACAGAAUACUGCC SEQIDNO.59 GCaCAGCUGGAUmU*mU*mC*mC*mC-3 5-mC*mA*mU*mA*mAUUCUUGUGUCUACUGUACAGAAUACUGCC SEQIDNO.60 GCCaAGCUGGAUmU*mU*mC*mC*mC-3 5-mC*mA*mU*mA*mAUUCUUGUGUCUACUGUACAGAAUACUGCC SEQIDNO.61 GaCaCaAGCUGGAUmU*mU*mC*mC*mC-3 5-mC*mA*mU*mA*mAUUCUUGUGUCUACUGUACAGAAUACUGCC SEQIDNO.62 GamCCAGCUGGAUmU*mU*mC*mC*mC-3 5-mC*mA*mU*mA*mAUUCUUGUGUCUACUGUACAGAAUACUGCC SEQIDNO.63 GCamCAGCUGGAUmU*mU*mC*mC*mC-3 5-mC*mA*mU*mA*mAUUCUUGUGUCUACUGUACAGAAUACUGCC SEQIDNO.64 GCCamAGCUGGAUmU*mU*mC*mC*mC-3 5-mC*mA*mU*mA*mAUUCUUGUGUCUACUGUACAGAAUACUGCC SEQIDNO.65 GCaCAGCUGGAUmU*mU*mC*mC*mC-3 5-mC*mA*mU*mA*mAUUCUUGUGUCUACUGUACAGAAUACUGCC SEQIDNO.66 GCdSAGCUGGAUmU*mU*mC*mC*mC-3 5-mC*mA*mU*mA*mAUUCUUGUGUCUACUGUACAGAAUACUGCC SEQIDNO.67 GCrSAGCUGGAUmU*mU*mC*mC*mC-3 5-mC*mA*mU*mA*mAUUCUUGUGUCUACUGUACAGAAUACUGCC SEQIDNO.68 GCmSAGCUGGAUmU*mU*mC*mC*mC-3 5-mC*mA*mU*mA*mAUUCmUmUGUGmUmCUACmUmGUACmAmGA SEQIDNO.69 AUmAmCUGCmCmGCCAmGmCUGmGmAUmU*mU*mC*mC*mC-3 5-mC*mA*mU*mA*mAUUCmUmUGUGmUmCUACmUmGUACmAmGA SEQIDNO.70 AUmAmCUGCmCmGfCCAmGmCUGmGmAUmU*mU*mC*mC*mC-3 5-mC*mA*mU*mA*mAUUCmUmUGUGmUmCUACmUmGUACmAmGA SEQIDNO.71 AUmAmCUGCmCmGCfCAmGmCUGmGmAUmU*mU*mC*mC*mC-3 5-mC*mA*mU*mA*mAUUCmUmUGUGmUmCUACmUmGUACmAmGA SEQIDNO.72 AUmAmCUGCmCmGCCfAmGmCUGmGmAUmU*mU*mC*mC*mC-3 5-mC*mA*mU*mA*mAUUCmUmUGUGmUmCUACmUmGUACmAmGA SEQIDNO.73 AUmAmCUGCmCmGCfCfAmGmCUGmGmAUmU*mU*mC*mC*mC-3 5-mC*mA*mU*mA*mAUUCmUmUGUGmUmCUACmUmGUACmAmGA SEQIDNO.74 AUmAmCUGCmCmGfCfCAmGmCUGmGmAUmU*mU*mC*mC*mC-3 5-mC*mA*mU*mA*mAUUCmUmUGUGmUmCUACmUmGUACmAmGA SEQIDNO.75 AUmAmCUGCmCmGfCfCfAmGmCUGmGmAUmU*mU*mC*mC*mC-3 5-mC*mA*mU*mA*mAUUCmUmUGUGmUmCUACmUmGUACmAmGA SEQIDNO.76 AUmAmCUGCmCmGaCCAmGmCUGmGmAUmU*mU*mC*mC*mC-3 5-mC*mA*mU*mA*mAUUCmUmUGUGmUmCUACmUmGUACmAmGA SEQIDNO.77 AUmAmCUGCmCmGCaCAmGmCUGmGmAUmU*mU*mC*mC*mC-3 5-mC*mA*mU*mA*mAUUCmUmUGUGmUmCUACmUmGUACmAmG SEQIDNO.78 AAUmAmCUGCmCmGCCaAmGmCUGmGmAUmU*mU*mC*mC*mC-3 5-mC*mA*mU*mA*mAUUCmUmUGUGmUmCUACmUmGUACmAmGA SEQIDNO.79 AUmAmCUGCmCmGaCaCaAmGmCUGmGmAUmU*mU*mC*mC*mC-3 5-mC*mA*mU*mA*mAUUCmUmUGUGmUmCUACmUmGUACmAmGA SEQIDNO.80 AUmAmCUGCmCmGamCCAmGmCUGmGmAUmU*mU*mC*mC*mC-3 5-mC*mA*mU*mA*mAUUCmUmUGUGmUmCUACmUmGUACmAmGA SEQIDNO.81 AUmAmCUGCmCmGCamCAmGmCUGmGmAUmU*mU*mC*mC*mC-3 5-mC*mA*mU*mA*mAUUCmUmUGUGmUmCUACmUmGUACmAmGA SEQIDNO.82 AUmAmCUGCmCmGCCamAmGmCUGmGmAUmU*mU*mC*mC*mC-3 5-mC*mA*mU*mA*mAUUCmUmUGUGmUmCUACmUmGUACmAmGA SEQIDNO.83 AUmAmCUGCmCmGCaCAmGmCUGmGmAUmU*mU*mC*mC*mC-3 5-mC*mA*mU*mA*mAUUCmUmUGUGmUmCUACmUmGUACmAmGA SEQIDNO.84 AUmAmCUGCmCmGCdSAmGmCUGmGmAUmU*mU*mC*mC*mC-3 5-mC*mA*mU*mA*mAUUCmUmUGUGmUmCUACmUmGUACmAmGA SEQIDNO.85 AUmAmCUGCmCmGCrSAmGmCUGmGmAUmU*mU*mC*mC*mC-3 5-mC*mA*mU*mA*mAUUCmUmUGUGmUmCUACmUmGUACmAmGA SEQIDNO.86 AUmAmCUGCmCmGCmSAmGmCUGmGmAUmU*mU*mC*mC*mC-3

    [0111] In some embodiments, the oligonucleotides of the instant invention include a stem-loop structure that acts as a recruitment domain for the ADAR enzyme (e.g., an ADAR-recruiting domain). Such oligonucleotides may be referred to as axiomer AONs or self-looping AONs. The recruitment portion acts in recruiting a natural ADAR enzyme present in the cell to the dsRNA formed by hybridization of the target sequence with the targeting portion. The recruitment portion may be a stem-loop structure mimicking either a natural substrate (e.g. the glutamate ionotropic receptor AMPA type subunit 2 (GluR2) receptor; such as a GluR2 ADAR-recruiting domain) or a Z-DNA structure known to be recognized by the dsRNA binding regions of ADAR enzymes (e.g., a Z-DNA ADAR-recruiting domain). As GluR2 and Z-DNA ADAR-recruiting domains are high affinity binding partners to ADAR, there is no need for conjugated entities or presence of modified recombinant ADAR enzymes. A stem-loop structure can be an intermolecular stem-loop structure, formed by two separate nucleic acid strands, or an intramolecular stem loop structure, formed within a single nucleic acid strand. The stem-loop structure of the recruitment portion may be a step loop structure described in WO 2016/097212, US 2018/0208924, Merkle et al. Nature Biotechnology, 37: 133-8 (2019), Katrekar et al. Nature Methods, 16(3): 239-42 (2019), Fukuda et al. Scientific Reports, 7: 41478 (2017), the stem-loop structures of the ADAR recruitment portion of which are herein incorporated by reference. In some embodiments, the oligonucleotides include one or more ADAR-recruiting domains (e.g., 1 or 2 ADAR-recruiting domains).

    [0112] In some embodiments, the oligonucleotides of the invention include those having a structure of any one of Formulas VI, VII, IX, or X. In one embodiment, the oligonucleotides of the invention include those including an ADAR-recruiting domain having a structure of Formula XXIV:


    C-L.sub.1-D, Formula XXIV,

    wherein C is a single-stranded oligonucleotide of about 10-50 linked nucleosides in length (e.g., about 10, 15, 20, 25, 30, 35, 40, 45, 46, 47, 48, 49, or 50 linked nucleosides in length), L.sub.1 is a loop region, and D is a single-stranded oligonucleotide of about 10-50 linked nucleosides in length (e.g., about 10, 15, 20, 25, 30, 35, 40, 45, 46, 47, 48, 49, or 50 linked nucleosides in length).

    [0113] In some embodiments, C includes a region that is complementary to D such that the two strands hybridize and form a duplex under suitable conditions. Generally, the duplex structure is between 5 and 50 linked nucleosides in length, e.g., between, 5-49, 5-45, 5-40, 5-35, 5-30, 5-25, 5-20, 5-15, 5-10, 5-6, 8-50, 8-45, 8-40, 8-35, 8-30, 8-25, 8-20, 8-15, 8-10, 15-50, 15-45, 15-40, 15-35, 15-30, 15-25, 15-20, 15-16, 20-50, 20-45, 20-40, 20-35, 20-30, 20-25, 25-50, 25-45, 25-40, 25-35, or 25-30 linked nucleosides in length. Ranges and lengths intermediate to the above-recited ranges and lengths are also contemplated to be part of the invention. In some embodiments, C is complementary to at least 5 contiguous nucleobases (e.g., 5, 10, 15, 20, 25, 30, or more contiguous nucleobases) of D, and the oligonucleotide forms a duplex structure of between 10-50 linked nucleosides in length (e.g., at least 10, 15, 20, 25, 30, 35, 40, 45, 46, 47, 48, 49, or 50 linked nucleosides in length).

    [0114] In some embodiments, the duplex structure includes at least one mismatch between nucleotides of C and nucleotides of D (e.g., at least 1, 2, 3, 4, or 5 mismatches). In some embodiments, the mismatch is a paired A to C mismatch. In some embodiments, the A nucleoside of the A to C mismatch is on the C strand and the C nucleoside of the A to C mismatch is on the D strand. In some embodiments, the A nucleoside of the A to C mismatch is on the D strand and the C nucleoside of the A to C mismatch is on the C strand. In other embodiments, the mismatch is a paired G-to-G mismatch. In still yet other embodiments, the mismatch is a paired C to A mismatch. In some embodiments, the C nucleoside of the C to A mismatch is on the C strand and the A nucleoside of the C to A mismatch is on the D strand. In some embodiments, the C nucleoside of the C to A mismatch is on the D strand and the A nucleoside of the C to A mismatch is on the C strand. In some embodiments, the mismatch is a paired I to I mismatch. In some embodiments, the mismatch is a paired I to G mismatch. In some embodiments, the I nucleoside of the I to G mismatch is on the C strand and the G nucleoside of the I to G mismatch is on the D strand. In some embodiments, the I nucleoside of the I to G mismatch is on the D strand and the G nucleoside of the I to G mismatch is on the C strand. In some embodiments, the mismatch is a paired G to I mismatch. In some embodiments, the G nucleoside of the G to I mismatch is on the C strand and the I nucleoside of the G to I mismatch is on the D strand. In some embodiments, the G nucleoside of the G to I mismatch is on the D strand and the I nucleoside of the G to I mismatch is on the C strand. In some embodiments, the mismatch includes a nucleoside having an alternative nucleobase. In some embodiments, the alternative nucleobase has the structure:

    ##STR00009##

    wherein R.sup.1 is hydrogen, trifluoromethyl, optionally substituted amino, hydroxyl, or optionally substituted C.sub.1-C.sub.6 alkoxy;

    [0115] R.sup.2 is hydrogen, optionally substituted amino, or optionally substituted C.sub.1-C.sub.6 alkyl; and

    [0116] R.sup.3 and R.sup.4 are, independently, hydrogen, halogen, or optionally substituted C.sub.1-C.sub.6 alkyl, or a salt thereof. In some embodiments, R.sup.1 is a hydrogen bond donor group (e.g., a hydroxyl group, an amino group). In some embodiments, R.sup.1 is a hydrogen bond accepting group (e.g., an alkoxy group).

    [0117] In some embodiments, the duplex structure includes two mismatches. In some embodiments, the mismatches are at least three linked nucleosides apart. For example, when mismatches are separated by 3 nucleotides, the oligonucleotide includes the structure M.sub.1-N.sub.1N.sub.2N.sub.3-M.sub.2, where M.sub.1 is the first mismatch, N.sub.1, N.sub.2, and N.sub.3 are paired nucleobases, and M.sub.2 is the second mismatch. In some embodiments M.sub.1 is a paired A to C mismatch and M.sub.2 is a paired G-to-G mismatch.

    [0118] In some embodiments, the loop region, L.sub.1, includes linked nucleosides. In some embodiments, L.sub.1 includes at least one alternative nucleobase, at least one alternative internucleoside linkage, and/or at least one alternative sugar moiety.

    [0119] In other embodiments, the loop region has the structure of Formula VIII:


    F.sup.1-(G.sup.1).sub.j-(H.sup.1).sub.k(G.sup.2).sub.m-(I)-(G.sup.3).sub.n-(H.sup.2).sub.p-(G.sup.4).sub.q-F.sup.2 Formula VIII,

    wherein F.sup.1 is a bond between the loop region and C; F.sup.2 is a bond between D and a nucleotide or between D and, optionally, a linker; G.sup.1, G.sup.2, G.sup.3, and G.sup.4 each, independently, is selected from optionally substituted C1-C2 alkyl, optionally substituted C1-C3 heteroalkyl, O, S, and NR.sup.N; R.sup.N is hydrogen, optionally substituted C.sub.1-4 alkyl, optionally substituted C.sub.2-4 alkenyl, optionally substituted C.sub.2-4 alkynyl, optionally substituted C.sub.2-6 heterocyclyl, optionally substituted C.sub.6-12 aryl, or optionally substituted C.sub.1-7 heteroalkyl; C.sup.1 and C.sup.2 are each, independently, selected from carbonyl, thiocarbonyl, sulphonyl, or phosphoryl; j, k, m, n, p, and q are each, independently, 0 or 1; and I is optionally substituted C.sub.1-10 alkyl, optionally substituted C.sub.2-10 alkenyl, optionally substituted C.sub.2-10 alkynyl, optionally substituted C.sub.2-6 heterocyclyl, optionally substituted C.sub.6-12 aryl, optionally substituted C.sub.2-C.sub.10 polyethylene glycol, or optionally substituted C.sub.1-10 heteroalkyl, or a chemical bond linking F.sup.1-(G.sup.1).sub.j-(H.sup.1).sub.k-(G.sup.2).sub.m-(I)-(G.sup.3).sub.n-(H.sup.2).sub.p-(G.sup.4).sub.q-F.sup.2. In some embodiments, the linker is optional.

    [0120] In some embodiments, the loop region, L.sub.1 includes a carbohydrate-containing linking moiety.

    [0121] In one embodiment, one or more of the nucleotides of the oligonucleotides of the invention, is naturally-occurring, and does not include, e.g., chemical modifications and/or conjugations known in the art and described herein. In another embodiment, one or more of the nucleotides of an oligonucleotide of the invention is chemically modified to enhance stability or other beneficial characteristics (e.g., alternative nucleotides). Without being bound by theory, it is believed that certain modification can increase nuclease resistance and/or serum stability, or decrease immunogenicity. For example, polynucleotides of the invention may contain nucleotides found to occur naturally in DNA or RNA (e.g., adenine, thymidine, guanosine, cytidine, uridine, or inosine) or may contain nucleotides which have one or more chemical modifications to one or more components of the nucleotide (e.g., the nucleobase, sugar, or phospho-linker moiety). Oligonucleotides of the invention may be linked to one another through naturally-occurring phosphodiester bonds, or may be modified to be covalently linked through phosphorothiorate, 3-methylenephosphonate, 5-methylenephosphonate, 3-phosphoamidate, 2-5 phosphodiester, guanidinium, S-methylthiourea, or peptide bonds.

    [0122] In some embodiments, C includes at least one alternative nucleobase, at least one alternative internucleoside linkage, and/or at least one alternative sugar moiety. In other embodiments, D includes at least one alternative nucleobase, at least one alternative internucleoside linkage, and/or at least one alternative sugar moiety. In some embodiments, both C and D each include at least one alternative nucleobase, at least one alternative internucleoside linkage, and/or at least one alternative sugar moiety.

    [0123] In certain embodiments of the invention, substantially all of the nucleotides of an oligonucleotide of the invention are alternative nucleotides. In other embodiments of the invention, all of the nucleotides of an oligonucleotide of the invention are alternative nucleotides. Oligonucleotides of the invention in which substantially all of the nucleotides are alternative nucleotides are largely but not wholly modified and can include no more than 5, 4, 3, 2, or 1 naturally-occurring nucleotides. In still other embodiments of the invention, an oligonucleotide of the invention can include no more than 5, 4, 3, 2, or 1 alternative nucleotides.

    [0124] In one embodiment, the oligonucleotides of the invention include an ADAR-recruiting domain having the structure of Formula XXIV, wherein C is a single-stranded oligonucleotide of 10-50 linked nucleosides in length, L.sub.1 is a loop region, and D is a single-stranded oligonucleotide of 10-50 linked nucleosides in length. In some embodiments, C is complementary to at least 5 contiguous nucleobases of D, and the oligonucleotide includes a duplex structure formed by C and D of between 10-50 linked nucleosides in length. In some embodiments, the duplex structure includes at least one mismatch. In some embodiments, C or D includes at least one alternative nucleobase. In some embodiments, C and D each include at least one alternative nucleobase. In some embodiments, C and/or D, independently, further include at least one alternative internucleoside linkage and/or at least one alternative sugar moiety. In some embodiments, L.sub.1 includes linked nucleotides. In other embodiments, L.sub.1 consists of linked nucleosides. In some embodiments, L.sub.1 includes at least one alternative nucleobase, at least one alternative internucleoside linkage, and/or at least one alternative sugar moiety.

    [0125] In another embodiment, the oligonucleotides of the invention include an ADAR-recruiting domain having the structure of Formula XXIV, wherein C is a single-stranded oligonucleotide of 10-50 linked nucleosides in length, L.sub.1 is a loop region that does not consist of linked nucleosides, and D is a single-stranded oligonucleotide of 10-50 linked nucleosides in length. In some embodiments, C is complementary to at least 5 contiguous nucleobases of D, and the oligonucleotide includes a duplex structure formed by C and D of between 10-50 linked nucleosides in length. In some embodiments, the duplex structure includes at least one mismatch. In some embodiments, L.sub.1 has the structure of Formula VIII, as described herein. In some embodiments, L.sub.1 includes a carbohydrate-containing linking moiety. In some embodiments, C and/or D, independently, include at least one alternative nucleobase, at least one alternative internucleoside linkage, and/or at least one alternative sugar moiety.

    [0126] In another embodiment, the oligonucleotides of the invention include an ADAR-recruiting domain having the structure of Formula XXIV, wherein C is a single-stranded oligonucleotide of 10-50 linked nucleosides in length, L.sub.1 is a loop region including at least one alternative nucleobase or at least one alternative internucleoside linkage, and D is a single-stranded oligonucleotide of 10-50 linked nucleosides in length. In some embodiments, C is complementary to at least 5 contiguous nucleobases of D, and the oligonucleotide includes a duplex structure formed by C and D of between 10-50 linked nucleosides in length. In some embodiments, the duplex structure includes at least one mismatch. In some embodiments, L.sub.1 includes at least one alternative nucleobase and at least one alternative internucleoside linkage.

    [0127] In another embodiment, the oligonucleotides of the invention include an ADAR-recruiting domain having the structure of Formula XXIV, wherein C is a single-stranded oligonucleotide of 10-50 linked nucleosides in length, L.sub.1 is a loop region including, at least one alternative sugar moiety that is not a 2-O-methyl sugar moiety (e.g., the alternative sugar moiety is selected from the group consisting of a 2-O-C.sub.1-C.sub.6 alkyl-sugar moiety, a 2-amino-sugar moiety, a 2-fluoro-sugar moiety, a 2-O-MOE sugar moiety, an LNA sugar moiety, an arabino nucleic acid (ANA) sugar moiety, a 2-fluoro-ANA sugar moiety, a deoxyribose sugar moiety, and a bicyclic nucleic acid), and D is a single-stranded oligonucleotide of 10-50 linked nucleosides in length. In some embodiments, C is complementary to at least 5 contiguous nucleobases of D, and the oligonucleotide includes a duplex structure formed by C and D of between 10-50 linked nucleosides in length. In some embodiments, the duplex structure includes at least one mismatch. In some embodiments, C and/or D, independently, include at least one alternative nucleobase, at least one alternative internucleoside linkage, and/or at least one alternative sugar moiety.

    [0128] In some embodiments, C includes a nucleobase sequence having at least 50% sequence identity (e.g., at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity) to a nucleobase sequence set forth in of any one of SEQ ID NOs. 1, 4, 7, 10, 13, 16, 19, 22, 25, 28, 31, and 34, and D includes a nucleobase sequence complementary to the nucleobase sequence of C, wherein the sequence includes at least one mismatch as described herein. In other embodiments, D includes a nucleobase sequence having at least 50% sequence identity (e.g., at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity) to a nucleobase sequence set forth in of any one of SEQ ID NOs. 2, 5, 8, 11, 14, 17, 20, 23, 26, 29, 32, and 35, and C includes a nucleobase sequence complementary to the nucleobase sequence of C, wherein the sequence includes at least one mismatch as described herein. In some embodiments, C-L.sub.1-D includes a nucleobase sequence having at least 50% sequence identity (e.g., at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity) to a nucleobase sequence set forth in of any one of SEQ ID NOs. 3, 6, 9, 12, 15, 18, 21, 24, 27, 30, 33, and 36, wherein the sequence includes at least one mismatch as described herein. Nucleobase sequences of SEQ ID NOs. 1-36 are provided below:

    TABLE-US-00017 TABLE4 GGUGAAUAGUAUAACAAUAU SEQIDNO.1 AUGUUGUUAUAGUAUCCACC SEQIDNO.2 GGUGAAUAGUAUAACAAUAU SEQIDNO.3 GCUAAAUGUUGUUAUAGUAU CCACC GGUGAAGAGGAGAACAAUAU SEQIDNO.4 AUGUUGUUCUCGUCUCCACC SEQIDNO.5 GGUGAAGAGGAGAACAAUAU SEQIDNO.6 GCUAAAUGUUGUUCUCGUCU CCACC GGUGUCGAGAAGAGGAGAAC SEQIDNO.7 AAUAU AUGUUGUUCUCGUCUCCUCG SEQIDNO.8 ACACC GGUGUCGAGAAGAGGAGAAC SEQIDNO.9 AAUAUGCUAAAUGUUGUUCU CGUCUCCUCGACACC GGGUGGAAUAGUAUAACAAU SEQIDNO.10 AU AUGUUGUUAUAGUAUCCCAC SEQIDNO.11 CU GGGUGGAAUAGUAUAACAAU SEQIDNO.12 AUGCUAAAUGUUGUUAUAGU AUCCCACCU GUGGAAUAGUAUAACAAUAU SEQIDNO.13 AUGUUGUUAUAGUAUCCCAC SEQIDNO.14 GUGGAAUAGUAUAACAAUAU SEQIDNO.15 GCUAAAUGUUGUUAUAGUAU CCCAC GGUGUCGAGAAUAGUAUAAC SEQIDNO.16 AAUAU AUGUUGUUAUAGUAUCCUCG SEQIDNO.17 ACACC GGUGUCGAGAAUAGUAUAAC SEQIDNO.18 AAUAUGCUAAAUGUUGUUAU AGUAUCCUCGACACC GGGUGGAAUAGUAUAACAAU SEQIDNO.19 AU AUGUUGUUAUAGUAUCCCAC SEQIDNO.20 CU GGGUGGAAUAGUAUAACAAU SEQIDNO.21 AUGCUAAAUGUUGUUAUAGU AUCCCACCU GGGUGGAAUAGUAUACCA SEQIDNO.22 UGGUAUAGUAUCCCACCU SEQIDNO.23 GGGUGGAAUAGUAUACCAUU SEQIDNO.24 CGUGGUAUAGUAUCCCACCU GUGGGUGGAAUAGUAUACCA SEQIDNO.25 UGGUAUAGUAUCCCACCUAC SEQIDNO.26 GUGGGUGGAAUAGUAUACCA SEQIDNO.27 UUCGUGGUAUAGUAUCCCAC CUAC UGGGUGGAAUAGUAUACCA SEQIDNO.28 UGGUAUAGUAUCCCACCUA SEQIDNO.29 UGGGUGGAAUAGUAUACCAU SEQIDNO.30 UCGUGGUAUAGUAUCCCACC UA GGUGGAAUAGUAUACCA SEQIDNO.31 UGGUAUAGUAUCCCACC SEQIDNO.32 GGUGGAAUAGUAUACCAUUC SEQIDNO.33 GUGGUAUAGUAUCCCACC GUGGAAUAGUAUACCA SEQIDNO.34 UGGUAUAGUAUCCCAC SEQIDNO.35 GUGGAAUAGUAUACCAUUCG SEQIDNO.36 UGGUAUAGUAUCCCAC

    [0129] It will be understood that, although the sequences in SEQ ID NOs. 1-36 are described as unmodified and/or un-conjugated sequences, the RNA of the oligonucleotides of the invention may include any one of the sequences set forth in SEQ ID NOs. 1-36 that is an alternative nucleoside and/or conjugated as described in detail below.

    [0130] In some embodiments, the oligonucleotide of the invention may further include a 5 cap structure. In some embodiments, the 5 cap structure is a 2,2,7-trimethylguanosine cap.

    [0131] An oligonucleotide of the invention can be synthesized by standard methods known in the art as further discussed below, e.g., by use of an automated DNA synthesizer, such as are commercially available from, for example, Biosearch, Applied Biosystems, Inc.

    [0132] The oligonucleotide compound can be prepared using solution-phase or solid-phase organic synthesis or both. Organic synthesis offers the advantage that the oligonucleotide including unnatural or alternative nucleotides can be easily prepared. Single-stranded oligonucleotides of the invention can be prepared using solution-phase or solid-phase organic synthesis or both.

    [0133] Further, it is contemplated that for any sequence identified herein, further optimization could be achieved by systematically either adding or removing linked nucleosides to generate longer or shorter sequences. Further still, such optimized sequences can be adjusted by, e.g., the introduction of alternative nucleosides, alternative sugar moieties, and/or alternative internucleosidic linkages as described herein or as known in the art, including alternative nucleosides, alternative sugar moieties, and/or alternative internucleosidic linkages as known in the art and/or discussed herein to further optimize the molecule (e.g., increasing serum stability or circulating half-life, increasing thermal stability, enhancing transmembrane delivery, targeting to a particular location or cell type, and/or increasing interaction with RNA editing enzymes (e.g., ADAR)).

    [0134] In some embodiments, the oligonucleotide includes one ADAR-recruiting domain. In some embodiments, the ADAR-recruiting domain is at the 5 end of the oligonucleotide. In some embodiments, the ADAR-recruiting domain is at the 3 end of the oligonucleotide. In some embodiments, the oligonucleotide includes a first ADAR-recruiting domain and a second ADAR-recruiting domain. In some embodiments, the first ADAR-recruiting domain is at the 5 end of the oligonucleotide, wherein the second ADAR-recruiting domain is at the 3 end of the oligonucleotide. In some embodiments, the one or more ADAR-recruiting domains are GluR2 ADAR-recruiting domains. In some embodiments, the GluR2 ADAR-recruiting domain has the nucleotide sequence of SEQ ID NO. 37, as shown below in the 5 to 3 direction:

    TABLE-US-00018 (SEQIDNO.37) GGUGAAUAGUAUAACAAUAUGCUAAAUGUUGUUAUAGUAUCCACC

    [0135] In some embodiments, the oligonucleotide includes the structure of Formula XI, as shown below:

    TABLE-US-00019 FormulaXI, (SEQIDNO.37) A.sub.mG.sub.mG 5GGUGAUAUAUAACAAUAUC ||||||||||||||||||U 3[ASO]-CCACUAUAUAUUGUUGUAA C.sub.mG.sub.mA
    wherein [ASO] includes any of the oligonucleotides of the instant invention, wherein m designates a mismatched nucleotide. In some embodiments, the GluR2 ADAR-recruiting domain has the nucleotide sequence of SEQ ID NO. 38, as shown below in the 5 to 3 direction:

    TABLE-US-00020 (SEQIDNO.38) GGUGAAGAGGAGAACAAUAUGCUAAAUGUUGUUCUCGUCUCCACC

    [0136] In some embodiments, the oligonucleotide includes the structure of Formula XII, as shown below:

    TABLE-US-00021 FormulaXII, (SEQIDNO.38) A.sub.mG.sub.mG 5GGUGAGAGAGAACAAUAUC ||||||||||||||||||U 3[ASO]-CCACUCUCUCUUGUUGUAA C.sub.mG.sub.mA
    wherein [ASO] includes any of the oligonucleotides of the instant invention, wherein m designates a mismatched nucleotide. In some embodiments, the GluR2 ADAR-recruiting domain has the nucleotide sequence of SEQ ID NO. 39, as shown below in the 5 to 3 direction:

    TABLE-US-00022 (SEQIDNO.39) GGUGUCGAGAAGAGGAGAACAAUAUGCUAAAUGUUGUUCUCGUCUCCUCG ACACC

    [0137] In some embodiments, the oligonucleotide includes the structure of Formula XIII, as shown below:

    TABLE-US-00023 FormulaXIII, (SEQIDNO.39) A.sub.mG.sub.mG 5GGUGUCGAGAGAGAGAACAAUAUC |||||||||||||||||||||||U 3[ASO]-CCACAGCUCUCUCUCUUGUUGUAA C.sub.mG.sub.mA
    wherein [ASO] includes any of the oligonucleotides of the instant invention, wherein m designates a mismatched nucleotide.

    [0138] In some embodiments, the GluR2 ADAR-recruiting domain has the nucleotide sequence of SEQ ID NO. 40, as shown below in the 5 to 3 direction:

    TABLE-US-00024 (SEQIDNO.40) *s*s*G**GAGAAGAGGAGAA*AA*A*G**AAA*G**G*****G****** *GA*A**
    wherein * is a 2-O-methyl nucleotide and s is a phosphorothioate internucleoside linkage between two linked nucleotides. In some embodiments, the oligonucleotide includes the structure of Formula XIV, as shown below:

    TABLE-US-00025 FormulaXIV, (SEQIDNO.40) A.sub.mG.sub.mG ***G**GAGAGAGAGAA*AA*A** |*|*|||||||||||||||||||||* [ASO]-**A*AG***********G**G*AA *.sub.mG.sub.mA
    wherein [ASO] includes any of the oligonucleotides of the instant invention, wherein * is a 2-O-methyl nucleotide, wherein s is a phosphorothioate internucleoside linkage, wherein m designates a mismatched nucleotide. In some embodiments, the ADAR-recruiting domains further include at least one nuclease-resistant nucleotide (e.g., 2-O-methyl nucleotide). In some embodiments, the ADAR-recruiting domains include at least one alternative internucleoside linkage (e.g., a phosphorothioate internucleoside linkage). In some embodiments, the GluR2 ADAR-recruiting domain has the nucleotide sequence of SEQ ID NO. 41, as shown below in the 5 to 3 direction:

    TABLE-US-00026 (SEQIDNO.41) GGGUGGAAUAGUAUAACAAUAUGCUAAAUGUUGUUAUAGUAUCCCACCU

    [0139] In some embodiments, the oligonucleotide includes the structure of Formula XV, as shown below:

    TABLE-US-00027 FormulaXV, (SEQIDNO.41) A.sub.mG.sub.mG 5GGGUGGAUAUAUAACAAUAUC ||||||||||||||||||||U 3[ASO]-UCCACCUAUAUAUUGUUGUAA C.sub.mG.sub.mA
    wherein [ASO] includes any of the oligonucleotides of the instant invention, wherein m designates a mismatched nucleotide. In some embodiments, the GluR2 ADAR-recruiting domain has the nucleotide sequence of SEQ ID NO. 42, as shown below in the 5 to 3 direction:

    TABLE-US-00028 (SEQIDNO.42) GUGGAAUAGUAUAACAAUAUGCUAAAUGUUGUUAUAGUAUCCCAC

    [0140] In some embodiments, the oligonucleotide includes the structure of Formula XVI, as shown below:

    TABLE-US-00029 FormulaXVI, (SEQIDNO.42) A.sub.mG.sub.mG 5GUGGAUAUAUAACAAUAUC ||||||||||||||||||U 3[ASO]-CACCUAUAUAUUGUUGUAA C.sub.mG.sub.mA
    wherein [ASO] includes any of the oligonucleotides of the instant invention, wherein m designates a mismatched nucleotide. In some embodiments, the GluR2 ADAR-recruiting domain has the nucleotide sequence of SEQ ID NO. 43, as shown below in the 5 to 3 direction:

    TABLE-US-00030 (SEQIDNO.43) GGUGUCGAGAAUAGUAUAACAAUAUGCUAAAUGUUGUUAUAGUAUCCUCG ACACC

    [0141] In some embodiments, the oligonucleotide includes the structure of Formula XVII, as shown below:

    TABLE-US-00031 FormulaXVII, (SEQIDNO.43) A.sub.mG.sub.mG 5GGUGUCGAGAUAUAUAACAAUAUC |||||||||||||||||||||||U 3[ASO]-CCACAGCUCUAUAUAUUGUUGUAA C.sub.mG.sub.mA
    wherein [ASO] includes any of the oligonucleotides of the instant invention, wherein m designates a mismatched nucleotide. In some embodiments, the GluR2 ADAR-recruiting domain has the nucleotide sequence of SEQ ID NO. 44, as shown below in the 5 to 3 direction:

    TABLE-US-00032 (SEQIDNO.44) GGGUGGAAUAGUAUAACAAUAUGCUAAAUGUUGUUAUAGUAUCCCACCU

    [0142] In some embodiments, the oligonucleotide includes the structure of Formula XVIII, as shown below:

    TABLE-US-00033 FormulaXVIII, (SEQIDNO.44) A.sub.mG.sub.mG 5GGGUGGAUAUAUAACAAUAUC ||||||||||||||||||||U 3[ASO]-UCCACCUAUAUAUUGUUGUAA C.sub.mG.sub.mA
    wherein [ASO] includes any of the oligonucleotides of the instant invention, wherein m designates a mismatched nucleotide. In some embodiments, the GluR2 ADAR-recruiting domain has the nucleotide sequence of SEQ ID NO. 45, as shown below in the 5 to 3 direction:

    TABLE-US-00034 (SEQIDNO.45) GGGUGGAAUAGUAUACCAUUCGUGGUAUAGUAUCCCACCU

    [0143] In some embodiments, the oligonucleotide includes the structure of Formula XIX, as shown below:

    TABLE-US-00035 FormulaXIX, (SEQIDNO.45) A.sub.mG.sub.mU 5GGGUGGAUAUAUACCAU |||||||||||||||| 3[ASO]-UCCACCUAUAUAUGGUC C.sub.mG.sub.mG
    wherein [ASO] includes any of the oligonucleotides of the instant invention, wherein m designates a mismatched nucleotide. In some embodiments, the GluR2 ADAR-recruiting domain has the nucleotide sequence of SEQ ID NO. 46, as shown below in the 5 to 3 direction:

    TABLE-US-00036 (SEQIDNO.46) GUGGGUGGAAUAGUAUACCAUUCGUGGUAUAGUAUCCCACCUAC

    [0144] In some embodiments, the oligonucleotide includes the structure of Formula XX, as shown below:

    TABLE-US-00037 FormulaXX, (SEQIDNO.46) A.sub.mG.sub.mU 5GUGGGUGGAUAUAUACCAU |||||||||||||||||| 3[ASO]-CAUCCACCUAUAUAUGGUC C.sub.mG.sub.mG
    wherein [ASO] includes any of the oligonucleotides of the instant invention, wherein m designates a mismatched nucleotide. In some embodiments, the GluR2 ADAR-recruiting domain has the nucleotide sequence of SEQ ID NO. 47, as shown below in the 5 to 3 direction:

    TABLE-US-00038 (SEQIDNO.47) UGGGUGGAAUAGUAUACCAUUCGUGGUAUAGUAUCCCACCUA

    [0145] In some embodiments, the oligonucleotide includes the structure of Formula XXI, as shown below:

    TABLE-US-00039 FormulaXXI, (SEQIDNO.47) A.sub.mG.sub.mU 5UGGGUGGAUAUAUACCAU ||||||||||||||||| 3[ASO]-AUCCACCUAUAUAUGGUC C.sub.mG.sub.mG
    wherein [ASO] includes any of the oligonucleotides of the instant invention, wherein m designates a mismatched nucleotide. In some embodiments, the GluR2 ADAR-recruiting domain has the nucleotide sequence of SEQ ID NO. 48, as shown below in the 5 to 3 direction:

    TABLE-US-00040 (SEQIDNO.48) GGUGGAAUAGUAUACCAUUCGUGGUAUAGUAUCCCACC

    [0146] In some embodiments, the oligonucleotide includes the structure of Formula XXII, as shown below:

    TABLE-US-00041 FormulaXXII, (SEQIDNO.48) A.sub.mG.sub.mU 5GGUGGAUAUAUACCAU ||||||||||||||| 3[ASO]-CCACCUAUAUAUGGUC C.sub.mG.sub.mU
    wherein [ASO] includes any of the oligonucleotides of the instant invention, wherein m designates a mismatched nucleotide. In some embodiments, the GluR2 ADAR-recruiting domain has the nucleotide sequence of SEQ ID NO. 49, as shown below in the 5 to 3 direction:

    TABLE-US-00042 (SEQIDNO.49) GUGGAAUAGUAUACCAUUCGUGGUAUAGUAUCCCAC

    [0147] In some embodiments, the oligonucleotide includes the structure of Formula XXIII, as shown below:

    TABLE-US-00043 FormulaXXIII, (SEQIDNO.49) A.sub.mG.sub.mU 5GUGGAUAUAUACCAU |||||||||||||| 3[ASO]-CACCUAUAUAUGGUC C.sub.mG.sub.mG
    wherein [ASO] includes any of the oligonucleotides of the instant invention, wherein m designates a mismatched nucleotide.

    [0148] In some embodiments, the ADAR-recruiting domains are Z-DNA ADAR-recruiting domains. In some embodiments, the ADAR-recruiting domains are MS2 ADAR-recruiting domains. In some embodiments, an MS2 bacteriophage stem-loop structure may be used as an ADAR-recruiting domain (e.g., and MS2 ADAR-recruiting domain). MS2 stem-loops are known to bind the MS2 bacteriophage coat protein, which when fused to the deaminase domain of ADAR (e.g. an ADAR fusion protein) can be used for target-specific deamination. In some embodiments, the MS2 ADAR-recruiting domain has the nucleotide sequence of SEQ ID NO. 50, as shown below in the 5 to 3 direction:

    TABLE-US-00044 (SEQIDNO.50) ACATGAGGATCACCCATGT

    [0149] In some embodiments, an ADAR fusion protein is administered to the cell or to the subject using an expression vector construct including a polynucleotide encoding an ADAR fusion protein. In some embodiments, the ADAR fusion protein includes a deaminase domain of ADAR fused to an MS2 bacteriophage coat protein. In some embodiments, the deaminase domain of ADAR is a deaminase domain of ADAR1. In some embodiments, the deaminase domain of ADAR is a deaminase domain of ADAR2. The ADAR fusion protein may be a fusion protein described in Katrekar et al. Nature Methods, 16(3): 239-42 (2019), the ADAR fusion protein of which is herein incorporated by reference

    [0150] The nucleic acids featured in the invention can be synthesized and/or modified by methods well established in the art, such as those described in Current protocols in nucleic acid chemistry, Beaucage, S. L. et al. (Edrs.), John Wiley & Sons, Inc., New York, N.Y., USA, which is hereby incorporated herein by reference. Alternative nucleotides and nucleosides include those with modifications including, for example, end modifications, e.g., 5-end modifications (phosphorylation, conjugation, inverted linkages) or 3-end modifications (conjugation, DNA nucleotides, inverted linkages, etc.); base modifications, e.g., replacement with stabilizing bases, destabilizing bases, or bases that base pair with an expanded repertoire of partners, removal of bases (abasic nucleotides), or conjugated bases; sugar modifications (e.g., at the 2-position or 4-position) or replacement of the sugar; and/or backbone modifications, including modification or replacement of the phosphodiester linkages. The nucleobase may also be an isonucleoside in which the nucleobase is moved from the C1 position of the sugar moiety to a different position (e.g. C2, C3, C4, or C5). Specific examples of oligonucleotide compounds useful in the embodiments described herein include, but are not limited to alternative nucleosides containing modified backbones or no natural internucleoside linkages. Nucleotides and nucleosides having modified backbones include, among others, those that do not have a phosphorus atom in the backbone. For the purposes of this specification, and as sometimes referenced in the art, alternative RNAs that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides. In some embodiments, an oligonucleotide will have a phosphorus atom in its internucleoside backbone.

    [0151] Alternative internucleoside linkages include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boronophosphates having normal 3-5 linkages, 2-5-linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3-5 to 5-3 or 2-5 to 5-2. Various salts, mixed salts, and free acid forms are also included.

    [0152] Representative U.S. patents that teach the preparation of the above phosphorus-containing linkages include, but are not limited to, U.S. Pat. Nos. 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,195; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,316; 5,550,111; 5,563,253; 5,571,799; 5,587,361; 5,625,050; 6,028,188; 6,124,445; 6,160,109; 6,169,170; 6,172,209; 6,239,265; 6,277,603; 6,326,199; 6,346,614; 6,444,423; 6,531,590; 6,534,639; 6,608,035; 6,683,167; 6,858,715; 6,867,294; 6,878,805; 7,015,315; 7,041,816; 7,273,933; 7,321,029; and U.S. Pat. RE39464, the entire contents of each of which are hereby incorporated herein by reference.

    [0153] Alternative internucleoside linkages that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatoms and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S, and CH.sub.2 component parts.

    [0154] Representative U.S. patents that teach the preparation of the above oligonucleosides include, but are not limited to, U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,64,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and, 5,677,439, the entire contents of each of which are hereby incorporated herein by reference.

    [0155] In other embodiments, suitable oligonucleotides include those in which both the sugar and the internucleoside linkage, i.e., the backbone, of the nucleotide units are replaced. The base units are maintained for hybridization with an appropriate nucleic acid target compound. One such oligomeric compound, a mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar of a nucleoside is replaced with an amide containing backbone, in particular an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. Representative U.S. patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Pat. Nos. 5,539,082; 5,714,331; and 5,719,262, the entire contents of each of which are hereby incorporated herein by reference. Additional PNA compounds suitable for use in the oligonucleotides of the invention are described in, for example, in Nielsen et al., Science, 1991, 254, 1497-1500.

    [0156] Some embodiments featured in the invention include oligonucleotides with phosphorothioate backbones and oligonucleotides with heteroatom backbones, and in particular CH.sub.2NHCH.sub.2, CH.sub.2N(CH.sub.3)OCH.sub.2-[known as a methylene (methylimino) or MMI backbone], CH.sub.2ON(CH.sub.3)CH.sub.2, CH.sub.2N(CH.sub.3)N(CH.sub.3)CH.sub.2 and N(CH.sub.3)CH.sub.2CH.sub.2-[wherein the native phosphodiester backbone is represented as OPOCH.sub.2] of the above-referenced U.S. Pat. No. 5,489,677, and the amide backbones of the above-referenced U.S. Pat. No. 5,602,240. In some embodiments, the oligonucleotides featured herein have morpholino backbone structures of the above-referenced U.S. Pat. No. 5,034,506. In other embodiments, the oligonucleotides described herein include phosphorodiamidate morpholino oligomers (PMO), in which the deoxyribose moiety is replaced by a morpholine ring, and the charged phosphodiester inter-subunit linkage is replaced by an uncharged phophorodiamidate linkage, as described in Summerton, et al., Antisense Nucleic Acid Drug Dev. 1997, 7:63-70.

    [0157] Alternative nucleosides and nucleotides can also contain one or more substituted sugar moieties. The oligonucleotides, e.g., oligonucleotides, featured herein can include one of the following at the 2-position: OH; F; O, S, or N-alkyl; O, S, or N-alkenyl; O, S or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl can be substituted or unsubstituted C.sub.1 to C.sub.10 alkyl or C.sub.2 to C.sub.10 alkenyl and alkynyl. Exemplary suitable modifications include O[(CH.sub.2).sub.nO].sub.mCH.sub.3, O(CH.sub.2).sub.nOCH.sub.3, O(CH.sub.2).sub.nNH.sub.2, O(CH.sub.2).sub.nCH.sub.3, O(CH.sub.2).sub.nONH.sub.2, and O(CH.sub.2).sub.nON[(CH.sub.2).sub.nCH.sub.3].sub.2, where n and m are from 1 to about 10. In other embodiments, oligonucleotides include one of the following at the 2 position: C.sub.1 to C.sub.10 lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH.sub.3, OCN, Cl, Br, CN, CF.sub.3, OCF.sub.3, SOCH.sub.3, SO.sub.2CH.sub.3, ONO.sub.2, NO.sub.2, N.sub.3, NH.sub.2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an oligonucleotide, and other substituents having similar properties. In some embodiments, the modification includes a 2-methoxyethoxy (2-OCH.sub.2CH.sub.2OCH.sub.3, also known as 2-O-(2-methoxyethyl) or 2-O-MOE) (Martin et al., Helv. Chin. Acta, 1995, 78:486-504) i.e., an alkoxy-alkoxy group. 2-O-MOE nucleosides confer several beneficial properties to oligonucleotides including, but not limited to, increased nuclease resistance, improved pharmacokinetics properties, reduced non-specific protein binding, reduced toxicity, reduced immunostimulatory properties, and enhanced target affinity as compared to unmodified oligonucleotides.

    [0158] Another exemplary alternative contains 2-dimethylaminooxyethoxy, i.e., a O(CH.sub.2).sub.2ON(CH.sub.3).sub.2 group, also known as 2-DMAOE, as described in examples herein below, and 2-dimethylaminoethoxyethoxy (also known in the art as 2-O-dimethylaminoethoxyethyl or 2-DMAEOE), i.e., 2-O(CH.sub.2).sub.2O(CH.sub.2).sub.2N(CH.sub.3).sub.2. Further exemplary alternatives include: 5-Me-2-F nucleotides, 5-Me-2-OMe nucleotides, 5-Me-2-deoxynucleotides, (both R and S isomers in these three families); 2-alkoxyalkyl; and 2-NMA (N-methylacetamide).

    [0159] Other alternatives include 2-methoxy (2-OCH.sub.3), 2-aminopropoxy (2-OCH.sub.2CH.sub.2CH.sub.2NH.sub.2) and 2-fluoro (2-F). Similar modifications can also be made at other positions on the nucleosides and nucleotides of an oligonucleotide, particularly the 3 position of the sugar on the 3 terminal nucleotide or in 2-5 linked oligonucleotides and the 5 position of 5 terminal nucleotide. Oligonucleotides can also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar. Representative U.S. patents that teach the preparation of such modified sugar structures include, but are not limited to, U.S. Pat. Nos. 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; and 5,700,920, certain of which are commonly owned with the instant application. The entire contents of each of the foregoing are hereby incorporated herein by reference.

    [0160] An oligonucleotide of the invention can also include nucleobase (often referred to in the art simply as base) alternatives (e.g., modifications or substitutions). Unmodified or natural nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Alternative nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine, 5-hydroxymethylcytosine, 5-formylcytosine, 5-carboxycytosine, pyrrolocytosine, dideoxycytosine, uracil, 5-methoxyuracil, 5-hydroxydeoxyuracil, dihydrouracil, 4-thiouracil, pseudouracil, 1-methyl-pseudouracil, deoxyuracil, 5-hydroxybutynl-2-deoxyuracil, xanthine, hypoxanthine, 7-deaza-xanthine, thienoguanine, 8-aza-7-deazaguanine, 7-methylguanine, 7-deazaguanine, 6-aminomethyl-7-deazaguanine, 8-aminoguanine, 2,2,7-trimethylguanine, 8-methyladenine, 8-azidoadenine, 7-methyladenine, 7-deazaadenine, 3-deazaadenine, 2,6-diaminopurine, 2-aminopurine, 7-deaza-8-aza-adenine, 8-amino-adenine, thymine, dideoxythymine, 5-nitroindole, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl anal other 8-substituted adenines and guanines, 5-halo, particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 8-azaguanine and 8-azaadenine, and 3-deazaguanine. Further nucleobases include those disclosed in U.S. Pat. No. 3,687,808, those disclosed in Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley-VCH, 2008; those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. L, ed. John Wiley & Sons, 1990, these disclosed by Englisch et al., (1991) Angewandte Chemie, International Edition, 30:613, and those disclosed by Sanghvi, Y S., Chapter 15, Antisense Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B., Ed., CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds featured in the invention. These include 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil, and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2 C. (Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., Eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are exemplary base substitutions, even more particularly when combined with 2-O-methoxyethyl sugar modifications.

    [0161] Representative U.S. patents that teach the preparation of certain of the above noted alternative nucleobases as well as other alternative nucleobases include, but are not limited to, the above noted U.S. Pat. Nos. 3,687,808, 4,845,205; 5,130,30; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594, 121, 5,596,091; 5,614,617; 5,681,941; 5,750,692; 6,015,886; 6,147,200; 6,166,197; 6,222,025; 6,235,887; 6,380,368; 6,528,640; 6,639,062; 6,617,438; 7,045,610; 7,427,672; and 7,495,088, the entire contents of each of which are hereby incorporated herein by reference.

    [0162] In other embodiments, the sugar moiety in the nucleotide may be a ribose molecule, optionally having a 2-O-methyl, 2-O-MOE, 2-F, 2-amino, 2-O-propyl, 2-aminopropyl, or 2-OH modification.

    [0163] An oligonucleotide of the invention can include one or more bicyclic sugar moieties. A bicyclic sugar is a furanosyl ring modified by the bridging of two atoms. A bicyclic nucleoside (BNA) is a nucleoside having a sugar moiety including a bridge connecting two carbon atoms of the sugar ring, thereby forming a bicyclic ring system. In certain embodiments, the bridge connects the 4-carbon and the 2-carbon of the sugar ring. Thus, in some embodiments an agent of the invention may include one or more locked nucleosides. A locked nucleoside is a nucleoside having a modified ribose moiety in which the ribose moiety includes an extra bridge connecting the 2 and 4 carbons. In other words, a locked nucleoside is a nucleoside including a bicyclic sugar moiety including a 4-CH.sub.2O-2 bridge. This structure effectively locks the ribose in the 3-endo structural conformation. The addition of locked nucleosides to oligonucleotides has been shown to increase oligonucleotide stability in serum, and to reduce off-target effects (Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193). Examples of bicyclic nucleosides for use in the polynucleotides of the invention include without limitation nucleosides including a bridge between the 4 and the 2 ribosyl ring atoms. In certain embodiments, the polynucleotide agents of the invention include one or more bicyclic nucleosides including a 4 to 2 bridge. Examples of such 4 to 2 bridged bicyclic nucleosides, include but are not limited to 4-(CH.sub.2)O-2 (LNA); 4-(CH.sub.2)S-2; 4-(CH.sub.2).sub.2O-2 (ENA); 4CH(CH.sub.3)O-2 (also referred to as constrained ethyl or cEt) and 4CH (CH.sub.2OCH.sub.3)O-2 (and analogs thereof; see, e.g., U.S. Pat. No. 7,399,845); 4-C(CH.sub.3)(CH.sub.3)O-2 (and analogs thereof; see e.g., U.S. Pat. No. 8,278,283); 4CH.sub.2-N(OCH.sub.3)-2 (and analogs thereof; see e.g., U.S. Pat. No. 8,278,425); 4-CH.sub.2ON (CH.sub.3).sub.2-2 (see, e.g., U.S. Patent Publication No. 2004/0171570); 4-CH.sub.2N(R)O2, wherein R is H, C.sub.1-C.sub.12 alkyl, or a protecting group (see, e.g., U.S. Pat. No. 7,427,672); 4-CH.sub.2C(H)(CH.sub.3)-2 (see, e.g., Chattopadhyaya et al., J. Org. Chem., 2009, 74, 118-134); and 4-CH.sub.2C(CH.sub.2)-2 (and analogs thereof; see, e.g., U.S. Pat. No. 8,278,426). The entire contents of each of the foregoing are hereby incorporated herein by reference.

    [0164] Additional representative U.S. Patents and US Patent Publications that teach the preparation of locked nucleic acid nucleotides include, but are not limited to, the following: U.S. Pat. Nos. 6,268,490; 6,525,191; 6,670,461; 6,770,748; 6,794,499; 6,998,484; 7,053,207; 7,034,133; 7,084,125; 7,399,845; 7,427,672; 7,569,686; 7,741,457; 8,022,193; 8,030,467; 8,278,425; 8,278,426; 8,278,283; US 2008/0039618; and US 2009/0012281, the entire contents of each of which are hereby incorporated herein by reference.

    [0165] Any of the foregoing bicyclic nucleosides can be prepared having one or more stereochemical sugar configurations including for example -L-ribofuranose and -D-ribofuranose (see WO 99/14226).

    [0166] An oligonucleotide of the invention can also be modified to include one or more constrained ethyl nucleotides. As used herein, a constrained ethyl nucleotide or cEt is a locked nucleic acid including a bicyclic sugar moiety including a 4-CH (CH.sub.3)O-2 bridge. In one embodiment, a constrained ethyl nucleotide is in the S conformation referred to herein as S-cEt.

    [0167] An oligonucleotide of the invention may also include one or more conformationally restricted nucleotides (CRN). CRN are nucleotide analogs with a linker connecting the C2 and C4 carbons of ribose or the C3 and C5 carbons of ribose. CRN lock the ribose ring into a stable conformation and increase the hybridization affinity to mRNA. The linker is of sufficient length to place the oxygen in an optimal position for stability and affinity resulting in less ribose ring puckering.

    [0168] Representative publications that teach the preparation of certain of the above noted CRN include, but are not limited to, US Patent Publication No. 2013/0190383; and PCT publication WO 2013/036868, the entire contents of each of which are hereby incorporated herein by reference.

    [0169] In some embodiments, an oligonucleotide of the invention includes one or more monomers that are UNA (unlocked nucleic acid) nucleotides. UNA is unlocked acyclic nucleic acid, wherein any of the bonds of the sugar has been removed, forming an unlocked sugar residue. In one example, UNA also encompasses monomer with bonds between C1-C4 have been removed (i.e. the covalent carbon-oxygen-carbon bond between the C1 and C4 carbons). In another example, the C2-C3 bond (i.e. the covalent carbon-carbon bond between the C2 and C3 carbons) of the sugar has been removed (see Nuc. Acids Symp. Series, 52, 133-134 (2008) and Fluiter et al., Mol. Biosyst., 2009, 10, 1039 hereby incorporated by reference).

    [0170] Representative U.S. publications that teach the preparation of UNA include, but are not limited to, U.S. Pat. No. 8,314,227; and US Patent Publication Nos. 2013/0096289; 2013/0011922; and 2011/0313020, the entire contents of each of which are hereby incorporated herein by reference.

    [0171] The ribose molecule may also be modified with a cyclopropane ring to produce a tricyclodeoxynucleic acid (tricyclo DNA). The ribose moiety may be substituted for another sugar such as 1,5,-anhydrohexitol, threose to produce a threose nucleoside (TNA), or arabinose to produce an arabino nucleoside. The ribose molecule can also be replaced with non-sugars such as cyclohexene to produce cyclohexene nucleoside or glycol to produce glycol nucleosides.

    [0172] The ribose molecule can also be replaced with non-sugars such as cyclohexene to produce cyclohexene nucleic acid (CeNA) or glycol to produce glycol nucleic acids (GNA). Potentially stabilizing modifications to the ends of nucleotide molecules can include N-(acetylaminocaproyl)-4-hydroxyprolinol (Hyp-C6-NHAc), N-(caproyl-4-hydroxyprolinol (Hyp-C6), N-(acetyl-4-hydroxyprolinol (Hyp-NHAc), thymidine-2-O-deoxythymidine (ether), N-(aminocaproyl)-4-hydroxyprolinol (Hyp-C6-amino), 2-docosanoyl-uridine-3-phosphate, inverted base dT (idT) and others. Disclosure of this modification can be found in PCT Publication No. WO 2011/005861.

    [0173] Other alternatives chemistries of an oligonucleotide of the invention include a 5 phosphate or 5 phosphate mimic, e.g., a 5-terminal phosphate or phosphate mimic of an oligonucleotide. Suitable phosphate mimics are disclosed in, for example US Patent Publication No. 2012/0157511, the entire contents of which are incorporated herein by reference.

    [0174] Exemplary oligonucleotides of the invention include sugar-modified nucleosides and may also include DNA or RNA nucleosides. In some embodiments, the oligonucleotide includes sugar-modified nucleosides and DNA nucleosides. Incorporation of alternative nucleosides into the oligonucleotide of the invention may enhance the affinity of the oligonucleotide for the target nucleic acid. In that case, the alternative nucleosides can be referred to as affinity enhancing alternative nucleotides.

    [0175] In some embodiments, the oligonucleotide includes at least 1 alternative nucleoside, such as at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15 or at least 16 alternative nucleosides. In other embodiments, the oligonucleotides include from 1 to 10 alternative nucleosides, such as from 2 to 9 alternative nucleosides, such as from 3 to 8 alternative nucleosides, such as from 4 to 7 alternative nucleosides, such as 6 or 7 alternative nucleosides. In an embodiment, the oligonucleotide of the invention may include alternatives, which are independently selected from these three types of alternative (alternative sugar moiety, alternative nucleobase, and alternative internucleoside linkage), or a combination thereof. Preferably the oligonucleotide includes one or more nucleosides including alternative sugar moieties, e.g., 2 sugar alternative nucleosides. In some embodiments, the oligonucleotide of the invention include the one or more 2 sugar alternative nucleoside independently selected from the group consisting of 2-O-alkyl-RNA, 2-O-methyl-RNA, 2-alkoxy-RNA, 2-O-methoxyethyl-RNA, 2-amino-DNA, 2-fluoro-DNA, ANA, 2-fluoro-ANA, and BNA (e.g., LNA) nucleosides. In some embodiments, the one or more alternative nucleoside is a BNA.

    [0176] In some embodiments, at least 1 of the alternative nucleosides is a BNA (e.g., an LNA), such as at least 2, such as at least 3, at least 4, at least 5, at least 6, at least 7, or at least 8 of the alternative nucleosides are BNAs. In a still further embodiment, all the alternative nucleosides are BNAs.

    [0177] In a further embodiment the oligonucleotide includes at least one alternative internucleoside linkage. In some embodiments, the internucleoside linkages within the contiguous nucleotide sequence are phosphorothioate or boronophosphate internucleoside linkages. In some embodiments, all the internucleotide linkages in the contiguous sequence of the oligonucleotide are phosphorothioate linkages. In some embodiments the phosphorothioate linkages are stereochemically pure phosphorothioate linkages. IN some embodiments, the phosphorothioate linkages are Sp phosphorothioate linkages. In other embodiments, the phosphorothioate linkages are Rp phosphorothioate linkages.

    [0178] In some embodiments, the oligonucleotide of the invention includes at least one alternative nucleoside which is a 2-O-MOE-RNA, such as 2, 3, 4, 5, 6, 7, 8, 9, or 10 2-O-MOE-RNA nucleoside units. In some embodiments, the 2-O-MOE-RNA nucleoside units are connected by phosphorothioate linkages. In some embodiments, at least one of said alternative nucleoside is 2-fluoro DNA, such as 2, 3, 4, 5, 6, 7, 8, 9, or 10 2-fluoro-DNA nucleoside units. In some embodiments, the oligonucleotide of the invention includes at least one BNA unit and at least one 2 substituted alternative nucleoside. In some embodiments of the invention, the oligonucleotide includes both 2 sugar modified nucleosides and DNA units. In some embodiments, the oligonucleotide of the invention or contiguous nucleotide region thereof is a gapmer oligonucleotide.

    B. Oligonucleotide Conjugated to Ligands

    [0179] Oligonucleotides of the invention may be chemically linked to one or more ligands, moieties, or conjugates that enhance the activity, cellular distribution, or cellular uptake of the oligonucleotide. Such moieties include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al., (1989) Proc. Natl. Acid. Sci. USA, 86: 6553-6556), cholic acid (Manoharan et al., (1994) Biorg. Med. Chem. Let., 4:1053-1060), a thioether, e.g., beryl-S-tritylthiol (Manoharan et al., (1992) Ann. N.Y. Acad. Sci., 660:306-309; Manoharan et al., (1993) Biorg. Med. Chem. Let., 3:2765-2770), a thiocholesterol (Oberhauser et al., (1992) Nucl. Acids Res., 20:533-538), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al., (1991) EMBO J, 10:1111-1118; Kabanov et al., (1990) FEBS Lett., 259:327-330; Svinarchuk et al., (1993) Biochimie, 75:49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-phosphonate (Manoharan et al., (1995) Tetrahedron Lett., 36:3651-3654; Shea et al., (1990) Nucl. Acids Res., 18:3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., (1995) Nucleosides & Nucleotides, 14:969-973), or adamantane acetic acid (Manoharan et al., (1995) Tetrahedron Lett., 36:3651-3654), a palmityl moiety (Mishra et al., (1995) Biochim. Biophys. Acta, 1264:229-237), or an octadecylamine or hexylamino-carbonyloxycholesterol moiety (Crooke et al., (1996) J. Pharmacol. Exp. Ther., 277:923-937).

    [0180] In one embodiment, a ligand alters the distribution, targeting, or lifetime of an oligonucleotide agent into which it is incorporated. In some embodiments, a ligand provides an enhanced affinity for a selected target, e.g., molecule, cell or cell type, compartment, e.g., a cellular or organ compartment, tissue, organ, or region of the body, as, e.g., compared to a species absent such a ligand.

    [0181] Ligands can include a naturally occurring substance, such as a protein (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), or globulin); carbohydrate (e.g., a dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, N-acetylglucosamine, N-acetylgalactosamine, or hyaluronic acid); or a lipid. The ligand can also be a recombinant or synthetic molecule, such as a synthetic polymer, e.g., a synthetic polyamino acid. Examples of polyamino acids include polyamino acid is a polylysine (PLL), poly L-aspartic acid, poly L-glutamic acid, styrene-maleic acid anhydride copolymer, poly (L-lactide-co-glycolied) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl) methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacryllic acid), N-isopropylacrylamide polymers, or polyphosphazine. Example of polyamines include: polyethylenimine, polylysine (PLL), spermine, spermidine, polyamine, pseudopeptide-polyamine, peptidomimetic polyamine, dendrimer polyamine, arginine, amidine, protamine, cationic ionizable lipid, cationic porphyrin, quaternary salt of a polyamine, or an alpha helical peptide.

    [0182] Ligands can also include targeting groups, e.g., a cell or tissue targeting agent, e.g., a lectin, glycoprotein, lipid or protein, e.g., an antibody, that binds to a specified cell type such as a kidney cell. A targeting group can be a thyrotropin, melanotropin, lectin, glycoprotein, surfactant protein A, Mucin carbohydrate, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-gulucosamine multivalent mannose, multivalent fucose, glycosylated polyaminoacids, multivalent galactose, transferrin, bisphosphonate, polyglutamate, polyaspartate, a lipid, cholesterol, a steroid, bile acid, folate, vitamin B12, vitamin A, biotin, or an RGD peptide or RGD peptide mimetic.

    [0183] Other examples of ligands include dyes, intercalating agents (e.g. acridines), cross-linkers (e.g. psoralen, mitomycin C), porphyrins (TPPC4, texaphyrin, Sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases (e.g. EDTA), lipophilic molecules, e.g., cholesterol, cholic acid, adamantane acetic acid, 1-pyrene butyric acid, dihydrotestosterone, 1,3-Bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine) and peptide conjugates (e.g., antennapedia peptide, Tat peptide), alkylating agents, phosphate, amino, mercapto, PEG (e.g., PEG-40K), MPEG, [MPEG].sub.2, polyamino, alkyl, substituted alkyl, radiolabeled markers, enzymes, haptens (e.g. biotin), transport/absorption facilitators (e.g., aspirin, vitamin E, folic acid), synthetic ribonucleases (e.g., imidazole, bisimidazole, histamine, imidazole clusters, acridine-imidazole conjugates, Eu3+ complexes of tetraazamacrocycles), dinitrophenyl, HRP, or AP.

    [0184] Ligands can be proteins, e.g., glycoproteins, or peptides, e.g., molecules having a specific affinity for a co-ligand, or antibodies e.g., an antibody, that binds to a specified cell type such as a hepatic cell. Ligands can also include hormones and hormone receptors. They can also include non-peptidic species, such as lipids, lectins, carbohydrates, vitamins, cofactors, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-gulucosamine multivalent mannose, or multivalent fucose.

    [0185] The ligand can be a substance, e.g., a drug, which can increase the uptake of the oligonucleotide agent into the cell, for example, by disrupting the cell's cytoskeleton, e.g., by disrupting the cell's microtubules, microfilaments, and/or intermediate filaments. The drug can be, for example, taxon, vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin, swinholide A, indanocine, or myoservin.

    [0186] In some embodiments, a ligand attached to an oligonucleotide as described herein acts as a pharmacokinetic modulator (PK modulator). PK modulators include lipophiles, bile acids, steroids, phospholipid analogues, peptides, protein binding agents, PEG, vitamins etc. Exemplary PK modulators include, but are not limited to, cholesterol, fatty acids, cholic acid, lithocholic acid, dialkylglycerides, diacylglyceride, phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, biotin etc. Oligonucleotides that include a number of phosphorothioate linkages are also known to bind to serum protein, thus short oligonucleotides, e.g., oligonucleotides of about 5 bases, 10 bases, 15 bases, or 20 bases, including multiple of phosphorothioate linkages in the backbone are also amenable to the present invention as ligands (e.g. as PK modulating ligands). In addition, aptamers that bind serum components (e.g. serum proteins) are also suitable for use as PK modulating ligands in the embodiments described herein.

    [0187] Ligand-conjugated oligonucleotides of the invention may be synthesized by the use of an oligonucleotide that bears a pendant reactive functionality, such as that derived from the attachment of a linking molecule onto the oligonucleotide (described below). This reactive oligonucleotide may be reacted directly with commercially-available ligands, ligands that are synthesized bearing any of a variety of protecting groups, or ligands that have a linking moiety attached thereto.

    [0188] The oligonucleotides used in the conjugates of the present invention may be conveniently and routinely made through the well-known technique of solid-phase synthesis. Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, Calif.). Any other means for such synthesis known in the art may additionally or alternatively be employed. It is also known to use similar techniques to prepare other oligonucleotides, such as the phosphorothioates and alkylated derivatives.

    [0189] In the ligand-conjugated oligonucleotides of the present invention, such as the ligand-molecule bearing sequence-specific linked nucleosides of the present invention, the oligonucleotides and oligonucleosides may be assembled on a suitable DNA synthesizer utilizing standard nucleotide or nucleoside precursors, or nucleotide or nucleoside conjugate precursors that already bear the linking moiety, ligand-nucleotide or nucleoside-conjugate precursors that already bear the ligand molecule, or non-nucleoside ligand-bearing building blocks.

    [0190] When using nucleotide-conjugate precursors that already bear a linking moiety, the synthesis of the sequence-specific linked nucleosides is typically completed, and the ligand molecule is then reacted with the linking moiety to form the ligand-conjugated oligonucleotide. In some embodiments, the oligonucleotides or linked nucleosides of the present invention are synthesized by an automated synthesizer using phosphoramidites derived from ligand-nucleoside conjugates in addition to the standard phosphoramidites and non-standard phosphoramidites that are commercially available and routinely used in oligonucleotide synthesis.

    i. Lipid Conjugates

    [0191] In one embodiment, the ligand or conjugate is a lipid or lipid-based molecule. Such a lipid or lipid-based molecule preferably binds a serum protein, e.g., human serum albumin (HSA). An HSA binding ligand allows for distribution of the conjugate to a target tissue, e.g., a non-kidney target tissue of the body. For example, the target tissue can be the liver, including parenchymal cells of the liver. Other molecules that can bind HSA can also be used as ligands. For example, neproxin or aspirin can be used. A lipid or lipid-based ligand can (a) increase resistance to degradation of the conjugate, (b) increase targeting or transport into a target cell or cell membrane, and/or (c) can be used to adjust binding to a serum protein, e.g., HSA.

    [0192] A lipid-based ligand can be used to inhibit, e.g., control the binding of the conjugate to a target tissue. For example, a lipid or lipid-based ligand that binds to HSA more strongly will be less likely to be targeted to the kidney and therefore less likely to be cleared from the body. A lipid or lipid-based ligand that binds to HSA less strongly can be used to target the conjugate to the kidney.

    [0193] In another aspect, the ligand is a moiety, e.g., a vitamin, which is taken up by a target cell, e.g., a proliferating cell. Exemplary vitamins include vitamin A, E, and K.

    ii. Cell Permeation Agents

    [0194] In another aspect, the ligand is a cell-permeation agent, preferably a helical cell-permeation agent. Preferably, the agent is amphipathic. An exemplary agent is a peptide such as tat or antennopedia. If the agent is a peptide, it can be modified, including a peptidylmimetic, invertomers, non-peptide or pseudo-peptide linkages, and use of D-amino acids. The helical agent is preferably an alpha-helical agent, which preferably has a lipophilic and a lipophobic phase.

    [0195] The ligand can be a peptide or peptidomimetic. A peptidomimetic (also referred to herein as an oligopeptidomimetic) is a molecule capable of folding into a defined three-dimensional structure similar to a natural peptide. The attachment of peptide and peptidomimetics to oligonucleotide agents can affect pharmacokinetic distribution of the oligonucleotide, such as by enhancing cellular recognition and absorption. The peptide or peptidomimetic moiety can be about 5-50 amino acids long, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids long.

    [0196] A peptide or peptidomimetic can be, for example, a cell permeation peptide, cationic peptide, amphipathic peptide, or hydrophobic peptide (e.g., consisting primarily of Tyr, Trp, or Phe). The peptide moiety can be a dendrimer peptide, constrained peptide or crosslinked peptide. In another alternative, the peptide moiety can include a hydrophobic membrane translocation sequence (MTS). An exemplary hydrophobic MTS-containing peptide is RFGF having the amino acid sequence AAVALLPAVLLALLAP (SEQ ID NO. 87). An RFGF analogue (e.g., amino acid sequence AALLPVLLAAP (SEQ ID NO. 88) containing a hydrophobic MTS can also be a targeting moiety. The peptide moiety can be a delivery peptide, which can carry large polar molecules including peptides, oligonucleotides, and protein across cell membranes. For example, sequences from the HIV Tat protein (GRKKRRQRRRPPQ; SEQ ID NO. 89) and the Drosophila Antennapedia protein (RQIKIWFQNRRMKWKK; SEQ ID NO. 90) have been found to be capable of functioning as delivery peptides. A peptide or peptidomimetic can be encoded by a random sequence of DNA, such as a peptide identified from a phage-display library, or one-bead-one-compound (OBOC) combinatorial library (Lam et al., Nature, 354:82-84, 1991). Examples of a peptide or peptidomimetic tethered to an oligonucleotide agent via an incorporated monomer unit for cell targeting purposes is an arginine-glycine-aspartic acid (RGD)-peptide, or RGD mimic. A peptide moiety can range in length from about 5 amino acids to about 40 amino acids. The peptide moieties can have a structural modification, such as to increase stability or direct conformational properties. Any of the structural modifications described below can be utilized.

    [0197] An RGD peptide for use in the compositions and methods of the invention may be linear or cyclic, and may be modified, e.g., glycosylated or methylated, to facilitate targeting to a specific tissue(s). RGD-containing peptides and peptidomimetics may include D-amino acids, as well as synthetic RGD mimics. In addition to RGD, one can use other moieties that target the integrin ligand. Some conjugates of this ligand target PECAM-1 or VEGF.

    [0198] A cell permeation peptide is capable of permeating a cell, e.g., a microbial cell, such as a bacterial or fungal cell, or a mammalian cell, such as a human cell. A microbial cell-permeating peptide can be, for example, an -helical linear peptide (e.g., LL-37 or Ceropin P1), a disulfide bond-containing peptide (e.g., -defensin, -defensin, or bactenecin), or a peptide containing only one or two dominating amino acids (e.g., PR-39 or indolicidin). A cell permeation peptide can also include a nuclear localization signal (NLS). For example, a cell permeation peptide can be a bipartite amphipathic peptide, such as MPG, which is derived from the fusion peptide domain of HIV-1 gp41 and the NLS of SV40 large T antigen (Simeoni et al., Nucl. Acids Res. 31:2717-2724, 2003).

    iii. Carbohydrate Conjugates

    [0199] In some embodiments of the compositions and methods of the invention, an oligonucleotide further includes a carbohydrate. The carbohydrate conjugated oligonucleotide is advantageous for the in vivo delivery of nucleic acids, as well as compositions suitable for in vivo therapeutic use, as described herein. As used herein, carbohydrate refers to a compound which is either a carbohydrate per se made up of one or more monosaccharide units having at least 6 carbon atoms (which can be linear, branched or cyclic) with an oxygen, nitrogen or sulfur atom bonded to each carbon atom; or a compound having as a part thereof a carbohydrate moiety made up of one or more monosaccharide units each having at least six carbon atoms (which can be linear, branched or cyclic), with an oxygen, nitrogen or sulfur atom bonded to each carbon atom. Representative carbohydrates include the sugars (mono-, di-, tri- and oligosaccharides containing from about 4, 5, 6, 7, 8, or 9 monosaccharide units), and polysaccharides such as starches, glycogen, cellulose and polysaccharide gums. Specific monosaccharides include C5 and above (e.g., C5, C6, C7, or C8) sugars; di-and trisaccharides include sugars having two or three monosaccharide units (e.g., C5, C6, C7, or C8).

    [0200] In one embodiment, a carbohydrate conjugate for use in the compositions and methods of the invention is a monosaccharide.

    [0201] In some embodiments, the carbohydrate conjugate further includes one or more additional ligands as described above, such as, but not limited to, a PK modulator and/or a cell permeation peptide.

    [0202] Additional carbohydrate conjugates (and linkers) suitable for use in the present invention include those described in PCT Publication Nos. WO 2014/179620 and WO 2014/179627, the entire contents of each of which are incorporated herein by reference.

    iv. Linkers

    [0203] In some embodiments, the conjugate or ligand described herein can be attached to an oligonucleotide with various linkers that can be cleavable or non-cleavable.

    [0204] Linkers typically include a direct bond or an atom such as oxygen or sulfur, a unit such as NR.sup.8, C(O), C(O)NH, SO, SO.sub.2, SO.sub.2NH or a chain of atoms, such as, but not limited to, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, arylalkyl, arylalkenyl, arylalkynyl, heteroarylalkyl, heteroarylalkenyl, heteroarylalkynyl, heterocyclylalkyl, heterocyclylalkenyl, heterocyclylalkynyl, aryl, heteroaryl, heterocyclyl, cycloalkyl, cycloalkenyl, alkylarylalkyl, alkylarylalkenyl, alkylarylalkynyl, alkenylarylalkyl, alkenylarylalkenyl, alkenylarylalkynyl, alkynylarylalkyl, alkynylarylalkenyl, alkynylarylalkynyl, alkylheteroarylalkyl, alkylheteroarylalkenyl, alkylheteroarylalkynyl, alkenylheteroarylalkyl, alkenylheteroarylalkenyl, alkenylheteroarylalkynyl, alkynylheteroarylalkyl, alkynylheteroarylalkenyl, alkynylheteroarylalkynyl, alkylheterocyclylalkyl, alkylheterocyclylalkenyl, alkylhererocyclylalkynyl, alkenylheterocyclylalkyl, alkenylheterocyclylalkenyl, alkenylheterocyclylalkynyl, alkynylheterocyclylalkyl, alkynylheterocyclylalkenyl, alkynylheterocyclylalkynyl, alkylaryl, alkenylaryl, alkynylaryl, alkylheteroaryl, alkenylheteroaryl, alkynylhereroaryl, which one or more methylenes can be interrupted or terminated by O, S, S(O), SO.sub.2, N(R.sup.8), C(O), substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted heterocyclic; where R.sup.8 is hydrogen, acyl, aliphatic or substituted aliphatic. In one embodiment, the linker is between about 1-24 atoms, 2-24, 3-24, 4-24, 5-24, 6-24, 6-18, 7-18, 8-18 atoms, 7-17, 8-17, 6-16, 7-17, or 8-16 atoms.

    [0205] A cleavable linking group is one which is sufficiently stable outside the cell, but which upon entry into a target cell is cleaved to release the two parts the linker is holding together. In a preferred embodiment, the cleavable linking group is cleaved at least about 10 times, 20, times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times, or more, or at least about 100 times faster in a target cell or under a first reference condition (which can, e.g., be selected to mimic or represent intracellular conditions) than in the blood of a subject, or under a second reference condition (which can, e.g., be selected to mimic or represent conditions found in the blood or serum).

    [0206] Cleavable linking groups are susceptible to cleavage agents, e.g., pH, redox potential, or the presence of degradative molecules. Generally, cleavage agents are more prevalent or found at higher levels or activities inside cells than in serum or blood. Examples of such degradative agents include: redox agents which are selective for particular substrates or which have no substrate specificity, including, e.g., oxidative or reductive enzymes or reductive agents such as mercaptans, present in cells, that can degrade a redox cleavable linking group by reduction; esterases; endosomes or agents that can create an acidic environment, e.g., those that result in a pH of five or lower; enzymes that can hydrolyze or degrade an acid cleavable linking group by acting as a general acid, peptidases (which can be substrate specific), and phosphatases.

    [0207] A cleavable linkage group, such as a disulfide bond can be susceptible to pH. The pH of human serum is 7.4, while the average intracellular pH is slightly lower, ranging from about 7.1-7.3. Endosomes have a more acidic pH, in the range of 5.5-6.0, and lysosomes have an even more acidic pH at around 5.0. Some linkers will have a cleavable linking group that is cleaved at a preferred pH, thereby releasing a cationic lipid from the ligand inside the cell, or into the desired compartment of the cell.

    [0208] A linker can include a cleavable linking group that is cleavable by a particular enzyme. The type of cleavable linking group incorporated into a linker can depend on the cell to be targeted. For example, a liver-targeting ligand can be linked to a cationic lipid through a linker that includes an ester group. Liver cells are rich in esterases, and therefore the linker will be cleaved more efficiently in liver cells than in cell types that are not esterase-rich. Other cell-types rich in esterases include cells of the lung, renal cortex, and testis.

    [0209] Linkers that contain peptide bonds can be used when targeting cell types rich in peptidases, such as liver cells and synoviocytes.

    [0210] In general, the suitability of a candidate cleavable linking group can be evaluated by testing the ability of a degradative agent (or condition) to cleave the candidate linking group. It will also be desirable to also test the candidate cleavable linking group for the ability to resist cleavage in the blood or when in contact with other non-target tissues. Thus, one can determine the relative susceptibility to cleavage between a first and a second condition, where the first is selected to be indicative of cleavage in a target cell and the second is selected to be indicative of cleavage in other tissues or biological fluids, e.g., blood or serum. The evaluations can be carried out in cell free systems, in cells, in cell culture, in organ or tissue culture, or in whole animals. It can be useful to make initial evaluations in cell-free or culture conditions and to confirm by further evaluations in whole animals. In preferred embodiments, useful candidate compounds are cleaved at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times faster in the cell (or under in vitro conditions selected to mimic intracellular conditions) as compared to blood or serum (or under in vitro conditions selected to mimic extracellular conditions).

    a. Redox Cleavable Linking Groups

    [0211] In one embodiment, a cleavable linking group is a redox cleavable linking group that is cleaved upon reduction or oxidation. An example of reductively cleavable linking group is a disulphide linking group (SS). To determine if a candidate cleavable linking group is a suitable reductively cleavable linking group, or for example is suitable for use with a particular oligonucleotide moiety and particular targeting agent one can look to methods described herein. For example, a candidate can be evaluated by incubation with dithiothreitol (DTT), or other reducing agent using reagents know in the art, which mimic the rate of cleavage which would be observed in a cell, e.g., a target cell. The candidates can also be evaluated under conditions which are selected to mimic blood or serum conditions. In one embodiment, candidate compounds are cleaved by at most about 10% in the blood. In other embodiments, useful candidate compounds are degraded at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times faster in the cell (or under in vitro conditions selected to mimic intracellular conditions) as compared to blood (or under in vitro conditions selected to mimic extracellular conditions). The rate of cleavage of candidate compounds can be determined using standard enzyme kinetics assays under conditions chosen to mimic intracellular media and compared to conditions chosen to mimic extracellular media.

    b. Phosphate-Based Cleavable Linking Groups

    [0212] In another embodiment, a cleavable linker includes a phosphate-based cleavable linking group. A phosphate-based cleavable linking group is cleaved by agents that degrade or hydrolyze the phosphate group. An example of an agent that cleaves phosphate groups in cells are enzymes such as phosphatases in cells. Examples of phosphate-based linking groups are OP(O)(OR.sup.k)O, OP(S)(OR.sup.k)O, OP(S)(SR.sup.k)O, SP(O)(OR.sup.k)O, OP(O)(OR.sup.k)S, SP(O)(OR.sup.k)S, OP(S)(OR.sup.k)S, SP(S)(OR.sup.k)O, OP(O)(R.sup.k)O, OP(S)(R.sup.k)O, SP(O)(R.sup.k)O, SP(S)(R.sup.k)O, SP(O)(R.sup.k)S, OP(S)(R.sup.k)S. These candidates can be evaluated using methods analogous to those described above.

    c. Acid Cleavable Linking Groups

    [0213] In another embodiment, a cleavable linker includes an acid cleavable linking group. An acid cleavable linking group is a linking group that is cleaved under acidic conditions. In preferred embodiments acid cleavable linking groups are cleaved in an acidic environment with a pH of about 6.5 or lower (e.g., about 6.0, 5.75, 5.5, 5.25, 5.0, or lower), or by agents such as enzymes that can act as a general acid. In a cell, specific low pH organelles, such as endosomes and lysosomes can provide a cleaving environment for acid cleavable linking groups. Examples of acid cleavable linking groups include but are not limited to hydrazones, esters, and esters of amino acids. Acid cleavable groups can have the general formula CNN, C(O)O, or OC(O). A preferred embodiment is when the carbon attached to the oxygen of the ester (the alkoxy group) is an aryl group, substituted alkyl group, or tertiary alkyl group such as dimethyl pentyl or t-butyl. These candidates can be evaluated using methods analogous to those described above.

    d. Ester-Based Linking Groups

    [0214] In another embodiment, a cleavable linker includes an ester-based cleavable linking group. An ester-based cleavable linking group is cleaved by enzymes such as esterases and amidases in cells. Examples of ester-based cleavable linking groups include but are not limited to esters of alkylene, alkenylene and alkynylene groups. Ester cleavable linking groups have the general formula C(O)O, or OC(O). These candidates can be evaluated using methods analogous to those described above.

    e. Peptide-Based Cleaving Groups

    [0215] In yet another embodiment, a cleavable linker includes a peptide-based cleavable linking group. A peptide-based cleavable linking group is cleaved by enzymes such as peptidases and proteases in cells. Peptide-based cleavable linking groups are peptide bonds formed between amino acids to yield oligopeptides (e.g., dipeptides, tripeptides etc.) and polypeptides. Peptide-based cleavable groups do not include the amide group (C(O)NH). The amide group can be formed between any alkylene, alkenylene, or alkynelene. A peptide bond is a special type of amide bond formed between amino acids to yield peptides and proteins. The peptide-based cleavage group is generally limited to the peptide bond (i.e., the amide bond) formed between amino acids yielding peptides and proteins and does not include the entire amide functional group. Peptide-based cleavable linking groups have the general formula NHCHRAC(O)NHCHRBC(O), where RA and RB are the R groups of the two adjacent amino acids. These candidates can be evaluated using methods analogous to those described above.

    [0216] In one embodiment, an oligonucleotide of the invention is conjugated to a carbohydrate through a linker. Linkers include bivalent and trivalent branched linker groups. Exemplary oligonucleotide carbohydrate conjugates with linkers of the compositions and methods of the invention include, but are not limited to, those described in formulas 24-35 of PCT Publication No. WO 2018/195165.

    [0217] Representative U.S. patents that teach the preparation of oligonucleotide conjugates include, but are not limited to, U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218, 105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5,688,941; 6,294,664; 6,320,017; 6,576,752; 6,783,931; 6,900,297; 7,037,646; 8,106,022, the entire contents of each of which are hereby incorporated herein by reference.

    [0218] In certain instances, the nucleotides of an oligonucleotide can be modified by a non-ligand group. A number of non-ligand molecules have been conjugated to oligonucleotides in order to enhance the activity, cellular distribution, or cellular uptake of the oligonucleotide, and procedures for performing such conjugations are available in the scientific literature. Such non-ligand moieties have included lipid moieties, such as cholesterol (Kubo, T. et al., Biochem. Biophys. Res. Comm, 2007, 365(1):54-61; Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86:6553), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4:1053), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660:306; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3:2765), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20:533), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10:111; Kabanov et al., FEBS Lett., 1990, 259:327; Svinarchuk et al., Biochimie, 1993, 75:49), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36:3651; Shea et al., Nucl. Acids Res., 1990, 18:3777), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36:3651), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277:923). Representative United States patents that teach the preparation of such oligonucleotide conjugates have been listed above. Typical conjugation protocols involve the synthesis of an oligonucleotide bearing an amino linker at one or more positions of the sequence. The amino group is then reacted with the molecule being conjugated using appropriate coupling or activating reagents. The conjugation reaction can be performed either with the oligonucleotide still bound to the solid support or following cleavage of the oligonucleotide, in solution phase. Purification of the oligonucleotide conjugate by HPLC typically affords the pure conjugate.

    III. Pharmaceutical Uses

    [0219] The oligonucleotides of the invention may be used to treat any disorder which may be treated through deamination of an adenosine. For example, any disorder which is caused by a guanosine to adenosine mutation, the introduction of a premature stop codon, or expression of an undesired protein. In some embodiments, the oligonucleotides of the invention, when administered to a subject, can result in correction of a guanosine to adenosine mutation. In some embodiments, the oligonucleotides of the invention can result in turning off of a premature stop codon so that a desired protein is expressed. In some embodiments, the oligonucleotides of the invention can result in inhibition of expression of an undesired protein.

    [0220] Particularly interesting target adenosines for editing using oligonucleotides according to the invention are those that are part of codons for amino acid residues that define key functions, or characteristics, such as catalytic sites, binding sites for other proteins, binding by substrates, localization domains, for co- or post-translational modification, such as glycosylation, hydroxylation, myristoylation, and protein cleavage by proteases (to mature the protein and/or as part of the intracellular routing).

    [0221] A host of genetic diseases are caused by G-to-A mutations, and these are possible diseases to be treated by oligonucleotides of the invention because adenosine deamination at the mutated target adenosine will reverse the mutation to wild-type. However, reversal to wild-type may not always be necessary to obtain a beneficial effect. Modification of an A to a G in a target may also be beneficial if the wild-type nucleotide is other than a G. In certain circumstances this may be predicted to be the case, in others this may require some testing. In certain circumstances, the modification from an A in a target RNA to a G where the wild-type is not a G may be silent (not translated into a different amino acid), or otherwise non-consequential (for example an amino acid is substituted but it constitutes a conservative substitution that does not disrupt protein structure and function), or the amino acid is part of a functional domain that has a certain robustness for change. If the A-to-G transition brought about by editing in accordance with the invention is in a non-coding RNA, or a non-coding part of an RNA, the consequence may also be inconsequential or less severe than the original mutation. Those of ordinary skill in the art will understand that the applicability of the current invention is very wide and is not even limited to preventing or treating disease. The invention may also be used to modify transcripts to study the effect thereof, even if, or particularly when, such modification induces a diseased state, for example in a cell or a non-human animal model.

    [0222] Examples of genetic diseases that can be prevented and/or treated with oligonucleotides according to the invention are any disease where the modification of one or more adenosines in a target RNA will bring about a (potentially) beneficial change.

    [0223] The invention is not limited to correcting mutations, as it may instead be useful to change a wildtype sequence into a mutated sequence by applying oligonucleotides according to the invention. One example where it may be advantageous to modify a wild-type adenosine is to bring about skipping of an exon, for example by modifying an adenosine that happens to be a branch site required for splicing of said exon. Another example is where the adenosine defines or is part of a recognition sequence for protein binding or is involved in secondary structure defining the stability of the RNA. As noted above, therefore, the invention can be used to provide research tools for diseases, to introduce new mutations which are less deleterious than an existing mutation.

    [0224] Deamination of an adenosine using the oligonucleotides disclosed herein includes any level of adenosine deamination, e.g., at least 1 deaminated adenosine within a target sequence (e.g., at least, 1, 2, 3, or more deaminated adenosines in a target sequence).

    [0225] Adenosine deamination may be assessed by a decrease in an absolute or relative level of adenosines within a target sequence compared with a control level. The control level may be any type of control level that is utilized in the art, e.g., pre-dose baseline level, or a level determined from a similar subject, cell, or sample that is untreated or treated with a control (such as, e.g., buffer only control or inactive agent control).

    [0226] Because the enzymatic activity of ADAR converts adenosines to inosines, adenosine deamination can alternatively be assessed by an increase in an absolute or relative level of inosines within a target sequence compared with a control level. Similarly, the control level may be any type of control level that is utilized in the art, e.g., pre-dose baseline level, or a level determined from a similar subject, cell, or sample that is untreated or treated with a control (such as, e.g., buffer only control or inactive agent control).

    [0227] The levels of adenosines and/or inosines within a target sequence can be assessed using any of the methods known in the art for determining the nucleotide composition of a polynucleotide sequence. For example, the relative or absolute levels of adenosines or inosines within a target sequence can be assessed using nucleic acid sequencing technologies including but not limited to Sanger sequencing methods, Next Generation Sequencing (NGS; e.g., pyrosequencing, sequencing by reversible terminator chemistry, sequencing by ligation, and real-time sequencing) such as those offered on commercially available platforms (e.g., Illumina, Qiagen, Pacific Biosciences, Thermo Fisher, Roche, and Oxford Nanopore Technologies). Clonal amplification of target sequences for NGS may be performed using real-time polymerase chain reaction (also known as qPCR) on commercially available platforms from Applied Biosystems, Roche, Stratagene, Cepheid, Eppendorf, or Bio-Rad Laboratories. Additionally or alternatively, emulsion PCR methods can be used for amplification of target sequences using commercially available platforms such as Droplet Digital PCR by Bio-Rad Laboratories.

    [0228] In certain embodiments, surrogate markers can be used to detect adenosine deamination within a target sequence. For example, effective treatment of a subject having a genetic disorder involving G-to-A mutations with an oligonucleotide of the present disclosure, as demonstrated by an acceptable diagnostic and monitoring criteria can be understood to demonstrate a clinically relevant adenosine deamination. In certain embodiments, the methods include a clinically relevant adenosine deamination, e.g., as demonstrated by a clinically relevant outcome after treatment of a subject with an oligonucleotide of the present disclosure.

    [0229] Adenosine deamination in a gene of interest may be manifested by an increase or decrease in the levels of mRNA expressed by a first cell or group of cells (such cells may be present, for example, in a sample derived from a subject) in which a gene of interest is transcribed and which has or have been treated (e.g., by contacting the cell or cells with an oligonucleotide of the present disclosure, or by administering an oligonucleotide of the invention to a subject in which the cells are or were present) such that the expression of the gene of interest is increased or decreased, as compared to a second cell or group of cells substantially identical to the first cell or group of cells but which has not or have not been so treated (control cell(s) not treated with an oligonucleotide or not treated with an oligonucleotide targeted to the gene of interest). The degree of increase or decrease in the levels of mRNA of a gene of interest may be expressed in terms of:

    [00001] ( mRNA in control cells ) - ( mRNA in treated cells ) ( mRNA in control cells ) 100 %

    [0230] In other embodiments, change in the levels of a gene may be assessed in terms of a reduction of a parameter that is functionally linked to the expression of a gene of interest, e.g., protein expression of the gene of interest or signaling downstream of the protein. A change in the levels of the gene of interest may be determined in any cell expressing the gene of interest, either endogenous or heterologous from an expression construct, and by any assay known in the art.

    [0231] A change in the level of expression of a gene of interest may be manifested by an increase or decrease in the level of the protein produced by the gene of interest that is expressed by a cell or group of cells (e.g., the level of protein expressed in a sample derived from a subject). As explained above, for the assessment of mRNA suppression, the change in the level of protein expression in a treated cell or group of cells may similarly be expressed as a percentage of the level of protein in a control cell or group of cells.

    [0232] A control cell or group of cells that may be used to assess the change in the expression of a 3 gene of interest includes a cell or group of cells that has not yet been contacted with an oligonucleotide of the present disclosure. For example, the control cell or group of cells may be derived from an individual subject (e.g., a human or animal subject) prior to treatment of the subject with an oligonucleotide.

    [0233] The level of mRNA of a gene of interest that is expressed by a cell or group of cells may be determined using any method known in the art for assessing mRNA expression. In one embodiment, the level of expression of a gene of interest in a sample is determined by detecting a transcribed polynucleotide, or portion thereof, e.g., mRNA of the gene of interest. RNA may be extracted from cells using RNA extraction techniques including, for example, using acid phenol/guanidine isothiocyanate extraction (RNAzol B; Biogenesis), RNEASY RNA preparation kits (Qiagen) or PAXgene (PreAnalytix, Switzerland). Typical assay formats utilizing ribonucleic acid hybridization include nuclear run-on assays, RT-PCR, RNase protection assays, northern blotting, in situ hybridization, and microarray analysis. Circulating mRNA of the gene of interest may be detected using methods the described in PCT Publication WO2012/177906, the entire contents of which are hereby incorporated herein by reference. In some embodiments, the level of expression of the gene of interest is determined using a nucleic acid probe. The term probe, as used herein, refers to any molecule that is capable of selectively binding to a specific sequence, e.g. to an mRNA or polypeptide. Probes can be synthesized by one of skill in the art, or derived from appropriate biological preparations. Probes may be specifically designed to be labeled. Examples of molecules that can be utilized as probes include, but are not limited to, RNA, DNA, proteins, antibodies, and organic molecules.

    [0234] Isolated mRNA can be used in hybridization or amplification assays that include, but are not limited to, Southern or northern analyses, polymerase chain reaction (PCR) analyses, and probe arrays. One method for the determination of mRNA levels involves contacting the isolated mRNA with a nucleic acid molecule (probe) that can hybridize to the mRNA of a gene of interest. In one embodiment, the mRNA is immobilized on a solid surface and contacted with a probe, for example by running the isolated mRNA on an agarose gel and transferring the mRNA from the gel to a membrane, such as nitrocellulose. In an alternative embodiment, the probe(s) are immobilized on a solid surface and the mRNA is contacted with the probe(s), for example, in an AFFYMETRIX gene chip array. A skilled artisan can readily adapt known mRNA detection methods for use in determining the level of mRNA of a gene of interest.

    [0235] An alternative method for determining the level of expression of a gene of interest in a sample involves the process of nucleic acid amplification and/or reverse transcriptase (to prepare cDNA) of for example mRNA in the sample, e.g., by RT-PCR (the experimental embodiment set forth in Mullis, 1987, U.S. Pat. No. 4,683,202), ligase chain reaction (Barany (1991) Proc. Natl. Acad. Sci. USA 88:189-193), self-sustained sequence replication (Guatelli et al. (1990) Proc. Natl. Acad. Sci. USA 87:1874-1878), transcriptional amplification system (Kwoh et al. (1989) Proc. Natl. Acad. Sci. USA 86:1173-1177), Q-Beta Replicase (Lizardi et al. (1988) Bio/Technology 6:1197), rolling circle replication (Lizardi et al., U.S. Pat. No. 5,854,033) or any other nucleic acid amplification method, followed by the detection of the amplified molecules using techniques well known to those of skill in the art. These detection schemes are especially useful for the detection of nucleic acid molecules if such molecules are present in very low numbers. In particular aspects of the invention, the level of expression of a gene of interest is determined by quantitative fluorogenic RT-PCR (i.e., the TAQMAN System) or the DUAL-GLO Luciferase assay.

    [0236] The expression levels of mRNA of a gene of interest may be monitored using a membrane blot (such as used in hybridization analysis such as northern, Southern, dot, and the like), or microwells, sample tubes, gels, beads or fibers (or any solid support including bound nucleic acids). See U.S. Pat. Nos. 5,770,722; 5,874,219; 5,744,305; 5,677,195; and 5,445,934, which are incorporated herein by reference. The determination of gene expression level may also include using nucleic acid probes in solution.

    [0237] In some embodiments, the level of mRNA expression is assessed using branched DNA (bDNA) assays or real time PCR (qPCR). The use of this PCR method is described and exemplified in the Examples presented herein. Such methods can also be used for the detection of nucleic acids of the gene of interest.

    [0238] The level of protein produced by the expression of a gene of interest may be determined using any method known in the art for the measurement of protein levels. Such methods include, for example, electrophoresis, capillary electrophoresis, high performance liquid chromatography (HPLC), thin layer chromatography (TLC), hyperdiffusion chromatography, fluid or gel precipitin reactions, absorption spectroscopy, a colorimetric assays, spectrophotometric assays, flow cytometry, immunodiffusion (single or double), immunoelectrophoresis, western blotting, radioimmunoassay (RIA), enzyme-linked immunosorbent assays (ELISAs), immunofluorescent assays, electrochemiluminescence assays, and the like. Such assays can also be used for the detection of proteins indicative of the presence or replication of proteins produced by the gene of interest. Additionally, the above assays may be used to report a change in the mRNA sequence of interest that results in the recovery or change in protein function thereby providing a therapeutic effect and benefit to the subject, treating a disorder in a subject, and/or reducing of symptoms of a disorder in the subject.

    [0239] In some embodiments of the methods of the invention, the oligonucleotide of the present disclosure is administered to a subject such that the oligonucleotide is delivered to a specific site within the subject. The change in the expression of the gene of interest may be assessed using measurements of the level or change in the level of mRNA or protein produced by the gene of interest in a sample derived from a specific site within the subject.

    [0240] In other embodiments, the oligonucleotide is administered in an amount and for a time effective to result in one of (or more, e.g., two or more, three or more, four or more of): (a) decrease the number of adenosines within a target sequence of the gene of interest, (b) delayed onset of the disorder, (c) increased survival of subject, (d) increased progression free survival of a subject, (e) recovery or change in protein function, and (f) reduction in symptoms.

    [0241] Treating disorders associated with G-to-A mutations can also result in a decrease in the mortality rate of a population of treated subjects in comparison to an untreated population. For example, the mortality rate is decreased by more than 2% (e.g., more than 5%, 10%, or 25%). A decrease in the mortality rate of a population of treated subjects may be measured by any reproducible means, for example, by calculating for a population the average number of disease-related deaths per unit time following initiation of treatment with a compound or pharmaceutically acceptable salt of a compound described herein. A decrease in the mortality rate of a population may also be measured, for example, by calculating for a population the average number of disease-related deaths per unit time following completion of a first round of treatment with a compound or pharmaceutically acceptable salt of a compound described herein.

    A. Delivery of Oligonucleotides

    [0242] The delivery of an oligonucleotide of the invention to a cell e.g., a cell within a subject, such as a human subject (e.g., a subject in need thereof, such as a subject having a disorder) can be achieved in a number of different ways. For example, delivery may be performed by contacting a cell with an oligonucleotide of the invention either in vitro or in vivo. In vivo delivery may also be performed directly by administering a composition including an oligonucleotide to a subject. Alternatively, in vivo delivery may be performed indirectly by administering one or more vectors that encode and direct the expression of the oligonucleotide. Combinations of in vitro and in vivo methods of contacting a cell are also possible. Contacting a cell may be direct or indirect, as discussed above. Furthermore, contacting a cell may be accomplished via a targeting ligand, including any ligand described herein or known in the art. In some embodiments, the targeting ligand is a carbohydrate moiety, e.g., a GalNAc.sub.3 ligand, or any other ligand that directs the oligonucleotide to a site of interest. Cells can include those of the central nervous system, or muscle cells. These alternatives are discussed further below.

    [0243] Contacting of a cell with an oligonucleotide may be done in vitro or in vivo. can be adapted for use with an oligonucleotide of the invention (see e.g., Akhtar S. and Julian R L., (1992) Trends Cell. Biol. 2(5):139-144 and WO94/02595, which are incorporated herein by reference in their entireties). For in vivo delivery, factors to consider in order to deliver an oligonucleotide molecule include, for example, biological stability of the delivered molecule, prevention of non-specific effects, and accumulation of the delivered molecule in the target tissue. The non-specific effects of an oligonucleotide can be minimized by local administration, for example, by direct injection or implantation into a tissue or topically administering the preparation. Local administration to a treatment site maximizes local concentration of the agent, limits the exposure of the agent to systemic tissues that can otherwise be harmed by the agent or that can degrade the agent, and permits a lower total dose of the oligonucleotide molecule to be administered.

    [0244] For administering an oligonucleotide systemically for the treatment of a disease, the oligonucleotide can include alternative nucleobases, alternative sugar moieties, and/or alternative internucleoside linkages, or alternatively delivered using a drug delivery system; both methods act to prevent the rapid degradation of the oligonucleotide by endo-and exo-nucleases in vivo. Modification of the oligonucleotide or the pharmaceutical carrier can also permit targeting of the oligonucleotide composition to the target tissue and avoid undesirable off-target effects. Oligonucleotide molecules can be modified by chemical conjugation to lipophilic groups such as cholesterol to enhance cellular uptake and prevent degradation. In an alternative embodiment, the oligonucleotide can be delivered using drug delivery systems such as a nanoparticle, a lipid nanoparticle, a polyplex nanoparticle, a lipoplex nanoparticle, a dendrimer, a polymer, liposomes, or a cationic delivery system. Positively charged cationic delivery systems facilitate binding of an oligonucleotide molecule (negatively charged) and also enhance interactions at the negatively charged cell membrane to permit efficient uptake of an oligonucleotide by the cell. Cationic lipids, dendrimers, or polymers can either be bound to an oligonucleotide, or induced to form a vesicle or micelle that encases an oligonucleotide. The formation of vesicles or micelles further prevents degradation of the oligonucleotide when administered systemically. In general, any methods of delivery of nucleic acids known in the art may be adaptable to the delivery of the oligonucleotides of the invention. Methods for making and administering cationic oligonucleotide complexes are well within the abilities of one skilled in the art (see e.g., Sorensen, D R., et al. (2003) J. Mol. Biol 327:761-766; Verma, U N. et al., (2003) Clin. Cancer Res. 9:1291-1300; Arnold, A S et al., (2007) J. Hypertens. 25:197-205, which are incorporated herein by reference in their entirety). Some non-limiting examples of drug delivery systems useful for systemic delivery of oligonucleotides include DOTAP (Sorensen, D R., et al (2003), supra; Verma, U N. et al., (2003), supra), Oligofectamine, solid nucleic acid lipid particles (Zimmermann, T S. et al., (2006) Nature 441:111-114), cardiolipin (Chien, P Y. et al., (2005) Cancer Gene Ther. 12:321-328; Pal, A. et al., (2005) Int J. Oncol. 26:1087-1091), polyethyleneimine (Bonnet M E. et al., (2008) Pharm. Res. August 16 Epub ahead of print; Aigner, A. (2006) J. Biomed. Biotechnol. 71659), Arg-Gly-Asp (RGD) peptides (Liu, S. (2006) Mol. Pharm. 3:472-487), and polyamidoamines (Tomalia, D A. et al., (2007) Biochem. Soc. Trans. 35:61-67; Yoo, H. et al., (1999) Pharm. Res. 16:1799-1804). In some embodiments, an oligonucleotide forms a complex with cyclodextrin for systemic administration. Methods for administration and pharmaceutical compositions of oligonucleotides and cyclodextrins can be found in U.S. Pat. No. 7,427,605, which is herein incorporated by reference in its entirety. In some embodiments the oligonucleotides of the invention are delivered by polyplex or lipoplex nanoparticles. Methods for administration and pharmaceutical compositions of oligonucleotides and polyplex nanoparticles and lipoplex nanoparticles can be found in U.S. Patent Application Nos. 2017/0121454; 2016/0369269; 2016/0279256; 2016/0251478; 2016/0230189; 2015/0335764; 2015/0307554; 2015/0174549; 2014/0342003; 2014/0135376; and 2013/0317086, which are herein incorporated by reference in their entirety.

    i. Membranous Molecular Assembly Delivery Methods

    [0245] Oligonucleotides of the invention can also be delivered using a variety of membranous molecular assembly delivery methods including polymeric, biodegradable microparticle, or microcapsule delivery devices known in the art. For example, a colloidal dispersion system may be used for targeted delivery an oligonucleotide agent described herein. Colloidal dispersion systems include macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes. Liposomes are artificial membrane vesicles that are useful as delivery vehicles in vitro and in vivo. It has been shown that large unilamellar vesicles (LUV), which range in size from 0.2-4.0 m can encapsulate a substantial percentage of an aqueous buffer containing large macromolecules. Liposomes are useful for the transfer and delivery of active ingredients to the site of action. Because the liposomal membrane is structurally similar to biological membranes, when liposomes are applied to a tissue, the liposomal bilayer fuses with bilayer of the cellular membranes. As the merging of the liposome and cell progresses, the internal aqueous contents that include the oligonucleotide are delivered into the cell where the oligonucleotide can specifically bind to a target RNA and can mediate RNase H-mediated gene silencing. In some cases, the liposomes are also specifically targeted, e.g., to direct the oligonucleotide to particular cell types. The composition of the liposome is usually a combination of phospholipids, usually in combination with steroids, especially cholesterol. Other phospholipids or other lipids may also be used. The physical characteristics of liposomes depend on pH, ionic strength, and the presence of divalent cations.

    [0246] A liposome containing an oligonucleotide can be prepared by a variety of methods. In one example, the lipid component of a liposome is dissolved in a detergent so that micelles are formed with the lipid component. For example, the lipid component can be an amphipathic cationic lipid or lipid conjugate. The detergent can have a high critical micelle concentration and may be nonionic. Exemplary detergents include cholate, CHAPS, octylglucoside, deoxycholate, and lauroyl sarcosine. The oligonucleotide preparation is then added to the micelles that include the lipid component. The cationic groups on the lipid interact with the oligonucleotide and condense around the oligonucleotide to form a liposome. After condensation, the detergent is removed, e.g., by dialysis, to yield a liposomal preparation of oligonucleotide.

    [0247] If necessary, a carrier compound that assists in condensation can be added during the condensation reaction, e.g., by controlled addition. For example, the carrier compound can be a polymer other than a nucleic acid (e.g., spermine or spermidine). The pH can also be adjusted to favor condensation.

    [0248] Methods for producing stable polynucleotide delivery vehicles, which incorporate a polynucleotide/cationic lipid complex as a structural component of the delivery vehicle, are further described in, e.g., WO 96/37194, the entire contents of which are incorporated herein by reference. Liposome formation can also include one or more aspects of exemplary methods described in Feigner, P. L. et al., (1987) Proc. Natl. Acad. Sci. USA 8:7413-7417; U.S. Pat. Nos. 4,897,355; 5,171,678; Bangham et al., (1965) M. Mol. Biol. 23:238; Olson et al., (1979) Biochim. Biophys. Acta 557:9; Szoka et al., (1978) Proc. Natl. Acad. Sci. 75: 4194; Mayhew et al., (1984) Biochim. Biophys. Acta 775:169; Kim et al., (1983) Biochim. Biophys. Acta 728:339; and Fukunaga et al., (1984) Endocrinol. 115:757. Commonly used techniques for preparing lipid aggregates of appropriate size for use as delivery vehicles include sonication and freeze-thaw plus extrusion (see, e.g., Mayer et al., (1986) Biochim. Biophys. Acta 858:161. Microfluidization can be used when consistently small (50 to 200 nm) and relatively uniform aggregates are desired (Mayhew et al., (1984) Biochim. Biophys. Acta 775:169. These methods are readily adapted to packaging oligonucleotide preparations into liposomes.

    [0249] Liposomes fall into two broad classes. Cationic liposomes are positively charged liposomes which interact with the negatively charged nucleic acid molecules to form a stable complex. The positively charged nucleic acid/liposome complex binds to the negatively charged cell surface and is internalized in an endosome. Due to the acidic pH within the endosome, the liposomes are ruptured, releasing their contents into the cell cytoplasm (Wang et al. (1987) Biochem. Biophys. Res. Commun., 147:980-985).

    [0250] Liposomes, which are pH-sensitive or negatively charged, entrap nucleic acids rather than complex with them. Since both the nucleic acid and the lipid are similarly charged, repulsion rather than complex formation occurs. Nevertheless, some nucleic acid is entrapped within the aqueous interior of these liposomes. pH sensitive liposomes have been used to deliver nucleic acids encoding the thymidine kinase gene to cell monolayers in culture. Expression of the exogenous gene was detected in the target cells (Zhou et al. (1992) Journal of Controlled Release, 19:269-274).

    [0251] One major type of liposomal composition includes phospholipids other than naturally-derived phosphatidylcholine. Neutral liposome compositions, for example, can be formed from dimyristoyl phosphatidylcholine (DMPC) or dipalmitoyl phosphatidylcholine (DPPC). Anionic liposome compositions generally are formed from dimyristoyl phosphatidylglycerol, while anionic fusogenic liposomes are formed primarily from dioleoyl phosphatidylethanolamine (DOPE). Another type of liposomal composition is formed from phosphatidylcholine (PC) such as, for example, soybean PC, and egg PC. Another type is formed from mixtures of phospholipid and/or phosphatidylcholine and/or cholesterol.

    [0252] Examples of other methods to introduce liposomes into cells in vitro and in vivo include U.S. Pat. Nos. 5,283,185; 5,171,678; WO 94/00569; WO 93/24640; WO 91/16024; Feigner, (1994) J. Biol. Chem. 269:2550; Nabel, (1993) Proc. Natl. Acad. Sci. 90:11307; Nabel, (1992) Human Gene Ther. 3:649; Gershon, (1993) Biochem. 32:7143; and Strauss, (1992) EMBO J. 11:417.

    [0253] Non-ionic liposomal systems have also been examined to determine their utility in the delivery of drugs to the skin, in particular systems including non-ionic surfactant and cholesterol. Non-ionic liposomal formulations including NOVASOME I (glyceryl dilaurate/cholesterol/polyoxyethylene-10-stearyl ether) and NOVASOME II (glyceryl distearate/cholesterol/polyoxyethylene-10-stearyl ether) were used to deliver cyclosporin-A into the dermis of mouse skin. Results indicated that such non-ionic liposomal systems were effective in facilitating the deposition of cyclosporine A into different layers of the skin (Hu et al., (1994) S.T.P.Pharma. Sci., 4 (6): 466).

    [0254] Liposomes may also be sterically stabilized liposomes, including one or more specialized lipids that result in enhanced circulation lifetimes relative to liposomes lacking such specialized lipids. Examples of sterically stabilized liposomes are those in which part of the vesicle-forming lipid portion of the liposome (A) includes one or more glycolipids, such as monosialoganglioside G.sub.M1, or (B) is derivatized with one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety. While not wishing to be bound by any particular theory, it is thought in the art that, at least for sterically stabilized liposomes containing gangliosides, sphingomyelin, or PEG-derivatized lipids, the enhanced circulation half-life of these sterically stabilized liposomes derives from a reduced uptake into cells of the reticuloendothelial system (RES) (Allen et al., (1987) FEBS Letters, 223:42; Wu et al., (1993) Cancer Research, 53:3765).

    [0255] Various liposomes including one or more glycolipids are known in the art. Papahadjopoulos et al. (Ann. N.Y. Acad. Sci., (1987), 507:64) reported the ability of monosialoganglio side G.sup.M1, galactocerebroside sulfate, and phosphatidylinositol to improve blood half-lives of liposomes. These findings were expounded upon by Gabizon et al. (Proc. Natl. Acad. Sci. U.S.A., (1988), 85:6949). U.S. Pat. No. 4,837,028 and WO 88/04924, both to Allen et al., disclose liposomes including (1) sphingomyelin and (2) the ganglioside G.sub.M1 or a galactocerebroside sulfate ester. U.S. Pat. No. 5,543,152 (Webb et al.) discloses liposomes including sphingomyelin. Liposomes including 1,2-sn-dimyristoylphosphatidylcholine are disclosed in WO 97/13499 (Lim et al).

    [0256] In one embodiment, cationic liposomes are used. Cationic liposomes possess the advantage of being able to fuse to the cell membrane. Non-cationic liposomes, although not able to fuse as efficiently with the plasma membrane, are taken up by macrophages in vivo and can be used to deliver oligonucleotides to macrophages.

    [0257] Further advantages of liposomes include: liposomes obtained from natural phospholipids are biocompatible and biodegradable; liposomes can incorporate a wide range of water and lipid soluble drugs; liposomes can protect encapsulated oligonucleotides in their internal compartments from metabolism and degradation (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, volume 1, p. 245). Important considerations in the preparation of liposome formulations are the lipid surface charge, vesicle size and the aqueous volume of the liposomes.

    [0258] A positively charged synthetic cationic lipid, N-[1-(2,3-dioleyloxy) propyl]-N,N, N-trimethylammonium chloride (DOTMA) can be used to form small liposomes that interact spontaneously with nucleic acid to form lipid-nucleic acid complexes which are capable of fusing with the negatively charged lipids of the cell membranes of tissue culture cells, resulting in delivery of oligonucleotides (see, e.g., Feigner, P. L. et al., (1987) Proc. Natl. Acad. Sci. USA 8:7413-7417, and U.S. Pat. No. 4,897,355 for a description of DOTMA and its use with DNA).

    [0259] A DOTMA analogue, 1,2-bis(oleoyloxy)-3-(trimethylammonia)propane (DOTAP) can be used in combination with a phospholipid to form DNA-complexing vesicles. LIPOFECTIN Bethesda Research Laboratories, Gaithersburg, Md.) is an effective agent for the delivery of highly anionic nucleic acids into living tissue culture cells that include positively charged DOTMA liposomes which interact spontaneously with negatively charged polynucleotides to form complexes. When enough positively charged liposomes are used, the net charge on the resulting complexes is also positive. Positively charged complexes prepared in this way spontaneously attach to negatively charged cell surfaces, fuse with the plasma membrane, and efficiently deliver functional nucleic acids into, for example, tissue culture cells. Another commercially available cationic lipid, 1,2-bis(oleoyloxy)-3,3-(trimethylammonia)propane (DOTAP) (Boehringer Mannheim, Indianapolis, Ind.) differs from DOTMA in that the oleoyl moieties are linked by ester, rather than ether linkages.

    [0260] Other reported cationic lipid compounds include those that have been conjugated to a variety of moieties including, for example, carboxyspermine which has been conjugated to one of two types of lipids and includes compounds such as 5-carboxyspermylglycine dioctaoleoylamide (DOGS) (TRANSFECTAM, Promega, Madison, Wis.) and dipalmitoylphosphatidylethanolamine 5-carboxyspermyl-amide (DPPES) (see, e.g., U.S. Pat. No. 5,171,678).

    [0261] Another cationic lipid conjugate includes derivatization of the lipid with cholesterol (DC-Chol) which has been formulated into liposomes in combination with DOPE (See, Gao, X. and Huang, L., (1991) Biochim. Biophys. Res. Commun. 179:280). Lipopolylysine, made by conjugating polylysine to DOPE, has been reported to be effective for transfection in the presence of serum (Zhou, X. et al., (1991) Biochim. Biophys. Acta 1065:8). For certain cell lines, these liposomes containing conjugated cationic lipids, are said to exhibit lower toxicity and provide more efficient transfection than the DOTMA-containing compositions. Other commercially available cationic lipid products include DMRIE and DMRIE-HP (Vical, La Jolla, Calif.) and Lipofectamine (DOSPA) (Life Technology, Inc., Gaithersburg, Md.). Other cationic lipids suitable for the delivery of oligonucleotides are described in WO 98/39359 and WO 96/37194.

    [0262] Liposomal formulations are particularly suited for topical administration, liposomes present several advantages over other formulations. Such advantages include reduced side effects related to high systemic absorption of the administered drug, increased accumulation of the administered drug at the desired target, and the ability to administer oligonucleotides into the skin. In some implementations, liposomes are used for delivering oligonucleotides to epidermal cells and also to enhance the penetration of oligonucleotides into dermal tissues, e.g., into skin. For example, the liposomes can be applied topically. Topical delivery of drugs formulated as liposomes to the skin has been documented (see, e.g., Weiner et al., (1992) Journal of Drug Targeting, vol. 2, 405-410 and du Plessis et al., (1992) Antiviral Research, 18:259-265; Mannino, R. J. and Fould-Fogerite, S., (1998) Biotechniques 6:682-690; Itani, T. et al., (1987) Gene 56:267-276; Nicolau, C. et al. (1987) Meth. Enzymol. 149:157-176; Straubinger, R. M. and Papahadjopoulos, D. (1983) Meth. Enzymol. 101:512-527; Wang, C. Y. and Huang, L., (1987) Proc. Natl. Acad. Sci. USA 84:7851-7855).

    [0263] Non-ionic liposomal systems have also been examined to determine their utility in the delivery of drugs to the skin, in particular systems including non-ionic surfactant and cholesterol. Non-ionic liposomal formulations including Novasome I (glyceryl dilaurate/cholesterol/polyoxyethylene-10-stearyl ether) and Novasome II (glyceryl distearate/cholesterol/polyoxyethylene-10-stearyl ether) were used to deliver a drug into the dermis of mouse skin. Such formulations with oligonucleotide are useful for treating a dermatological disorder.

    [0264] The targeting of liposomes is also possible based on, for example, organ-specificity, cell-specificity, and organelle-specificity and is known in the art. In the case of a liposomal targeted delivery system, lipid groups can be incorporated into the lipid bilayer of the liposome in order to maintain the targeting ligand in stable association with the liposomal bilayer. Various linking groups can be used for joining the lipid chains to the targeting ligand. Additional methods are known in the art and are described, for example in U.S. Patent Application Publication No. 20060058255, the linking groups of which are herein incorporated by reference.

    [0265] Liposomes that include oligonucleotides can be made highly deformable. Such deformability can enable the liposomes to penetrate through pore that are smaller than the average radius of the liposome. For example, transfersomes are yet another type of liposomes, and are highly deformable lipid aggregates which are attractive candidates for drug delivery vehicles. Transfersomes can be described as lipid droplets which are so highly deformable that they are easily able to penetrate through pores which are smaller than the droplet. Transfersomes can be made by adding surface edge activators, usually surfactants, to a standard liposomal composition. Transfersomes that include oligonucleotides can be delivered, for example, subcutaneously by infection in order to deliver oligonucleotides to keratinocytes in the skin. In order to cross intact mammalian skin, lipid vesicles must pass through a series of fine pores, each with a diameter less than 50 nm, under the influence of a suitable transdermal gradient. In addition, due to the lipid properties, these transfersomes can be self-optimizing (adaptive to the shape of pores, e.g., in the skin), self-repairing, and can frequently reach their targets without fragmenting, and often self-loading. Transfersomes have been used to deliver serum albumin to the skin. The transfersome-mediated delivery of serum albumin has been shown to be as effective as subcutaneous injection of a solution containing serum albumin.

    [0266] Other formulations amenable to the present invention are described in U.S. provisional application Ser. No. 61/018,616, filed Jan. 2, 2008; 61/018,611, filed Jan. 2, 2008; 61/039,748, filed Mar. 26, 2008; 61/047,087, filed Apr. 22, 2008 and 61/051,528, filed May 8, 2008. PCT application No. PCT/US2007/080331, filed Oct. 3, 2007 also describes formulations that are amenable to the present invention.

    [0267] Surfactants find wide application in formulations such as emulsions (including microemulsions) and liposomes. The most common way of classifying and ranking the properties of the many different types of surfactants, both natural and synthetic, is by the use of the hydrophile/lipophile balance (HLB). The nature of the hydrophilic group (also known as the head) provides the most useful means for categorizing the different surfactants used in formulations (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, N.Y., 1988, p. 285).

    [0268] If the surfactant molecule is not ionized, it is classified as a nonionic surfactant. Nonionic surfactants find wide application in pharmaceutical and cosmetic products and are usable over a wide range of pH values. In general, their HLB values range from 2 to about 18 depending on their structure. Nonionic surfactants include nonionic esters such as ethylene glycol esters, propylene glycol esters, glyceryl esters, polyglyceryl esters, sorbitan esters, sucrose esters, and ethoxylated esters. Nonionic alkanolamides and ethers such as fatty alcohol ethoxylates, propoxylated alcohols, and ethoxylated/propoxylated block polymers are also included in this class. The polyoxyethylene surfactants are the most popular members of the nonionic surfactant class.

    [0269] If the surfactant molecule carries a negative charge when it is dissolved or dispersed in water, the surfactant is classified as anionic. Anionic surfactants include carboxylates such as soaps, acyl lactylates, acyl amides of amino acids, esters of sulfuric acid such as alkyl sulfates and ethoxylated alkyl sulfates, sulfonates such as alkyl benzene sulfonates, acyl isethionates, acyl taurates and sulfosuccinates, and phosphates. The most important members of the anionic surfactant class are the alkyl sulfates and the soaps.

    [0270] If the surfactant molecule carries a positive charge when it is dissolved or dispersed in water, the surfactant is classified as cationic. Cationic surfactants include quaternary ammonium salts and ethoxylated amines. The quaternary ammonium salts are the most used members of this class.

    [0271] If the surfactant molecule has the ability to carry either a positive or negative charge, the surfactant is classified as amphoteric. Amphoteric surfactants include acrylic acid derivatives, substituted alkylamides, N-alkylbetaines, and phosphatides.

    [0272] The use of surfactants in drug products, formulations and in emulsions has been reviewed (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, N.Y., 1988, p. 285).

    [0273] The oligonucleotide for use in the methods of the invention can also be provided as micellar formulations. Micelles are a particular type of molecular assembly in which amphipathic molecules are arranged in a spherical structure such that all the hydrophobic portions of the molecules are directed inward, leaving the hydrophilic portions in contact with the surrounding aqueous phase. The converse arrangement exists if the environment is hydrophobic.

    ii. Lipid Nanoparticle-Based Delivery Methods

    [0274] Oligonucleotides of in the invention may be fully encapsulated in a lipid formulation, e.g., a lipid nanoparticle (LNP), or other nucleic acid-lipid particle. LNPs are extremely useful for systemic applications, as they exhibit extended circulation lifetimes following intravenous (i.v.) injection and accumulate at distal sites (e.g., sites physically separated from the administration site). LNPs include pSPLP, which include an encapsulated condensing agent-nucleic acid complex as set forth in PCT Publication No. WO 00/03683. The particles of the present invention typically have a mean diameter of about 50 nm to about 150 nm, more typically about 60 nm to about 130 nm, more typically about 70 nm to about 110 nm, most typically about 70 nm to about 90 nm, and are substantially nontoxic. In addition, the nucleic acids when present in the nucleic acid-lipid particles of the present invention are resistant in aqueous solution to degradation with a nuclease. Nucleic acid-lipid particles and their method of preparation are disclosed in, e.g., U.S. Pat. Nos. 5,976,567; 5,981,501; 6,534,484; 6,586,410; 6,815,432; U.S. Publication No. 2010/0324120 and PCT Publication No. WO 96/40964.

    [0275] In one embodiment, the lipid to drug ratio (mass/mass ratio) (e.g., lipid to oligonucleotide ratio) will be in the range of from about 1:1 to about 50:1, from about 1:1 to about 25:1, from about 3:1 to about 15:1, from about 4:1 to about 10:1, from about 5:1 to about 9:1, or about 6:1 to about 9:1. Ranges intermediate to the above recited ranges are also contemplated to be part of the invention.

    [0276] Non-limiting examples of cationic lipid include N,N-dioleyl-N,N-dimethylammonium chloride (DODAC), N,N-distearyl-N,N-dimethylammonium bromide (DDAB), N-(I-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTAP), N-(I-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTMA), N,N-dimethyl-2,3-dioleyloxy)propylamine (DODMA), 1,2-DiLinoleyloxy-N,N-dimethylaminopropane (DLinDMA), 1,2-Dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA), 1,2-Dilinoleylcarbamoyloxy-3-dimethylaminopropane (DLin-C-DAP), 1,2-Dilinoleyoxy-3-(dimethylamino)acetoxypropane (DLin-DAC), 1,2-Dilinoleyoxy-3-morpholinopropane (DLin-MA), 1,2-Dilinoleoyl-3-dimethylaminopropane (DLinDAP), 1,2-Dilinoleylthio-3-dimethylaminopropane (DLin-S-DMA), 1-Linoleoyl-2-linoleyloxy-3-dimethylaminopropane (DLin-2-DMAP), 1,2-Dilinoleyloxy-3-trimethylaminopropane chloride salt (DLin-TMA.CI), 1,2-Dilinoleoyl-3-trimethylaminopropane chloride salt (DLin-TAP.Math.Cl), 1,2-Dilinoleyloxy-3-(N-methylpiperazino)propane (DLin-MPZ), or 3-(N,N-Dilinoleylamino)-1,2-propanediol (DLinAP), 3-(N,N-Dioleylamino)-1,2-propanedio (DOAP), 1,2-Dilinoleyloxo-3-(2-N,N-dimethylamino)ethoxypropane (DLin-EG-DMA), 1,2-Dilinolenyloxy-N,N-dimethylaminopropane (DLinDMA), 2,2-Dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA) or analogs thereof, (3aR,5s,6aS)-N,N-dimethyl-2,2-di((9Z,12Z)-octadeca-9,12-dienyetetrahydro- 3aH-cyclopenta[d][1,3]dioxol-5-amine (ALN100), (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl4-(dimethylamino)bu-tanoate (MC3), 1,1-(2-(4-(2- ((2-(bis(2-hydroxydodecyl)amino)ethyl)(2-hydroxydodecyl)ami-no)ethyl)piperazin-1-yeethylazanediyedidodecan-2-ol (Tech G1), or a mixture thereof. The cationic lipid can include, for example, from about 20 mol % to about 50 mol % or about 40 mol % of the total lipid present in the particle.

    [0277] The ionizable/non-cationic lipid can be an anionic lipid or a neutral lipid including, but not limited to, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoylphosphatidylethanolamine (POPE), dioleoyl-phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoyl phosphatidyl ethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidyl-ethanolamine (DSPE), 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, 1-stearoyl-2-oleoyl-phosphatidyethanolamine (SOPE), cholesterol, or a mixture thereof. The non-cationic lipid can be, for example, from about 5 mol % to about 90 mol %, about 10 mol %, or about 58 mol % if cholesterol is included, of the total lipid present in the particle.

    [0278] The conjugated lipid that inhibits aggregation of particles can be, for example, a polyethyleneglycol (PEG)-lipid including, without limitation, a PEG-diacylglycerol (DAG), a PEG-dialkyloxypropyl (DAA), a PEG-phospholipid, a PEG-ceramide (Cer), or a mixture thereof. The PEG-DAA conjugate can be, for example, a PEG-dilauryloxypropyl (Ci.sub.2), a PEG-dimyristyloxypropyl (Ci.sub.4), a PEG-dipalmityloxypropyl (Ci.sub.6), or a PEG-distearyloxypropyl (C].sub.8). The conjugated lipid that prevents aggregation of particles can be, for example, from 0 mol % to about 20 mol % or about 2 mol % of the total lipid present in the particle.

    [0279] In some embodiments, the nucleic acid-lipid particle further includes cholesterol at, e.g., about 10 mol % to about 60 mol % or about 50 mol % of the total lipid present in the particle.

    B. Combination Therapies

    [0280] A method of the invention can be used alone or in combination with an additional therapeutic agent, e.g., other agents that treat the same disorder or symptoms associated therewith, or in combination with other types of therapies to the disorder. In combination treatments, the dosages of one or more of the therapeutic compounds may be reduced from standard dosages when administered alone. For example, doses may be determined empirically from drug combinations and permutations or may be deduced by isobolographic analysis (e.g., Black et al., Neurology 65:S3-S6 (2005)). In this case, dosages of the compounds when combined should provide a therapeutic effect.

    [0281] In some embodiments, the second therapeutic agent is a chemotherapeutic agent (e.g., a cytotoxic agent or other chemical compound useful in the treatment of a disorder).

    [0282] The second agent may be a therapeutic agent which is a non-drug treatment. For example, the second therapeutic agent is physical therapy.

    [0283] In any of the combination embodiments described herein, the first and second therapeutic agents are administered simultaneously or sequentially, in either order. The first therapeutic agent may be administered immediately, up to 1 hour, up to 2 hours, up to 3 hours, up to 4 hours, up to 5 hours, up to 6 hours, up to 7 hours, up to, 8 hours, up to 9 hours, up to 10 hours, up to 11 hours, up to 12 hours, up to 13 hours, 14 hours, up to hours 16, up to 17 hours, up 18 hours, up to 19 hours up to 20 hours, up to 21 hours, up to 22 hours, up to 23 hours up to 24 hours or up to 1-7, 1-14, 1-21 or 1-30 days before or after the second therapeutic agent.

    IV. Pharmaceutical Compositions

    [0284] The oligonucleotides described herein are preferably formulated into pharmaceutical compositions for administration to human subjects in a biologically compatible form suitable for administration in vivo.

    [0285] The compounds described herein may be used in the form of the free base, in the form of salts, solvates, and as prodrugs. All forms are within the methods described herein. In accordance with the methods of the invention, the described compounds or salts, solvates, or prodrugs thereof may be administered to a patient in a variety of forms depending on the selected route of administration, as will be understood by those skilled in the art. The compounds described herein may be administered, for example, by oral, parenteral, intrathecal, intracerebroventricular, intraparenchymal, buccal, sublingual, nasal, rectal, patch, pump, intratumoral, or transdermal administration and the pharmaceutical compositions formulated accordingly. Parenteral administration includes intravenous, intraperitoneal, subcutaneous, intramuscular, transepithelial, nasal, intrapulmonary, intrathecal, intracerebroventricular, intraparenchymal, rectal, and topical modes of administration. Parenteral administration may be by continuous infusion over a selected period of time.

    [0286] A compound described herein may be orally administered, for example, with an inert diluent or with an assimilable edible carrier, or it may be enclosed in hard or soft shell gelatin capsules, or it may be compressed into tablets, or it may be incorporated directly with the food of the diet. For oral therapeutic administration, a compound described herein may be incorporated with an excipient and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, and wafers. A compound described herein may also be administered parenterally. Solutions of a compound described herein can be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, DMSO, and mixtures thereof with or without alcohol, and in oils. Under ordinary conditions of storage and use, these preparations may contain a preservative to prevent the growth of microorganisms. Conventional procedures and ingredients for the selection and preparation of suitable formulations are described, for example, in Remington's Pharmaceutical Sciences (2012, 22nd ed.) and in The United States Pharmacopeia: The National Formulary (USP 41 NF 36), published in 2018. The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases the form must be sterile and must be fluid to the extent that may be easily administered via syringe. Compositions for nasal administration may conveniently be formulated as aerosols, drops, gels, and powders. Aerosol formulations typically include a solution or fine suspension of the active substance in a physiologically acceptable aqueous or non-aqueous solvent and are usually presented in single or multidose quantities in sterile form in a sealed container, which can take the form of a cartridge or refill for use with an atomizing device. Alternatively, the sealed container may be a unitary dispensing device, such as a single dose nasal inhaler or an aerosol dispenser fitted with a metering valve which is intended for disposal after use. Where the dosage form includes an aerosol dispenser, it will contain a propellant, which can be a compressed gas, such as compressed air or an organic propellant, such as fluorochlorohydrocarbon. The aerosol dosage forms can also take the form of a pump-atomizer. Compositions suitable for buccal or sublingual administration include tablets, lozenges, and pastilles, where the active ingredient is formulated with a carrier, such as sugar, acacia, tragacanth, gelatin, and glycerine. Compositions for rectal administration are conveniently in the form of suppositories containing a conventional suppository base, such as cocoa butter. A compound described herein may be administered intratumorally, for example, as an intratumoral injection. Intratumoral injection is injection directly into the tumor vasculature and is specifically contemplated for discrete, solid, accessible tumors. Local, regional, or systemic administration also may be appropriate. A compound described herein may advantageously be contacted by administering an injection or multiple injections to the tumor, spaced for example, at approximately, 1 cm intervals. In the case of surgical intervention, the present invention may be used preoperatively, such as to render an inoperable tumor subject to resection. Continuous administration also may be applied where appropriate, for example, by implanting a catheter into a tumor or into tumor vasculature.

    [0287] The compounds described herein may be administered to an animal, e.g., a human, alone or in combination with pharmaceutically acceptable carriers, as noted herein, the proportion of which is determined by the solubility and chemical nature of the compound, chosen route of administration, and standard pharmaceutical practice.

    V. Dosages

    [0288] The dosage of the compositions (e.g., a composition including an oligonucleotide) described herein, can vary depending on many factors, such as the pharmacodynamic properties of the compound; the mode of administration; the age, health, and weight of the recipient; the nature and extent of the symptoms; the frequency of the treatment, and the type of concurrent treatment, if any; and the clearance rate of the compound in the animal to be treated. One of skill in the art can determine the appropriate dosage based on the above factors. The compositions described herein may be administered initially in a suitable dosage that may be adjusted as required, depending on the clinical response. In some embodiments, the dosage of a composition (e.g., a composition including an oligonucleotide) is a prophylactically or a therapeutically effective amount.

    VI. Kits

    [0289] The invention also features kits including (a) a pharmaceutical composition including an oligonucleotide agent that results in deamination of an adenosine in an mRNA in a cell or subject described herein, and (b) a package insert with instructions to perform any of the methods described herein. In some embodiments, the kit includes (a) a pharmaceutical composition including an oligonucleotide agent that results in deamination of an adenosine in an mRNA in a cell or subject described herein, (b) an additional therapeutic agent, and (c) a package insert with instructions to perform any of the methods described herein.

    EXAMPLES

    General Methods

    [0290] All guide oligonucleotides were chemically synthesized on an automated RNA/DNA synthesizer using standard -cyanoethylphosphoramidite chemistry and a universal solid support such as controlled pore glass (CPG). Phosphoramidites of arabinosides, 2-deoxy-2-fluoro-arabinosides (FANA), 2-O-methyl-arabinosides, -2-deoxycytidine, DNA-abasic, RNA-abasic, and 2-O-methyl-abasic were purchased from ChemGenes Corp. (Wilmington, MA). Other 5-O-DMT-3-phosphoramidites of RNA, 2-O-methyl-RNA and DNA monomers, i.e., A, C, G, U, and T, were purchased from commercial sources. All oligonucleotides were synthesized by BioSpring GmbH (Frankfurt, Germany) at a 200 nmol scale. After synthesis, oligonucleotides were cleaved from the solid support, deprotected, and purified by a HPLC system using standard protocols. Oligonucleotides were desalted, dialyzed, and lyophilized. The purity of each lyophilized oligo was 95% as determined by analytical reversed-phase HPLC. The sequence integrity of the oligonucleotides was determined by ESI-MS.

    [0291] Human ADAR2 sequence (NM_001112.4) was cloned into pcDNA3.1 plasmid under the control of the CMV promoter using BamHI and XbaI restriction sites (Quintara Bio, Berkeley, CA) and the correct insert was sequence verified. This plasmid henceforth will be denoted as ADAR2/pcDNA3.1. For editing experiments, 2 g of ADAR2/pcDNA3.1 plasmid were transfected into 510.sup.6 HEK293T cells (ATCC) using 25 L of Lipofectamine 3000 and 24 L of P3000 (Life Technologies) per 10 cm dish. After 4 hours, the culture media was replenished with fresh warmed media (DMEM High Glucose; Life Technologies). 12-16 hours after transfection, the transfected HEK293T cells were transfected with guide oligonucleotides such that the final concentration in the each well was 100 nM. All transfections were carried out with Lipofectamine 3000 (0.4 L/per well) in a 96-well format according to manufacturer's instructions. 12-16 hours after the second transfection, the cells were washed once with ice cold PBS and total mRNA isolation was performed using Dyna Beads mRNA Direct Kit (Life Technologies) adapted for KingFisher Flex Purification (Life Technologies) according to manufacturer's instructions. The samples were treated with TURBO DNase (Life Technologies) prior to elution. The resultant isolated mRNA was used for cDNA synthesis using SuperScript IV Vilo according to the manufacturer's instructions (Life Technologies). One l of the cDNA was used as template for PCR (Platinum II Hot-Start PCR Master Mix; Life Technologies) using gene specific primers to generate an amplicon for Sanger sequencing (Table 5). Sanger sequencing was performed by Quintara Biosciences (Berkeley, CA). Adenosine to guanosine editing yields were quantified by measuring the peak height of adenosine and guanosine and dividing the guanosine peak height by the total peak height measurements of adenosine and guanosine combined.

    TABLE-US-00045 TABLE5 PrimersUsedforRT-PCR Name Sequence(5to3) SEQIDNO. RAB7Asite ACAGTATCCATTTATTATGTAA 91 1Forward TGCTTCTTAG RAB7Asite TGAAAGGAGCGCCTTCTAGAAC 92 1Reverse

    Example 1: Design of Guide Oligonucleotides With Novel Nucleotide Modifications Targeting Human RAB7A 3-UTR Target (UAG)

    Guide Oligonucleotide Targeting Human RAB7A (3-UTR):

    TABLE-US-00046 (SEQIDNO:93 5CAGAGUGUUACUCAGAAUUGGGAAAUCCAGCUAGCGGCAGUAUUCUGU ACAGUAGACACAAGAAUUAUGUACGCCUUUUAUCAAAGAC-3 (SEQIDNO:94) 3-CCCUUUAGGUCGACCGCCGUCAUAAGACAUGUCAUCUGGGUUCUUAA UAC-5

    [0292] Shown in Table 6 below are exemplary modified guide oligonucleotides targeting human RAB7A with UAG triplet. In Table 6, A, C, G and U are ribonucleosides; underlined and bolded is the central triplet; mA, mC, mG and mU are 2-O-methyl ribonucleosides; fC represents 2-deoxy'-2-fluoro-arabinocytidine (Formula I: R.sup.1=fluoro and N.sup.1=cytosine); fA represents 2-deoxy-2-fluoro-arabinoadenosine (Formula I: R.sup.1=fluoro and N.sup.1=adenine); aC represents arabinocytidine (Formula I: R.sup.1=hydroxy and N.sup.1=cytosine); aA represents arabinoadenosine (Formula I: R.sup.1=hydroxy and N.sup.1=adenine); amC represents 2-O-methyl-arabinocytidine (Formula I: R.sup.1=methoxy and N.sup.1=cytosine); amA represents 2-O-methyl-arabinoadenosine (Formula I: R.sup.1=methoxy and N.sup.1=adenine); C represents -2-deoxycytidine (Formula II: R.sup.2=hydrogen and N.sup.1=cytosine); dS represents 2-deoxyribose (abasic DNA; Formula V: R.sup.4=hydrogen and R.sup.5=hydrogen); rS represents ribose (abasic RNA; Formula V: R.sup.4=hydrogen and R.sup.5=hydroxy); mS represents 2-O-methyl-ribose (abasic 2-OMe-RNA; Formula V: R.sup.4=hydrogen and R.sup.5=methoxy); and asterisks indicate phosphorothioate linkages (the remaining linkages are phosphodiester linkages).

    TABLE-US-00047 TABLE6 GuideOligonucleotidesTargetingHumanRAB7A3-UTRTarget(UAG) SEQ ID Editing NO. (%) SD Sequencewith20%2-O-MethylModifications(5to3) 51 5-mC*mA*mU*mA*mAUUCUUGUGUCUACUGUACAGAAUACUGCCGCCAGCUGGAUmU*mU*mC*mC*mC-3 22.35 7.42 52 5-mC*mA*mU*mA*mAUUCUUGUGUCUACUGUACAGAAUACUGCCGfCCAGCUGGAUmU*mU*mC*mC*mC-3 17.34 1.00 53 5-mC*mA*mU*mA*mAUUCUUGUGUCUACUGUACAGAAUACUGCCGCfCAGCUGGAUmU*mU*mC*mC*mC-3 14.06 2.35 54 5-mC*mA*mU*mA*mAUUCUUGUGUCUACUGUACAGAAUACUGCCGCCfAGCUGGAUmU*mU*mC*mC*mC-3 16.87 2.00 55 5-mC*mA*mU*mA*mAUUCUUGUGUCUACUGUACAGAAUACUGCCGCfCfAGCUGGAUmU*mU*mC*mC*mC-3 12.84 1.87 56 5-mC*mA*mU*mA*mAUUCUUGUGUCUACUGUACAGAAUACUGCCGfCfCAGCUGGAUmU*mU*mC*mC*mC-3 16.10 2.72 57 5-mC*mA*mU*mA*mAUUCUUGUGUCUACUGUACAGAAUACUGCCGfCfCfAGCUGGAUmU*mU*mC*mC*mC-3 13.97 1.64 58 5-mC*mA*mU*mA*mAUUCUUGUGUCUACUGUACAGAAUACUGCCGaCCAGCUGGAUmU*mU*mC*mC*mC-3 17.08 3.85 59 5-mC*mA*mU*mA*mAUUCUUGUGUCUACUGUACAGAAUACUGCCGCaCAGCUGGAUmU*mU*mC*mC*mC-3 19.33 2.32 60 5-mC*mA*mU*mA*mAUUCUUGUGUCUACUGUACAGAAUACUGCCGCCaAGCUGGAUmU*mU*mC*mC*mC-3 14.57 2.46 61 5-mC*mA*mU*mA*mAUUCUUGUGUCUACUGUACAGAAUACUGCCGaCaCaAGCUGGAUmU*mU*mC*mC*mC-3 10.55 2.09 62 5-mC*mA*mU*mA*mAUUCUUGUGUCUACUGUACAGAAUACUGCCGamCCAGCUGGAUmU*mU*mC*mC*mC-3 22.71 3.27 63 5-mC*mA*mU*mA*mAUUCUUGUGUCUACUGUACAGAAUACUGCCGCamCAGCUGGAUmU*mU*mC*mC*mC-3 19.24 3.38 64 5-mC*mA*mU*mA*mAUUCUUGUGUCUACUGUACAGAAUACUGCCGCCamAGCUGGAUmU*mU*mC*mC*mC-3 20.28 3.87 65 5-mC*mA*mU*mA*mAUUCUUGUGUCUACUGUACAGAAUACUGCCGCCAGCUGGAUmU*mU*mC*mC*mC-3 2.66 0.84 66 5-mC*mA*mU*mA*mAUUCUUGUGUCUACUGUACAGAAUACUGCCGCdSAGCUGGAUmU*mU*mC*mC*mC-3 13.50 1.91 67 5-mC*mA*mU*mA*mAUUCUUGUGUCUACUGUACAGAAUACUGCCGCrSAGCUGGAUmU*mU*mC*mC*mC-3 5.81 1.12 68 5-mC*mA*mU*mA*mAUUCUUGUGUCUACUGUACAGAAUACUGCCGCmSAGCUGGAUmU*mU*mC*mC*mC-3 3.85 0.98 Sequencewith50%2-O-MethylModifications(5to3) 69 5-mC*mA*mU*mA*mAUUCmUmUGUGmUmCUACmUmGUACmAmGA 17.17 5.26 AUmAmCUGCmCmGCCAmGmCUGmGmAUmU*mU*mC*mC*mC-3 70 5-mC*mA*mU*mA*mAUUCmUmUGUGmUmCUACmUmGUACmAmGA 17.41 2.86 AUmAmCUGCmCmGfCCAmGmCUGmGmAUmU*mU*mC*mC*mC-3 71 5-mC*mA*mU*mA*mAUUCmUmUGUGmUmCUACmUmGUACmAmGA 12.27 1.79 AUmAmCUGCmCmGCfCAmGmCUGmGmAUmU*mU*mC*mC*mC-3 72 5-mC*mA*mU*mA*mAUUCmUmUGUGmUmCUACmUmGUACmAmGA 13.83 3.18 AUmAmCUGCmCmGCCfAmGmCUGmGmAUmU*mU*mC*mC*mC-3 73 5-mC*mA*mU*mA*mAUUCmUmUGUGmUmCUACmUmGUACmAmGA 13.24 6.58 AUmAmCUGCmCmGCfCfAmGmCUGmGmAUmU*mU*mC*mC*mC-3 74 5-mC*mA*mU*mA*mAUUCmUmUGUGmUmCUACmUmGUACmAmGA 17.08 4.78 AUmAmCUGCmCmGfCfCAmGmCUGmGmAUmU*mU*mC*mC*mC-3 75 5-mC*mA*mU*mA*mAUUCmUmUGUGmUmCUACmUmGUACmAmGA 13.93 3.60 AUmAmCUGCmCmGfCfCfAmGmCUGmGmAUmU*mU*mC*mC*mC-3 76 5-mC*mA*mU*mA*mAUUCmUmUGUGmUmCUACmUmGUACmAmGA 16.04 3.61 AUmAmCUGCmCmGaCCAmGmCUGmGmAUmU*mU*mC*mC*mC-3 77 5-mC*mA*mU*mA*mAUUCmUmUGUGmUmCUACmUmGUACmAmGA 18.89 1.27 AUmAmCUGCmCmGCaCAmGmCUGmGmAUmU*mU*mC*mC*mC-3 78 5-mC*mA*mU*mA*mAUUCmUmUGUGmUmCUACmUmGUACmAmG 16.30 3.40 AAUmAmCUGCmCmGCCaAmGmCUGmGmAUmU*mU*mC*mC*mC-3 79 5-mC*mA*mU*mA*mAUUCmUmUGUGmUmCUACmUmGUACmAmGA 11.30 3.38 AUmAmCUGCmCmGaCaCaAmGmCUGmGmAUmU*mU*mC*mC*mC-3 80 5-mC*mA*mU*mA*mAUUCmUmUGUGmUmCUACmUmGUACmAmGA 18.10 9.56 AUmAmCUGCmCmGamCCAmGmCUGmGmAUmU*mU*mC*mC*mC-3 81 5-mC*mA*mU*mA*mAUUCmUmUGUGmUmCUACmUmGUACmAmGA 14.30 1.81 AUmAmCUGCmCmGCamCAmGmCUGmGmAUmU*mU*mC*mC*mC-3 82 5-mC*mA*mU*mA*mAUUCmUmUGUGmUmCUACmUmGUACmAmGA 17.36 5.27 AUmAmCUGCmCmGCCamAmGmCUGmGmAUmU*mU*mC*mC*mC-3 83 5-mC*mA*mU*mA*mAUUCmUmUGUGmUmCUACmUmGUACmAmGA 4.42 3.03 AUmAmCUGCmCmGCCAmGmCUGmGmAUmU*mU*mC*mC*mC-3 84 5-mC*mA*mU*mA*mAUUCmUmUGUGmUmCUACmUmGUACmAmGA 4.64 2.04 AUmAmCUGCmCmGCdSAmGmCUGmGmAUmU*mU*mC*mC*mC-3 85 5-mC*mA*mU*mA*mAUUCmUmUGUGmUmCUACmUmGUACmAmGA 5.57 1.30 AUmAmCUGCmCmGCrSAmGmCUGmGmAUmU*mU*mC*mC*mC-3 86 5-mC*mA*mU*mA*mAUUCmUmUGUGmUmCUACmUmGUACmAmGA 4.07 0.80 AUmAmCUGCmCmGCmSAmGmCUGmGmAUmU*mU*mC*mC*mC-3

    Other Embodiments

    [0293] All publications, patents, and patent applications mentioned in this specification are incorporated herein by reference in their entirety to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference in its entirety. Where a term in the present application is found to be defined differently in a document incorporated herein by reference, the definition provided herein is to serve as the definition for the term.

    [0294] While the invention has been described in connection with specific embodiments thereof, it will be understood that invention is capable of further modifications and this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure that come within known or customary practice within the art to which the invention pertains and may be applied to the essential features hereinbefore set forth, and follows in the scope of the claims.