SUBSTITUTED DIAZENYLANILINES AS FLUORESCENCE QUENCHER AND USE THEREOF

Abstract

The present invention relates to substituted-diazenylanilines of the formula I and their nucleotide conjugates, complexes, salts which may be used potentially as fluorescent quenchers in chemical and biological sciences such as cell imaging applications, diagnostics, fluorescent and non-fluorescent tags, pharmaceuticals and other useful applications, and a process of preparing said new compounds. More particularly, the present invention relates to 2,2-((4-((2,5-disubstituted-4-((4-nitrophenyl)diazenyl)phenyl)diazenyl)-2/3-substituted-phenyl)azanediyl)dialkanol, processes for preparing said compounds and their use as fluorescent quenchers in cell imaging applications, diagnostics, fluorescent and non-fluorescent tags, pharmaceuticals and other useful applications.

Claims

1. A compound of general formula I, nucleic acid conjugates, complexes and salts thereof ##STR00008## wherein R is independently selected from the group consisting of hydrogen and halogen; R.sub.1 and R.sub.2 are independently selected from the group consisting of hydrogen, substituted or unsubstituted (C.sub.1-C.sub.4) alkyl and (C.sub.1-C.sub.6) alkoxy; R.sub.3 is selected from the group consisting of hydroxy, halogen, (C.sub.1-C.sub.6) alkoxy, substituted or unsubstituted (C.sub.1-C.sub.4) alkyl, thioalkyl (SC.sub.1-C.sub.6), methylamino and dimethylamino; R.sub.4 is selected from the group consisting of hydrogen, hydroxy, halogen, (C.sub.1-C.sub.6) alkoxy, and substituted or unsubstituted (C.sub.1-C.sub.4) alkyl; m and n are independently selected from 0 to 3; Y.sub.1 and Y.sub.2 are independently selected from the group consisting of hydrogen, (C.sub.1-C.sub.6) alkyl, glycol, substituted or unsubstituted alkylaryl, oxo-alkanoic acid, epoxy, N-hydroxysuccinimide ester, N-hydroxybenztriazole ester, acid halide, acyl imidazole, thioester, p-nitrophenyl ester, alkyl ester, phosphoramidite, mononucleotide unit, two or more mononucleotide units with or without separate phosphate or polyphosphate groups linked by nucleoside groups.

2. The compounds claimed in claim 1, wherein the compound is selected from the group consisting of: i. 2,2-((4-((2,5-dimethoxy-4-((4-nitrophenyl)diazenyl)phenyl)diazenyl)-3-methoxyphenyl)azanediyl)bis(ethan-1-ol) (1), ii. 2,2-((4-((2,5-dimethoxy-4-((4-nitrophenyl)diazenyl)phenyl)diazenyl)-3-ethoxyphenyl)azanediyl)bis(ethan-1-ol) (2), iii. 2,2-((4-((2,5-dimethoxy-4-((4-nitrophenyl)diazenyl)phenyl)diazenyl)-3-propoxyphenyl)azanediyl)bis(ethan-1-ol) (3), iv. 2,2-((3-butoxy-4-((2,5-dimethoxy-4-((4-nitrophenyl)diazenyl)phenyl)diazenyl)phenyl)azanediyl)bis(ethan-1-ol) (4), v. 2,2-((4-((2,5-dimethoxy-4-((4-nitrophenyl)diazenyl)phenyl)diazenyl)-3-(hexyloxy)phenyl)azanediyl)bis(ethan-1-ol) (5), vi. 2,2-((4-((2,5-dimethoxy-4-((4-nitrophenyl)diazenyl)phenyl)diazenyl)-3-methylphenyl)azanediyl)bis(ethan-1-ol) (6), vii. 2,2-((4-((2,5-dimethoxy-4-((4-nitrophenyl)diazenyl)phenyl)diazenyl)-2,5-dimethoxyphenyl)azanediyl)bis(ethan-1-ol)(7), viii. 2,2-((3-bromo-4-((2,5-dimethoxy-4-((4-nitrophenyl)diazenyl)phenyl)diazenyl)phenyl) azanediyl)bis(ethan-1-ol)(8), ix. 2,2-((4-((4-((2,6-dichloro-4-nitrophenyl)diazenyl)-2,5-dimethoxyphenyl)diazenyl)-3-methoxyphenyl)azanediyl)bis(ethan-1-ol) (9), x. 22-((4-((2,5-dimethoxy-4-((4-nitrophenyl)diazenyl)phenyl)diazenyl)-3-hydroxyphenyl)azanediyl)bis(ethan-1-ol) (10), xi. 4-(2-((2-(bis(4-methoxyphenyl)(phenyl)methoxy)ethyl)(4-((2,5-dimethoxy-4-((4-nitrophenyl)diazenyl)phenyl)diazenyl)-3-methoxyphenyl)amino)ethoxy)-4-oxobutanoic acid (11), xii. 4-(2-((2-(bis(4-methoxyphenyl)(phenyl)methoxy)ethyl)(4-(2,5-dimethoxy-4-((4-nitrophenyl)diazenyl)phenyl)diazenyl)-3-ethoxyphenyl)amino)ethoxy)-4-oxobutanoic acid (12), xiii. 4-(2-((2-(bis(4-methoxyphenyl)(phenyl)methoxy)ethyl)(4-((2,5-dimethoxy-4-((4-nitrophenyl)diazenyl)phenyl)diazenyl)-3-propoxyphenyl)amino)ethoxy)-4-oxobutanoic acid (13), xiv. 4-(2-((2-(bis(4-methoxyphenyl)(phenyl)methoxy)ethyl)(3-butoxy-4-((2,5-dimethoxy-4-((4-nitrophenyl)diazenyl)phenyl)diazenyl)phenyl)amino)-ethoxy)-4-oxobutanoic acid (14), xv. 4-(2-((2-(bis(4-methoxyphenyl)(phenyl)methoxy)ethyl)(4-((2,5-dimethoxy-4-((4-nitrophenyl)diazenyl)phenyl)diazenyl)-3-(hexyloxy)phenyl)amino)-ethoxy)-4-oxobutanoic acid, (15) and xvi. 4-(2-((2-(bis(4-methoxyphenyl)(phenyl)methoxy)ethyl)(4-((2,5-dimethoxy-4-((4-nitrophenyl)diazenyl)phenyl)diazenyl)-3-methylphenyl)amino)-ethoxy)-4-oxobutanoic acid (16).

3. The compound as claimed in claim 1, wherein its nucleic acid conjugate comprises nucleotide sequence selected from the group consisting of SEQ ID NO: 1-3.

4. A process for the preparation of compound of general formula I, nucleic acid conjugates, complexes, and salts thereof, ##STR00009## wherein R is selected from the group consisting of hydrogen and halogen; R.sub.1 and R.sub.2 are independently selected from the group consisting of hydrogen, substituted or unsubstituted (C.sub.1-C.sub.4) alkyl and (C.sub.1-C.sub.6) alkoxy; R.sub.3 is selected from the group consisting of hydroxy, halogen, (C.sub.1-C.sub.6) alkoxy, substituted or unsubstituted (C.sub.1-C.sub.4) alkyl, thioalkyl (SC.sub.1-C.sub.6), methylamino and dimethylamino; R.sub.4 is selected from the group consisting of hydrogen, hydroxy, halogen, (C.sub.1-C.sub.6) alkoxy, and substituted or unsubstituted (C.sub.1-C.sub.4) alkyl; m and n are independently selected from 0 to 3; Y.sub.1 and Y.sub.2 are independently selected from the group consisting of hydrogen, (C.sub.1-C.sub.6) alkyl, glycol, substituted or unsubstituted alkylaryl, oxo-alkanoic acid, epoxy, N-hydroxysuccinimide ester, N-hydroxybenztriazole ester, acid halide, acyl imidazole, thioester, p-nitrophenyl ester, alkyl ester, alkenyl ester, alkynyl ester, aromatic ester, phosphoramidite, mononucleotide unit, two or more mononucleotide units with or without separate phosphate or polyphosphate groups linked by nucleoside groups, comprising the steps of: ##STR00010## a. reacting a solution of unsubstituted or substituted 4-nitroaniline in HCl with a solution of sodium nitrite in distilled water to form diazonium salts followed by reaction with substituted aniline to form a compound having general formula S1; b. reacting a mixture of substituted aniline with substituted alkylhalide in the presence of base to form a compound having general formula S2; c. reacting a compound having general formula S1 in HCl with a solution of sodium nitrite to form a diazonium salt, which was then reacted with a compound having general formula S2 in the presence of NaOAc buffer to obtain a compound having general formula I and d. isolating the compound of general formula I from the reaction mixture and purifying by washing with organic solvents or by chromatography.

5. The process as claimed in claim 4, wherein steps a-c are carried out in the presence of an organic solvent selected from CH.sub.3CN, Dimethylsulphoxide, water and tetrahydrofuran at a temperature ranging between 0 C. to 100 C. for a period ranging between 1 minute to 3 days.

6. A process for the preparation of compound of general formula I, nucleic acid conjugates, complexes, and salts thereof as claimed in claim 4, wherein the process comprises the steps of: ##STR00011## a. reacting compound S2, wherein Y.sub.1, Y.sub.2=OH and m, n=1 in dry DCM in the presence of a base (DIPEA) with DMT-Cl at room temperature under inert atmosphere to afford compound S3; b. reacting S3 with succinic anhydride, and DMAP in organic solvent for 12-48 h to afford compound S4 and c. reacting the diazonium salt of S1 with S4 to obtain the compound having general formula I.

7. A process for the preparation of conjugate compound of general formula I wherein Q is the quencher compound of formula 1 comprising the steps of: ##STR00012## a. coupling of a compound of formula S4 with the amine functionality of the solid support CPG beads of formula S5 to produce S6 followed by deprotection of DMT group to obtain S7; b. reacting S7 with nucleotide phosphoramidites to form oligonucleotide S8 followed by 5-modiciation with hexynyl-phosphoramidite to afford product S9 and c. treating S9 with abase for cleaving the oligonucleotide from the solid support to obtain S10 and d. reacting S10 with fluorescent dye azides to furnish oligonucleotides probes of general formula S12.

8. The compound as claimed in claim 1, wherein the compound is used in combination with acetyl, azides, oxo-alkanoic acid, epoxy, N-hydroxysuccinimide ester, N-hydroxybenztriazole ester, acid halide, acyl imidazole, thioester, p-nitrophenyl ester, alkyl ester, phosphoramidite, mononucleotide unit, two or more mononucleotide units with or without separate phosphate or polyphosphate groups linked by nucleoside groups.

9. A process for detecting nucleic acids (DNA, RNA), peptides, chemicals, pharmaceuticals, microorganisms and other biological substances of diagnostic importance using the compounds as claimed in claim 1.

10. A process for detection of substances, hormones, pathogenic microorganisms, viruses, antibodies, enzymes and nucleic acids using the compounds as claimed in claim 1.

11. The compound as claimed in claim 1, wherein the compound is useful for preparing mono-, or dual labelled probe and analyzing them in single, duplexing and multiplexing in RTPCR or other related detecting systems.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0061] The following drawing form a part of the present specification and is included to further illustrate aspects of the present disclosure. The disclosure may be better understood by reference to the drawing in combination with the detailed description of the specific embodiments presented herein:

[0062] FIG. 1 illustrates absorption spectra of newly synthesized quencher derivatives (1-9) in accordance with an embodiment of the present disclosure.

[0063] FIG. 2 illustrates comparison of absorption of BHQ-2 and CDRI-Q2 at 20 M concentration in PCR buffer solution in accordance with an embodiment of the present disclosure.

[0064] FIG. 3 depicts fluorescence quenching of 5-FAM in the presence of different concentration of CDRI Q2 (1) in PCR buffer solution in accordance with an embodiment of the present disclosure.

[0065] FIG. 4 depicts fluorescence quenching of CY3 in the presence of different concentration of CDRI Q2 (1) in PCR buffer solution in accordance with an embodiment of the present disclosure.

[0066] FIG. 5 depicts fluorescence quenching of 5-TAMRA in the presence of different concentration of CDRI Q2 (1) in PCR buffer solution in accordance with an embodiment of the present disclosure.

[0067] FIG. 6 depicts fluorescence quenching of CalFluor in the presence of different concentration of CDRI Q2 (1) in PCR buffer solution in accordance with an embodiment of the present disclosure.

[0068] FIG. 7 depicts fluorescence quenching of Texas Red in the presence of different concentration of CDRI Q2 (1) in PCR buffer solution in accordance with an embodiment of the present disclosure.

[0069] FIG. 8 depicts fluorescence quenching of Cy5 in the presence of different concentration of CDRI Q2 (1) in PCR buffer solution in accordance with an embodiment of the present disclosure.

[0070] FIG. 9 illustrates RT-PCR data representation with the cycle threshold (Ct) on X-axis and RFU on Y-axis in accordance with an embodiment of the present disclosure.

[0071] FIG. 10 illustrates Multiplexing RT-PCR based detection of SARS-CoV-2 viral genes E and RdRp and RnaseP as housekeeping gene using positive Control; data represents with the cycle threshold (Ct) on X-axis and RFU on Y-axis, in accordance with an embodiment of the present disclosure.

[0072] FIG. 11 illustrates Multiplexing RT-PCR based detection of SARS-CoV-2 viral genes E and RdRp and Rnase P as housekeeping gene using positive RNA samples from COVID-19 positive patients; data represents with the cycle threshold (Ct) on X-axis and RFU on Y-axis, in accordance with an embodiment of the present disclosure.

ABBREVIATIONS

[0073] PCR Polymerase Chain Reaction [0074] TDW Triple Distilled Water

DETAILED DESCRIPTION OF THE INVENTION

[0075] Those skilled in the art will be aware that the present disclosure is subject to variations and modifications other than those specifically described. It is to be understood that the present disclosure includes all such variations and modifications. The disclosure also includes all such steps, features, compositions, and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations of any or more of such steps or features.

[0076] The invention will now be described in detail in connection with certain preferred and optional embodiments, so that various aspects thereof may be more fully understood and appreciated.

[0077] For convenience, before further description of the present disclosure, certain terms employed in the specification, and examples are delineated here. These definitions should be read in the light of the remainder of the disclosure and understood as by a person of skill in the art. The terms used herein have the meanings recognized and known to those of skill in the art, however, for convenience and completeness, particular terms and their meanings are set forth below.

Definitions

[0078] For convenience, before further description of the present disclosure, certain terms employed in the specification, and examples are delineated here. These definitions should be read in the light of the remainder of the disclosure and understood as by a person of skill in the art. The terms used herein have the meanings recognized and known to those of skill in the art, however, for convenience and completeness, particular terms and their meanings are set forth below.

[0079] The articles a, an and the are used to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article.

[0080] The terms comprise and comprising are used in the inclusive, open sense, meaning that additional elements may be included. It is not intended to be construed as consists of only.

[0081] Throughout this specification, unless the context requires otherwise the word comprise, and variations such as comprises and comprising, will be understood to imply the inclusion of a stated element or step or group of element or steps but not the exclusion of any other element or step or group of element or steps.

[0082] Accordingly, the present invention relates to the synthesis and study of fluorescence quenching properties of substituted-diazenylanilines and their nucleotide conjugates, complexes, salts which may be used potentially as fluorescent quenchers in chemical and biological sciences such as cell imaging applications, diagnostics, fluorescent and non-fluorescent tags, pharmaceuticals and other useful applications, and a process of preparing said new compounds.

[0083] The term quenching probes refers to a quencher, which may be used to quench and/or reduce fluorescence emission in different UV-visible region to respond to a specific analyte/substance.

[0084] The present invention provides a compound of formula I:

##STR00005## [0085] wherein [0086] R is selected from the group consisting of hydrogen and halogen; [0087] R.sub.1 and R.sub.2 are independently selected from the group consisting of hydrogen, substituted or unsubstituted (C.sub.1-C.sub.4) alkyl and (C.sub.1-C.sub.6) alkoxy; [0088] R.sub.3 is selected from the group consisting of hydroxy, halogen, (C.sub.1-C.sub.6) alkoxy, substituted or unsubstituted (C.sub.1-C.sub.4) alkyl, thioalkyl (S C.sub.1-C.sub.6), methylamino and dimethylamino; [0089] R.sub.4 is selected from the group consisting of hydrogen, hydroxy, halogen, (C.sub.1-C.sub.6) alkoxy and substituted or unsubstituted (C.sub.1-C.sub.4) alkyl; [0090] m and n are numbers independently selected from 0 to 3 and [0091] Y.sub.1 and Y.sub.2 are independently selected from the group consisting of hydrogen, (C.sub.1-C.sub.6) alkyl, glycol, substituted or unsubstituted alkylaryl, oxo-alkanoic acid, epoxy, N-hydroxysuccinimide ester, N-hydroxybenztriazole ester, acid halide, acyl imidazole, thioester, p-nitrophenyl ester, alkyl ester, phosphoramidite, mononucleotide unit, two or more mononucleotide units with or without separate phosphate or polyphosphate groups linked by nucleoside groups.

[0092] The following is a list of representative substituted-diazenylanilines compounds: [0093] i. 2,2-((4-((2,5-dimethoxy-4-((4-nitrophenyl)diazenyl)phenyl)diazenyl)-3-methoxyphenyl)azanediyl)bis(ethan-1-ol) (1), [0094] ii. 2,2-((4-((2,5-dimethoxy-4-((4-nitrophenyl)diazenyl)phenyl)diazenyl)-3-ethoxyphenyl)azanediyl)bis(ethan-1-ol) (2), [0095] iii. 2,2-((4-((2,5-dimethoxy-4-((4-nitrophenyl)diazenyl)phenyl)diazenyl)-3-propoxyphenyl)azanediyl)bis(ethan-1-ol) (3), [0096] iv. 2,2-((3-butoxy-4-((2,5-dimethoxy-4-((4-nitrophenyl)diazenyl)phenyl)diazenyl)phenyl)azanediyl)bis(ethan-1-ol) (4), [0097] v. 2,2-((4-((2,5-dimethoxy-4-((4-nitrophenyl)diazenyl)phenyl)diazenyl)-3-(hexyloxy)phenyl)azanediyl)bis(ethan-1-ol) (5), [0098] vi. 2,2-((4-((2,5-dimethoxy-4-((4-nitrophenyl)diazenyl)phenyl)diazenyl)-3-methylphenyl)azanediyl)bis(ethan-1-ol) (6), [0099] vii. 2,2-((4-((2,5-dimethoxy-4-((4-nitrophenyl)diazenyl)phenyl)diazenyl)-2,5-dimethoxyphenyl)azanediyl)bis(ethan-1-ol)(7), [0100] viii. 2,2-((3-bromo-4-((2,5-dimethoxy-4-((4-nitrophenyl)diazenyl)phenyl)diazenyl)phenyl) azanediyl)bis(ethan-1-ol)(8), [0101] ix. 2,2-((4-((4-((2,6-dichloro-4-nitrophenyl)diazenyl)-2,5-dimethoxyphenyl)diazenyl)-3-methoxyphenyl)azanediyl)bis(ethan-1-ol) (9), [0102] x. 2,2-((4-((2,5-dimethoxy-4-((4-nitrophenyl)diazenyl)phenyl)diazenyl)-3-hydroxyphenyl)azanediyl)bis(ethan-1-ol) (10), [0103] xi. 4-(2-((2-(bis(4-methoxyphenyl)(phenyl)methoxy)ethyl)(4-((2,5-dimethoxy-4-((4-nitrophenyl)diazenyl)phenyl)diazenyl)-3-methoxyphenyl)amino)ethoxy)-4-oxobutanoic acid (11), [0104] xii. 4-(2-((2-(bis(4-methoxyphenyl)(phenyl)methoxy)ethyl)(4-((2,5-dimethoxy-4-((4-nitrophenyl)diazenyl)phenyl)diazenyl)-3-ethoxyphenyl)amino)ethoxy)-4-oxobutanoic acid (12), [0105] xiii. 4-(2-((2-(bis(4-methoxyphenyl)(phenyl)methoxy)ethyl)(4-((2,5-dimethoxy-4-((4-nitrophenyl)diazenyl)phenyl)diazenyl)-3-propoxyphenyl)amino)ethoxy)-4-oxobutanoic acid (13), [0106] xiv. 4-(2-((2-(bis(4-methoxyphenyl)(phenyl)methoxy)ethyl)(3-butoxy-4-((2,5-dimethoxy-4-((4-nitrophenyl)diazenyl)phenyl)diazenyl)phenyl)amino)-ethoxy)-4-oxobutanoic acid (14), [0107] xv. 4-(2-((2-(bis(4-methoxyphenyl)(phenyl)methoxy)ethyl)(4-((2,5-dimethoxy-4-((4-nitrophenyl)diazenyl)phenyl)diazenyl)-3-(hexyloxy)phenyl)amino)-ethoxy)-4-oxobutanoic acid, (15) and 4-(2-((2-(bis(4-methoxyphenyl)(phenyl)methoxy)ethyl)(4-((2,5-dimethoxy-4-((4-nitrophenyl)diazenyl)phenyl)diazenyl)-3-methylphenyl)amino)-ethoxy)-4-oxobutanoic acid (16).

[0108] The process for the preparation of compound of formula I wherein R, R.sub.1, R.sub.2 R.sub.3, R.sub.4, m, n, Y.sub.1 and Y.sub.2 are as defined above is shown in Scheme I.

##STR00006##

[0109] The process comprises that step of: [0110] a. reacting a solution of unsubstituted or substituted 4-nitroaniline in HCl with a solution of sodium nitrite in distilled water at 0 C. to form diazonium salts followed by reaction with substituted aniline to form a compound having general formula S1; [0111] b. reacting a mixture of substituted aniline with substituted alkyl halide in the presence of base to form a compound having general formula S2; [0112] c. reacting a compound having general formula S1 in HCl with a solution of sodium nitrite to form a diazonium salt, which was then reacted with a compound having general formula S-2 in the presence of NaOAc buffer gives a compound having general formula I and [0113] d. isolating the compound of general formula, I from the reaction mixture and purifying by washing with organic solvents or by chromatographic techniques.

[0114] The reactions are carried out in a common organic solvent particularly CH.sub.3CN, Dimethylsulphoxide, water and tetrahydrofuran at a temperature ranging between 0 C. to 100 C. for a period ranging between 1 minute to 3 days depending upon the reactants.

[0115] In another embodiment the present invention provides a process for the preparation of preferred compounds having the formula I wherein R.sub.1, R.sub.2 R.sub.3, R.sub.4, are as defined above; Y.sub.1, Y.sub.2=OH and m, n=1 is shown Scheme II.

##STR00007##

[0116] The process comprises that step of: [0117] a) reacting a solution of unsubstituted or substituted 4-nitroaniline in HCl with a solution of sodium nitrite in distilled water at 0 C. to form diazonium salts followed by reaction with substituted aniline to form a compound having general formula S1; [0118] b) reacting a compound having general formula S2 wherein Y.sub.1, Y.sub.2=OH and m, n=1 in dry DCM in the presence of a base (DIPEA) with DMT-Cl at room temperature under inert atmosphere to afford product S3; [0119] c) reacting a compound of general formula S3 with succinic anhydride, and DMAP in organic solvent for 12-48 h to afford compound S4; [0120] d) reacting a compound having general formula S1 in HCl with a solution of sodium nitrite to form a diazonium salt, which was then reacted with a compound having general formula S4 in the presence of a buffer (NaOAc) gives a compound having general formula I and [0121] e) isolating the compound of general formula I from the reaction mixture and purifying by washing with organic solvents or by chromatographic techniques.

[0122] The reactions are carried out in a common organic solvent particularly CH.sub.3CN, Dimethylsulphoxide, water and tetrahydrofuran in the presence of buffer solution at a temperature ranging between 0 C. to 100 C. for a period ranging between 1 minute to 3 days depending upon the reactants.

[0123] In an embodiment of the invention wherein the compounds are useful for fluorescent quenchers in chemical and biological sciences.

[0124] In another embodiment of the invention wherein the compounds showing wide quenching range, in between nm 450-700 nm.

[0125] Furthermore, the compounds having the general formula I can be used potentially as fluorescent quenchers in chemical and biological sciences such as cell imaging applications, fluorescent and non-fluorescent tags and other useful biological applications such as developing diagnostic kits.

EXAMPLES

[0126] Following examples are given by way of illustration and should not construe the scope of the present invention.

Example-1

2,2-((4-((2,5-dimethoxy-4-((4-nitrophenyl)diazenyl)phenyl)diazenyl)-3-methoxyphenyl) azanediyl)bis(ethan-1-ol) (1). (CDRI-Q2)

[0127] To the stirred mixture of salt of S1 in solution of NaOAc buffer and ACN (1:1), solution of compound S2 (R3=OCH.sub.3, R4=H) in ACN was added slowly at 0 C. After the addition, reaction mixture was stirred for 30 mins 0 C. The completion of the reaction was monitored by TLC. The reaction mixture was then filtered and washed with ACN and water (1:1) to get the product 2,2-((4-((2,5-dimethoxy-4-((4-nitrophenyl)diazenyl)phenyl)diazenyl)phenyl)azanediyl)bis(ethan-1-ol) as purple solid. M.P.=205-206 C., MS (ESI) m/z 525 [M+H].sup.+, 1H NMR (400 MHz, DMSO-d6) 8.47-8.40 (m, 2H), 8.09-8.03 (m, 2H), 7.62 (d, J=9.3 Hz, 1H), 7.44 (s, 1H), 7.28 (s, 1H), 6.48 (dd, J=9.4, 2.5 Hz, 1H), 6.40 (d, J=2.5 Hz, 1H), 5.03-4.80 (m, 2H), 3.99 (s, 3H), 3.97 (s, 3H), 3.94 (s, 3H), 3.68-3.57 (m, 8H). 13C NMR (101 MHz, DMSO) 160.61, 156.28, 154.27, 153.76, 150.62, 148.44, 147.60, 141.34, 134.36, 125.57, 123.88, 118.66, 105.80, 101.37, 100.20, 95.24, 79.64, 58.81, 56.98, 56.80, 56.49, 53.93.

Example-2

2,2-((4-((2,5-dimethoxy-4-((4-nitrophenyl)diazenyl)phenyl)diazenyl)-3-ethoxyphenyl) azanediyl)bis(ethan-1-ol) (2)

[0128] To the stirred mixture of salt of S1 in solution of NaOAc buffer and ACN (1:1), solution of compound S2 (R4=H R3=OCH.sub.2CH.sub.3) in ACN was added slowly at 0 C. After the addition, reaction mixture was stirred for 30 mins 0 C. The completion of the reaction was monitored by TLC. The reaction mixture was than filtered and washed with ACN and water (1:1) to get the product 2,2-((4-((2,5-dimethoxy-4-((4-nitrophenyl)diazenyl)phenyl)diazenyl)-3-ethoxyphenyl)azanediyl)bis(ethan-1-ol) as purple solid.

[0129] M.P.=202-203 C., MS (ESI) m/z 539 [M+H].sup.+, 1H NMR (400 MHz, DMSO-d6) 8.43 (d, J=8.6 Hz, 2H), 8.05 (d, J=8.5 Hz, 2H), 7.62 (d, J=9.3 Hz, 1H), 7.44 (s, 1H), 7.35 (s, 1H), 6.49 (d, J=9.4 Hz, 1H), 6.44-6.35 (m, 1H), 4.88 (t, J=5.1 Hz, 2H), 4.25 (q, J=7.0 Hz, 2H), 3.98 (s, 3H), 3.94 (s, 3H), 3.68-3.56 (m, 8H), 1.44 (t, J=7.0 Hz, 3H). 13C NMR (101 MHz, DMSO) 160.12, 156.28, 154.25, 153.70, 150.63, 148.43, 147.58, 141.26, 134.36, 125.57, 123.88, 118.51, 106.06, 101.24, 100.27, 96.67, 65.10, 58.80, 56.81, 56.67, 53.91, 15.17.

Example-3

2,2-((4-((2,5-dimethoxy-4-((4-nitrophenyl)diazenyl)phenyl)diazenyl)-3-propoxyphenyl)azanediyl)bis(ethan-1-ol) (3)

[0130] To the stirred mixture of salt of S1 in solution of NaOAc buffer and ACN (1:1), solution of compound S2 (R4=H, R3=OCH.sub.2CH.sub.2CH.sub.3) in ACN was added slowly at 0 C. After the addition, reaction mixture was stirred for 30 mins 0 C. The completion of the reaction was monitored by TLC. The reaction mixture was then filtered and washed with ACN and water (1:1) to get the product 2,2-((4-((2,5-dimethoxy-4-((4-nitrophenyl)diazenyl)phenyl)diazenyl)-3-propoxyphenyl) azanediyl)bis(ethan-1-ol) as purple solid. M.P.=202-203 C., MS (ESI) m/z 553 [M+H].sup.+, 1H NMR (400 MHz, DMSO-d6) 8.41 (d, J=8.6 Hz, 2H), 8.11-7.90 (m, 2H), 7.62 (s, 1H), 7.45-7.19 (m, 2H), 6.74-6.31 (m, 2H), 4.41-4.11 (m, 2H), 4.10-3.59 (m, 16H), 1.92-1.80 (m, 2H), 1.19-1.02 (m, 3H).

Example-4

2,2-((3-butoxy-4-((2,5-dimethoxy-4-((4-nitrophenyl)diazenyl)phenyl)diazenyl)-phenyl)azanediyl)bis(ethan-1-ol) (4)

[0131] To the stirred mixture of salt of S1 in solution of NaOAc buffer and ACN (1:1), solution of compound S2 (R4=H, R3=OCH.sub.2CH.sub.2CH.sub.2CH.sub.3) in ACN was added slowly at 0 C. After the addition, reaction mixture was stirred for 30 mins 0 C. The completion of the reaction was monitored by TLC. The reaction mixture was then filtered and washed with ACN and water (1:1) to get the product 2,2-((3-butoxy-4-((2,5-dimethoxy-4-((4-nitrophenyl)diazenyl)phenyl)diazenyl)phenyl) azanediyl)bis(ethan-1-ol) as purple solid. MS (ESI) m/z 567 [M+H].sup.+, 1H NMR (400 MHz, DMSO-d6) 8.40 (d, J=8.4 Hz, 2H), 8.10-7.90 (m, 2H), 7.61 (s, 1H), 7.79-7.22 (m, 2H), 6.77-6.22 (m, 2H), 4.12-3.64 (m, 2H), 4.12-3.64 (m, 16H), 2.01-1.75 (m, 2H), 1.67-1.46 (m, 2H), 1.12-0.88 (m, 3H).

Example-5

2,2-((4-((2,5-dimethoxy-4-((4-nitrophenyl)diazenyl)phenyl)diazenyl)-3-(hexyloxy)phenyl) azanediyl)bis(ethan-1-ol) (5)

[0132] To the stirred mixture of salt of S1 in solution of NaOAc buffer and ACN (1:1), solution of compound S2 (R4=H, R3=OCH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.3) in ACN was added slowly at 0 C. After the addition, reaction mixture was stirred for 30 mins 0 C. The completion of the reaction was monitored by TLC. The reaction mixture was then filtered and washed with ACN and water (1:1) to get the product 2,2-((4-((2,5-dimethoxy-4-((4-nitrophenyl)diazenyl)phenyl)diazenyl)-3-(hexyloxy)phenyl)azanediyl)bis(ethan-1-ol) as purple solid. M.P.=198-199 C., MS (ESI) m/z 595 [M+H].sup.+, 1H NMR (400 MHz, DMSO-d6) 8.41 (d, J=8.5 Hz, 2H), 8.11-7.92 (m, 2H), 7.68-7.53 (m, 1H), 7.45-7.21 (m, 2H), 6.75-6.30 (m, 2H), 4.47-4.11 (m, 2H), 4.08-3.60 (m, 16H), 1.99-1.76 (m, 2H), 1.63-1.44 (m, 2H), 1.40-1.27 (m, 4H), 0.87 (t, J=6.5 Hz, 3H).

Example-6

2,2-((4-((2,5-dimethoxy-4-((4-nitrophenyl)diazenyl)phenyl)diazenyl)-3-methylphenyl)azanediyl)bis(ethan-1-ol) (6)

[0133] To the stirred mixture of salt of S1 in solution of NaOAc buffer and ACN (1:1), solution of compound S2 (R4=H, R3=CH.sub.3) in ACN was added slowly at 0 C. After the addition, reaction mixture was stirred for 30 mins 0 C. The completion of the reaction was monitored by TLC. The reaction mixture was then filtered and washed with ACN and water (1:1) to get the product 2,2-((4-((2,5-dimethoxy-4-((4-nitrophenyl)diazenyl)phenyl)diazenyl)-3-methylphenyl)azanediyl)-bis(ethan-1-ol) as purple solid. M.P.=201-202 C., MS (ESI) m/z 509 [M+H].sup.+, 1H NMR (400 MHz, DMSO-d6) 8.48-8.39 (m, 2H), 8.10-8.01 (m, 2H), 7.64 (d, J=9.9 Hz, 1H), 7.44 (s, 1H), 7.37 (s, 1H), 6.75-6.69 (m, 2H), 4.86 (t, J=5.2 Hz, 2H), 4.00 (s, 3H), 3.95 (s, 3H), 3.65-3.55 (m, 8H), 2.67 (s, 3H). 13C NMR (101 MHz, DMSO) 156.22, 153.67, 152.25, 150.76, 148.49, 147.24, 142.54, 142.25, 141.54, 125.57, 123.91, 118.02, 112.68, 110.76, 101.35, 100.35, 58.72, 56.84, 56.80, 53.73, 18.48.

Example-7

2,2-((4-((2,5-dimethoxy-4-((4-nitrophenyl)diazenyl)phenyl)diazenyl)-2,5-dimethoxyphenyl) azanediyl)bis(ethan-1-ol)(7)

[0134] To the stirred mixture of salt of S1 in solution of NaOAc buffer and ACN (1:1), solution of compound S2 (R.sub.3=OCH.sub.3 R.sub.4=OCH.sub.3) in ACN was added slowly at 0 C. After the addition, reaction mixture was stirred for 30 mins 0 C. The completion of the reaction was monitored by TLC. The reaction mixture was then filtered and washed with ACN and water (1:1) to get the product 2,2-((4-((2,5-dimethoxy-4-((4-nitrophenyl)diazenyl)phenyl)diazenyl)-2,5-dimethoxyphenyl) azanediyl)bis(ethan-1-ol) as purple solid. M.P.=230-231 C., MS (ESI) m/z 555 [M+H].sup.+, 1H NMR (400 MHz, DMSO-d6) 8.32 (d, J=8.8 Hz, 2H), 8.00 (d, J=8.8 Hz, 2H), 7.78 (d, J=9.2 Hz, 1H), 7.53 (s, 1H), 7.4 (s, 1H), 7.0 (d, J=2.34 Hz, 1H), 6.66 (dd, J=2.4, 9.2 Hz, 1H), 4.03 (s, 3H), 4.0 (s, 3H), 3.85 (s, 3H), 3.75 (s, 3H), 3.52 (t, J=4.95 Hz, 4H), 3.23 (t, J=4.96 Hz, 4H).

Example-8

2,2-((3-bromo-4-((2,5-dimethoxy-4-((4-nitrophenyl)diazenyl)phenyl)diazenyl)phenyl) azanediyl)bis(ethan-1-ol) (8)

[0135] To the stirred mixture of salt of S1 in solution of NaOAc buffer and ACN (1:1), solution of compound S2 (R4=H, R3=Br) in ACN was added slowly at 0 C. After the addition, reaction mixture was stirred for 30 mins at 0 C. The completion of the reaction was monitored by TLC. The reaction mixture was then filtered and washed with ACN and water (1:1) to get the product 2,2-((3-bromo-4-((2,5-dimethoxy-4-((4-nitrophenyl)diazenyl)-phenyl)diazenyl)phenyl) azanediyl)bis(ethan-1-ol) as purple solid. M.P.=220-221 C., MS (ESI) m/z 573 [M+H].sup.+, 1H NMR (400 MHz, DMSO-d6) 8.32 (d, J=8.8 Hz, 2H), 8.00 (d, J=8.8 Hz, 2H), 7.78 (d, J=9.2 Hz, 1H), 7.53 (s, 1H), 7.4 (s, 1H), 7.0 (d, J=2.34 Hz, 1H), 6.66 (dd, J=2.4, 9.2 Hz, 1H), 4.03 (s, 3H), 4.0 (s, 3H), 3.82 (t, J=4.95 Hz, 4H), 3.63 (t, J=4.96 Hz, 4H).

Example-9

2,2-((4-((4-((2,6-dichloro-4-nitrophenyl)diazenyl)-2,5-dimethoxyphenyl)diazenyl)-3-methoxyphenyl)azanediyl)bis(ethan-1-ol) (9)

[0136] To the stirred mixture of salt of S1 in solution of NaOAc buffer and ACN (1:1), solution of compound S2 (R3=OCH.sub.3, R4=H) in ACN was added slowly at 0 C. After the addition, reaction mixture was stirred for 30 mins at 0 C. The completion of the reaction was monitored by TLC. The reaction mixture was then filtered and washed with ACN and water (1:1) to get the 2,2-((4-((4-((2,6-dichloro-4-nitrophenyl)diazenyl)-2,5-dimethoxyphenyl)diazenyl)-3-methoxyphenyl)azanediyl)bis(ethan-1-ol) as purple solid. M.P.=189-190 C., MS (ESI) m/z 592 [M+H].sup.+, 1H NMR (400 MHz, DMSO-d6) 8.49 (s, 2H), 7.65 (d, J=9.38 Hz, 1H), 7.37 (s, 1H), 7.31 (s, 1H), 6.53 (d, J=7.61 Hz, 1H), 6.40 (s, 1H), 4.0-3.94 (m, 6H), 3.92 (s, 3H), 3.69-3.59 (m, 8H).

Example-10

2,2-((4-((2,5-dimethoxy-4-((4-nitrophenyl)diazenyl)phenyl)diazenyl)-3-hydroxyphenyl)azanediyl)bis(ethan-1-ol) (10)

[0137] To the stirred mixture of salt of S1 in solution of NaOAc buffer and ACN (1:1), solution of compound S2 (R3=OH, R4=H) in ACN was added slowly at 0 C. After the addition, reaction mixture was stirred for 30 mins at 0 C. The completion of the reaction was monitored by TLC. The reaction mixture was then filtered and washed with ACN and water (1:1) to get the product 2,2-((4-((2,5-dimethoxy-4-((4-nitrophenyl)diazenyl)phenyl)diazenyl)-3-hydroxyphenyl)azanediyl)-bis(ethan-1-ol as purple solid. M.P.=203-204 C., MS (ESI) m/z 551[M+H].sup.+, 1H NMR (400 MHz, DMSO-d6) 8.47-8.40 (m, 2H), 8.09-8.03 (m, 2H), 7.62 (d, J=9.3 Hz, 1H), 7.44 (s, 1H), 7.28 (s, 1H), 6.48 (dd, J=9.4, 2.5 Hz, 1H), 6.40 (d, J=2.5 Hz, 1H), 5.03-4.80 (m, 2H), 3.99 (s, 3H), 3.97 (s, 3H), 3.68-3.57 (m, 8H).

Example-11

4-(2-((2-(bis(4-methoxyphenyl)(phenyl)methoxy)ethyl)(4-((2,5-dimethoxy-4-((4-nitrophenyl)diazenyl)phenyl)diazenyl)-3-methoxyphenyl)amino)ethoxy)-4-oxobutanoic acid. (11)

[0138] To the stirred mixture of salt of S1 in solution of NaOAc buffer and ACN (1:1), solution of compound S4 (R4=H, R3=OCH3) in ACN was added slowly at 0 C. After the addition, reaction mixture was stirred for 30 mins at 0 C. The completion of the reaction was monitored by TLC. The reaction mixture was than filtered and washed with ACN and water (1:1) to get the 4-(2-((2-(bis(4-methoxyphenyl)(phenyl)methoxy)ethyl)(4-((2,5-dimethoxy-4-((4-nitrophenyl)diazenyl)phenyl)diazenyl)-3-methoxyphenyl)amino)ethoxy)-4-oxobutanoic acid as purple solid. M.P.=208-209 C., MS (ESI) m/z 927 [M+H].sup.+, 1H NMR (400 MHz, DMSO-d6) 12.1 (brs, 1H), 8.44 (d, J=8.8 Hz, 2H), 8.06 (d, J=8.8 Hz, 2H), 7.59-7.57 (m, 1H), 7.44 (s, 1H), 7.36-7.34 (m, 2H), 7.28-7.20 (m, 7H), 7.08 (d, J=8.8 Hz, 2H), 6.84 (d, J=9.2 Hz, 4H), 6.47-6.45 (m, 1H), 6.17-6.22-6.20 (m, 1H), 4.29-4.27 (m, 2H), 3.99-3.94 (m, 9H), 3.83-3.68 (m, 10H), 3.28-3.25 (m, 2H), 2.52-2.41 (m, 4H).

Photophysical Studies of the Compounds of General Formula I

[0139] The photophysical properties of all the synthesized compounds 1-6 were examined by UV-vis absorption analysis. Table 1 showed absorption maxima and quenching range in PCR buffer (pH 7.2).

TABLE-US-00001 TABLE 1 Photophysical properties of Examples 1-9. Example .sub.max, abs (nm) Absorption range (nm) 1 563 450-700 2 567 450-700 3 562 500-700 4 562 500-700 5 550 500-700 6 550 500-700 7 591 450-650 8 475 450-600 9 550 450-700

[0140] All the synthesized quenchers shown by representative examples 1-9 exhibited broad absorption spectra in PCR buffer at room temperature. The absorption spectra of newly synthesized quencher derivatives (1-9) is provided in FIG. 1. Among them compound 1 and 2 showed absorption in the range of 400-750 nm with good intensity. Similarly increasing the methylene unit of the alkoxy group in (R.sub.4=H, R.sub.3=OC.sub.1-C.sub.6) of the general formula I, a decrease in intensity was observed (FIG. 1).

Comparison of Known Quencher BHQ-2 and the New Quencher CDRI-Q2 of the Present Invention

[0141] The absorption of the quencher CDRI-Q2 (Example 1) of the present invention was compared with the absorption spectrum of the known commercial quencher BHQ-2. The data suggested that the quencher CDRI-Q2 of the present invention showed broad absorption and better intensity as compared to BHQ-2 (FIG. 2).

Quenching Studies of the CDRI-Q2 in the Presence of Different Fluorescent Dyes

[0142] The compound CDRI-Q2 of the present invention showed effective quenching of fluorescent dye 5-FAM which showed emission maximum at 517 nm in PCR buffer solution (FIG. 3).

[0143] The compound CDRI-Q2 of the present invention showed effective quenching of fluorescent dye Cy-3 which showed emission maximum at 566 nm in PCR buffer solution (FIG. 4).

[0144] The compound CDRI-Q2 of the present invention showed effective quenching of fluorescent dye 5-TAMRA which showed emission maximum at 583 nm in PCR buffer solution (FIG. 5).

[0145] The compound CDRI-Q2 of the present invention showed effective quenching of fluorescent dye CalFluor red which showed emission maximum at 601 nm in PCR buffer solution (FIG. 6).

[0146] The compound CDRI-Q2 of the present invention showed effective quenching of fluorescent dye Texas Red which showed emission maximum at 603 nm in PCR buffer solution (FIG. 7).

[0147] The compound CDRI-Q2 of the present invention showed effective quenching of fluorescent dye Cy-5 which showed emission maximum at 662 nm in PCR buffer solution (FIG. 8).

Synthesis of Dual-Labelled Probe.

[0148] To a mixture of terminal acid containing fluorescence quencher of general formula I (3 eq.), DMAP (0.05 eq.), triethylamine (13 eq.), DEC/EDC (10 eq.), and anhydrous pyridine (2 mL) added free amine containing Controlled Pore Glass (CPG beads, 1000 A), then shaken at room temperature for 24 h. The solvent was removed by suction filtration and washed successively with pyridine and DCM and dried under vacuum for few hours. Then the coupling efficiency was determined by using detritylation method.

Fluorophore Labeling at 5-End of 3-Quencher Tagged Oligonucleotides:

[0149] The probes for RT-PCR based diagnosis of COVID-19 were generated. CPG-amine (1000 Angs) was tagged with a novel quencher CDRI Q2 taken as representative from general formula I. Using CPG-CDRI-Q2, synthesis of oligonucleotide was performed as shown above. The oligonucleotide sequences corresponding to one host and two viral different genes E and RdRp (but not limited to these viral genes) are given in Table 2. Using phosphoramidite based solid-phase synthesis, a hexynyl group was introduced at the 5-end of each 3-CDRI Q2 tagged oligonucleotide, with hexynyl phosphoramidite. Fluorophore azides were obtained commercially as well as synthesized in-house.

TABLE-US-00002 TABLE2 OligonucleotidesequencesforprobesforRNaseP (host)andviralEandRdRPgenes Oligo Sequence RnaseP-gene TTCTGACCTGAAGGCTCTGCGCG E-gene ACACTAGCCATCCTTACTGCGCTTCG RdRp-gene CAGGTGGAACCTCATCAGGAGATGC

[0150] Fluorophore azides were coupled to hexynyl-oligonucleotide-3-CDRI Q2 by Cu(I)-Catalyzed Azide-Alkyne 1,3-dipolar cycloaddition reaction, also known as Copper catalyzed alkyne azide cycloaddition (CuAAC). The copper-catalyzed reaction allows the synthesis of the 1,4-disubstituted regioisomers specifically.

Advantages of Using Fluorophore Azides in Place of Fluorophore Phosphoramidites

[0151] In general, dual labelled probes are prepared by attaching fluorophore at 5-end of oligonucleotides having 3-quencher using phosphoramidite chemistry. These fluorophore phosphoramidites are stored at 20 C. and they are not stable at room temperature and are also moisture sensitive. In the present invention, we used fluorophore azides which are stable at room temperature and are not hygroscopic in nature. Such triazole-based dual labelled oligonucleotides having different viral gene sequences (E-gene, RdRp and human gene RNaseP) are not being used for the detection of SARS-Cov2 or related viral infections using RTPCR techniques. The results of triplexing RT-PCR experiments are mentioned in FIGS. 9-11 in the drawing accompanying the specification. The details of different fluorophore azides used for labelling are given in Table 3.

TABLE-US-00003 TABLE 3 Photophysical of different fluorophore azides .sub.abs/.sub.em Molecular Weight Fluorophores (nm) (g/mol) 6-FAM-azide 496/516 460.44 Cyanine-5-azide 646/662 565.37 5/6-Texas Red- 584/603 806.95 PEG.sub.3-azide

[0152] The details of the reagents and stock concentrations used for conjugate chemistry are given in Table 4.

TABLE-US-00004 TABLE 4 Reagents and stock concentrations used for labeling. Molecular Weight Stock Reagents (g/mol) concentrations Oligonucleotides Variable 500 M Triethyl amine 101.19 2M DMSO 78.13 100% Fluorophore Variable 10 mM Ascorbic acid 176.12 5 mM Cupric Sulphate 249.69 20.02 mM Tris[(1-benzyl-1H-1,2,3- 530.63 19.87 mM Triazol-4-yl)methyl] amine

[0153] 500 M stocks of the 5 modified oligonucleotide were made in Nuclease Free Water (NFW) (Sigma Cat no) and 10 mM stocks of fluorescent dyes were made in molecular biology grade DMSO (Sigma).

[0154] For a 100 L CuAAC reaction, 50 M of alkynated oligo solution (10 L from 500 M stock in NFW) was sequentially treated with 0.2 M of Triethylammonium acetate buffer, pH 7.0 (Sigma) followed by the addition of 50 L DMSO. The reaction was mixed properly by vortexing. 150 M of the fluorescent azide solution (1.5 L from 10 mM stock in DMSO) and 0.5 mM of freshly prepared ascorbic acid solution in NFW were further added to the reaction mixture, with proper mixing after addition of each reagent. The reaction mix was then degassed properly and flushed with argon for about 60 seconds. 0.5 mM of Copper (II)-Tris [(1-benzyl-1H-1,2,3-trizole-4-yl)methyl]amine complex (Cu-TBTA complex, prepared by mixing 5 mg/mL copper (II) sulphate pentahydrate and 10.5 mg/mL of TBTA in 55% DMSO) was added to the reaction mixture, mixed thoroughly by vortexing and was again flushed with argon for another 60-100 seconds. The reaction was incubated for 12-16 hours at 22 C. After the completion of the reaction, the reaction was precipitated by adding 3 volumes of chilled acetone and stored at 20 C. for 30 minutes. The labeled DNA was extracted by high-speed centrifugation of the mixture at 10,000 rpm for 20 minutes, at 4 C.

[0155] The pellet obtained at this step was washed twice with 1 mL of chilled acetone. The pellet obtained after final washing was dried by further incubating the tube at 22 C. for approximately 30 minutes. The dried fluorophore-labeled oligonucleotide obtained at this step was resuspended in 45 L of chilled NFW for HPLC purification.

[0156] Analytical purification of the labeled oligonucleotide was carried out by HPLC using a dual pump Shimadzu HPLC system equipped with 20 L sample loop, and RF-20A spectrofluorometric and SPD-10A UV-VIS detectors, over an XTerra MS C18 column (754.6 mm packed with 2.5 m particles, average pore diameter 125 ) with an Inertsil C4 5 m guard column (4.010 mm). The fluorescence detector was set with the corresponding excitation and emission wavelengths for the fluorophore of interest, while 260 and 280 nm wavelengths were set in the UV detector. The mobile phase was composed of 0.1 M triethylammonium acetate buffer, pH 7.0 (Sigma), and acetonitrile (HPLC grade, Sigma). The oligos were separated by running an acetonitrile gradient of 0-60% over 30 minutes through the column, at a flow rate of 1 mL/min. The peaks corresponding to both the fluorescent and UV detection were collected manually and stored at 20 C. These stored samples were frozen in liquid nitrogen and lyophilized in CHRiST lyophilization system at 0.08 mbar and 51 C. The lyophilized probes were stored at 20 C. and used in RT-PCR for detection of the respective genes.

Demonstration of Application of Quenchers in RT-PCR Based Diagnosis of SARS Cov-2 Infection

Assay Procedure:

[0157] 1) Extract RNA using commercially available kits. For RT-PCR reaction, a single tube RT-mix allows first-strand synthesis of cDNA from RNA molecules followed by PCR amplification and detection using specific primer-probe. Depending upon the abundance of target RNA, template concentration can be used in the range of 0.5 pg-0.5 g. Alternatively, the reaction can be performed separately by cDNA synthesis (0.5 g-2 g). The cDNA can be diluted 3-5 times and used for PCR amplification and detection using specific primer-probe. [0158] 2) For reaction set-up for real time PCR and cycling protocol, follow manufacture's protocol. The primers (Forward and Reverse) and probe concentration can be used 0.2 M-1 M. [0159] 3) The fluorophore-quencher is compatible for detection of target genes in various real-time PCR instruments (ABI, BioRad) using Fluorophore specific channels.

[0160] FIG. 9 provides RT-PCR data representation with the cycle threshold (Ct) on X-axis and RFU on Y-axis. FAM-RnaseP-BHQ1 (from IDT) was used as a positive control. Probes used for detection had CDRI-Q2 at 3end and FAM/Texas red (TR)/Cy5 at 5end. Data demonstrates the CDRI-Q2 quenching compatibility in diverse range (520 nm-670 nm) for accurate RT-PCR based detection.

[0161] Multiplexing RT-PCR based detection of SARS-CoV-2 viral genes E and RdRp and RnaseP as housekeeping gene was conducted using positive Control; data represents with the cycle threshold (Ct) on X-axis and RFU on Y-axis as shown in FIG. 10. Data demonstrated the CDRI-Q2 quenching compatibility in diverse emission range (450 nm-700 nm) for RT-PCR.

[0162] Also, FIG. 11 illustrates Multiplexing RT-PCR based detection of SARS-CoV-2 viral genes E and RdRp and Rnase P as housekeeping gene using positive RNA samples from COVID-19 positive patients; data represents with the cycle threshold (Ct) on X-axis and RFU on Y-axis. FAM-E-CDRI-Q2, TR-RdRp-CDRI-Q2 and Cy5-RnaseP-CDRI-Q2 probes were used. Data demonstrates the CDRI-Q2 quenching compatibility in diverse emission range (450 nm-700 nm) for RT-PCR.

Advantages of the Present Invention

[0163] The present invention provides a family of significantly non-fluorescent quenchers of excited state energy, well-defined modified quenchers of already known BHQ-2 (Black Hole Quencher). As per the literature, BHQ-2 is good for the dyes that emit in the orange-red part of visible range (560-670 nm), and it is not suitable for FAM. For FAM, BHQ-1 is preferably used. The present invention provides a class of universal quenchers that are functionalized to allow their rapid attachment to probe components and provides quenchers that are engineered to have a desired broad quenching range covering of entire visible spectrum. The present invention illustrate use of fluorophore azides which are stable at room temperature and are not hygroscopic in nature

[0164] A quencher may consist of electron donating and withdrawing groups combining together by a pi-conjugating network. By modifying conjugated system of quencher and/or incorporating electron donating and withdrawing groups onto aromatic scaffold, the spectral properties (e.g., absorbance) can be tuned to match the spectral characteristics (e.g., emission) of one or more fluorophores. New quenchers of the present invention showed broad absorption spectra covering entire visible color range. These quenchers can be used to quench different fluorophores which emit in the range between 500-750 nm such as FAM, Cyanine dyes, Texas red, Calfluor red, as well as other fluorescent dyes. Moreover, it has better quenching properties such as higher absorbance than other well-known BHQ-dyes.