CONSTRUCTION OF RECOMBINANT SACCHAROMYCES CEREVISIAE FOR SYNTHESIZING CARMINIC ACID AND APPLICATION THEREOF

Abstract

The disclosure discloses construction of recombinant Saccharomyces cerevisiae for synthesizing carminic acid and application thereof and belongs to the technical field of genetic engineering and bioengineering. The disclosure obtains recombinant S. cerevisiae CA-B2 capable of synthesizing carminic acid by heterologously expressing cyclase Zhul, aromatase ZhuJ, OKS of Octaketide synthase 1, C-glucosyltransferase UGT2, monooxygenase aptC and 4′-phosphopantetheinyl transferase npgA in S. cerevisiae. The recombinant S. cerevisiae can be used for synthesizing carminic acid by taking self-synthesized acetyl-CoA and malonyl-CoA as a precursor. On this basis, OKS, cyclase, aromatase, C-glucosyltransferase and monooxygenase relevant to carminic acid are integrated to a high copy site, which can remarkably improve the yield of carminic acid. The yield of carminic acid can be increased to 2664.6 .Math.g/L by optimizing fermentation conditions, and the fermentation time is shortened significantly. Therefore, the recombinant S. cerevisiae plays an important role in the fields of cosmetics, textiles and food.

Claims

1. A recombinant bacterium, wherein by taking Saccharomyces cerevisiae as an original strain, 4′-phosphopantetheinyl transferase derived from Aspergillus nidulans undergoes integrated expression on a genome of the original strain, and octaketide synthase, cyclase, aromatase, C-glucosyltransferase and monooxygenase undergoes ectopic expression or integrated expression.

2. The recombinant bacterium according to claim 1, wherein the amino acid sequence of the 4′-phosphopantetheinyl transferase is as set forth in SEQ ID NO.14, the amino acid sequence of the octaketide synthase is as set forth in SEQ ID NO.15, the amino acid sequence of the C-glucosyltransferase is as set forth in SEQ ID NO.18, the amino acid sequence of the monooxygenase is as set forth in SEQ ID NO.19, the amino acid sequence of the cyclase is as set forth in SEQ ID NO.16, the amino acid sequence of the aromatase is as set forth in SEQ ID NO.17.

3. The recombinant bacterium according to claim 1, wherein a GAL80 gene in the genome is knocked out, and the nucleotide sequence of the GAL80 gene is as set forth in SEQ ID NO.21.

4. The recombinant bacterium according to claim 1, wherein an ADY2 gene in the genome of the S. cerevisiae is knocked out, and the nucleotide sequence of the ADY2 gene is as set forth in SEQ ID NO.22.

5. The recombinant bacterium according to claim 1, wherein the octaketide synthase, cyclase, aromatase, C-glucosyltransferase and monooxygenase are integrated to a high copy site.

6. The recombinant bacterium according to claim 5, wherein the high copy site is a Ty2Cons site.

7. A method for producing carminic acid, comprising producing the carminic acid by fermentation by taking the recombinant bacterium according to claim 4 as a fermentation strain.

8. The method according to claim 7, wherein method comprising: (1) enriching and culturing the recombinant bacteria in YNB medium for 20-24 hours to obtain enriched cells; (2) transfer enriched cells to YPD medium, culturing for 70-76 hours, adding pyruvic acid every 20-24 hours, and fermenting for 72-264 hours; alternatively, (1) enriching the recombinant bacteria in YNB medium for 40-48 hours to obtain enriched cells; (2) add the enriched cells to YPD medium for fermentation, and add ethanol or acetic acid every 20-24 hours.

9. The method according to claim 8, wherein pyruvic acid is added with the amount of 1∼5 g per liter of reaction system.

10. The method according to claim 8, wherein a concentration of the ethanol in a reaction system is 0.1-0.5%.

11. The method according to claim 8, wherein a concentration of the acetic acid is 45-55%, and an addition amount of the acetic acid is 0.1-0.5% by volume of the reaction system.

Description

BRIEF DESCRIPTION OF FIGURES

[0040] FIG. 1 is a plasmid profile of a recombinant vector pY26-CA pathway A.

[0041] FIG. 2 is a plasmid profile of a recombinant vector pY26-CA pathway B.

[0042] FIG. 3 is a gel electrophoretogram of colony PCR verification of recombinant S. cerevisiae CA-A1.

[0043] FIG. 4 is a gel electrophoretogram of colony PCR verification of recombinant S. cerevisiae CA-B1.

[0044] FIG. 5 is a gel electrophoretogram of colony PCR verification of recombinant S. cerevisiae C800-npgA.

[0045] FIG. 6 is a gel electrophoretogram of colony PCR verification of recombinant S. cerevisiae CA-A2.

[0046] FIG. 7 is a gel electrophoretogram of colony PCR verification of recombinant S. cerevisiae CA-B2.

[0047] FIG. 8A is an LCMS graph of recombinant S. cerevisiae CA-B2 and a carminic acid standard substance, where a is the carminic acid standard substance and b is fermentation liquor of the recombinant S. cerevisiae CA-B2.

[0048] FIG. 8B is an LCMS graph of recombinant S. cerevisiae CA-B2, a control group C800-npgA and a carminic acid standard substance, where a is the carminic acid standard substance, b is fermentation liquor of the recombinant S. cerevisiae CA-B2, and c is an original strain C800-npgA.

[0049] FIG. 9 is a synthetic pathway diagram of synthesizing carminic acid by S. cerevisiae.

[0050] FIG. 10 is a plasmid profile of pCT23-CA.

[0051] FIG. 11A is an expression box of a synthetic pathway of carminic acid.

[0052] FIG. 11B is a fermentation result diagram of 24-deep well plates.

[0053] FIG. 11C is a yield diagram of carminic acid.

[0054] FIG. 12 is a yield diagram of carminic acid under different fermentation conditions.

DETAILED DESCRIPTION

(I) Culture Medium

[0055] An LB culture medium: a liquid culture medium was prepared from 10 g/L peptone, 5 g/L yeast powder and 10 g/L sodium chloride; and 20 g/L agar strip was added into the liquid culture medium to prepare an LB solid culture medium.

[0056] A YNB culture medium was prepared from 6.74 g/L yeast nitrogen base culture medium (without ammonium sulfate), 5 g/L ammonium sulfate, 20 g/L glucose and amino acids (5 g/L uracil, 10 g/L tryptophan, 10 g/L leucine and 10 g/L histidine, with proper amino acid deletion as needed).

[0057] An YPD culture medium was prepared from 20 g/L peptone, 10 g/L yeast powder and 20 g/L glucose.

(II) Solution

[0058] Preparation of 200 g/L pyruvic acid solution: 10 g of pyruvic acid was dissolved in 50 mL of ultrapure water.

[0059] (III) extraction and concentration of carminic acid: 5 mL of fermentation liquor was collected, isometric extract liquor was added (the extract liquor contained ethyl acetate, normal butanol and formic acid in a volume ratio of 69:30:1), the fermentation liquor was extracted to extract a fermentation product, an organic phase was collected and rotatory-dried by distillation, 1 ml of methanol (with 1% formic acid) was added to resuspend, and the organic phase passed through a membrane for HPLC analysis.

[0060] (IV) HPLC detection of carminic acid: by utilizing a chromatographic column (250*4.6 mm, 5 .Math.m, Thermo-Fisher, MA, USA), a mobile phase was eluted with an aqueous solution (A) containing 0.1% formic acid and acetonitrile containing 0.1% formic acid at a flow rate of 1 mL/min by using an SPD-20A detector (SHIMADZU, Japan) under 40° C. detection condition, a detection wavelength being 494 nm, an elution condition being 0-20 min, 10%-100% B; 20-25 min, 100% B; 25-27 min, 100%-10%B; and 28-30 min, 10%B.

(V) Lithium Acetate Conversion Method

[0061] A S. cerevisiae cell was streaked on an YPD panel and cultured at 30° C. for 3 days, a single colony was picked and inoculated to a 5 mL YPD liquid culture medium and was subjected to shaking culture at 30° C. at 220 rpm for 16 h, a bacterial solution was diluted till an OD.sub.600 value was 0.3 and was then transferred to 50 mL of fresh YPD liquid culture media and was subjected to shaking culture at 30° C. at 220 rpm for about 5 h till the OD.sub.600 value was 1.2-1.6.

[0062] The bacterial solution was collected and pre-cooled for 5 min on ice, the bacterial solution was centrifugalized at 5000*g for 5 min to collect bacterial cells, 25 mL of pre-cooled sterile water was added to resuspend the bacterial cells, the bacterial cells was centrifugalized at 5000*g for 5 min to collect precipitates, namely the bacterial cells, 1 mL of 0.1 mM lithium acetate was added into the bacterial cells to resuspend the bacterial cells, the bacterial cells was centrifugalized at 5000*g for 1 min to collect precipitates, namely the bacterial cells, 400 .Math.L of 0.1 mM lithium acetate solutions was added into the bacterial cells to resuspend the bacterial cells, 50 .Math.L of resuspended solutions was added into 240 .Math.L of PEG3350, 36 .Math.L of 1 mM lithium acetate solutions and 25 .Math.L of 2 mg/mL ssDNA respectively, the mixture was subjected to shaking for 30 s to evenly mix the system, then the system was cultured at 30° C. for 30 min, the system was then subjected to hot shock in a 42° C. water bath after culture for 25 min, the system was centrifugalized at 5000*g for 1 min to collect bacterial cells, 1 mL of sterile resuspended bacterial cells was added, and 100 .Math.L of bacterial cells resuspended solution was smeared to a corresponding YNP panel, and was cultured at 30° C. for 3 days.

(VI) Gibson Assembling Method

[0063] A reaction system: 50 ng of DNA fragments was added, 100 ng of vectors was added, 5 .Math.L of Gibson mix was added, and sterilize ultrapure water was added till the system was 10 .Math.L.

[0064] A reaction condition: a reaction was performed at 50° C. for 60 min, and the system was placed on ice immediately after the reaction was finished to obtain a reaction solution. 10 .Math.L of the reaction solutions was converted into an E. coli competent JM109.

[0065] (VII) Construction of chassis cell C800: the chassis cell with GAL80 knocked out was constructed based on S. cerevisiae CEN.PK2-1D cell (GAL80 was involved in galactose metabolic regulation, the constitutive expression of a GAL7 promoter could be realized after knockout instead of inducible expression); GAL80 (Gene ID: 854954) was knocked out according to a principle of homologous recombination of yeast, and the C800 chassis cell was constructed by taking G418 as a selection marker. A specific construction process was seen in literature Promoter-Library-Based Pathway Optimization for Efficient (2S)-Naringenin Production From p-Coumaric Acid in S. cerevisiae, Song Gao, Hengrui Zhou, Jingwen Zhou, Jian Chen. J Agric Food Chem, 2020 Jun 24.

(VIII) Primer Star MasterMix Was Purchased From Takara

Definition of Ectopic Expression and Integrated Expression

[0066] Ectopic expression means the occurrence of gene expression in a tissue in which it is normally not expressed.

[0067] Integrated expression means expression that occurs when a gene is integrated into the genome.

Example 1: Construction of Expression Box of Related Gene of Synthetic Pathway Of Carminic Acid

[0068] By taking a synthetic sequence of Zhul (the nucleotide sequence was as set forth in SEQ ID NO.3) as a template, a primer pair F1/R1 was designed, PCR amplification was performed with the primer pair by using a high fidelity enzyme pfu enzyme of Primer Star MasterMix under the following conditions: predegeneration was performed at 95° C. for 3 min; 30 cycles was performed in an amplification stage according to 95° C., 10 s, 55° C., 10 s and 72° C., 30 s; extension was performed at 72° C. for 5 min, a PCR product was purified to obtain a fragment Zhul; and by taking a vector pY26 as a template, PCR amplification was performed with a primer pair F2/R2, and a product was purified. The fragment Zhul and the vector pY26 were recombined by means of the Gibson assembling method to obtain a recombinant vector, the recombinant vector was converted into Escherichia coli JM109, and a plasmid was extracted, sequenced and verified, so as to obtain a correct recombinant vector pY26-Zhul.

[0069] By taking a synthetic sequence of ZhuJ (the nucleotide sequence was as set forth in SEQ ID NO.4) as a template, a primer pair F3/R3 was designed, PCR amplification was performed with the primer pair and a product was purified to obtain a fragment ZhuJ; by taking the vector pY26-Zhul as a template, a primer pair F4/R4 was designed, PCR amplification was performed with the primer pair and a product was purified to obtain a fragment of the vector pY26-Zhul. The fragment ZhuJ and the vector pY26-Zhul were recombined by means of the Gibson assembling method to construct a recombinant vector pY26-Zhul-ZhuJ, the recombinant vector pY26-Zhul-ZhuJ was converted into E. coli JM109, and a plasmid was extracted, sequenced and verified, so as to obtain a correct recombinant vector pY26-Zhul-ZhuJ.

[0070] By taking a synthetic sequence of OKS (the nucleotide sequence was as set forth in SEQ ID NO.2) as a template, PCR amplification was performed with a primer pair F5/R5 and a product was purified to obtain a fragment OKS; by taking a promoter pINO1 (the nucleotide sequence was as set forth in SEQ ID NO.7), PCR amplification was performed with a primer pair F6/R6 and a product was purified to obtain a fragment pINO1; by taking a terminator tPGK1 (the nucleotide sequence was as set forth in SEQ ID NO.8) as a template, PCR amplification was performed with a primer pair F7/R7 and a product was purified to obtain a fragment tPGK1. By taking a pMD19T-simple as a template, PCR amplification was performed with a primer pair F8/R8 and a product was purified to obtain a vector fragment of the pMD19T-simple. The OKS, pINO1, tPGK1 and vector pMD19T-simple were assembled by means of the Gibson assembling method to obtain a vector pMD19T-pINO1-OKS-tPGK1, the obtained vector was converted into E. coli JM109, and was sequenced and verified, so as to obtain a correct recombinant vector pMDl9T-pIN01-OKS-tPGK1.

[0071] By taking a synthetic sequence of UGT2 (the nucleotide sequence was as set forth in SEQ ID NO.5) as a template, PCR amplification was performed with a primer pair F9/R9 and a product was purified to obtain a fragment UGT2; by taking the promoter pTDH1 (the nucleotide sequence was as set forth in SEQ ID NO.9) as a template, PCR amplification was performed with a primer pair F10/R10 and a product was purified to obtain a fragment pTDH1; by taking a terminator ter-pGAL7 (the nucleotide sequence was as set forth in SEQ ID NO.10) as a template, PCR amplification was performed with a primer pair F11/R11 and a product was purified to obtain a fragment ter-pGAL7; and by taking pMD19T-simple as a template, PCR amplification was performed with a primer pair F12/R12 and a product was purified to obtain a linearized vector pMD19T-simple. The fragments UGT2, pTDH1 and ter-pGAL7 and the vector pMD19T-simple were assembled by means of the Gibson assembling method to obtain a recombinant vector pMD19T-pTDH1-UGT2-ter-pGAL7, the obtained recombinant vector was converted into E. coli JM109, and a plasmid was extracted, sequenced and verified, so as to obtain a correct recombinant vector pMD19T-pTDH1-UGT2-ter-pGAL7.

[0072] By taking a synthetic sequence of aptC (the nucleotide sequence was as set forth in SEQ ID NO.6) as a template, PCR amplification was performed with a primer pair F13/R13 and a product was purified to obtain a fragment aptC; by taking a terminator tVPS13 (the nucleotide sequence was as set forth in SEQ ID NO.11) as a template, PCR amplification was performed with a primer pair F14/R14 and a product was purified to obtain a fragment tVPS13; and by taking pMD19T-simple as a template, PCR amplification was performed with a primer pair F15/R15 and a product was purified to obtain a linearized vector pMD19T-simple. The fragments aptC and tVPS13 and the vector pMD19T-simple were assembled by means of the Gibson assembling method to obtain a recombinant vector pMD19T-aptC-tVPS13, and the obtained recombinant vector was converted into E. coli JM109, and was sequenced and verified, so as to obtain a correct recombinant vector pMD19T-aptC-tVPS13.

[0073] By taking a synthetic sequence of npgA (the nucleotide sequence was as set forth in SEQ ID NO.1) as a template, PCR amplification was performed with a primer pair F16/R16 and a product was purified to obtain a fragment npgA; by taking the promoter pGAL1 as a template, PCR amplification was performed with a primer pair F17/R17 and a product was purified to obtain a fragment pGALl; and by taking a vector pY26 as a template, PCR amplification was performed with a primer pair F18/R18 and a product was purified to obtain a linearized vector pY26. The fragments npgA and pGAL1 and the vector pY26 were recombined by means of the Gibson assembling method to obtain a recombinant vector pY26-pGAL1-npgA, and the obtained recombinant vector was converted into E. coli JM109, and was sequenced and verified, so as to obtain a correct recombinant vector pY26-pGAL1-npgA.

TABLE-US-00001 primers used Primers Sequences 5′-3′ (Underlined parts are regions of homologous arms) Fl GCGAAGAATTTTAAGCAGTAACAGTACCAACACCACCAGCAG R1 TCTAGAACTAATGAGACATGTTGAACATACTGTTACTGTCG F2 CATGTCTCATTAGTTCTAGAAAACTTAGATTAGATTGCTATGCTTTCTTTCT R2 TACTGCTTAAAATTCTTCGCCAGAGGTTTGGTCAA F3 TTCGACGGATATGTCTGGTAGAAAGACTTTCTTGGATTTGT R3 GTGACATAACTTAATCTTCTTCTTCTTGTTCGAAAACAGCAACAAC F4 AGAAGATTAAGTTATGTCACGCTTACATTCACGCC R4 TACCAGACATATCCGTCGAAACTAAGTTCTGGTGT F5 TCAATTCAATTTACATCAATGGCAAAGAATGCAACAAAATAGTTTC R5 AAGAAGTAACATGTCCTCTTTGTCCAACGCTTCC F6 AAGAGGACATGTTACTTCTTTTTCACTGGAAAAAAAAGGGAATGAAAC R6 TTCGACGATTGAAGACGATGAGGCCGGTG F7 TCCAGAGATTTTTGAACCTCATTGTATTTTACGGAAAAGAATATCATACTC R7 ATTGATGTAAATTGAATTGAATTGAAATCGATAGATCAATTTTTTTCTTTTCTCTTTC F8 CATCGTCTTCAATCGTCGAACGGCAGGC R8 GAGGTTCAAAAATCTCTGGAAGATCCGCGC F9 ACAAAACAAAATGGAATTCAGATTATTGATTTTGGCTTTATTCTCTG R9 AGCTGGCAAATTAGTTCTTCTTCAACTTTTCAGACTTAGAAGAAGACC F10 TCCAGAGATTGAAACCACACCGTGGGGC R10 TGAATTCCATTTTGTTTTGTGTGTAAATTTAGTGAAGTACTGTTTTTTGTG F11 GAAGAACTAATTTGCCAGCTTACTATCCTTCTTGAAAATATGC R11 TTCGACGATTTTTTGAGGGAATATTCAACTGTTTTTTTTTATCATGTTGATG F12 TCCCTCAAAAAATCGTCGAACGGCAGGC R12 GTGTGGTTTCAATCTCTGGAAGATCCGCGC F13 TCCAGAGATTATGACTTTGCCAGTTTTGATTATTGGTG R13 TCATATGTGATTAAGCTCTCATCTTTTGCTTTTCAGCGA F14 GAGAGCTTAATCACATATGAAAGTATATACCCGCTTTTGTACAC R14 TTCGACGATTGAGAGTAGACTTTTTCTGTGAAATTTAATGAGTTTTTGT F15 GTCTACTCTCAATCGTCGAACGGCAGGC R15 GCAAAGTCATAATCTCTGGAAGATCCGCGC F16 AAAAACTATAATGGTTCAAGATACTTCTTCAGCTTCTACATC R16 AATTACATGATTAAGATAAACAATTACAAACACCTGTAGCACATGG F17 TAACTGATCATTATATTGAATTTTCAAAAATTCTTACTTTTTTTTTGGATGGACG R17 CTTGAACCATTATAGTTTTTTCTCCTTGACGTTAAAGTATAGAGGTATATTAACAAT F18 TTTATCTTAATCATGTAATTAGTTATGTCACGCTTACATTCACG R18 TTCAATATAATGATCAGTTAACTCCGGACCGC

Example 2: Construction of Vector A of Synthetic Pathway of Carminic Acid

[0074] By taking a vector pMDl9T-pIN01-OKS-tPGK1 constructed in Example 1 as a template, PCR amplification was performed with a primer pair F19/R19 and a product was purified to obtain a fragment pINO1-OKS-tPGK1; by taking pMD19T-pTDH1-UGT2-ter-pGAL7 constructed in Example 1 as a template, PCR amplification was performed with a primer pair F20/R20 and a product was purified to obtain a fragment pTDH1-UGT2-ter-pGAL7; and by taking pY26-Zhul-ZhuJ constructed in Example 1 as a template, PCR amplification was performed with a primer pair F21/R21 and a product was purified to obtain a vector fragment pY26-Zhul-ZhuJ. The fragments pINO1-OKS-tPGK1 and pTDH1-UGT2-ter-pGAL7 and the vector pY26-Zhul-ZhuJ were recombined by means of the Gibson assembling method to obtain a recombinant vector, and the obtained recombinant vector was converted into E. coli JM109, and was sequenced and verified, so as to obtain a correct recombinant vector pY26-CA pathway A (pY26-Zhul-ZhuJ-pINO1-OKS-tPGK1-pTDH1-UGT2-ter-pGAL7) (see FIG. 1)

TABLE-US-00002 primers used Primers Sequences 5′-3′ (Underlined parts are regions of homologous arms) F19 GTCGTATTACTTTGAACCTCATTGTATTTTACGGAAAAGAATATCATACTC R19 GTGTGGTTTCGAGGCTTGTCAGTACATCAGCGAT F20 GACAAGCCTCGAAACCACACCGTGGGGC R20 GTGAGCGCGCTTTTGAGGGAATATTCAACTGTTTTTTTTTATCATGTTGATG F21 TCCCTCAAAAGCGCGCTCACTGGCC R21 GAGGTTCAAAGTAATACGACTCACTATAGGGCGAATTGG

Example 3: Construction of a Vector B of a Synthetic Pathway of Carminic Acid

[0075] By taking a pMD19T-aptC-tVPS13 constructed in Example 1 as a template, PCR amplification was performed with a primer pair F22/R22 and a product was purified to obtain a fragment aptC-tVPS13; by taking pY26-CA pathway A as a template, PCR amplification was performed with a primer pair F23/R23 to obtain a linearized vector pY26-CA pathway A. The fragment aptC-tVPS13 and the vector pY26-CA pathway A were recombined by means of the Gibson assembling method to obtain a recombinant vector, and the obtained recombinant vector was converted into E. coli JM109, and was sequenced and verified, so as to obtain a correct recombinant vector pY26-CA pathway B (pY26-Zhul-ZhuJ-pINO1-OKS-tPGK1-pTDH1-UGT2-ter-pGAL7-aptC-tVPS13) (see FIG. 2).

TABLE-US-00003 primers used Primers Sequences 5′-3′ (Underlined parts are regions of homologous arms) F22 TCCCTCAAAAATGACTTTGCCAGTTTTGATTATTGGTG R22 GTGAGCGCGCGAGAGTAGACTTTTTCTGTGAAATTTAATGAGTTTTTGTTC F23 GTCTACTCTCGCGCGCTCACTGGCC R23 GCAAAGTCATTTTTGAGGGAATATTCAACTGTTTTTTTTTATCATGTTG

Example 4: Analysis of Synthetic Pathway of Carminic Acid

[0076] The recombinant vector pY26-CA pathway A and the recombinant vector pY26-CA pathway B were converted into the chassis cell C800 by means of a lithium acetate chemical conversion method, and were cultured on a YNB panel without uracil at 30° C. for 3 days till a single colony grew; the single colony was picked and cultured in a YNB culture medium without uracil at 220 rpm for 24 h; and the following primer pair was designed:

TABLE-US-00004 F24: TCATGTTTATGGTAGAACTAGAGAATACTTGCAATTAGAAAAG;

TABLE-US-00005 R24: GTTTTGTGGGATTGTGGTAACATGGTC.

[0077] The cultured bacterial solution was subjected to PCR verification with the primer pair, and a correct clone was picked to construct recombinant S. cerevisiae CA-A1 (expressing pY26-CA pathway A based on the chassis cell C800, see FIG. 3) and CA-B1 (expressing pY26-CA pathway B based on the chassis cell C800, see FIG. 4). The recombinant S. cerevisiae CA-A1 and CA-B1 were streaked on the YNB panel without uracil and cultured at 30° C. for 3 days till a single colony grew; the single colony was picked and cultured in the YNB culture medium without uracil at 220 rpm for 24 h, and was transferred to the YPD culture medium, 200 g/L pyruvic acid at 1 mL/100 mL was added every 24 h after 72 h, sampling was performed respectively at 72 h, 120 h, 168 h, 216 h and 264 h, the bacterial solution was extracted, and an HPLC result showed that carminic acid products were not detected in the recombinant S. cerevisiae CA-A1 and CA-B1.

Example 5: Integrative Expression of npgA in Genome of S. Cerevisiae Based on CRISPR-Cas9 Technology

[0078] A npgA expression box is integrated to a ADY2 site of the genome to express by utilizing the CRISPR-Cas9 technology, and the following primer pair was designed by taking pY26-pGAL1-npgA as a template:

TABLE-US-00006 F25: ATGTCTGACAAGGAACAAACGAGCGGAAACACAGATTTGGAGAATGCACCAGCAGGATACTTATATTG AATTTTCAAAAATTCTTACTTTTTTTTTGGA;

TABLE-US-00007 R25: CATAGCACAACCGACGACAACATTAGGAACAGTGATCCCTTGCGCTCTCGCATTGAACGTAATACGACTC ACTATAGGGCGAATTGG.

[0079] PCR amplification was performed with the primer pair and a product was purified to obtain a fragment UP60-pGAL1-npgA-ter-DOWN60. The UP60-pGAL1-npgA-ter-DOWN60, the p414-TEF1p-Cas9-CYC1t plasmid and 20 nt sgRNA plasmid pRS426-ADY2-sgRNA containing ADY2 (the nucleotide sequence thereof was as set forth in SEQ ID NO.12) were converted into the chassis cell C800 by means of a lithium acetate chemical conversion method, and were cultured on a YNB panel without uracil and tryptophan at 30° C. for 3 days till a single colony grew; the single colony was picked and cultured in a YNB culture medium without uracil and tryptophan at 220 rpm for 24 h; and the following primer pair was designed:

TABLE-US-00008 F26: GCTACTGCTGCAAGAGGTGG,

TABLE-US-00009 R26: CATGGTACAAACGGTTAAACCAAACGT.

[0080] PCR verification was performed on the cultured bacterial solution with the primer pair, a correct clone was picked, and a plasmid pRS426-ADY2-sgRNA was eliminated through continuous passage culture and spotting verification of plasmid elimination so as to construct the recombinant S. cerevisiae C800-npgA (see FIG. 5).

Example 6: Identification of Synthetic Pathway of Carminic Acid

[0081] The correctly sequenced recombinant vector pY26-CA pathway A and the recombinant vector pY26-CA pathway B were respectively converted into the chassis cell C800 by means of a lithium acetate chemical conversion method, and were cultured on a YNB panel without uracil at 30° C. for 3 days till a single colony grew; the single colony was picked and cultured in a YNB culture medium without uracil at 220 rpm for 24 h; and the following primer pair was designed:

TABLE-US-00010 F27: TCATGTTTATGGTAGAACTAGAGAATACTTGCAATTAGAAAAG;

TABLE-US-00011 R27: GTTTTGTGGGATTGTGGTAACATGGTC.

[0082] The cultured bacterial solution was subjected to PCR verification with the primer pair, and a correct clone was picked to construct recombinant S. cerevisiae CA-A2 (expressing pY26-CA pathway A based on the chassis cell C800-npgA, see FIG. 6) and CA-B2 (expressing pY26-CA pathway B based on the chassis cell C800-npgA, see FIG. 7). The recombinant S. cerevisiae CA-A2 and CA-B2 were streaked on the YNB panel without uracil and cultured at 30° C. for 3 days till a single colony grew; the single colony was picked and cultured in the YNB culture medium without uracil at 220 rpm for 24 h, and was transferred to the YPD culture medium, 200 g/ L pyruvic acid at 1 mL/100 mL was added every 24 h after 72 h, sampling was performed respectively at 72 h, 120 h, 168 h, 216 h and 264 h, the bacterial solution was extracted, and an HPLC result showed that carminic acid products were not detected in the recombinant S. cerevisiae CA-A2, and carminic acid products were detected in the recombinant S. cerevisiae CA-B2. In order to further confirm that the compound is carminic acid, LCMS analysis was performed, identifying that the substance was carminic acid (see FIG. 8). Therefore, expressing npgA, Zhul, ZhuJ, OKS, UGT2 and aptC in S. cerevisiae can synthesize carminic acid.

TABLE-US-00012 Yield of carminic acid 72 h 120 h 168 h 216 h 264 h Carminic acid (.Math.g/L) 0 0 24.7 39.8 52.7

Example 7: Construction of High Copy Integrative Expression Box of Synthetic Pathway of Carminic Acid

[0083] By taking a vector pCT23-EGFP (the nucleotide sequence thereof was as set forth in SEQ ID NO.13) constructed in the lab as a template, PCR amplification was performed with a primer pair F28/R28 and a PCR product was purified to obtain a fragment pCT23; by taking pY26-CA pathway B constructed in Example 3 as a template, PCR amplification was performed with a primer pair F29/R29 and a PCR product was purified to obtain a fragment pTEF-Zhul- tADH1-pGPD-ZhuJ-tCYC1-pINO1-OKS-tPGK1-pTDH1- UGT2-ter-pGAL7-aptC-tVPS13 of an expression box of a synthetic pathway of carminic acid; the fragments pCT23 and pTEF-Zhul-tADH1-pGPD-ZhuJ-tCYC1-pINO1-OKS-tPGK1-pTDH1-UGT2-ter-pGAL7-aptC-tVPS13 were recombined by means of the Gibson assembling method to obtain a recombinant vector, and the obtained recombinant vector was converted into E. coli JM109, and was sequenced and verified, so as to obtain a correct recombinant vector pCT23-CA (pCT23-pTEF-Zhul-tADH1-pGPD-ZhuJ-tCYC1-pINO1-OKS-tPGK1-pTDH1-UGT2- ter-pGAL7-aptC-tVPS13) (a plasmid profile was shown in FIG. 10).

TABLE-US-00013 primers used Primer s Sequences 5′-3′ (Underlined parts are regions of homologous arms) F28 AAAAAGTCTACTCTCTTACAAATGAATAACGAAATGAGACAAAGAAGAGAAC R28 AGCTGGCGTAATAGCGTTAATATTCATTGATCCTATTACATTATCAATCCTTGCGTTTCA F29 TCAATGAATATTAACGCTATTACGCCAGCTGAATTGGAGC R29 GTTATTCATTTGTAAGAGAGTAGACTTTTTCTGTGAAATTTAATGAGTTTTTGTTCAC

Example 8: Construction of High Copy Integratively Expressed Strain of Synthetic Pathway of Carminic Acid

[0084] Based on a homologous recombination capacity of yeast itself, the expression box of the synthetic pathway of carminic acid was integrated to a multi-copy site, Ty2Cons site, of S. cerevisiae through integrated homologous arms upstream and downstream Ty2Cons, and the following primer pair was designed:

TABLE-US-00014     F30:     GTGTCCGCGCTGAGGGTTTAATGGCGCGCCGCGGCCGCCCGCGGTGTTGGAATAAAAATCAACTA TCATCTACTAACTAGTATTTAC,

TABLE-US-00015     R30:     GTATAGGAACTTCACTTCAGGTCTGAGTGCGGCCGCAGATCTGAGAATGTGGATTTTGATGTAATT GTTGGGATTCCATTTTTAATAAG.

[0085] PCR amplification was performed on the plasmid pCT23-CA constructed in Example 7 with the primer pair and a product was purified to obtain a fragment Ty2ConsUP- pTEF-Zhul- tADH1-pGPD-ZhuJ- tCYC1-pINO1-OKS-tPGK1- pTDH1- UGT2- ter-pGAL7-aptC- tVPS13-URA3-Ty2ConsDown. The fragment Ty2ConsUP- pTEF-Zhul- tADH1-pGPD-ZhuJ- tCYC1- pINO1-OKS-tPGK1- pTDH1- UGT2- ter-pGAL7-aptC- tVPS13-URA3-Ty2ConsDown was converted into the chassis cell C800-npgA by means of a lithium acetate chemical conversion method, and was cultured on a YNB panel without uracil at 30° C. for 3 days till a single colony grew; the single colony was picked and cultured in a 24-deep well plate with 4 mL of YNB culture media at 220 rpm for 216 h; the bacterial solution was extracted, detected by HPLC, and screened to obtain a high-yield strain CA1. The high-yield strain CA1 was re-screened on a shake flask (the producing strain CA1 for carminic acid was streaked on the YNB panel without uracil, and cultured at 30° C. for 3 days till a single colony grew; the single colony was picked and inoculated to 5 mL of YNB culture media without uracil, cultured at 220 rpm for 24 h, 2 mL of seed solutions was transferred to 30 mL of YPD culture media, and was cultured at 220 rpm for 216 h), and the highest yield of carminic acid could reached 2245.7 .Math.g/L (see FIG. 11).

Example 9: Optimization of Fermentation Condition of Producing Strain of Carminic Acid

[0086] The fermentation conditions were optimized based on the producing strain CA1 of carminic acid, so that the fermentation period was shortened.

[0087] A fermentation condition A: the acid producing strain CA1 of carminic was streaked on the YNB panel without uracil, and cultured at 30° C. for 3 days till a single colony grew; the single colony was picked and inoculated to 5 mL of YNB culture media without uracil, cultured at 220 rpm for 24 h, 2 mL of seed solutions was transferred to 30 mL of YPD culture media, and was cultured for 216 h at 220 rpm.

[0088] A fermentation condition B: the producing strain CA1 of carminic acid was streaked on the YNB panel without uracil, and cultured at 30° C. for 3 days till a single colony grew; the single colony was picked and inoculated to 5 mL of YNB culture media without uracil, cultured at 220 rpm for 24 h, and 2 mL of seed solutions was transferred to 50 mL of YPD culture media, was cultured in the YNB culture medium for 48 h for cell enrichment, then resuspended in 10 mL of YPD culture media to ferment, and cultured at 220 rpm for 96 h.

[0089] A fermentation condition C: the producing strain CA1 of carminic acid was streaked on the YNB panel without uracil, and cultured for 3 days at 30° C. till a single colony grew; the single colony was picked and inoculated to 5 mL of YNB culture media without uracil, cultured for 24 h at 220 rpm, 2 mL of seed solutions was transferred to 50 mL of YPD culture media, was cultured for 48 h in the YNB culture medium after cells were enriched and resuspended in 10 mL of YPD culture media to ferment, and it was cultured at 220 rpm for 96 h under a condition of adding 0.1% ethanol every 24 h.

[0090] A fermentation condition D: the producing strain CA1 of carminic acid was streaked on the YNB panel without uracil, and cultured at 30° C. for 3 days till a single colony grew; the single colony was picked and inoculated to 5 mL of YNB culture media without uracil, cultured for 24 h at 220 rpm, and 2 mL of seed solutions was transferred to 50 mL of YPD culture media, was cultured in the YNB culture medium for 48 h for cell enrichment, then resuspended in 10 mL of YPD culture media to ferment, and cultured at 220 rpm for 96 h under a condition of adding 0.1% of 50% acetic acid every 24 h.

[0091] Yields of carminic acid in the fermentation conditions B, C and D were higher than that of carminic acid in the fermentation condition A. Under the condition of supplementing 0.1% ethanol (the fermentation condition C), after fermentation in YPD for 96 h, the yield of carminic acid was 2664.6 .Math.g/L. Compared with the fermentation condition A (2245.7 .Math.g/L, the fermentation period 216 h), the yield of carminic acid was increased by 18.7%, and the period was shortened by half, thereby greatly saving the time cost and increasing the yield of carminic acid (see FIG. 12).

[0092] Although disclosed with preferred examples above, the disclosure is not limited by the examples. Any of those skilled in the art may make various alternations and modifications without departing the spirit and scope of the disclosure. Therefore, the scope of protection of the disclosure should be subject to the scope of the disclosure as defined in the claims.