Composition for separating extracellular vesicles comprising amine-functionalized solid support and homobifunctional hydrazide
20250065298 ยท 2025-02-27
Inventors
Cpc classification
B01J20/165
PERFORMING OPERATIONS; TRANSPORTING
B01J20/28004
PERFORMING OPERATIONS; TRANSPORTING
B01J2220/64
PERFORMING OPERATIONS; TRANSPORTING
International classification
B01J20/28
PERFORMING OPERATIONS; TRANSPORTING
Abstract
Proposed are an extracellular vehicle-isolating composition including a homobifunctional hydrazide and a solid support functionalized with amine groups, and a method of isolating extracellular vesicles by using the composition. The method may isolate highly enriched high-purity EVs from a biological sample and also enable simultaneous operation for EVs isolation and extraction of EV-derived proteins or EV-derived nucleic acids. The method is low-cost and simple, does not require special equipment other than a syringe filter, and allows for high-throughput experiments due to the use of large-volume samples. The method may reduce the time required for protein and nucleic acid extraction by simplifying the experiments. Additionally, this EV enrichment may increase the sensitivity of biomarker detection for disease diagnosis and treatment.
Claims
1. A composition for isolating an extracellular vesicle (EV) from a biological sample, the composition comprising a homobifunctional hydrazide and a solid support functionalized with an amine group (NH.sub.2).
2. The composition of claim 1, wherein the solid support comprises one or more types selected from the group consisting of zeolite, silica gel, and diatomaceous earth.
3. The composition of claim 1, wherein the homobifunctional hydrazide has a structure of Formula I or II: ##STR00005## wherein in Formula I, X is (CH.sub.2).sub.n, and n is an integer of 0 to 10.
4. The composition of claim 3, wherein n is an integer of 0 to 4.
5. The composition of claim 1, wherein the homobifunctional hydrazide comprises one or more types selected from the group consisting of an adipic acid dihydrazide, a malonic dihydrazide, an oxalyl dihydrazide, a succinic dihydrazide, and a carbonic dihydrazide that respectively have the following structures: ##STR00006##
6. The composition of claim 1, wherein zeolite-NH.sub.2 is added at a concentration of 1 to 10 mg/ml per 1 ml of the biological sample.
7. The composition of claim 1, wherein zeolite-NH.sub.2 is added at a concentration of 2.5 to 5 mg/ml per 1 ml of the biological sample.
8. The composition of claim 1, wherein the homobifunctional hydrazide is added at a concentration of 10 to 100 mg/ml per 1 ml of the biological sample.
9. The composition of claim 1, wherein the homobifunctional hydrazide is added at a concentration of 25 to 50 mg/ml per 1 ml of the biological sample.
10. The composition of claim 1, wherein the composition is used in conjunction with a syringe filter.
11. The composition of claim 10, wherein the syringe filter has a pore size in a range of 0.22 to 3 m.
12. A method of isolating an extracellular vesicle (EV) from a biological sample by using the composition of any one of claims 1 to 9.
13. A method of isolating an extracellular vesicle (EV) from a biological sample, the method comprising: (a) adding the composition of any one of claims 1 to 9 to the biological sample containing the extracellular vesicle (EV); (b) transferring the resulting mixture obtained through the (a) adding into a syringe and connecting a syringe filter to the syringe; (c) pressing the syringe to remove an unreacted material and enriching the extracellular vesicle (EV) bound to zeolite-NH.sub.2 on the surface of the syringe filter; (d) isolating the extracellular vesicle (EV) from the zeolite-NH.sub.2 by injecting a high pH elution buffer; and (e) recovering the isolated extracellular vesicle (EV).
14. The method of claim 13, further comprising: incubating the mixture for EV capture after the (a) adding.
15. The method of claim 13, further comprising: washing the extracellular vesicle (EV) enriched on the surface of the syringe filter by injecting phosphate-buffered saline (PBS), after the (c) pressing.
16. The method of claim 13, wherein the syringe filter used in the (b) transferring has a pore size in a range of 0.22 to 3 m.
17. The method of claim 13, wherein, in the (d) isolating, when a RIPA lysis buffer is injected instead of the high pH elution buffer, an EV-derived protein is extracted.
18. The method of claim 13, wherein, in the (d) isolating, when (i) a non-chaotropic lysis buffer is injected instead of the high pH elution buffer, and then (ii) a high pH elution buffer is injected, an EV-derived nucleic acid is extracted.
19. The method of claim 18, wherein the non-chaotropic lysis buffer is an NP-40 lysis buffer.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0042]
[0049]
[0051]
[0052]
[0054]
[0065]
[0068]
[0069]
[0072]
[0079]
[0085]
DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0088] Hereinafter, the present disclosure will be described in detail.
[0089] The present disclosure provides an extracellular vehicle-isolating composition including a homobifunctional hydrazide (HH) and a solid support functionalized with amine groups.
[0090] In the present disclosure, all solid materials commonly used as adsorbents in the art may be used as the solid support. Representative solid supports may include zeolite and silica-based materials such as silica gel or diatomaceous earth. In one embodiment, the solid support may be one or more types selected from the group consisting of zeolite, silica gel, and diatomaceous earth but is not limited thereto.
[0091] Methods of functionalizing a solid support with amine groups are known in the art. A representative method is to functionalize hydroxyl groups with amine groups using silanization. Materials such as 3-minopropyl(diethoxy)methylsilane (APDMS) and (3-aminopropyl)triethoxysilane (APTES) may be used.
[0092]
[0093] First, the present inventors synthesized zeolite-NH.sub.2 as a solid support being functionalized with amine groups (NH.sub.2) that impart a positive charge to the surface of zeolite for EV capture. Zeolites are efficient in isolating and preserving biological molecules due to the zeolites' selective adsorption of specific molecules, high adsorption capacity, chemical and thermal stability, reusability, and environmental friendliness. Zeolites also have a large surface area, uniform pore size, and excellent ion exchangeability, so zeolites may efficiently capture negatively charged EVs. Accordingly, the advantages of zeolite use are further growing.
[0094] In the present disclosure, homobifunctional hydrazides are used with the zeolite-NH.sub.2 as a new cross-linking agent. The homobifunctional hydrazides have highly reactive and chemically tunable structures, so the homobifunctional hydrazides play an important role in the present disclosure by greatly improving the efficiency and precision of EV capture.
[0095] The term extracellular vesicle, used herein, is used interchangeably with the English abbreviation EV.
[0096] The term biological sample, used herein, is a broad concept that includes all types of specimens derived from humans or animals. Specifically, biological samples include blood, serum, plasma, saliva, urine, cerebrospinal fluid, gastric secretions, mucous membrane samples, peritoneal samples, nasal secretions, sputum, and pharyngeal exudate but is not limited thereto. Cell-free supernatants used in the embodiments described below are also included within the scope of the biological samples.
[0097] The term zeolite-NH.sub.2, used herein, refers to zeolite functionalized with amine groups (NH.sub.2) that impart a positive charge to the surface of the zeolite. The term, herein, is used interchangeably with amine-functionalized zeolite or its English abbreviation AZ.
[0098] The term homobifunctional hydrazide, used herein, refers to a compound that provides dual functionality by having each hydrazide reactive group (CONHNH.sub.2) at both ends of the molecule. The term, herein, is used interchangeably with the English abbreviation HH.
[0099] In another embodiment, the homobifunctional hydrazide may have a structure of Formula I or II:
##STR00003##
[0100] In Formula I, X is (CH.sub.2).sub.n, and n is an integer of 0 to 10.
[0101] Specifically, n may be an integer of 0 to 4, and more specifically, n may be 0, 1, 2, 3, or 4.
[0102] In yet another embodiment, the homobifunctional hydrazide may be one or more types selected from the group consisting of adipic acid dihydrazide, malonic dihydrazide, oxalyl dihydrazide, succinic dihydrazide, and carbonic dihydrazide but is not limited thereto.
[0103] In yet another embodiment, the homobifunctional hydrazide may be adipic acid dihydrazide (ADH), which is a compound with a structure of Formula (I) in which n is 4.
[0104] In yet another embodiment, the homobifunctional hydrazide may be malonic dihydrazide (MDH), which is a compound with a structure of Formula (I) in which n is 1.
[0105] In yet another embodiment, the homobifunctional hydrazide may be oxalyl dihydrazide (ODH), which is a compound with a structure of Formula (I) in which n is 0.
[0106] In yet another embodiment, the homobifunctional hydrazide may be succinic dihydrazide (SDH), which is a compound with a structure of Formula (I) in which n is 2.
[0107] In yet another embodiment, the homobifunctional hydrazide may be carbonic dihydrazide (CDH), which is a compound with a structure of Formula (II).
[0108] ADH, CDH, MDH, ODH, and SDH respectively have the following structures.
##STR00004##
[0109] One of the key properties of the homobifunctional hydrazide is having each hydrazide reactive group (CONHNH.sub.2) at both ends of the molecule, thereby the different types of the homobifunctional hydrazide provide dual functionality. Hydrazine groups (NH-NH.sub.2) inherently carry a positive charge, allowing electrostatic interaction with negatively charged EVs.
[0110] Additionally, the carbonyl components (CO) in the hydrazide groups may form imine bonds with the amine of zeolite-NH.sub.2, resulting in amplified bonding force between zeolite-NH.sub.2 and EVs. This multiplicative and robust binding mechanism between the zeolite-NH.sub.2, homobifunctional hydrazides, and EVs not only facilitates the successful EV capture and safe binding of EVs to the zeolite-NH.sub.2 surface but also achieves efficient enrichment in a remarkably swift span of only 10 minutes.
[0111] In yet another embodiment, the zeolite-NH.sub.2 may be added at a concentration of 1 to 10 mg/ml per 1 ml of biological samples. More specifically, the zeolite-NH.sub.2 may be added at a concentration of 2.5 to 5 mg/ml per 1 ml of biological samples.
[0112] In yet another embodiment, the homobifunctional hydrazide may be added at a concentration of 1 to 100 mg/ml per 1 ml of biological samples. More specifically, the homobifunctional hydrazide may be added at a concentration of 25 to 50 mg/ml per 1 ml of biological samples.
[0113] After EVs are effectively attached to zeolite-NH.sub.2, the zeolite-NH.sub.2-EVs undergo a syringe filtration process. This process is crucial as the zeolite-NH.sub.2 particles are larger than the pore size of the syringe filters, enabling selective filtration. In this process, unbound molecules other than the EVs bound to zeolite-NH.sub.2 pass through the filters and are discarded as waste, and the EVs are enriched on the filter surface. The ease of use, speed, and precision of the syringe filters combined with the zeolite-NH.sub.2 and homobifunctional hydrazide facilitate sample processing and significantly reduce the time required for EV isolation.
[0114] Accordingly, the composition of the present disclosure may be used by using the syringe filters. It is sufficient when the pore size of the syringe filters is smaller than the solid support used. In other words, it is sufficient when the solid support is larger than the pore size of the syringe filters so that the solid support does not pass through the syringe filters and remains on the syringe filter surface. Those skilled in the art will understand that the pore size of the syringe filters may vary depending on the type of syringe filter. In the embodiments described later, commercially available PVDF and PTFE filters with a pore size diameter of 3, 1, 0.45, and 0.22 m were used.
[0115] However, syringe filters with various pore sizes may be used depending on the various types of filters and the size of solid supports.
[0116] In yet another embodiment, the syringe filters may have a pore size of 0.22 to 3 um, and more specifically, the syringe filters may have a pore size of 0.22 to 0.45 m.
[0117] The combination of the solid support functionalized with amine groups and homobifunctional hydrazide of the present disclosure serves as a one-stop platform that not only enables the enrichment of the EVs but also allows the simultaneous isolation of the EVs and the extraction of EV-derived proteins and EV-derived nucleic acids (NAs) (
[0118] First, the isolation of the EVs may be achieved using a high pH elution buffer. The high pH elution buffer causes the amine groups of the zeolite-NH.sub.2 and the hydrazine groups of the homobifunctional hydrazide to lose positive charge thereof, thereby promoting the isolation of the EVs which were enriched on the zeolite-NH.sub.2 surface. These isolated EVs may be easily filtered through the pores of the syringe filters. As a result, the entire process, including preparation of the zeolite-NH.sub.2-HHs and 10-minute incubation for EV binding, is completed within 15 minutes, enabling the isolation of the highly enriched high-purity EVs.
[0119] Second, the extraction of the EV-derived proteins may be achieved using a RIPA lysis buffer, which may lyse EVs. These proteins remain suspended in the RIPA lysis buffer due to the proteins' non-reactivity with the zeolite-NH.sub.2 and homobifunctional hydrazide. As a result, the EV-derived proteins may be simply collected and easily obtained by using the buffer. Third, the extraction of the EV-derived nucleic acids (NAs) may be achieved using a non-chaotropic NP-40 lysis buffer. Chaotropic reagents may cause degradation and potential damage to NAs, so to minimize this, the non-chaotropic NP-40 lysis buffer is used instead of typical RIPA or common lysis buffers. By lysing the EVs with the NP-40 lysis buffer, the EV-derived NAs are released, and the EV-derived NAs may form bonds with the zeolite-NH.sub.2 and added homobifunctional hydrazide. This binding is promoted by electrostatic interactions between the negatively charged EV-derived NAs, the positively charged zeolite-NH.sub.2, and the homobifunctional hydrazide. Additionally, the carbonyl groups of the homobifunctional hydrazide interact with the nucleotide groups (adenine, guanine, and cytosine) and the amino groups of the zeolite-NH.sub.2. Meanwhile, the carbonyl groups of nucleotide groups (guanine, cytosine, thymine, and uracil) react with the amino groups of the zeolite-NH.sub.2 and homobifunctional hydrazide. Additionally, the hydrazide groups of homobifunctional hydrazide react with the carbonyl groups of nucleotide groups (guanine, cytosine, thymine, and uracil). These interactions lead to electrostatic and covalent bonds, effectively trapping EV-derived nucleic acids on the zeolite-NH.sub.2 surface. The bonds between the EV-derived nucleic acids and zeolite-NH.sub.2 and between the EV-derived nucleic acids and homobifunctional hydrazide are broken by the high pH elution buffer, facilitating the extraction of the EV-derived nucleic acids.
[0120] Therefore, in yet another aspect, the present disclosure provides a method of isolating extracellular vesicles (EVs) from biological samples by using a composition including a homobifunctional hydrazide and a solid support functionalized with the amine groups.
[0121] In yet another aspect, the present disclosure provides a method of isolating extracellular vesicles (EVs) from biological samples, the method including: [0122] (a) adding a composition to biological samples containing extracellular vesicles (EVs); [0123] (b) transferring the resulting mixture obtained through the (a) adding into a syringe and connecting a syringe filter to the syringe; [0124] (c) pressing the syringe to remove unreacted materials and enriching the extracellular vesicles (EVs) bound to zeolite-NH.sub.2 on the surface of the syringe filter; [0125] (d) isolating the extracellular vesicles (EVs) from the zeolite-NH.sub.2 by injecting a high pH elution buffer; and [0126] (e) recovering the isolated extracellular vesicles (EVs). In yet another embodiment, the method may further include incubating the mixture for EV capture after the (a) adding. In yet another embodiment, the method may further include washing the extracellular vesicles (EVs) enriched on the surface of the syringe filter by injecting phosphate-buffered saline (PBS) after the (c) pressing.
[0127] In yet another embodiment, in the (b) transferring, the syringe filter may have a pore size of 0.22 to 3 m. More specifically, the syringe filter may have a pore size of 0.22 to 0.45 m.
[0128] In yet another embodiment, in step (d) isolating, when a RIPA lysis buffer is injected instead of the high pH elution buffer, EV-derived proteins may be extracted. When the RIPA lysis buffer is injected, EVs are lysed, and proteins are released and present in suspension in the RIPA lysis buffer. In this case, the EV-derived proteins may be obtained by recovering the proteins.
[0129] In yet another embodiment, in step (d) isolating, when (i) a non-chaotropic lysis buffer is injected instead of the pH elution buffer, and then (ii) a high pH elution buffer is injected, the EV-derived nucleic acids may be extracted. When the non-chaotropic lysis buffer is injected, all components except nucleic acids are released from the EVs, and the nucleic acids remain captured on the zeolite-NH.sub.2 surface. Subsequently, when the high pH elution buffer is injected, the nucleic acids captured on the zeolite-NH.sub.2 surface are released. In this case, the EV-derived nucleic acids may be obtained by recovering the nucleic acids.
[0130] In yet another embodiment, the non-chaotropic lysis buffer may be an NP-40 lysis buffer.
[0131] In this way, the combination of the solid support functionalized with amine groups and the homobifunctional hydrazide of the present disclosure serves as an efficient tool for the EV isolation and extraction of the EV-derived proteins and nucleic acids which are useful for diagnosis and prognostic assessment of cancer by using clinical specimens.
[0132] The present disclosure relates to an extracellular vehicle-isolating composition including a homobifunctional hydrazide and a solid support functionalized with amine groups, and to a method of isolating extracellular vesicles by using the composition. The method may isolate highly enriched high-purity EVs from biological samples and also enable the simultaneous operation for EVs isolation and extraction of EV-derived proteins or EV-derived nucleic acids. The method is low-cost and simple, does not require special equipment other than syringe filters, and allows for high-throughput experiments due to the use of large-volume samples. The method may reduce the time required for protein and nucleic acid extraction by simplifying the experiments. Additionally, this EV enrichment may increase the sensitivity of biomarker detection for disease diagnosis and treatment.
[0133] Hereinafter, the configuration and effects of the present disclosure will be explained in more detail through examples. However, these examples are only for illustrative purposes of the present disclosure, and the scope of the present disclosure is not limited by these examples.
EXAMPLES
Experiment Materials
[0134] The following experimental materials were commonly applied to each example described below.
[0135] Zeolite (#96096), 3-aminopropyl (diethoxy) methylsilane (APDMS, #371890), glutaraldehyde (#340855), and sodium bicarbonate (#S5761) were purchased from Sigma-Aldrich.
[0136] Malonic acid dihydrazide (#M3206) was purchased from Tokyo
[0137] Chemical Industry. Adipic acid dihydrazide (#A0638) was purchased from Sigma-Aldrich. Oxalyl dihydrazide (#131296) was purchased from Sigma-Aldrich. Succinic acid dihydrazide (#S5502) was purchased from Sigma-Aldrich. Carbonic dihydrazide (#C11006) was purchased from Sigma-Aldrich.
[0138] Kovax 1 to 30 ml syringes and BD 1 ml syringes (#309628) were purchased from Korea Vaccine and Becton, Dickinson and Company, respectively.
[0139] Polytetrafluoroethylene (PTFE) 3 m syringe filters (#18140), PTFE 1 m syringe filters (#16278), polyvinylidene fluoride (PVDF) 3 m syringe filters (#18215), and PVDF 1 m syringe filters (#18214) were purchased from Tisch Scientific. PVDF 0.22 m syringe filters (#FJ25ASCCA002DL01) and PVDF 0.45 m syringe filters (#FJ25ASCCA004FL01) were supplied by GVS Filter Technology. 100X antibiotic-antifungal cocktail (#15240062), exosome-depleted fetal bovine serum (FBS, #A2720803), and Dulbecco's modified Eagle medium (DMEM, #41965039) were purchased from Gibco.
[0140] Total exosome isolation reagents (#4478359) and a SuperScript IV First-Strand Synthesis System (#18091050) were supplied by Invitrogen.
[0141] Antibodies included rabbit anti-CD9 antibodies (#ab236630), rabbit anti-CD63 antibodies (#ab134045), mouse anti-CD81 antibodies (#ab79559), rabbit anti-ARF6 antibodies (#ab131261), rabbit anti-GRP78 antibodies (#ab108615), rabbit anti-GM130 antibodies (#ab52649), goat anti-rabbit IgG/HRP antibodies (#ab205718), goat anti-mouse IgG/HRP antibodies (#ab6789), and donkey anti-rabbit IgG/Gold antibodies (#ab39597), all the antibodies being from Abcam Plc, and also included rabbit anti-Calnexin antibodies (#2679S) from Cell Signaling Technology.
[0142] A RIPA lysis and extraction buffer (#89901) from Thermo Scientific and an NP-40 lysis buffer (#J60766) from Alfa Aesar were used to lyse EVs.
[0143] A Mir-X miRNA qRT-PCR TB Green Kit (#638314) was purchased from Takara. A Brilliant III SYBR Green QPCR Master Mix (#600882) was supplied by Agilent Technologies. Oligonucleotides used were purchased from BIONICS and Macrogen.
Example 1
Synthesis of Zeolite-NH.SUB.2
[0144] Zeolite-NH.sub.2 was synthesized in accordance with a slightly modified protocol from a previously reported method. A total of 3 g of zeolite was washed twice for 10 minutes at 550 rpm by using distilled water and 95% ethanol. To ensure uniformity of zeolite size, larger-sized particles that precipitated within 1 minute were removed in the first washing. After each washing, the washed zeolite was briefly centrifuged at 1,000 rpm for 10 seconds, and the supernatant was discarded to remove smaller-sized particles. Amine group functionalization was then performed by incubating the zeolite in a 2% APDMS solution in 95% ethanol for 4 hours at 450 rpm. The synthesized zeolite-NH.sub.2 was washed three times for 5 minutes at 550 rpm using distilled water and 95% ethanol. After these, the zeolite-NH, was left to dry completely in a vacuum chamber for at least 24 hours. The dried zeolite-NH.sub.2 was stored at room temperature until further use.
Example 2
Biological Sample Preparation
[0145] Human colon cancer cell line HCT116 (ATCC #CCL-247) was purchased from American Type Culture Collection. The cells were cultured under standard conditions of a temperature of 37 C. and 5% CO.sub.2. A DMEM medium was supplemented with 10% exosome-depleted FBS and an antibiotic-antifungal cocktail. The cells were grown to isolate EVs from the HCT-116 cell culture medium until the cells reached approximately 80% confluence. The medium was centrifuged at 400 g for 30 minutes at a temperature of 4 C. to obtain cell-free supernatant. After filtering the cell-free supernatant by using a PVDF 0.22 m syringe filter, the filtered cell-free supernatant was immediately used to isolate EVs by using a zeolite-NH-homobifunctional hydrazide (HH) combination described below or to isolate EVs by an ultracentrifugation (UC) method and a total exosome isolation (TEI) method. Alternatively, the filtered cell-free supernatant was stored at a temperature of 20 C. for up to 4 weeks.
Example 3
Extracellular Vesicle (EV) Isolation by Using Zeolite-NH.SUB.2.-HH Combination, and Extraction of EV-Derived Proteins or EV-Derived Nucleic Acids
[0146] The workflow of combining zeolite-NH.sub.2 and HH is schematically shown in
[0147] For EV-derived protein extraction, 300 l of RIPA lysis buffer was injected by using a BD 1 ml syringe, and the sample with the RIPA lysis buffer was incubated at a temperature of 4 C. for 20 minutes. The EV-derived proteins in RIPA lysis buffer were then extracted by injecting air.
[0148] For EV-derived nucleic acid (NA) extraction, 300 l of NP-40 lysis buffer containing 7.5 mg of MDH was injected by using a BD 1 ml syringe, and the sample with the NP-40 lysis buffer was incubated for 20 minutes at room temperature. After removing the EV-derived proteins through air injection, the residual EV-derived proteins in the sample were washed with 3 ml of PBS, and then the residual PBS in the filter was removed. Lastly, the EV-derived NAs were eluted by injecting 300 l of high pH elution buffer by using a BD 1 ml syringe and incubating the EV-derived nucleic acids for 1 minute. The NAs isolated from the zeolite-NH.sub.2 surface were isolated by injecting air.
Example 4
Characterization of Zeolite-NH.SUB.2.-HH Combination
[0149] The properties of the zeolite-NH.sub.2-HH (herein, homobifunctional hydrazide (HH) is assumed to be MDH) combination were confirmed through SEM, DLS, FT-IR, and zeta potential analysis.
[0150] The zeolite-NH.sub.2 had a uniform size distribution with an average of 3,833.4529.7 nm (
[0151] Additionally, the zeta potential values of the zeolite-NH.sub.2, zeolite-NH.sub.2-MDH, and zeolite-NH.sub.2-MDH-EV are shown in
Example 5
Efficiency Comparison Among Different Types of Homobifunctional Hydrazide
[0152] To determine and compare the efficiencies of different types of homobifunctional hydrazide, extraction of EV-derived proteins and EV-derived nucleic acids using different types of homobifunctional hydrazide was performed with a cell-free supernatant derived from HCT116 cells. First, the concentration of the EV-derived proteins was measured, the EV-derived proteins having been extracted by using adipic acid dihydrazide, carbonic dihydrazide, malonic dihydrazide, oxalyl dihydrazide, and succinic acid dihydrazide, respectively.
[0153] As a result, the concentration of the EV-derived proteins was found to be high in that order of use of carbonic dihydrazide, succinic acid dihydrazide, oxalyl dihydrazide, adipic acid dihydrazide, and malonic acid dihydrazide, and a larger amount of the EV-derived proteins could be extracted than the conventional ultracentrifugation (UC) method (
Example 6
Optimization of Zeolite-NH.SUB.2.-MDH Combination
[0154] To determine the optimal conditions for efficient EV isolation using the zeolite-NH.sub.2-MDH combination, several key were optimized, including the concentrations of parameters zeolite-NH.sub.2 and MDH, and the type and pore size of the syringe filter.
[0155] The present inventors found that the isolation efficiency increased as the concentration of zeolite-NH.sub.2 was increased from 1 to 5 mg/ml, but the isolation efficiency decreased when the concentration was further increased to 10 mg/ml (
[0156] The concentration of homobifunctional hydrazide (herein, homobifunctional hydrazide (HH) is assumed to be MDH) was an important factor affecting the increase in bond strength between the zeolite-NH.sub.2 and EVs. The hydrazide group of the homobifunctional hydrazide served d as a positively charged functional group with the ability to form a variety of covalent bonds while also acting as a potential competitor to the amine group. Therefore, it was essential to use an appropriate concentration of homobifunctional hydrazide. As shown in
[0157] Meanwhile, the isolation efficiency was further evaluated depending on the type and pore size of the syringe filter used for the zeolite-NH.sub.2-HH combination. Both PTFE and PVDF syringe filters were chemically stable, exhibited high durability, and were widely used in biological applications.
Example 7
Comparative Evaluation of Zeolite-NH.SUB.2.-HH Combination Method with Conventional Methods
[0158] The efficacy of the zeolite-NH.sub.2-HH combination method was evaluated in comparison with those obtained by commonly used EV isolation techniques, especially ultracentrifugation (UC) and total exosome isolation (TEI) methods.
[0159] To perform experiments by the zeolite-NH.sub.2-HH combination method, the method described in Example 3 was used as it is. In the experiments by the UC method, 10 ml of cell culture medium was centrifuged at 110,000 g for 70 minutes at a temperature of 4 C., and the supernatant was discarded, leaving behind an EV pellet. In the experiments by the TEI method, 10 ml of cell culture medium was mixed with 5 ml of TEI reagent, the mixture was then incubated overnight at a temperature of 4 C., centrifuged at 10,000 g for 60 minutes at a temperature of 4 C., and the supernatant was discarded. In both UC and TEI methods, the EV pellets were reconstituted with 300 l of PBS for EV collection, or the EV pellets were reconstituted with 300 l of RIPA lysis buffer for EV-derived protein extraction.
[0160] The morphology of the EVs isolated by each method (zeolite-NH.sub.2-HH combination method, UC method, and TEI method) were evaluated through TEM and SEM images. For TEM imaging, the EVs were diluted 1:10 in PBS and incubated on Formvar/carbon-coated copper grids for 30 minutes at a temperature of 37 C. For CD9 labeling, grids were initially blocked with 5% BSA for 20 minutes, followed by incubation overnight at a temperature of 4 C. with 10 nm gold-tagged CD9 antibodies which were diluted in accordance with the manufacturer's instructions. For both blank and CD9 labeled images, grids were treated with 2.5% glutaraldehyde and 3% citrate solutions for 5 minutes each, washed with distilled water (DW), and placed on Parafilm. The grids were left to dry overnight in a fume hood. TEM images were visualized with a JEM-ARM200F device (JEOL, Japan). For SEM imaging, the EVs were diluted at a ratio of 1:10 in PBS and dropped onto silicon wafers for 30 minutes at a temperature of 37 C. The silicon wafers were then fixed using 2.5% glutaraldehyde for 10 minutes. The silicon wafers were soaked in various percentages of ethanol (30%, 50%, 70%, 80%, 90%, and 100%) for 15 minutes each time. After drying the silicon wafers in the fume hood, the silicon wafers were covered with a thin layer of platinum (Pt), and images were captured using a JSM-7610F-Plus device (JEOL).
[0161] The morphology of the EVs isolated by each method was confirmed through blank TEM and SEM images. All cases showed spherical EVs approximately 100 nm in size (
[0162] Next, NTA, DLS, and zeta potential analyzes were performed in accordance with standard protocols to determine the number, diameter distribution, and surface properties of the EVs. The EVs isolated by each method were resuspended in PBS at a ratio of 1:50 or 1:100 and injected into a cuvette. In the NTA analysis, the concentration and intensity distribution of the EVs were measured by using NS300 instrument (Malvern Panalytical) and NanoSight software (Malvern Panalytical). In the DLS analysis, the number distribution of the EVs was measured by using ELS-z1000 instrument (Otsuka Electronics, Japan) and Photal software (Otsuka Electronics). The surface charge of the EVs was measured with a NANO ZS 90 instrument (Malvern Panalytical).
[0163] As shown in
[0164] Additionally, as shown in
[0165] The ratio of particle number to protein concentration of the isolated EVs was an important indicator of the concentration and purity of the EVs. A higher ratio suggested successful separation due to increased particle concentration. As shown in
[0166] Next, to determine the quantity and purity of EV-derived proteins extracted by the zeolite-NH.sub.2-HH combination method and confirm the presence of specific EV proteins, western blotting analysis was performed for EV-specific proteins (CD9, CD63, and CD81) as well as non-specific proteins (GRP78, GM130, and
[0167] Calnexin).
[0168] Specifically, the EV-derived proteins extracted with a RIPA lysis buffer were analyzed in each case of the zeolite-NH.sub.2 and HH combination method, UC method, and TEI method. Protein concentration was determined using a Bradford assay by using serial dilutions of BSA as a standard. Equal amounts (20 g) of the extracted proteins were placed, the proteins were separated on 10% SDS-PAGE and transferred to PVDF microporous membranes. The membranes were blocked in PBS-Tween 20 containing 5% skim milk for 1 hour. Primary antibodies (CD9, CD63, CD81, ARF6, GRP78, GM130, and Calnexin) were diluted in accordance with the manufacturer's instructions and incubated overnight at a temperature of 4 C. The membranes were then placed in HRP-tagged secondary antibody solution for 1 hour which had been diluted again in accordance with the manufacturer's instructions. Marker proteins were detected using a 1:1 mixture of peroxidase and chemiluminescent substrate. Images were captured with the ChemiDoc MP Imaging System (Bio-Rad) and Image Lab software (Bio-Rad).
[0169] The results of the Western blotting analysis are shown in
[0170] Therefore, the zeolite-NH.sub.2-HH combination method was demonstrated to be an effective approach for EV isolation and EV-derived protein extraction, thereby the combination method allowed the achievement of purity and concentration comparable to the established UC and TEI methods.
[0171] Furthermore, the extraction efficiencies of the EV-derived nucleic acids were evaluated depending on the addition of additional homobifunctional hydrazide (HH) and zeolite-NH.sub.2 (AZ) when the EV-derived nucleic acids were extracted. Specifically, in injecting the NP-40 lysis buffer (LB) used for the EV-derived nucleic acid extraction, these three cases were designed: injection of only LB (LB only), injection of homobifunctional hydrazide mixed LB with (LB+HH), and injection of homobifunctional hydrazide and zeolite-NH.sub.2 (AZ) mixed with LB (LB+HH+AZ). Afterward, the EV-derived nucleic acid extraction efficiencies among the three cases were compared. As a result, as shown in
Example 8
Detection of EV-Derived Nucleic acid Biomarkers for colorectal cancer (CRC) using zeolite-NH.SUB.2.-HH combination
[0172] To evaluate the capacity of zeolite-NH.sub.2-HH combination in EV-derived nucleic acid (NA) extraction and detect colorectal cancer (CRC)-related biomarkers, non-coding RNAs from EVs extracted from the cell culture medium of the CRC cell line HCT116 were analyzed using real-time PCR (qPCR).
[0173] A Mir-X miRNA qRT-PCR TB Green Kit was used for miRNA cDNA synthesis and qPCR analysis. 4 l of EV-derived NAs obtained from the samples using a zeolite-NH.sub.2-HH combination were mixed with 5 l of reaction buffer and 1 l of reverse transcriptase, and then the mixture was incubated at a temperature of 37 C. for 1 hour. After inactivating an enzyme for 5 minutes at a temperature of 85 C., 90 l of RNase-free water was added to a reagent, and 100 l of synthesized cDNA was stored at a temperature of 20 C. for future use. For qPCR of miRNA, the cDNA was combined with a miRNA-specific forward primer, mRQ 3 reverse primer, and TB Green premix. The amplification protocol was designed to implement 40 cycles of an initial denaturation stage at a temperature of 95 C. for 10 seconds, followed by 95 C. for 5 seconds, and 60 C. for 20 seconds, and then a final melt curve stage.
[0174] During qPCR analysis for circRNA, a SuperScript IV First-Strand Synthesis System was used with 50 M random hexamers to denature a template RNA. 11 l of EV-derived circRNA obtained from the samples using a zeolite-NH.sub.2-HH combination was coupled with reaction buffer and reverse transcriptase, and 20 l of the combined reaction mixture was incubated at a temperature of 23 C. for 10 minutes, followed by 50 C. for 10 minutes, and 80 C. for 10 minutes. Then, 30 l of RNase-free water was added to the synthesized cDNA and stored at a temperature of 20 C. until use. For qPCR analysis of circRNA, 5 l of synthesized cDNA and a primer set were mixed with a Brilliant III SYBR Green QPCR Master Mix. The amplification protocol was designed to implement 50 cycles of an initial denaturation stage at a temperature of 94 C. for 2 minutes, followed by 94 C. for 15 seconds, 55 C. for 30 seconds, and 68 C. for 1 minute. Amplification in the protocol was finalized with a final melt curve stage.
[0175] All primers used in the qPCR are shown in Table 1 below.
TABLE-US-00001 TABLE1 PrimersetsfordetectionofCRC-relatedEV-derived non-codingRNAs(miRNAsandcircRNAs) Length Target Location Sequence(5-3) (bp) Micro hsa-miR-19a-3p Forward TGTGCAAATCTATGCAAAACTGA 23 RNAS hsa-miR-21-5p Forward TAGCTTATCAGACTGATGTTGA 22 hsa-miR-23a-3p Forward ATCACATTGCCAGGGATTTCC 21 hsa-miR-92a-3p Forward TATTGCACTTGTCCCGGCCTGT 22 hsn-mik-996-5p Forward CACCCGTAGAACCGACCTTGCG 22 hsa-miR-125a-3p Forward ACAGGTGAGGTTCTTGGGAGCC 22 hsa-mik-141-3p Forward TAACACTGTCTGGTAAAGATGG 22 hsa-mik-150-5p Forward TCTCCCAACCCTTGTACCAGTG 22 hva-miR-182-5p Forward TTTGGCAATGGTAGAACTCACACT 24 hxa-miR-200h-3p Forward TAATACTGCCTGGTAATGATGA 22 ksa-mik-223-3p Forward TGTCAGTTTGTCAAATACCCCA 22 hsa-miR-1246 Forward AATGGATTTTTGGAGCAGG 19 Universal Reverse mRQ3PrimerfromTAKARA U6 Forward CTCGCTTCGGGAGCACA 17 Reverse AACGCTTCACGAATTTGCGT 20 Circular circLPAR1 Forward GTAGTTCTGGGGCGTGTTCA 20 RNAs Reverse TAGGTGGATGGGGAGCTTCA 20 circPACRGL Forward GCCAGAAAATACTGATGTTCACT 23 Reverse TCGGTCGGCCAACAACC 17 circLONP2 Forward GTGAAGGTGGCAGAAGGACA 20 Reverse TGGGTTGTTCACTCCCACAG 20 circERBIN Forward ACCAGCATCCATTGCAAACC 20 Reverse TGGTACCAACCGCACAAACA 20 circPNN Forward CCTGGAAGAATGTGTCCAGCTA 22 Reverse GCTTTCTCTCTTCTTCTGCCTG 22 GAPDH Forward TATCGTGATGCTAGTCCGATG 23 Reverse TGCAGCTAGCTGCATCGATCGG 22
[0176] First, twelve miRNAs known to be related to the diagnosis and prognosis of CRC (miR-19, miR-21, miR-23, miR-92, miR-99, miR-125, miR-141, miR-150, miR-182, miR-200, miR-223, and miR-1246) and a housekeeping gene U6 which was a commonly used miRNA were detected.
[0177] In addition, primers for qPCR of GAPdh, which was commonly used as circRNA and circRNA housekeeping gene, were synthesized by selecting CRC-related circRNA markers (CircLPAR1, CircPACRGL, CircLONP2, CircERBIN, and CircPNN) and using the CircInteractome database and NCBI primer design tool. Similar to EV-derived miRNAs, it was confirmed that the zeolite-NH.sub.2-HH combination could serve to extract EV-derived circRNAs and that all five biomarkers were detected (
[0178] These results suggested that the zeolite-NH.sub.2-HH combination of the present disclosure had the potential to serve as a one-stop platform to extract nucleic acids from EVs and that the zeolite-NH.sub.2-HH combination might serve as a valuable tool for sample preparation in CRC diagnosis and prognosis monitoring.
Example 9
Clinical Validation of Selected EV-Derived Biomarkers in Blood Plasma
[0179] To confirm the clinical relevance of biomarkers identified through cell line models, blood plasma samples from CRC patients (n=80) and healthy control (HC) individuals (n=20) were analyzed using the zeolite-NH.sub.2-HH-based extracellular vesicle isolation (ZAHVIS) platform (
[0180] The survival rates were observed to be 95% for early-stage CRC, 75% for advanced-stage CRC, 100% for CRC stages 0-1, 90% for CRC stage 2, 80% for CRC stage 3, and 70% for CRC stage 4. The data were then subjected to statistical analysis to determine the RQ values and their significance. The present inventors focused on four statistically significant miRNAs, including miR-23a-3p, miR-92a-3p, miR-125a-3p, and miR-150-5p (
[0181] The results showed significant differences in the expression levels of miR-23a-3p, miR-92a-3p, miR-125a-3p, and miR-150-5p between CRC patients and HC individuals, indicating their potential as diagnostic biomarkers for CRC. The present inventors also measured carcinoembryonic antigen (CEA) levels and found them to be significantly higher in CRC patients compared to HC individuals, confirming CEA's established role as a diagnostic marker for CRC (
[0182] To visualize the separation between CRC patients and HC individuals based on the combined biomarker profiles, the present inventors performed t-SNE analysis (
[0183] Performance evaluation metrics, including sensitivity, specificity, accuracy, and F1 score, were calculated for each biomarker according to Youden's index. miR-23a-3p showed a sensitivity of 75%, specificity of 60%, accuracy of 72%, and F1 score of 81.08%. miR-92a-3p had a sensitivity of 76.25%, specificity of 70%, accuracy of 75%, and F1 score of 82.99%. miR-125a-3p displayed a sensitivity of 35%, specificity of 100%, accuracy of 48%, and F1 score of 51.85%. miR-150-5p demonstrated the highest performance with a sensitivity of 76.25%, specificity of 90%, accuracy of 79%, and F1 score of 85.31%.
[0184] CEA exhibited a sensitivity of 66.25%, specificity of 90%, accuracy of 71%, and F1 score of 78.52% (
Example 10
AI-Driven Comprehensive Evaluation of Blood Biomarker Combinations for Enhanced CRC Diagnosis
[0185] The comprehensive AI-driven analysis workflow for evaluating blood biomarker combinations for CRC diagnosis using the ZAHV-AI system is illustrated in
[0186] The AI-driven evaluation provided critical insights across various stages of the disease. In overall CRC, single markers showed varied effectiveness, with miR-150-5p achieving the highest AUC of 0.9167. However, combinations significantly improved performance, particularly with miR-23a-3p and miR-150-5p (AUC: 0.9444), miR-125a-3p, miR-150-5p, and CEA (AUC: 0.9653), and miR-23a-3p, miR-92a-3p, miR-150-5p, and CEA (AUC: 0.9861), demonstrating the highest diagnostic accuracy. The combination of miR-23a-3p, miR-92a-3p, miR-150-5p, and CEA achieved sensitivity of 95.83%, specificity of 100%, accuracy of 96.67%, and an F1 score of 97.87% (
[0187] By leveraging multiple biomarkers, the ZAHV-AI system demonstrated significantly improved sensitivity, specificity, accuracy, and F1 scores across various stages of CRC compared to single markers. This approach enhances the diagnostic accuracy for overall CRC and shows remarkable strength in early detection, which is crucial for effective clinical management.
Example 11
Diagnostic Performance of Optimal Blood Biomarker Combinations for Early Detection of CRC in the ZAHV-AI System
[0188] The schemes of optimal combinations for overall CRC, early-stage CRC (stages 0-2), and advanced-stage CRC (stages 3-4) are illustrated (
[0189] In early-stage CRC, six combinations were identified: miR-23a-3p+miR-150-5p+CEA; miR-92a-3p+miR-125a-3p+miR-150-5p; miR-92a-3p+miR-150-5p+CEA; miR-125a-3p+miR-150-5p+CEA; miR-23a-3p+miR-92a-3p+miR-150-5p+CEA; and miR-23a-3p+miR-125a-3p+miR-150-5p+CEA. These combinations yielded an AUC of 0.9861, sensitivity of 91.67%, specificity of 100%, accuracy of 94.44%, and F1 score of 95.65%. For advanced-stage CRC, the combination of miR-150-5p and CEA achieved an AUC of 0.9583, sensitivity of 91.67%, specificity of 100%, accuracy of 94.44%, and F1 score of 95.65%, highlighting the system's effectiveness in detecting both early and advanced stages of the disease. Optimal combinations specific to individual CRC stages are detailed, which includes the schemes for CRC stages 0-1, 2, 3, and 4. Detailed analysis of these stages showed high levels of diagnostic performance. For stages 0-1, perfect diagnostic performance (AUC 1.0, sensitivity 100%, specificity 100%, accuracy 100%, F1 score 100%) was achieved with three combinations: miR-150-5p; miR-92a-3p +miR-150-5p; and miR-92a-3p+miR-150-5p+CEA. Stage 2 exhibited high performance with four combinations: miR-23a-3p+miR-92a-3p; miR-92a-3p+miR-150-5p; miR-125a-3p+miR-150-5p; and miR-92a-3p+miR-125a-3p +CEA, achieving an AUC of 0.9722, sensitivity of 83.33%, specificity of 100%, accuracy of 91.67%, and F1 score of 90.91%. For stage 3, perfect diagnostic metrics were observed with the combination of miR-150-5p and CEA. Stage 4 also demonstrated perfect diagnostic performance with eleven combinations: miR-150-5p; miR-23a-3p+miR-150-5p; miR-125a-3p+CEA; miR-150-5p +CEA; miR-23a-3p+miR-125a-3p+miR-150-5p; miR-92a-3p+miR-150-5p+CEA; miR-125a-3p+miR-150-5p+CEA; miR-23a-3p+miR-92a-3p+miR-125a-3p+miR-150-5p; miR-23a-3p+miR-125a-3p+miR-150-5p+CEA; miR-92a-3p+miR-125a-3p+miR-150-5p+CEA; and miR-23a-3p+miR-92a-3p+miR-125a-3p+miR-150-5p+CEA.
[0190] These comprehensive analyses underscore the ZAHV-AI system's exceptional capability to identify optimal blood biomarker combinations, significantly enhancing diagnostic accuracy for CRC, particularly in its early stages. By integrating the efficient EV isolation using the ZAHVIS platform with AI-driven analysis, the ZAHV-AI system offers a streamlined, highly sensitive, and accurate approach to CRC diagnostics. This powerful combination not only improves early detection rates but also provides a robust tool for ongoing monitoring and personalized treatment strategies. Overall, the ZAHV-AI system demonstrates its potential for use in clinical practices, offering significant improvements in cancer diagnostics and patient care.