CRM197 protein expression
12234266 ยท 2025-02-25
Assignee
Inventors
Cpc classification
C12N15/70
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention relates to a method for producing CRM197 recombinant protein in cells. The method comprises culturing a cell comprising an expression plasmid with a polynucleotide and inducing expression of the CRM197 protein.
Claims
1. A method of producing a CRM197 protein, comprising culturing a cell comprising an expression plasmid having a polynucleotide, wherein the polynucleotide comprises: (a) a CRM197 nucleotide sequence comprising SEQ ID NO: 1, and (b) a secretion signal sequence encoding amino acids of SEQ ID NO: 2 at 5-terminus of the CRM197 nucleotide sequence; and inducing expression of the CRM197 protein, wherein the induction is performed at pH 7.5-8.0 in an expression medium, and an expression temperature of the CRM197 protein is first incubating at 37 C. and then reducing to about 20-25 C., wherein the expression plasmid comprises a phosphate regulated promoter, and the cell comprises E. coli, wherein the phosphate regulated promoter is a bacterial alkaline phosphatase A promoter; and the CRM197 protein is soluble, periplasmic, and folded and comprises two intra-disulfide bonds.
2. The method of claim 1, wherein the secretion signal sequence is from Erwinia spp.
3. A expression plasmid, comprising a polynucleotide of comprising: (a) a CRM197 nucleotide sequence at least 90% identical to SEQ ID NO: 1, and (b) a secretion signal sequence encoding amino acids of SEQ ID NO: 2 at 5-terminus of the CRM197 nucleotide sequence; and an inducible promoter to initiate an expression of the polynucleotide, wherein the inducible promoter comprises a phosphate regulated promoter, wherein the expression plasmid is deposited under ATCC Accession Number PTA-124609 on Nov. 28, 2017.
4. A host cell comprising the expression plasmid of claim 3.
5. The method of claim 1, wherein the induction is performed in the expression medium with a MOPS buffer.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
DETAILED DESCRIPTION
(10) The foregoing and other aspects of the present disclosure will now be described in more detail with respect to other embodiments described herein. It should be appreciated that the invention can be embodied in different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the invention to those skilled in the art.
(11) The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. As used in the description of the invention and the appended claims, the singular forms a, an and the are intended to include the plural forms as well, unless the context clearly indicates otherwise.
(12) As used herein, the terms comprises, comprising, includes, including, has, having, contains, containing, characterized by or any other variation thereof, are intended to cover a non-exclusive inclusion, subject to any limitation explicitly indicated. For example, a composition, mixture, process or method that comprises a list of elements is not necessarily limited to only those elements but may include other elements not expressly listed or inherent to such composition, mixture, process, or method.
(13) The transitional phrase consisting of excludes any elements, steps, or ingredients not specified. If in the claim, such would close the claim to the inclusion of materials other than those recited except for impurities ordinarily associated therewith. When the phrase consisting of appears in a clause of the body of a claim, rather than immediately following the preamble, it limits only the element set forth in that clause; other elements are not excluded from the claim as a whole.
(14) The transitional phrase consisting essentially of is used to define a composition, method that includes materials, steps, features, components, or elements, in addition to those literally disclosed, provided that these additional materials, steps, features, components, or elements do not materially affect the basic and novel characteristic(s) of the claimed invention. The term consisting essentially of occupies a middle ground between comprising and consisting of.
(15) Where applicants have defined an invention or a portion thereof with an open-ended term such as comprising, it should be readily understood that (unless otherwise stated) the description should be interpreted to also describe such an invention using the terms consisting essentially of or consisting of.
(16) As used herein, the term about is used to indicate that a value includes for example, the inherent variation of error for a measuring device, the method being employed to determine the value, or the variation that exists among the study subjects. Typically the term is meant to encompass approximately or less than 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19% or 20% variability depending on the situation.
(17) The use of the term or in the claims is used to mean and/or unless explicitly indicated to refer to alternatives only or the alternatives are mutually exclusive, although the disclosure supports a definition that refers to only alternatives and and/or.
(18) As used herein, the terms transform, transformed or introduce a nucleic acid into a host cell refer to the application of any methods for introducing a foreign nucleic acid (such as a vector or plasmid) into a host cell with or without the presence of accompanying substances. The terms transform a cell or transformed cell suggest that a foreign nucleic acid is introduced into the cell or its daughter cells so that the host cell contains the foreign nucleic acid. Once introduced into the host cell, the nucleic acid is integrated with the chromosome and becomes a fragment thereof, or remains as an extrachromosomal element, for the purpose of replication. Transformation of an appropriate host cell with, for example, an expression vector can be achieved using known methods in the art, such as electroporation and particle bombardment, or using chemical methods such as catalyzing the transformation process with calcium phosphate. These methods are described in, for example, Maniatis et al., Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory, 1982), or Ausubel et al., Current Protocols in Molecular Biology (John Wiley and Sons, 1994).
(19) Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. All publications, patent applications, patents and other references cited herein are incorporated by reference in their entireties for the teachings relevant to the sentence and/or paragraph in which the reference is presented.
(20) Embodiments according to an invention of the present application relate to methods for the production of a recombinant CRM197 protein.
(21) A method in accordance with embodiments of the invention involves culturing a bacterial cell comprising an expression plasmid with a polynucleotide. After culturing, the cell, e.g. E. coli, is induced to express the CRM197 protein under optimal conditions so that over-expression of the recombinant CRM197 protein in soluble form was successfully achieved. Preferably, the cell is propagated or induced at a temperature from about 15 C. to about 37 C., more preferably 20-35 C., 20-30 C., or 20-25 C. This method will be helpful for the production and purification of the recombinant CRM197 at the native conformation and disulfide bonds.
(22) The method may further comprise a step of cloning a codon optimized polynucleotide into an expression vector for transformation of bacterial cells such as, for example, an E. coli cell or a derivative or strain of E. coli. The polynucleotide comprises a CRM197 nucleotide sequence at least 90% identical to SEQ ID NO: 1, and a secretion signal sequence encoding amino acids of SEQ ID NO: 2 at 5-terminus of the CRM197 nucleotide sequence. A pectate lyase B (PelB) sequence may be used as a leader sequence for the CRM197 protein so that the CRM197 protein expressed by the cell is soluble and is intracellular, periplasmic or secreted. In an embodiment, the PelB sequence may be from Erwinia spp. The secretion signal sequence may directly linked to the CRM197 nucleotide sequence. Alternatively, there may be a spacer between the secretion signal sequence and the CRM197 nucleotide sequence. The spacer may comprise more or less than 9 nucleotides such as, for example, between 5 and 20 nucleotides. In a preferred embodiment, the expression enhancer comprises a ribosome binding site upstream of the CRM197 nucleotide sequence and an ATG codon.
(23) Embodies of the invention will be further illustrated with specific examples set forth below. One skilled in the art would appreciate that these examples are for illustration only an dare not intended to be limiting because variations and modifications are possible without departing from the scope of the invention.
(24) Without further elaboration, it is believed that one skilled in the art can, based on the above description, utilize the present invention to its fullest extent. The following specific examples are, therefore, to be construed as merely illustrative, and not limitative of the remainder of the disclosure in any way whatsoever. All publications cited herein are incorporated by reference.
EXAMPLES
Example 1: Construction of pEGm-pho A 1.0 Vector, an Alkaline Phosphatase A Promoter-Derived Expression Vector
(25) Briefly, the codon optimized sequence of the target gene CRM197 was fused to various 5-terminus signal sequences which can direct the expression of CRM197 to periplasm to achieve correct disulfide bond formation and proper protein folding. The recombinant CRM197 was operably linked to an expression control promoter under conditions suitable for expression. In a related aspect, the 5-terminus signal sequence encodes a Sec-dependent signal sequence, such as PelB was fused to CRM197 for periplasmic expression. The optimized sequence of CRM197 gene (SEQ ID NO: 1) was synthesized in a pMK-RQ vector (CRM197_pMK-RQ) and several pairs of primers were used to insert signal sequence into 5-terminus of CRM197 in pMK-RQ vector. The original CRM197 sequence was optimized and fused with various signal sequences, and was subsequently sub-cloned into an expression vector, e.g. pEGm-phoA 1.0, which contained a selection marker gene, such as kanamycin, and a phosphate-regulated promoter to control protein expression.
(26) Specifically, pEGm-phoA 1.0 was modified from a commercially available vector pTAC-MAT-Tag-2. Particularly. the selection marker, Amp.sup.R, in the pTAC-MAT-Tag-2 was replaced by Kan.sup.R. In addition, the original pTAC promoter was also replaced by E. coli alkaline phosphatase A (phoA) promoter (Craig et. al., 1991). The pho A promoter in the expression vector of pEGm-phoA 1.0 was utilized to regulate the expression of CRM197 under a culture medium with fine control of phosphate concentration.
Example 1-1: Construction of Kanamycin Resistant Gene as Selection Marker
(27) The DNA fragment of kanamycin resistant gene was amplified and obtained by a pairs of specific primers (Table 1, SEQ ID NO: 3 and SEQ ID NO: 4) using pET27b(+) plasmid as template. The vector backbone of pEGm-phoA 1.0 was also amplified by two specific primers (Table 1, SEQ ID NO: 5 and SEQ ID NO: 6) but without Amp.sup.R resistant gene using pTAC-MAT-Tag-2 as template. Phusion high fidelity PCR kit was used in the amplification of these two DNA fragments and GeneArt seamless cloning and assembly kit was further applied in cloning of the two DNA fragments to generate a modified pTAC-MAT-Tag-2 vector with Kan.sup.R gene, named pTAC-MAT-Tag-2-Kan.
(28) TABLE-US-00001 TABLE 1 SEQ ID NO: Primer name Sequence (5 .fwdarw. 3 ) 3 Kan-F TGAAAAAGGAAGAGTATGAGCCATATTCAACGG 4 Kan-R AACTTGGTCTGACAGTTAGAAAAACTCATCGAGCAT 5 pTAC-F CTGTCAGACCAAGTTTACTCATATATAC 6 pTAC-R ACTCTTCCTTTTTCAATATTATTGAA 7 phoA-pTAC-1-F CTTTGTTTTTATTTTTTAATGTATTTGTACATAGGAG ATATAATATGAAGCTTCCTCG 8 phoA-pTAC-1-R CGACTATAAGTCTCGGCCGTGACAACTTTATGACAG AATTTCAGAAGGATCCTCTACGC 9 pelB-F
Example 1-2: Replacement of pTAC Promoter by Pho A Promoter
(29) The pTAC-MAT-Tag-2-Kan was further used as template to amplify the whole vector with insertion of a pho A promoter sequence via two primers (Table 1, SEQ ID NO: 7 and SEQ ID NO: 8). The phoA promoter contains the Pho box sequence at the 35 (CTGTCATAAAGTTGTCAC) region (Craig et. al., 1991). Lastly, after DNA sequencing, we obtained two new constructs with the correct pho A promoter sequences. These new expression vectors were named pEGm-pho A 1.0 #2 and pEGm-pho A 1.0 #3.
Example 2: Construction of CRM197 Expression Plasmid
Example 2-1: CRM197 Gene Synthesis
(30) Coding sequence of CRM197 gene was synthesized by GeneArt (Life Technologies) and codon usage was optimized for E. coli expression (
Example 2-2: Insertion of pelB Signal Sequence at the 5-Terminus of CRM197
(31) To achieve proper folding and disulfide bond formation of CRM197 during protein synthesis, leader nucleotide sequence of pelB (pelBss) was inserted into the 5-terminus of CRM197 coding sequence by amplified the CRM197pMK-RQ with two designed primers (Table 1, SEQ ID NO: 9 and SEQ ID NO: 10). pelB was a 22 amino acid peptide (MKYLLPTAAAGLLLLAAQPAMA; SEQ ID NO: 2) that can direct the fusion protein to the periplasmic space and will be removed by the endogenous signal peptidase. The new CRM197 construct was named pelBss-CRM197_pMK-RQ.
Example 2-3: Construction of pelBss-CRM197 to pEGm-phoA 1.0
(32) The final step for the construction of CRM197 expression plasmid was to subclone pelBss-CRM197 gene to pEGm-phoA 1.0 vector by HindIII and EcoRI restriction sites to generate an expression plasmid, pelBss-CRM197_pEGm-phoA 1.0 (
Example 3: Expression Bacterial Strain Screening
(33) The expression vector pelBss-CRM197pEGm-phoA 1.0 #3-14 was transformed to E. coli BL21 strain and plated on LB agar plate (with 30 g/ml kanamycin) at 37 C. overnight incubation to obtain several single-colony transformants. Six transformants were screened to select for the best CRM197 expression strain. The transformants were first inoculated in 5 ml LB broth (with 30 g/ml kanamycin) in a 14 ml polypropylene tube at 37 C., 225 rpm for 5 hr, till OD.sub.600 is about 1.0. Next, 0.5 mL culture of each strain was transferred into 50 mL of expression medium in a 250 ml flask at 37 C., 225 rpm for another 3 hr. The expression medium comprises 30 mM of ammonium sulfate; 2.4 mM of trisodium citrate dehydrate; 14.35 mM of potassium chloride; 1.07 g/L of yeast extract; 3.22 g/L of tryptone, 0.11 M of MOPS pH 8; 0.55% of glucose and 0.007 mM of magnesium sulphate. When OD.sub.600 reaches to about 0.5-1, preferably 0.5, 0.6, 0.7, 0.8, 0.9 or 1.0, the temperature was shifted to about 16 C. to 25 C., preferably about 20 C. to 25 C., more preferably 20, 21, 22, 23 24 or 25 C., for 29 hr for CRM197 expression. The expression level of soluble CRM197 were further analyzed by SDS-PAGE to determine the candidate bacterial strain. Total 6 g of each sample from supernatant fraction of the culture was loaded into a 10% SDS-PAGE for analysis (
(34) In addition,
(35) In addition, strain #3-14-8 was deposited under at The American Type Culture Collection (ATCC), 10801 University Boulevard, Manassas, VA 20110, USA, on Nov. 28, 2017, under ATCC Accession Number PTA-124609, and at Food Industry Research and Development Institute (FIRDI), 331 Shih-Pin Road, Hsinchu, Taiwan 300, R.O.C., on Dec. 7, 2017, under BCRC Accession Number BCRC 940662.
Example 3-A: Optimization of Induction Conditions
Example 3-A-1: Expression Medium
(36) Periplasmic expression of PelB-CRM197 was tested in the medium with various buffer compositions, for example, 1M of MOPS, Tris or phosphate buffer. Strain #3-14-8 was inoculated and cultured in a medium with the addition of 1M of MOPS, Tris and phosphate buffer, pH 8. The cultured bacteria were harvested at different time points, i.e. 3 and 24 hours, to examine the effect of buffer composition on the expression level of CRM197. The cells harvested were disrupted by lysis buffer. 6 g of soluble total protein were fractioned by 10% SDS-PAGE analysis.
(37) The result in
Example 3-A-2: pH Value of the Expression Medium
(38) Periplasmic expression of PelB-CRM197 was tested in the medium with various pH values of 1M MOPS, for example, pH 7.0, 7.5 or 8.0. Strain #3-14-8 was inoculated and cultured in a medium with various pH values of 7.0, 7.5 or 8.0. The cultured bacteria were harvested at different time points, i.e. 3 and 24 hours, to examine the effect of pH value on the expression level of CRM197. The cells harvested were disrupted by lysis buffer. 6 g of soluble total protein were fractioned by 10% SDS-PAGE analysis.
(39) The result in
Example 4: pelBss-CRM197 N-Terminus Cleavage Site Analysis
(40) Since soluble form CRM197 was successfully expressed, it was then proceeding to examine whether pelB signal sequence had been precisely and completely removed from the CRM197 recombinant protein by the cellular protease. Therefore, partially purified CRM197 was subjected to liquid chromatography-mass spectrometry (LC-MS) analysis. For this experiment, two batches of CRM197 expression cells were prepared: one was cultured in phoA medium, the other was in fed-batch system using MTB as basal medium (yeast extract 24 g/L; phytone peptone 12 g/L; glycerol 8 g/L; sodium chloride 5 g/L; potassium phosphate monobasic 0.232 g/L; and potassium phosphate dibasic 1.643 g/L). The harvested cells were further subjected to one-step DEAE chromatography in order to obtain homogenized CRM197 for LC-MS analysis. The results of LC-MS and CID analysis (
Example 5: pelBss-CR1VI197 Disulfide Bond Formation Analysis
(41) CRM197 contains four cystines and can form two intra-disulfide bonds between Cys186-Cys201 and Cys461-Cys471. Therefore, partially purified CRM197 above was also applied for disulfide linkage analysis. The results from
Example 6: pelBss-CR1VI197_pEGm-phoA 1.0 BL21 #3-14-8 Bacterial Strain Stability Assay
(42) To comprehend the stability of CRM197 expression strain, e.g. strain #3-14-8, both protein expression and plasmid stability analysis were performed. To evaluate the strain stability after several generations of passage, bacterial strain was continuous cultured and maintained in exponential phase for up to 96 generations (doubling time is about 40 min in phoA medium, data not shown). In brief, one vial of pelBss-CRM197pEGm-phoA 1.0 BL21 #3-14-8 RCB were thawed and 0.4 mL of glycerol stock was inoculated in 40 ml of phoA medium (containing 30 L/mL of kanamycin) in a 250 mL flask at 37 C., 225 rpm. When OD.sub.600 reach to 1 (approximately 4 hr), 0.4 ml of culture broth was transferred to another flask with 40 ml of fresh phoA medium. This procedure was repeatedly performed for 16 times. Certain stages (6, 66 and 96 generations) of cultured cells were collected and the glycerol stocks were also generated and stored at 75 C. for further analysis.
Example 6-1: Protein Expression Stability Analysis
(43) To examine the CRM197 expression stability, three different generations of CRM197 strain #3-14-8 were subjected for CRM197 expression. The protein expression procedure had been mentioned earlier and the final CRM197 expression analysis was shown in
(44) TABLE-US-00002 TABLE 2 Generations OD.sub.600 (4 hr) OD.sub.600 (27.5 hr) 6 0.576 3.576 66 0.592 3.402 96 0.552 3.408
Example 6-2: Plasmid Stability Analysis
(45) To confirm whether the CRM197 expression vector also retains its stability without deletion, duplication or inversion of DNA fragment, plasmids extracted from 6, 66 and 96 generations of cells were subjected to restriction enzyme digestion and DNA sequencing. Two sets of restriction enzymes were applied for plasmid digestion. HindIII and EcoRI can release the pelBss-CRM197 gene fragment (about 1.67 kb) and vector backbone (about 5.13 kb). On the other hand, EcoRV has two recognition sites in pelBss-CRM197pEGm-phoA 1.0, one at CRM197 gene and the other at kanamycin gene, which can release two DNA fragments (about 2.65 and 4.15 kb, respectively). The results of restriction mapping on
Example 6-3: Plasmid Copy Number Retention Rate Analysis
(46) Furthermore, the plasmid copy number retention rate after 96-generations of passage was examined. To do this, real-time quantitative-PCR (qPCR) based method was applied to determine plasmid copy number in E. coli (Lee et. al., 2006). In order to calculate absolute and relative plasmid copy number, two sets of primers were used to detect CRM197 gene in plasmid as target gene (Table 1, SEQ ID NO: 14 and SEQ ID NO: 15). DXS gene (D-1-deoxyxylulose 5-phosphate synthase) in host chromosome was used as reference gene (Table 1, SEQ ID NO: 16 and SEQ ID NO: 17). Since CRM197 and DXS are single-copy genes in vector and E. coli chromosome, the plasmid copy number can be determined as the ratio of CRM197/DXS. In order to calculate the exact copy number of plasmid (target gene) and reference gene, two standard linear lines were first generated to convert the plasmid molecules to Ct values by the known molecules (calculated from concentration) of pelBss-CRM197pEGm phoA 1.0 and DXSpEGm phoA 1.0. Next, the total DNA (containing pelBss-CRM197 plasmid and genomic DNA) extracted from 6, 66 and 96 generations of cells was subjected to qPCR and calculated the quantities of CRM197 gene (plasmid) and DXS gene (genome). Lastly, the absolute plasmid copy number were obtained by the number of CRM197DXS. The copy number retention rate was further calculated by dividing the plasmid copy number of 6-generation of sample as shown in Table 3. The results from two-time experiments revealed that the plasmid copy number retention rate still maintained at least 80% up to 96-generations of passage.
(47) TABLE-US-00003 TABLE 3 Detector Copy Generations Name Ct Copies number Ratio 1.sup.st 6 DXS 17.8 3.80E+06 66 DXS 17.7 3.83E+06 96 DXS 18.7 2.19E+06 6 CRM197 14.6 7.34E+06 19.3 1.0 66 CRM197 13.3 1.68E+06 43.9 2.3 96 CRM197 15.9 3.50E+06 16.0 0.8 2.sup.nd 6 DXS 17.5 5.20E+06 66 DXS 17.7 4.54E+06 96 DXS 18.3 3.10E+06 6 CRM197 14.4 9.65E+06 18.5 10 66 CRM197 13.6 1.68E+06 37.0 2.0 96 CRM197 15.7 4.39E+06 14.1 0.8
(48) It will be apparent to those skilled in the art that various modifications and variations can be made to the disclosed embodiments. It is intended that the specification and examples be considered as exemplary only, with a true scope of the disclosure being indicated by the following claims and their equivalents.
REFERENCES
(49) The references listed below and referred to herein are hereby incorporated into this specification by reference unless this specification expressly provides otherwise. 1. Craig, S. P. III, Yuan, L., Kuntz, D. A., McKerrow, J. H., and Wang, C. C., 1991. High level expression in Escherichia coli of soluble, enzymatically active schistosomal hypoxanthine/Guanine phosphoribosyltransferase and trypanosomal ornithine decarboxylase. Proc. Natl. Acad. Sci. USA. 88, 2500-2504. 2. Lee, C., Kim, J., Shin, S. G. and Hwang, S., 2006. Absolute and relative QPCR quantification of plasmid copy number in Escherichia coli. J. Biotechnol. 123, 273-280.