MARKERS, PRIMERS, PROBES AND KIT FOR EARLY SCREENING AND DIAGNOSIS OF ENDOMETRIAL CANCER

20230076141 · 2023-03-09

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention discloses markers, primers, probes and a kit for early screening and diagnosis of endometrial cancer. The markers are partial methylated regions in the four genes of CDO1, CELF4, HAND2 and HS3ST2. Detection primers and probes are designed for these methylated regions and to have clasp structures. The kit includes the aforementioned primers and probes. The present invention screens and combines multiple methylated regions to determine the most suitable methylated position for combined diagnosis, which can significantly improve the sensitivity and specificity of the detection for early endometrial cancer. The kit is especially suitable for early screening and diagnosis of endometrial cancer with cervical exfoliated cells as a sample. Even if the DNA template concentration is low, endometrial cancer can be detected. The kit has the advantages of non-invasive sampling, fast detection speed, higher sensitivity and specificity, etc., and can ensure the accuracy of the results to help achieve the purpose of early detection, early diagnosis, and early treatment of endometrial cancer.

Claims

1. A composition comprising a set of detection primers for early screening and diagnosis of endometrial cancer, wherein the detection primers are useful to correspondingly detect methylation status of at least one methylated region in each of the target genes CDO1, CELF4, HAND2, and HS3ST2: wherein the at least one methylated region of the CDO1 gene is selected from the group consisting of: Chr5:115816884-115817037, Chr5:115816018-115816152, and Chr5:115815760-115815872; wherein the at least one methylated region of the CELF4 gene is selected from the group consisting of: Chr18:37566573-37566662, Chr18:37565524-37565639, and Chr18:37565036-37565173; wherein the at least one methylated region of the HAND2 gene is selected from the group consisting of: Chr4:173530858-173530953, Chr4:173530225-173530335, and Chr4: 173528847-173528958; wherein the at least one methylated region of the HS3ST2 gene is selected from the group consisting of: Chr16:22813813-22813928, Chr16: 22814029-22814146, and Chr16: 22814452-22814557, and optionally, wherein the design for the primers adopts a clasp structure; a sequence of 5-10 bp in length which is complementary to and paired with the 3′ end and contains no CG site is added at the 5′ end of the nucleotide sequence of the primers; the terminal last two bases at the 3′ end are CG; and/or the Tm value of the double-stranded binding region in the primers is consistent with the annealing temperature in a PCR reaction system.

2. The composition of claim 1, wherein the detection primers detect the methylation status at the following combination of methylated regions: CDO1 gene: Chr5:115815760-115815872; CELF4 gene: Chr18:37565524-37565639; HAND2 gene: Chr4:173528847-173528958; HS3ST2 gene: Chr16:22813813-22813928

3. The composition of claim 1, wherein the detection primers comprise the nucleotide sequences as follows: in the CDO1 gene: the detection primers corresponding to Chr5: 115816884-115817037 are SEQ ID NO: 1-2, the detection primers corresponding to Chr5:115816018-115816152 are SEQ ID NO: 4-5, the detection primers corresponding to Chr5:115815760-115815872 are SEQ ID NO: 7-8; in the CELF4 gene: the detection primers corresponding to Chr18:37566573-37566662 are SEQ ID NO: 10-11, the detection primers corresponding to Chr18:37565524-37565639 are SEQ ID NO: 13-14, the detection primers corresponding to Chr18:37565036-37565173 are SEQ ID NO: 16-17; in the HAND2 gene: the detection primers corresponding to Chr4:173530858-173530953 are SEQ ID NO: 19-20, the detection primers corresponding to Chr4:173530225-173530335 are SEQ ID NO: 22-23, the detection primers corresponding to Chr4:173528847-173528958 are SEQ ID NO: 25-26; in the HS3ST2 gene: the detection primers corresponding to Chr16: 22813813-22813928 are SEQ ID NO: 28-29, the detection primers corresponding to Chr16: 22814029-22814146 are SEQ ID NO: 31-32, the detection primers corresponding to Chr16: 22814452-22814557 are SEQ ID NO: 34-35.

4. A composition comprising a set of labeled detection probes for the detection of methylation status in each of the target genes CDO1, CELF4, HAND2, and HS3ST2: wherein the detection probe used to detect methylation status in the CDO1 gene binds to a methylation region selected from the group consisting of: Chr5:115816884-115817037, Chr5:115816018-115816152, and Chr5:115815760-115815872; wherein the detection probe used to detect methylation status in the CELF4 gene binds to a methylation region selected from the group consisting of: Chr18:37566573-37566662, Chr18:37565524-37565639, and Chr18:37565036-37565173; wherein the detection probe used to detect methylation status in the HAND2 gene binds to a methylation region selected from the group consisting of: Chr4:173530858-173530953, Chr4:173530225-173530335, and Chr4:173528847-173528958; wherein the detection probe used to detect methylation status in the HS3ST2 gene binds to a methylation region selected from the group consisting of: Chr16:22813813-22813928, Chr16: 22814029-22814146, Chr16: 22814452-22814557, and optionally, wherein the design of the nucleotide sequence of the detection probes adopts a clasp structure; a sequence of 3-6 bp in length which is complementary to and paired with the terminal 3-4 bp region near the 3′ end and contains no CG site is added at the 5′ end of the nucleotide sequence; the Tm value of the double-stranded binding region in the probes is 2-15° C. higher than the annealing temperature in a PCR reaction system; the free energy of binding between the nucleotide sequence of the probes and the sequence of the marker genes is higher than that for the clasp structure formed by the probes themselves; and optionally, wherein the 5′ end of the detection probes is labeled with a fluorescent group, and the 3′ end is labeled with a quenching group, and different detection probes for marker genes in the same detection system are labeled with different fluorescent groups.

5. The composition of claim 4, wherein the nucleotide sequences of the detection probes are as follows: CDO1 gene detection probe: SEQ ID NO: 9 CELF4 gene detection probe: SEQ ID NO: 15 HAND2 gene detection probe: SEQ ID NO: 27 HS3ST2 gene detection probe: SEQ ID NO: 30.

6. A kit for early screening and diagnosis of endometrial cancer, the kit comprising a set of detection primers of claim 1, and reagents and instructions therefor.

7. The kit of claim 6, wherein the set of detection primers comprises: at least one detection primer that binds to a methylation region of each of the CDO1 gene, the CELF4 gene, the HAND2 gene and the HS3ST2 gene, wherein the at least one detection primer that binds to a methylation region of the CDO1 gene is selected from the group consisting of: SEQ ID NOs: 1, 2 4, 5, 7 and 8; wherein the at least one detection primer that binds to a methylation region of the CELF4 gene is selected from the group consisting of: SEQ ID NOs: 10, 11, 13, 14, 16 and 17; wherein the at least one detection primer that binds to a methylation region of the HAND2 gene is selected from the group consisting of: SEQ ID NOs: 19, 20, 22, 23, 25, and 26; and wherein the at least one detection primer that binds to a methylation region of the HS3ST2 gene is selected from the group consisting of: SEQ ID NOs: 28, 29, 31, 32, 34 and 35.

8. The kit of claim 6, further comprising a set of labeled detection probes to detect methylation status in each of the target genes CDO1, CELF4, HAND2, and HS3ST2: wherein the at least one detection probe to detect methylation status of the CDO1 gene binds to a methylation region selected from the group consisting of: Chr5:115816884-115817037, Chr5:115816018-115816152, and Chr5:115815760-115815872; wherein the at least one detection probe to detect methylation status in the CELF4 gene binds to a methylation region selected from the group consisting of: selected from the group consisting of: Chr18:37566573-37566662, Chr18:37565524-37565639, and Chr18:37565036-37565173; wherein the at least one detection probe to detect methylation status in the HAND2 gene binds to a methylation region selected from the group consisting of: Chr4:173530858-173530953, Chr4:173530225-173530335, and Chr4:173528847-173528958; wherein the at least one detection probe to detect methylation status in the HS3ST2 gene binds to a methylation region selected from the group consisting of: Chr16:22813813-22813928, Chr16: 22814029-22814146, and Chr16: 22814452-22814557, optionally, wherein the design of the nucleotide sequence of the detection probes adopts a clasp structure; a sequence of 3-6 bp in length which is complementary to and paired with the terminal 3-4 bp region near the 3′ end and contains no CG site is added at the 5′ end of the nucleotide sequence; the Tm value of the double-stranded binding region in the probes is 2-15° C. higher than the annealing temperature in a PCR reaction system; the free energy of binding between the nucleotide sequence of the probes and the sequence of the marker genes is higher than that for the clasp structure formed by the probes themselves;

9. The kit of claim 6, further comprising detection primers and a detection probe for an internal reference gene

10. The kit of claim 9, wherein the internal reference gene is GAPDH.

11. The kit of claim 9, wherein the nucleotide sequences of the detection primers for the internal reference gene comprise SEQ ID NOs: 37 and 38.

12. The kit of claim 9, wherein the nucleotide sequence of the detection probe for the internal reference gene comprises SEQ ID NO: 39.

13. The kit of claim 9, wherein the 5′ end of the nucleotide sequence of the detection probe for the internal reference gene and/or each of the marker genes is labeled with a fluorescent group and the 3′ end is labeled with a quenching group.

14. The kit of claim 13, wherein the fluorescent group for labeling the detection probe of the internal reference gene is different from the fluorescent group for labeling the detection probe of the marker gene.

15. The kit of claim 6, further comprising at least one of: (i) a PCR reaction solution; or (ii) a methylation pretreatment reagent for a sample.

16. The kit of claim 15, wherein the sample comprises cervical exfoliated cells.

17. The kit of claim 15, wherein the methylation pretreatment reagent for the sample includes a cell genomic DNA extraction reagent and a DNA bisulfate conversion reagent.

18. The kit of claim 15, wherein the PCR reaction solution is packaged in single use units comprising 0.5-1 μL of methylation-specific Taq DNA polymerase at a concentration of 1 U/μL, 2-5 μL of dNTPs at a concentration of 10 mM, 2-6 μL of Mg′ at a concentration of 2-5 mM, 5 μL of 10×DNA polymerase buffer and purified water made up to 15 μL.

19. A method for detecting cancer, the method comprising assessing the presence of methylation at a combination of DNA methylation markers, the method comprising: contacting a biological sample or extract thereof obtained from a subject with a set of detection primers according to claim 1.

20. The method of claim 19, wherein the biological sample comprises cervical exfoliated cells.

21. The method of claim 19, wherein the cancer is endometrial cancer.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0073] FIG. 1 shows the ROC curve of the methylated regions screened for each gene of CDO1, CELF4, HAND2 and HS3ST2;

[0074] FIG. 2 shows the ROC curve of CDO1, CELF4, HAND2 and HS3ST2 in combined detection.

DETAILED DESCRIPTION OF EMBODIMENTS

[0075] The technical solutions of the present invention will be explained and described in detail below in conjunction with the preferred specific embodiments in accordance with the drawings, so that those skilled in the art can better understand and implement the present invention.

Example 1

[0076] Detection test of kit for detecting the methylation in endometrial cancer-related genes CDO1, CELF4, HAND2 and HS3ST2.

[0077] The specific nucleotide sequences of the primers and probes used are shown in the following table:

TABLE-US-00001 CDO1-F1 ctaaatTTTTTTTTTTTTTTTATTTAGCG SEQ ID NO: 1 CDO1-R1 ttaaagtgTCTCTCCCCCACTTTAACG SEQ ID NO: 2 CDO1-FP1 FAM-tataatTAGCGTCGCGAATTATA-BHQ1 SEQ ID NO: 3 CDO1-F2 aaccaaGTTTAAAGTGATTGGTTCG SEQ ID NO: 4 CDO1-R2 aaggtCCAATAAAATCCACCTTCCG SEQ ID NO: 5 CDO1-FP2 FAM-acccTTAGTCGCGGGGTTGGT-BHQ1 SEQ ID NO: 6 CDO1-F3 ataacGTTTATATTTTTAAGTTATCG SEQ ID NO: 7 CDO1-R3 gattagACCCTCTACTAATCCG SEQ ID NO: 8 CDO1-FP3 FAM-catctATTTCGGGCGCGGAGATGCGG-BHQ1 SEQ ID NO: 9 CELF4-F1 aaaaaaaATGTAGTTTTTTTTTTTTCG SEQ ID NO: 10 CELF4-R1 tttttttATTTAAACTAAAAAAACG SEQ ID NO: 11 CELF4-FP1 ROX-aatccAATGCGCGTTCGGATTTTCG-BHQ2 SEQ ID NO: 12 CELF4-F2 attccatGTATATAAAGATGGTTACG SEQ ID NO: 13 CELF4-R2 gattaagAACTATAACTTAATCCG SEQ ID NO: 14 CELF4-FP2 ROX-atctaTAACGGGTTCGGTAGTAGTT-BHQ2 SEQ ID NO: 15 CELF4-F3 cccaaaaTAAGATTGGGTTTTGGGCG SEQ ID NO: 16 CELF4-R3 atttgaaCATCCCCATCTTTCAAATCG SEQ ID NO: 17 CELF4-FP3 ROX-cttcTAGCGGGCGTCGATGAAGAGA-BHQ2 SEQ ID NO: 18 HAND2-F1 attataaaAAATAATAGTATTTATAATCG SEQ ID NO: 19 HAND2-R1 tgagttatCTATTTAAAATAACTCACG SEQ ID NO: 20 HAND2-FP1 CY5-tcctcTGTTCGTTCGGAGGATTTA-BHQ2 SEQ ID NO: 21 HAND2-F2 acaataaaaTTAAAAAGTTTTATTGTCG SEQ ID NO: 22 HAND2-R2 gttttaaCAACTACATCTTTAAAACCG SEQ ID NO: 23 HAND2-FP2 CY5-aaaaGTTCGAGGCGTCGTTTTTGT-BHQ2 SEQ ID NO: 24 HAND2-F3 ctattaatGGATTTAGAGTATTAATAGCG SEQ ID NO: 25 HAND2-R3 tttggttATATAACTAATAACCAAACG SEQ ID NO: 26 HAND2-FP3 CY5-caatTTCGTCGAATTGCGCG-BHQ2 SEQ ID NO: 27 HS3ST2-F1 caaacacccATTAGGGTAGGGTGTTTGCG SEQ ID NO: 28 HS3ST2-R1 tggtggggCTAAACACCCCCACCACG SEQ ID NO: 29 HS3ST2-FP1 HEX-aaatTCGGCGCGATTTCGATTTGGA-BHQ1 SEQ ID NO: 30 HS3ST2-F2 cccccactGTAAGAGAGTGGGGGCG SEQ ID NO: 31 HS3ST2-R2 ttaggttaATTTAAAAAATAACCTAACG SEQ ID NO: 32 HS3ST2-FP2 HEX-ccccCGGCGCGGGTTCGGGGGATT-BHQ1 SEQ ID NO: 33 HS3ST2-F3 aaaactacTTTTGGTTAGTAGTTTTCG SEQ ID NO: 34 HS3ST2-R3 tagggttAAACTACTATAACCCTACG SEQ ID NO: 35 HS3ST2-FP3 HEX-aaaaAGCGTTACGCGAGTTTTTTAG-BHQ1 SEQ ID NO: 36 GAPDH-F AGGTTAAATATAGTTGTTGA SEQ ID NO: 37 GAPDH-R CAACCCAAACCCCCAAC SEQ ID NO: 38 GAPDH-FP Joe-TAGTTGGGGGTTTGGGTT-BHQ1 SEQ ID NO: 39 Notes: F stands for forward detection primer, R stands for reverse detection primer, and FP stands for detection probe. In this table, the probe sequences shown have been labeled with fluorescent groups and quenching groups.

[0078] The components in the kit without sample pretreatment reagents are as follows:

TABLE-US-00002 Component Main ingredients PCR reaction 0.5-1 μL of methylation-specific Taq DNA solution polymerase at a concentration of 1 U/μL; 2-5 μL of dNTPs at a concentration of 10 mM; Mg.sup.2+ 2-6 μL at a concentration of 2-5 mM; 5 μL of 10 × DNA polymerase buffer; purified water made up to 15 μL. Mixed solution CDO1 gene forward and reverse primers and probes, of primers CELF4 gene forward and reverse primers and probes, and probes HAND2 gene forward and reverse primers and probes, HS3ST2 gene forward and reverse primers, probes, GAPDH gene primers and probes. Positive quality Genomic DNA fragments of different malignant control tumor cell lines Negative quality Purified water control

[0079] 60 endometrial cancer samples with known and clear pathological information were selected: 15 cases were identified as endometrioid carcinoma, 15 cases were identified as endometrial mucinous carcinoma, 15 cases were identified as endometrial serous carcinoma, and 15 cases were identified as endometrial clear cell carcinoma; 40 cases were benign endometrial samples. The above samples were all obtained from the retained samples of cervical exfoliated cells.

[0080] I. Sample Methylation Pretreatment

[0081] The methylation pretreatment reagent for a sample includes a cell genomic DNA extraction reagent and a DNA bisulfate conversion reagent.

[0082] 1. Using the company's self-developed genomic DNA extraction kit (nucleic acid extraction or purification reagents (Beijing OriginPoly Bio-Tec Co., LtD., Beijing Large-scale Medical Equipment Record No. 20210020)) as a cell genomic DNA extraction reagent, genomic DNA was extracted from the above-mentioned 100 samples of endometrial benign and malignant cervical exfoliated cells. At the same time, DNA quality was monitored. The total amount of DNA was between 4 μg-8 μg, and the OD260/280 was between 1.9-2.0, maintaining a good yield and purity.

[0083] 2. Using the company's self-developed bisulfite conversion kit (methylation detection sample pretreatment kit (Beijing OriginPoly Bio-Tec Co., LtD., Beijing Large-scale Medical Equipment Record No. 20200110)) as the DNA bisulfite conversion reagent, bisulfite conversion was performed on the extracted DNA. Unmethylated cytosine (C) in DNA was converted to uracil (U), while methylated cytosine (C) remained unchanged. The converted bis-DNA was obtained. The conversion efficiency of bisulfite in this example is 99.8%, which is higher than most bisulfite conversion kits on the market.

[0084] II. Fluorescence Quantitative PCR Amplification of Bis-DNA

[0085] 3. Formulation of PCR Reaction Solution and Mixed Solution of Primers and Probes

[0086] PCR reaction solution (15 μL/person)

TABLE-US-00003 Adding amount/ Component person (μL) DNA polymerase with methylation 0.85 characteristics (1 U/μL) dNTPs(10 mM) 4 Mg.sup.2+ (2-5 mM) 3 10 x DNA polymerase buffer 1.5 Purified water Made up to 15 μL

[0087] Mixed solution of primers and probes (5 μL/person)

TABLE-US-00004 Adding amount/ Component person (μL) CDO1/CELF1/HAND2/HS3ST2-F (100 μM) 0.2-0.8 CDO1/CELF1/HAND2/HS3ST2-R (100 μM) 0.2-0.8 CDO1/CELF1/HAND2/HS3ST2-FP (100 μM) 0.2-0.4 GAPDH gene-F (100 μM) 0.05 GAPDH gene-R (100 μM) 0.05 GAPDH gene-FP (100 μM) 0.05 Purified water Make up to 5 μL

[0088] 4. Adding Samples

[0089] 5 μL of negative quality control, positive quality control and transformed Bis-DNA clinical samples were added to the above-mentioned system, respectively. PCR reaction was carried out and the conditions are: Pre-denaturation at 96° C. for 5 min; Denaturation at 94° C. for 15 s, annealing and extension at 60° C. for 35 s, 45 cycles; Keep at 25° C. for 10 min.

[0090] 5. The Amplification Procedure is as Follows:

[0091] Step 1: Pre-denaturation at 96° C. for 5 min;

[0092] Step 2: Denaturation at 94° C. for 15 s, annealing and extension at 60° C. for 35 s, 45 cycles;

[0093] Step 3: 25° C., 10 min; Signal collection, FAM, HEX, ROX, Joe and CY5 signals were collected at 60° C.

[0094] 6. Interpretation of Results

[0095] (1) the internal standard channel has an S-shaped amplification curve and Ct value≤32.2 means the result is valid;

[0096] (2) the ΔCt values of the 4 genes are:


ΔCt(CDO1)=Ct(CDO1)−Ct(GAPDH);


ΔCt(CELF4)=Ct(CELF4)−Ct(GAPDH);


ΔCt(HAND2)=Ct(HAND2)−Ct(GAPDH);


ΔCt(HS3ST2)=Ct(HS3ST2)−Ct(GAPDH).

[0097] (3) the threshold and performance (including specificity, sensitivity, negative predictive value, positive predictive value) of multiple methylated regions in the target genes were determined by integrating the ΔCt values of the above 4 genes and according to the ROC curve to determine the optimal methylated region and the interpretation method for the 4 target genes.

[0098] 7. Analysis of Detection Results

[0099] A total of 100 samples were detected using the above kit reaction system, including 60 samples of endometrial cancer and 40 samples of benign endometrium.

[0100] Comparing the clinicopathological results, in 100 samples of cervical exfoliated cells,

[0101] the positive rate of CDO1 (Chr5: 115816884-115817037) in endometrial cancer was 58.3% (35/60), the specificity in benign samples was 82.5% (33/40), and the ROC area was 0.728;

[0102] the positive rate of CDO1 (Chr5: 115816018-115816152) in endometrial cancer was 50% (30/60), the specificity in benign samples was 92.5% (37/40), and the ROC area was 0.714;

[0103] the positive rate of CDO1 (Chr5: 115815760-115815872) in endometrial cancer was 68.3% (41/60), the specificity in benign samples was 80% (32/40), and the ROC area was 0.767;

[0104] the positive rate of CELF4 (Chr18: 37566573-37566662) in endometrial cancer was 61.7% (37/60), the specificity in benign samples was 90% (36/40), and the ROC area was 0.776;

[0105] the positive rate of CELF4 (Chr18: 37565524-37565639) in endometrial cancer was 73.3% (44/60), the specificity in benign samples was 87.5% (35/40), and the ROC area was 0.847;

[0106] the positive rate of CELF4 (Chr18: 37565036-37565173) in endometrial cancer was 86.7% (52/60), the specificity in benign samples was 62.5% (25/40), and the ROC area was 0.792;

[0107] the positive rate of HAND2 (Chr4: 173530858-173530953) in endometrial cancer was 46.7% (28/60), the specificity in benign samples was 100% (40/40), and the ROC area was 0.742;

[0108] the positive rate of HAND2 (Chr4: 173530225-173530335) in endometrial cancer was 60% (36/60), the specificity in benign samples was 95% (38/40), and the ROC area was 0.811;

[0109] the positive rate of HAND2 (Chr4: 173528847-173528958) in endometrial cancer was 78.3% (47/60), the specificity in benign samples was 90% (36/40), and the ROC area was 0.882;

[0110] the positive rate of HS3ST2 (Chr16: 22813813-22813928) in endometrial cancer was 86.7% (52/60), the specificity in benign samples was 95% (38/40), and the ROC area was 0.915;

[0111] the positive rate of HS3ST2 (Chr16: 22814029-22814146) in endometrial cancer was 66.7% (40/60), the specificity in benign samples was 95% (38/40), and the ROC area was 0.790;

[0112] the positive rate of HS3ST2 (Chr16: 22814452-22814557) in endometrial cancer was 91.7% (55/60), the specificity in benign samples was 65% (26/40), and the ROC area was 0.797.

[0113] After comparative analysis of multiple methylated regions in CDO1, CELF4, HAND2 and HS3ST2, the methylated region selected in the CDO1 gene was Chr5: 115815760-115815872, the methylated region selected in the CELF4 gene was Chr18: 37565524-37565639, the methylated region selected in the HAND2 gene was Chr4: 173528847-173528958, the methylated region selected in the HS3ST2 was Chr16: 22813813-22813928.

[0114] According to each of the best methylated regions in CDO1, CELF4, HAND2 and HS3ST2, combined detection was performed. Two genes can be involved in interpretation, or three or four genes can be involved in interpretation and analysis at the same time, and the results in the following table can be obtained:

TABLE-US-00005 TABLE 1 Combined detection performance of two genes Combined detection CDO1, CDO1, CDO1, CELF4, CELF4, HAND2, of genes CELF4 HAND2 HS3ST2 HAND2 HS3ST2 HS3ST2 Sensitivity 88.3% (53/60) 90% (54/60) 95% (57/60) 98.3% (59/60) 98.3% (59/60) 98.3% (59/60) (positive rate in endometrial cancer) (positive for any gene) Specificity 67.5% (27/40) 70% (28/40) 75% (30/40) 77.5% (31/40) 82.5% (33/40) .sup. 85% (34/40) (specificity in a sample of benign endometrium) (positive for any gene) Sensitivity 53.3% (32/60) 56.7% (34/60).sup.  60% (36/60) 53.3% (32/60) 61.7% (37/60) 66.7% (40/60) (positive rate in endometrial cancer) (positive for two genes at the same time) Specificity  100% (40/40) 100% (40/40)  100% (40/40)   100% (40/40)  100% (40/40)  100% (40/40) (specificity in a sample of benign endometrium) (positive for two genes at the same time)

TABLE-US-00006 TABLE 2 Combined detection performance of three genes CDO1, CDO1, CELF4, CELF4, CELF4, HAND2, Combined detection of genes HAND2 HS3ST2 HS3ST2 Sensitivity (positive rate in endometrial 98.3% 98.3% 98.3% cancer) (positive for any gene) (59/60) (59/60) (59/60) Specificity (specificity in a sample of 57.5% 65% 72.5% benign endometrium) (positive for any (23/40) (26/40) (29/40) gene) Sensitivity (positive rate in endometrial 80% 86.7% 90% cancer) (positive for any two genes) (48/60) (52/60) (54/60) Specificity (specificity in a sample of 100% 100% 100% benign endometrium) (positive for any (40/40) (40/40) (40/40) two genes) Sensitivity (positive rate in endometrial 41.7% 48.3% 41.7% cancer) (positive for three genes at the (25/60) (29/60) (25/60) same time) Specificity (specificity in a sample of 100% 100% 100% benign endometrium) (positive for (40/40) (40/40) (40/40) three genes at the same time)

TABLE-US-00007 TABLE 3 Combined detection performance of four genes CDO1, CELF4, Combined detection of genes HAND2, HS3ST2 Sensitivity (positive rate in endometrial 98.3% cancer) (positive for any gene) (59/60) Specificity (specificity in a sample of benign 52.5% endometrium) (positive for any gene) (21/40) Sensitivity (positive rate in endometrial 98.3% cancer) (positive for any two genes) (59/60) Specificity (specificity in a sample of benign 100% endometrium) (positive for any two genes) (40/40) Sensitivity (positive rate in endometrial 78.3% cancer) (positive for any three genes at the (47/60) same time) Specificity (specificity in a sample of benign 100% endometrium) (positive for any three genes (40/40) at the same time) Sensitivity (positive rate in endometrial 66.7% cancer) (positive for four genes at the same (40/60) time) Specificity (specificity in a sample of benign 100% endometrium) (positive for four genes at the (40/40) same time)

[0115] From the above table, we can see that when any two of the four genes are positive at the same time, the positive rate in endometrial cancer is 98.3% (59/60), the specificity in benign samples is 100% (40/40) and the ROC area detected is 0.990.

[0116] Therefore, through the analysis in Example 1, it can be concluded that the combined detection of CDO1, CELF4, HAND2, and HS3ST2 has the highest detection rate for endometrial cancer and has good specificity. Through the verification of a small amount of samples, the preliminary application of DNA methylation for the early detection of endometrial cancer is confirmed, and using cervical exfoliated cells can achieve high detection rate and very low false positive rate.

Example 2

[0117] Other components in the kit are the same as in Example 1. In Example 1, a small amount of single-center samples were tested, and then nearly 1,000 samples from multiple centers were collected for detection. The multiple centers include Peking Union Medical College Hospital, Peking University International Hospital, Chinese PLA General Hospital, Inner Mongolia People's Hospital, Hebei Cangzhou Central Hospital. Wherein 450 cases were endometrial cancer samples, 650 cases were benign endometrial samples, a total of 1,100 samples.

[0118] Comparing the histopathological and pathological results, the combined ROC curve area obtained by using this methylation detection kit was 0.98, the overall specificity was 98.5% (640/650), and the detection sensitivity for endometrial cancer was 98.9% (445/450).

[0119] The kit of the present invention, from verification using small amount of samples to research using large amount of samples, all prove that the use of DNA methylation for early detection of endometrial cancer has high accuracy and the detection can use only cervical exfoliated cells. The invention uses a special primer and probe design method and a sample pretreatment kit independently developed by the company. Multiple genes are used for combined detection and the functions are complementary. The detection of early endometrial cancer is significantly improved.

[0120] Herein, specific examples are used to describe the inventive concept in detail, and the description of the above embodiments is only used to help understand the core idea of the present invention. It should be pointed out that for those of ordinary skill in the art, any obvious modification, equivalent replacement or other improvement made should be included in the protection scope of the present invention without departing from the inventive concept.