ANTISENSE OLIGONUCLEOTIDES (ASOS) THAT SUPPRESS SARS-COV-2 REPLICATION
20250059544 ยท 2025-02-20
Assignee
Inventors
Cpc classification
C12N2310/3231
CHEMISTRY; METALLURGY
A61K31/7125
HUMAN NECESSITIES
International classification
C12N15/113
CHEMISTRY; METALLURGY
Abstract
Provided herein are antisense oligonucleotides for use in targeting SARS-CoV-2. Also provided herein are compositions comprising such oligonucleotides and methods for administering the oligonucleotides or compositions thereof to a subject for the purpose of treating or preventing a SARS-CoV-2 infection.
Claims
1. An oligonucleotide comprising a region of complementarity to a severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) 5 untranslated region (UTR) target sequence set forth in SEQ ID NO: 1.
2. The oligonucleotide of claim 1, wherein the region of complementarity is at least 17 nucleotides in length.
3. The oligonucleotide of claim 1 or claim 2, wherein the oligonucleotide comprises one more ribonucleosides and/or one or more deoxyribonucleosides.
4. The oligonucleotide of claim 3, wherein at least 40% of nucleotides in the oligonucleotide are ribonucleosides.
5. The oligonucleotide of claim 3, wherein at least 40% of nucleotides in the oligonucleotide are deoxyribonucleosides.
6. The oligonucleotide of any one of claims 3-5, wherein at least one of the one or more ribonucleotides is a modified ribonucleoside.
7. The oligonucleotide of claim 6, wherein the modified ribonucleoside is a locked nucleic acid (LNA)-modified ribonucleoside.
8. The oligonucleotide of claim 7, wherein at least 40% of nucleosides in the oligonucleotide are LNA-modified ribonucleosides.
9. The oligonucleotide of any one of claims 1-8, wherein the oligonucleotide comprises one or more phosphorothioate internucleoside linkages.
10. The oligonucleotide of claim 9, wherein every internucleoside linkage is a phosphorothioate internucleoside linkage.
11. The oligonucleotide of any one of claims 1-10, wherein the oligonucleotide comprises at least 12 consecutive nucleotides of the nucleotide sequence of any one of: TABLE-US-00006 (SEQIDNO:2) CCTGGGAAGGTATAAACCTTTAAT; (SEQIDNO:3) GGTTTGTTACCTGGGAAGG; or (SEQIDNO:4) GTTACCTGGGAAGGTATAAACCTTTAAT.
12. The oligonucleotide of claim 11, wherein the oligonucleotide comprises the nucleotide sequence of any one of: TABLE-US-00007 (SEQIDNO:2) CCTGGGAAGGTATAAACCTTTAAT; (SEQIDNO:3) GGTTTGTTACCTGGGAAGG; or (SEQIDNO:4) GTTACCTGGGAAGGTATAAACCTTTAAT
13. The oligonucleotide of claim 12, wherein the oligonucleotide comprises the nucleotide sequence of any one of: TABLE-US-00008 (SEQIDNO:2) dC+CdTdG+G+GdA+AdGdG+TdA+TdAdA+AdC+CdTdT+TdA+AdT; (SEQIDNO:3) dG+GdTdT or (SEQIDNO:4) dGdT+TdA+C+C+T+G+G+GdAdAdGdG+TdA+TdA+AdA+C+CdTdT+ TdA+AdT, wherein dN represents a deoxyribonucleoside; +N represents a locked nucleic acid-modified ribonucleoside; and all nucleotides are linked by phosphodiester internucleoside linkages.
14. The oligonucleotide of any one of claims 1-13, wherein the oligonucleotide is not an oligonucleotide selected from: TABLE-US-00009 (SEQIDNO:5) GAAAGTTGGTTGGTTT; (SEQIDNO:6) GTTTGTTACCTGGGAA; or (SEQIDNO:7) GTTACCTGGGAAGGT.
15. A composition comprising the antisense oligonucleotide of any one of claims 1-14.
16. The composition of claim 15, further comprising a pharmacologically acceptable excipient.
17. The composition of claim 15 or claim 16, further comprising a liposome or a nanoparticle.
18. A method of treating a SARS-CoV-2 infection or reducing the risk of a SARS-CoV-2 infection in a subject in need thereof, the method comprising administering to the subject an effective amount of the antisense oligonucleotide of any one of claims 1-14 or the composition of any one of claims 15-17.
19. The method of claim 18, wherein the administration reduces the translation of SARS-CoV-2 RNA in cells of the subject.
20. The method of claim 18 or claim 19, wherein the administration increases the degradation of SARS-CoV-2 RNA in cells of the subject.
21. The method of any one of claims 18-20, wherein the administration reduces the production of SARS-CoV-2 viral particles in the subject.
22. The method of any one of claims 18-21, wherein the subject is a mammal.
23. The method of any one of claims 18-22, wherein the subject is a human.
24. The method of claim 23, wherein the subject is a human neonate, a human infant, a human adult, or an elderly human.
25. The method of claim 24, wherein the subject is a human adult.
26. The method of claim 24, wherein the subject is an elderly human.
27. The method of claim 26, wherein the administration occurs when the subject is more than 65 years of age.
28. The method of any one of claims 24-27, wherein the subject is immune-senescent, immune-compromised, is infected with human immunodeficiency virus (HIV), has chronic lung disease, asthma, cardiovascular disease, cancer, a metabolic disorder, chronic kidney disease, liver disease, is malnourished, or is frail.
29. The method of any one of claims 18-22, wherein the subject is a companion animal, a research animal, or a domesticated animal.
30. The method of claim 29, wherein the subject is an adult or elderly companion animal.
31. The method of any one of claims 18-30, wherein the administration is systemic.
32. The method of any one of claims 18-31, wherein the administration is intravenous, intramuscular, oral, sublingual, or inhaled.
33. The method of any one of claims 18-32, wherein the administration occurs more than once.
34. The method of any one of claims 18-33, wherein the administration is prophylactic.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0017] The accompanying drawings are not intended to be drawn to scale. In the drawings, each identical or nearly identical component that is illustrated in various figures is represented by a like numeral. For purposes of clarity, not every component may be labeled in every drawing. In the drawings:
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
DETAILED DESCRIPTION OF CERTAIN EMBODIMENTS
[0029] Some aspects of the present disclosure are based, at least in part, on the finding that antisense oligonucleotides targeting the 5 untranslated region (UTR) of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) mRNA transcripts, specifically stem loop 1 (SL1), may be used to reduce SARS-CoV-2 virulence by nullifying protection of SARS-CoV-2 transcripts from the SARS-CoV-2-mediated host translation block. As described herein, these antisense oligonucleotides may be used to treat or prevent SARS-CoV-2 infection in subjects by reducing translation of viral proteins and/or enhancing degradation of viral transcripts, thereby reducing overall production of virus particles. As further described, this approach is useful for the treatment or prevention of either the original SARS-CoV-2 virus or its subsequent variants, and may be combined with other methods for treating or reducing the risk for SARS-CoV-2 infection, such as vaccination against SARS-CoV-2. In some embodiments, the antisense oligonucleotides disclosed herein are useful for treating (both prophylactically and therapeutically) SARS-CoV-2 infection in vulnerable populations (e.g., neonates, elderly, immunosenescent, or immunocompromised individuals).
Antisense Oligonucleotides
[0030] Without wishing to be bound by theory, during infection by the SARS-CoV-2 beta coronavirus, the positive-sense RNA viral genome is transcribed to produce transcripts encoding two partially overlapping open reading frames, ORF1a and ORF1b, which are subsequently translated and proteolytically cleaved by host cells to produce 16 mature non-structural proteins (numbered Nsp1 through Nsp16). These non-structural proteins include virulence factors which are suggested to perform a variety of functions, including suppression of host gene expression and immune responses (e.g., by repurposing host translation machinery to preferentially translate SARS-CoV-2 viral RNA transcripts and by preventing the induction of Type 1 interferons). SARS-CoV-2 Nsp1 in particular suppresses the translation of host mRNAs by directly binding to the mRNA entry channel of the 40S small ribosomal subunit via its C-terminal domain (CT). Additionally, Nsp1 reduces the total pool of cytosolic host mRNAs available to infected cells by promoting the degradation of host mRNAs and inhibiting their nuclear export. Mutations in Nsp1 that disrupt ribosome binding also abolish the effect on mRNA degradation, implying that the increased degradation of host mRNAs observed in infected cells is likely downstream of the translational block. Together these two mechanisms synergistically impair host protein expression in SARS-CoV-2 infected cells.
[0031] However, while SARS-CoV-2 effectively inhibits the translation of host proteins, Nsp1 evidently does not interfere with the translation of SARS-CoV-2 viral proteins. The 5 UTR of SARS-CoV-2 viral RNA is critical for circumventing the translation block mediated by Nsp1. This region comprises a variety of stem loops, of which stem loop 1 (SL1) appears to be essential for bypassing the effect of Nsp1, perhaps by interaction with Nsp1 and/or the 40S small ribosomal subunit. Given the importance of SL1 for maintaining efficient translation of SARS-CoV-2 proteins in the presence of Nsp1, SARS-CoV-2 virulence and/or infectivity could potentially be reduced or eliminated by means of a SL1-binding agent, such as, for example, an oligonucleotide complementary to SL1. Such an agent would be of use for treating and/or preventing SARS-CoV-2 infection in subject populations, such as human populations, especially as the SL1 sequence is highly conserved between the original SARS-CoV-2 virus and its subsequent variants.
[0032] In some aspects, the present disclosure describes an oligonucleotide comprising a region of complementarity to the 5 UTR of a SARS-CoV-2 viral RNA. In some embodiments, such an oligonucleotide is capable of interacting (e.g., through Watson-Crick base pairing) with a region of the 5 UTR of a SARS-CoV-2 viral RNA. In some embodiments, an interaction between an oligonucleotide described herein and a region of the 5 UTR of a SARS-CoV-2 viral RNA reduces the virulence and/or infectivity of SARS-CoV-2 in a subject. In some embodiments, an oligonucleotide contemplated herein is an antisense oligonucleotide.
[0033] In some embodiments, an oligonucleotide described herein comprises a region of complementary to SL1 in the 5 UTR of a SARS-CoV-2 viral RNA. In some embodiments, an oligonucleotide described herein is complementary to part or all of a SARS-CoV-2 SL1 sequence. In some embodiments, an oligonucleotide described herein is further complementary to one or more additional nucleotides of the 5 UTR of a SARS-CoV-2 viral RNA.
[0034] In some embodiments, an oligonucleotide described herein comprises a region of complementarity to part or all of the SL1 sequence of the originally discovered SARS-CoV-2 virus. In some embodiments, an oligonucleotide described herein comprises a region of complementarity to part or all of the SL1 sequence of a SARS-CoV-2 variant, such as a variant of concern (VOC) as identified by the United States Centers for Disease Control and Prevention (CDC), such as, but not limited to, B.1.1.7 (alpha), B.1.351 (beta), P.1 (gamma), B.1.617.2 (delta), B.1.427 and B.1.429 (epsilon), B.1.525 (eta), B.1.526 (iota), B.1.617.1 (kappa), B.1.1.529 (omicron), B.1.621 (mu), and P.2 (zeta) variant SARS-CoV-2. In some embodiments, an oligonucleotide described herein comprises a region of complementarity to part or all of the sequence set forth as: AUUAAAGGUUUAUACCUUCCCAGGUAACAAACC (SEQ ID NO: 1).
[0035] In some embodiments, an oligonucleotide described herein comprises a region of complementarity that is at least 10 nucleotides in length, at least 11 nucleotides in length, at least 12 nucleotides in length, at least 13 nucleotides in length, at least 14 nucleotides in length, at least 15 nucleotides in length, at least 16 nucleotides in length, at least 17 nucleotides in length, at least 18 nucleotides in length, at least 19 nucleotides in length, at least 20 nucleotides in length, at least 21 nucleotides in length, at least 22 nucleotides in length, at least 23 nucleotides in length, at least 24 nucleotides in length, at least 25 nucleotides in length, at least 26 nucleotides in length, at least 27 nucleotides in length, at least 28 nucleotides in length, at least 29 nucleotides in length, at least 30 nucleotides in length, at least 31 nucleotides in length, at least 32 nucleotides in length, or at least 33 nucleotides in length. In some embodiments, an oligonucleotide described herein comprises a region of complementarity is between 10 and 15 nucleotides in length, between 15 and 20 nucleotides in length, between 20 and 25 nucleotides in length, between 25 and 30 nucleotides in length, between 20 and 30 nucleotides in length, between 15 and 30 nucleotides in length, between 10 and 30 nucleotides in length, or between 10 and 33 nucleotides in length.
[0036] In some embodiments, an oligonucleotide described herein comprises a region of complementarity that is fully (i.e., 100%) complementary to a region of the 5 UTR of a SARS-CoV-2 viral RNA, e.g., all or part of a SL1 sequence (SEQ ID NO: 1). In some embodiments, an oligonucleotide described herein comprises a region of complementarity that is partially (i.e., less than 100%) complementary to a region of the 5 UTR of a SARS-CoV-2 viral RNA, e.g., all or part of a SL1 sequence (SEQ ID NO: 1). In some embodiments, an oligonucleotide described herein comprises a region of complementarity that is at least 80%, at least 90%, at least 95%, or at least 99% complementary to a region of the 5 UTR of a SARS-CoV-2 viral RNA, e.g., all or part of a SL1 sequence (SEQ ID NO: 1). In some embodiments, an oligonucleotide described herein comprises a region of complementarity that contains 1, 2, or 3 mismatched nucleotides as compared to a region of the 5 UTR of a SARS-CoV-2 viral RNA, e.g., all or part of a SL1 sequence (SEQ ID NO: 1), where each mismatched nucleotide comprises a different nucleobase (e.g., adenine (A), uracil (U), guanine (G), cytosine (C)) than that which is encoded by the 5 UTR of a SARS-CoV-2 viral RNA at the corresponding position.
[0037] In some embodiments, an oligonucleotide described herein is at least 10 nucleotides in length, at least 11 nucleotides in length, at least 12 nucleotides in length, at least 13 nucleotides in length, at least 14 nucleotides in length, at least 15 nucleotides in length, at least 16 nucleotides in length, at least 17 nucleotides in length, at least 18 nucleotides in length, at least 19 nucleotides in length, at least 20 nucleotides in length, at least 21 nucleotides in length, at least 22 nucleotides in length, at least 23 nucleotides in length, at least 24 nucleotides in length, at least 25 nucleotides in length, at least 26 nucleotides in length, at least 27 nucleotides in length, at least 28 nucleotides in length, at least 29 nucleotides in length, at least 30 nucleotides in length, at least 31 nucleotides in length, at least 32 nucleotides in length, at least 33 nucleotides in length, at least 35 nucleotides in length, at least 40 nucleotides in length, at least 45 nucleotides in length, or at least 50 nucleotides in length. In some embodiments, an oligonucleotide described herein is between 10 and 15 nucleotides in length, between 15 and 20 nucleotides in length, between 20 and 25 nucleotides in length, between 25 and 30 nucleotides in length, between 20 and 30 nucleotides in length, between 15 and 30 nucleotides in length, between 10 and 30 nucleotides in length, between 10 and 33 nucleotides in length, between 10 and 40 nucleotides in length, or between 10 and 50 nucleotides in length.
[0038] In some embodiments, an oligonucleotide described herein comprises one or more ribonucleosides. In some embodiments, an oligonucleotide described herein comprises one or more deoxyribonucleosides. In some embodiments, an oligonucleotide described herein comprises one or more ribonucleosides and one or more deoxyribonucleosides. In some embodiments, at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% of nucleotides in an oligonucleotide described herein are ribonucleosides. In some embodiments, at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% of nucleotides in an oligonucleotide described herein are deoxyribonucleosides.
[0039] In some embodiments, at least one of the one or more ribonucleosides in an oligonucleotide described herein are modified ribonucleosides. In some embodiments, at least one of the one or more deoxyribonucleosides in an oligonucleotide described herein are modified deoxyribonucleosides. In some embodiments, at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% of nucleotides in an oligonucleotide described herein are modified ribonucleosides or modified deoxyribonucleosides. In some embodiments, every nucleotide in an oligonucleotide described herein are modified ribonucleosides or modified deoxyribonucleosides. As defined herein, a modified nucleoside is a nucleoside comprising a sugar (ribose) and/or a nucleobase modification, where such a modification is not naturally occurring or does not occur naturally in nucleosides of a particular species (subject). Modified nucleosides include, for example, ribonucleosides and deoxyribonucleosides comprising a sugar (ribose) with an additional moiety at one or more carbon positions. Examples of modified nucleosides include, for example, 2-nucleosides, such as 2-deoxy, 2-O-methyl (2-O-Me), 2-O-methoxyethyl (2-MOE), locked nucleic acids (LNA, i.e., methylene-bridged nucleic acids), ethylene-bridged nucleic acids (ENA), and (S)-constrained ethyl-bridged nucleic acids (cEt). Other alternative modified nucleosides are well known the relevant art. In some embodiments, at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% of nucleotides in an oligonucleotide described herein are LNA-modified ribonucleosides.
[0040] In some embodiments, one or more internucleoside linkages connecting nucleosides of an oligonucleotide described herein are modified internucleoside linkages. In some embodiments, every internucleoside linkage of an oligonucleotide described herein are modified internucleoside linkages. As defined herein, a modified nucleoside linkage is a nucleoside linkage that is not naturally occurring or does not occur naturally between nucleosides of a particular species (subject). In some embodiments, a modified internucleoside linkage is an internucleoside linkage that is not a phosphodiester internucleoside linkage. Examples of modified internucleoside linkages include, for example, phosphorothioate internucleoside linkages. Other alternative modified internucleoside linkages are well known the relevant art. In some embodiments, one or more internucleoside linkages connecting nucleosides of an oligonucleotide described herein are phosphorothioate internucleoside linkages. In some embodiments, every internucleoside linkage of an oligonucleotide described herein are phosphorothioate internucleoside linkages.
[0041] In some embodiments, an oligonucleotide described herein comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, or at least 24 consecutive nucleotides of the nucleotide sequence set forth as:
TABLE-US-00002 (SEQIDNO:2) CCTGGGAAGGTATAAACCTTTAAT.
[0042] In some embodiments, an oligonucleotide described herein comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19 consecutive nucleotides of the nucleotide sequence set forth as:
TABLE-US-00003 (SEQIDNO:3) GGTTTGTTACCTGGGAAGG.
[0043] In some embodiments, an oligonucleotide described herein comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, or at least 28 consecutive nucleotides of the nucleotide sequence set forth as:
TABLE-US-00004 (SEQIDNO:4) GTTACCTGGGAAGGTATAAACCTTTAAT.
[0044] In some embodiments, an oligonucleotide described herein comprises the nucleotide sequence of any one of SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4. In some embodiments, an oligonucleotide described herein consists of the nucleotide sequence of any one of SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4. In some embodiments, an oligonucleotide described herein does not consist of a nucleotide sequence set forth as any one of GAAAGTTGGTTGGTTT (SEQ ID NO: 5), GTTTGTTACCTGGGAA (SEQ ID NO: 6); or GTTACCTGGGAAGGT (SEQ ID NO: 7).
[0045] In some embodiments, an oligonucleotide described herein is a mixmer. As defined herein, a mixmer is an oligonucleotide comprising alternating LNA nucleosides and deoxyribonucleosides. Nucleosides of a mixmer may alternate between LNA and DNA in a regularly repeating pattern (e.g., alternating stretches of LNA and DNA are equal in length) or in a pattern that is not regularly repeating (e.g., alternating stretches of LNA and DNA are variable in length). In some embodiments, an oligonucleotide described herein is a mixmer comprising the modified nucleotides sequence set forth in any one of the following, where dN represents a deoxyribonucleoside; +N represents a locked nucleic acid-modified ribonucleoside; and nucleotides are linked by phosphodiester internucleoside linkages:
TABLE-US-00005 (SEQIDNO:2) dC+CdTdG+G+GdA+AdGdG+TdA+TdAdA+AdC+CdTdT+ TdA+AdT; (SEQIDNO:3) dG+GdTdT+T+GdTdTdA+CdC+T+G+G+GdA+A+G+G; or (SEQIDNO:4) dGdT+TdA+C+C+T+G+G+GdAdAdGdG+TdA+TdA+AdA+ C+CdTdT+TdA+AdT
Compositions
[0046] In some embodiments, compositions (e.g., pharmaceutical compositions) of the present disclosure comprise an oligonucleotide described herein. As contemplated herein, the terms composition and formulation may be used interchangeably.
[0047] In some embodiments, a composition may comprise an oligonucleotide described herein and one or more pharmacologically acceptable excipients. A pharmacologically acceptable excipient may enhance stability of an oligonucleotide described herein, enhance delivery of the oligonucleotide to cells of a subject to which the composition is administered, permit sustained or delayed release of the oligonucleotide upon administration, alter the biodistribution of the oligonucleotide (e.g., target the oligonucleotide to specific tissues or cell types), or reduce host immunity against the oligonucleotide. Examples of pharmacologically acceptable excipients includes any and all solvents, dispersion media, diluents or other liquid vehicles, dispersion or suspension aids, surface active agents, isotonic agents, thickening or emulsifying agents, and preservatives, as are known in the art. In some embodiments, a pharmacologically acceptable excipient comprises an aqueous solution or buffer. In some embodiments, the composition is isotonic, relative to a biological fluid of a subject (i.e., blood) to which the composition is to be administered. In some embodiments, the composition has a pH between 7 and 8, or optimally a pH of about 7.4.
[0048] In some embodiments, a composition may comprise an oligonucleotide described herein and a liposome or a nanoparticle. In some embodiments, a liposome or nanoparticle added to such a composition enhances delivery of the oligonucleotide to cells of a subject to which the composition is administered.
[0049] Liposomes are artificially prepared vesicles which may primarily be composed of a lipid bilayer and may be used as a delivery vehicle for the administration of one or more compounds in a pharmaceutical composition. Liposomes can be of different sizes such as, but not limited to, a multilamellar vesicle (MLV) which may be hundreds of nanometers in diameter and may contain a series of concentric bilayers separated by narrow aqueous compartments, a small unicellular vesicle (SUV) which may be smaller than 50 nm in diameter, and a large unilamellar vesicle (LUV) which may be between 50 and 500 nm in diameter. Liposome design may include, but is not limited to, opsonins or ligands in order to improve the attachment of liposomes to unhealthy tissue or to activate events such as, but not limited to, endocytosis. Liposomes may contain an acidic, basic, or neutral pH in order to improve the delivery of the pharmaceutical composition.
[0050] The formation of liposomes may depend on the physicochemical characteristics such as, but not limited to, the pharmaceutical formulation entrapped and the liposomal ingredients, the nature of the medium in which the lipid vesicles are dispersed, the effective concentration of the entrapped substance and its potential toxicity, any additional processes involved during the application and/or delivery of the vesicles, the optimization size, polydispersity and the shelf-life of the vesicles for the intended application, and the batch-to-batch reproducibility and possibility of large-scale production of safe and efficient liposomal products.
[0051] As a non-limiting example, liposomes such as synthetic membrane vesicles may be prepared by the methods, apparatus and devices described in US Patent Publication No. US20130177638, US20130177637, US20130177636, US20130177635, US20130177634, US20130177633, US20130183375, US20130183373 and US20130183372, the contents of each of which are incorporated herein by reference. Characteristics of liposomes for use in enhancing the delivery of antisense oligonucleotides are described, for example, in Gagliardi and Ashizawa The Challenges and Strategies of Antisense Oligonucleotide Drug Delivery Biomedicines 2021, 9, 433, the contents of which are incorporated herein by reference.
[0052] Nanoparticles are artificially prepared particles that may contain organic, inorganic, naturally occurring, and/or synthetic nanoscale materials (nanomaterials) and generally range in size from 20 nm to 1000 nm. Examples of materials used in nanoparticles for enhancing delivery of antisense oligonucleotides include, without limitation, poly d,l-lactide (PLA), d,l-lactide-co-glycolide (PLGA), polyethylene glycol (PEG), polyethylenimine (PEI), chitosan/pluronic F68-coated polyisobutylcyanoacrylate (PIBCA), silver nanoparticles, and calcium phosphate (CP)-based nanoparticles. Additional examples of nanoparticles for use in enhancing the delivery of antisense oligonucleotides are described, for example, in Falzarano, et al. Nanoparticle delivery of antisense oligonucleotides and their application in the exon skipping strategy for Duchenne muscular dystrophy Nucleic Acid Ther, 24(1), 87-100, the contents of which are incorporated herein by reference.
[0053] In some embodiments, liposomes and nanoparticles may be formulated for targeted delivery. As a non-limiting example, a liposome or nanoparticle may be formulated for targeted delivery to one or more specific organs, tissues, and/or cells, such as those in the respiratory tract (e.g., lungs) or nervous system (e.g., brain). Examples of liposomes used for targeted delivery include, but are not limited to, those described in and methods of making liposomes described in US Patent Publication No. US20130195967, the contents of which are incorporated herein by reference.
Kits
[0054] Also encompassed by the present disclosure are kits (e.g., pharmaceutical packs). The kits provided may comprise a pharmaceutical composition or oligonucleotide described herein and a container (e.g., a vial, ampule, bottle, syringe, and/or dispenser package, or other container suitable for storage and/or administration). In some embodiments, provided kits may optionally further include a second container comprising a pharmaceutical excipient for dilution or suspension of a pharmaceutical composition or oligonucleotide described herein. In some embodiments, the pharmaceutical composition or oligonucleotide described herein provided in the first container and the second container are combined to form one dosage unit.
[0055] Thus, in one aspect, provided are kits including a first container comprising a compound or pharmaceutical composition described herein. In certain embodiments, the kits are useful for treating a disease (e.g., coronavirus disease 2019 (i.e., COVID-19)) in a subject in need thereof. In certain embodiments, the kits are useful for preventing a disease (e.g., COVID-19) in a subject in need thereof.
[0056] In certain embodiments, a kit described herein further includes instructions for using the pharmaceutical composition or oligonucleotide included in the kit. A kit described herein may also include information as required by a regulatory agency such as the U.S. Food and Drug Administration (FDA). In certain embodiments, the information included in the kits is prescribing information. In certain embodiments, the kits and instructions provide for treating a disease (e.g., COVID-19) in a subject in need thereof. In certain embodiments, the kits and instructions provide for preventing a disease (e.g., COVID-19) in a subject in need thereof. A kit described herein may include one or more additional pharmaceutical agents described herein as a separate composition.
Administration of Antisense Oligonucleotides
[0057] The terms treatment, treat, and treating refer to reversing, alleviating, delaying the onset of, or inhibiting the progress of a disease (e.g., COVID-19) described herein. In some embodiments, treatment may be administered after one or more signs or symptoms of the disease have developed or have been observed. In other embodiments, treatment may be administered in the absence of signs or symptoms of the disease. For example, treatment may be administered to a susceptible subject prior to the onset of symptoms (e.g., in light of a history of symptoms and/or in light of exposure to a pathogen or the likelihood for future exposure to a pathogen). Treatment may also be continued after symptoms have resolved, for example, to delay or prevent recurrence. Prophylactic treatment refers to the treatment of a subject who is not and was not with a disease but is at risk of developing the disease or who was with a disease and is at risk of regression of the disease. In some embodiments, the subject is at a higher risk of developing the disease or at a higher risk of regression of the disease than an average healthy member of a population.
[0058] An effective amount of a composition described herein refers to an amount sufficient to elicit the desired biological response. An effective amount of a composition described herein may vary depending on such factors as the desired biological endpoint, the pharmacokinetics of a compound (e.g., an oligonucleotide described herein), the condition being treated, the mode of administration, and the age and health of the subject. In some embodiments, an effective amount is a therapeutically effective amount. In some embodiments, an effective amount is a prophylactic treatment. In some embodiments, an effective amount is the amount of a compound (e.g., an oligonucleotide described herein) administered in a single dose. In some embodiments, an effective amount is the combined amounts of a compound (e.g., an oligonucleotide described herein) administered in multiple doses. When an effective amount of a composition is referred herein, it means the amount is prophylactically and/or therapeutically effective, depending on the subject and/or the disease to be treated. Determining the effective amount or dosage is within the abilities of one skilled in the art.
[0059] The terms administer, administering, or administration refers to implanting, absorbing, ingesting, injecting, inhaling, or otherwise introducing a composition or compound (e.g., an oligonucleotide described herein) in or on a subject. A composition or compound (e.g., an oligonucleotide described herein) may be administered systemically (e.g., via intravenous injection) or locally (e.g., via local injection). In some embodiments, the composition or compound (e.g., an oligonucleotide described herein) is administered orally, intravenously, topically, intranasally, or sublingually. Parenteral administrating is also contemplated. The term parenteral as used herein includes subcutaneous, intracutaneous, intravenous, intramuscular, intraarticular, intraarterial, intrasynovial, intrasternal, intrathecal, intralesional, intradermally, and intracranial injection or infusion techniques. In some embodiments, the administering is done intramuscularly, intradermally, orally, intravenously, topically, intranasally, intravaginally, or sublingually. In some embodiments, the composition or compound (e.g., an oligonucleotide described herein) is administered prophylactically.
[0060] In some embodiments, a composition or compound (e.g., an oligonucleotide described herein) is administered once or is administered repeatedly (e.g., 2, 3, 4, 5, or more times). For multiple administrations, the administrations may be done over a period of time (e.g., 6 months, a year, 2 years, 5 years, 10 years, or longer). In some embodiments, the composition or compound (e.g., an oligonucleotide described herein) is administered twice (e.g., Day 0 and Day 7, Day 0 and Day 14, Day 0 and Day 21, Day 0 and Day 28, Day 0 and Day 60, Day 0 and Day 90, Day 0 and Day 120, Day 0 and Day 150, Day 0 and Day 180, Day 0 and 3 months later, Day 0 and 6 months later, Day 0 and 9 months later, Day 0 and 12 months later, Day 0 and 18 months later, Day 0 and 2 years later, Day 0 and 5 years later, or Day 0 and 10 years later). In some embodiments, the composition or compound (e.g., an oligonucleotide described herein) is administered more than twice, or is administered until a subject is free of symptoms of a disease (e.g., COVID-19) or until the risk of developing the disease subsides.
[0061] In some embodiments, a composition or compound (e.g., an oligonucleotide described herein) is administered to a subject for the purpose of treating or preventing an infection by a SARS-CoV-2 virus. In some embodiments, a composition or compound (e.g., an oligonucleotide described herein) is administered to a subject for the purpose of treating or preventing an infection by the originally discovered SARS-CoV-2 virus. In some embodiments, a composition or compound (e.g., an oligonucleotide described herein) is administered to a subject for the purpose of treating or preventing an infection by a SARS-CoV-2 variant, such as a variant of concern (VOC) as identified by the United States Centers for Disease Control and Prevention (CDC), such as, but not limited to, B.1.1.7 (alpha), B.1.351 (beta), P.1 (gamma), B.1.617.2 (delta), B.1.427 and B.1.429 (epsilon), B.1.525 (eta), B.1.526 (iota), B.1.617.1 (kappa), B.1.1.529 (omicron), B.1.621 (mu), and P.2 (zeta) variant SARS-CoV-2.
[0062] As defined herein, a subject refers to a living organism to which administration is contemplated. In some embodiments, a subject is a mammal. In some embodiments, the subject is a non-human animal (e.g., primate (e.g., cynomolgus monkey or rhesus monkey), a commercially relevant mammal (e.g., cattle, pig, horse, sheep, goat, cat, or dog), or a bird (e.g., commercially relevant bird, such as chicken, duck, goose, or turkey)). In some embodiments the subject is a domesticated animal (e.g., cattle, pig, horse, sheep, goat) or a companion animal (i.e., a pet or service animal, e.g., cat or dog). In some embodiments, the subject is a fish, reptile, or amphibian. The non-human animal may be a male or female at any stage of development. The non-human animal may be a transgenic animal or genetically engineered animal.
[0063] In some embodiments, the subject is a human. In some embodiments, the subject is a human infant. In some embodiments, the human infant is a neonate that is less than 28 days of age. In some embodiments, the human infant is less than 1, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 days of age at the time of administration.
[0064] In some embodiments, the human subject is more than 28 days of age (e.g., 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, 2 years, 3 years, 4 years, 5 years, 10 years, 11 years, 12 years, 13 years, 14 years, 15 years, 16 years, 17 years of age). In some embodiments, the human subject is an adult (e.g., more than 18 years of age). In some embodiments, the human subject is an elderly subject (e.g., more than 60 years of age). In some embodiments, the human subject is 60 years, 65 years, 70 years, 75 years, 80 years, 85 years, 90 years, 95 years, 100 years, or more than 100 years of age.
[0065] In some embodiments, the human subject is part of one or more immunologically vulnerable populations. In some embodiments, the human subject is frail (e.g., a subject having frailty syndrome, a malnourished subject, or a subject with a chronic disease causing frailty). In some embodiments, the human subject has a weak immune system, such as an undeveloped (e.g., an infant or a neonate subject), immunosenescent (e.g., an elderly subject), or compromised immune system. Immunosenescent subjects include, without limitation, subjects exhibiting a decline in immune function associated with advanced age. Immunocompromised subjects include, without limitation, subjects with primary immunodeficiency or acquired immunodeficiency such as those suffering from sepsis, HIV infection, and cancers, including those undergoing chemotherapy and/or radiotherapy, as well as subjects to which immunosuppressants are administered, as for organ or tissue transplantation. In some embodiments, the human subject has or is suspected of having one or more disorders or diseases that reduce immune system function and/or increase the risk of infection in the subject by one or more pathogens (e.g., a bacterium, a mycobacterium, a fungus, a virus, a parasite, or a prion). In some embodiments, the human subject is, for example, a subject that has or is suspected of having chronic lung disease, asthma, cardiovascular disease, cancer, a metabolic disorder (e.g., obesity or diabetes mellitus), chronic kidney disease, or liver disease.
[0066] Some of the embodiments, advantages, features, and uses of the technology disclosed herein will be more fully understood from the Examples below. The Examples are intended to illustrate some of the benefits of the present disclosure and to describe particular embodiments, but are not intended to exemplify the full scope of the disclosure and, accordingly, do not limit the scope of the disclosure.
EXAMPLES
Example 1: SARS-CoV-2 5 UTR Mediates Translation Despite the Presence of Nsp1
[0067] To investigate the function of SARS-CoV-2 non-structural protein 1 (Nsp1) in inhibiting mRNA translation, an mScarlet reporter construct with maltose-binding protein (MBP)-tagged Nsp1 or an MBP control were co-transfected into HeLa cells and mScarlet fluorescence and anti-MBP immunofluorescence was imaged (
[0068] On the other hand, when the 5 UTR in the control mScarlet reporter was replaced by the SARS-CoV-2 5 UTR (referred to as CoV-2 reporter throughout the manuscript), no significant difference in mScarlet expression was observed upon co-expression with MBP-Nsp-1 or MBP, indicating robust evasion of Nsp1-mediated translational suppression (
[0069] To model subgenomic RNAs generated during discontinuous SARS-CoV-2 gene transcription, constructs with SARS-CoV-2 5 UTR upstream of either green fluorescent protein (GFP) fused to open reading frame (ORF) 3a or ORF8 (ORF3a-GFP or ORF8-GFP, respectively) were tested. ORF3a-GFP expression was not significantly decreased by Nsp1 co-expression, and ORF8-GFP showed only a 1.4-fold decrease (
Example 2: The SL1 of the 5 UTR is Necessary and Sufficient for Evasion of Nsp1-Mediated Translation Suppression
[0070] The 5 UTR of coronaviruses comprises a number of stem-loop structures (
Example 3: Nsp1-CT and Nsp1-NT are Both Required for Optimal Host Suppression and SL1-Driven Bypass
[0071] Nsp1 is a 187 amino acid (aa) protein with a 128 aa amino-terminal (NT) domain and a 33 aa carboxy-terminal (CT) domain separated by a short linker region (
[0072] These apparently different observations from HeLa versus 293T cell lines were intriguing, but when the ratio of the SARS-CoV-2 5 UTR reporter to the control reporter fluorescence was examined, a strikingly similar trend was observed. FL Nsp1 co-expression led to a SARS-CoV-2 5 UTR/control fluorescence ratio of 5.61.2 and 5.90.62 for HeLa and 293T cells, respectively (
Example 4: Correct Association and Spacing of NT+CT Via the Nsp1 Linker is Required for Function
[0073] The fact that NT+CT expression from different constructs compromised SARS-CoV-2 5 UTR/control ratio suggested a role for covalent association between the two domains via a linker. To test whether the length of the linker between NT and CT in Nsp1 has any functional effect, an additional 20 residues (linker1) or 40 residues (linker2) were inserted at the Nsp1 linker region (
[0074] Various naturally occurring mutations have been described in Nsp1 throughout the SARS-CoV-2 pandemic including a 3 amino acid deletion in the Nsp1 linker region (Nsp1KSF) detected in North America and Europe. Given the importance of the Nsp1 linker length in regulating viral to host translation selectivity, the function of this variant was tested. Although Nsp1KSF induced a small significant decrease in SARS-CoV-2 5 UTR reporter activity, it more than doubled control reporter activity compared to WT Nsp1, and significantly reduced SARS-CoV-2/control translation ratio (p<0.001) (
[0075] It has been recently determined that Nsp1 promotes degradation of host mRNAs whose translation is suppressed, which depends on R124, a key residue in the NT that is conserved in SARS-CoV. To test whether this residue affects host translational shutdown, the control reporter was co-expressed with Nsp1R124A, which increased reporter activity by 5-fold relative to control (p<0.001). Interestingly, this mutation also led to a 1.5-fold decrease in SARS-CoV-2 reporter activity (p<0.001) and significantly reduced the SARS-CoV-2/control ratio (p<0.001;
Example 5: SL1 Antisense Oligos (ASOs) Selectively Target SARS-CoV-2 5 UTR with Nanomolar Potency
[0076] To suppress viral translation, the possibility of disrupting the function of SL1 was examined using anti-sense oligonucleotides (ASO). Since SL1 is sufficient for both viral translation and evasion of Nsp1-mediated translation suppression, ASOs targeting SL1 could represent novel therapeutic opportunities to effectively inhibit viral translation. SL1 starts immediately after the 5 cap and its structure is dynamically regulated during viral replication. The stem region of SL1 contains 10 Watson Crick base pairs with a bulge at the center (
[0077] In preliminary experiments, when transfected at 50 nM neither DNA nor RNA anti-SL1 ASOs showed activity against CoV-2 5 UTR, whether in the presence or absence of Nsp1 (
Example 6: SL1 ASOs Inhibit SARS-CoV-2 Replication in Vero E6 Cells and can Provide Partial Protection Against SARS-CoV-2-Induced Lethality in K18-hACE2 Mice
[0078] To test whether anti-SL1 ASOs with activity in reporter assays could also inhibit viral replication in Vero E6 cells, the function of these ASOs was first confirmed in the Vero E6 cell line by co-transfecting Vero E6 cells with the SARS-CoV-2 5 UTR reporter, Nsp1, and various ASOs. When co-transfected at 100 nM, ASO4 and ASO7 caused a 5-fold and 2-fold reduction in reporter activity at 24 hours, respectively (
[0079] Given that ASO4 showed the highest protection against infection in Vero E6 cells, its antiviral efficacy was further tested in vivo using the K18-hACE2 mice expressing the human angiotensin converting enzyme-2 (ACE2), the SARS-CoV-2 entry receptor. This model has been demonstrated to phenotypically recapitulate pathological and clinical features of COVID-19. K18-hACE2 mice were pretreated intranasally with 400 g of naked ASO4 or a control ASO (scrambled) daily for four days before infection with 2,500 plaque forming units (PFU) of ancestral SARS-CoV-2 and monitored for 14 days (
EQUIVALENTS AND SCOPE
[0080] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents of the embodiments described herein. The scope of the present disclosure is not intended to be limited to the above description, but rather is as set forth in the appended claims.
[0081] Articles such as a, an, and the may mean one or more than one unless indicated to the contrary or otherwise evident from the context. Claims or descriptions that include or between two or more members of a group are considered satisfied if one, more than one, or all of the group members are present, unless indicated to the contrary or otherwise evident from the context. The disclosure of a group that includes or between two or more group members provides embodiments in which exactly one member of the group is present, embodiments in which more than one member of the group are present, and embodiments in which all of the group members are present. For purposes of brevity those embodiments have not been individually spelled out herein, but it will be understood that each of these embodiments is provided herein and may be specifically claimed or disclaimed.
[0082] It is to be understood that the disclosure encompasses all variations, combinations, and permutations in which one or more limitation, element, clause, or descriptive term, from one or more of the claims or from one or more relevant portion of the description, is introduced into another claim. For example, a claim that is dependent on another claim can be modified to include one or more of the limitations found in any other claim that is dependent on the same base claim. Furthermore, where the claims recite a composition, it is to be understood that methods of making or using the composition according to any of the methods of making or using disclosed herein or according to methods known in the art, if any, are included, unless otherwise indicated or unless it would be evident to one of ordinary skill in the art that a contradiction or inconsistency would arise.
[0083] Where elements are presented as lists, e.g., in Markush group format, it is to be understood that every possible subgroup of the elements is also disclosed, and that any element or subgroup of elements can be removed from the group. It is also noted that the term comprising is intended to be open and permits the inclusion of additional elements or steps. It should be understood that, in general, where an embodiment, product, or method is referred to as comprising particular elements, features, or steps, embodiments, products, or methods that consist, or consist essentially of, such elements, features, or steps, are provided as well. For purposes of brevity those embodiments have not been individually spelled out herein, but it will be understood that each of these embodiments is provided herein and may be specifically claimed or disclaimed.
[0084] Where ranges are given, endpoints are included. Furthermore, it is to be understood that unless otherwise indicated or otherwise evident from the context and/or the understanding of one of ordinary skill in the art, values that are expressed as ranges can assume any specific value within the stated ranges in some embodiments, to the tenth of the unit of the lower limit of the range, unless the context clearly dictates otherwise. For purposes of brevity, the values in each range have not been individually spelled out herein, but it will be understood that each of these values is provided herein and may be specifically claimed or disclaimed. It is also to be understood that unless otherwise indicated or otherwise evident from the context and/or the understanding of one of ordinary skill in the art, values expressed as ranges can assume any subrange within the given range, wherein the endpoints of the subrange are expressed to the same degree of accuracy as the tenth of the unit of the lower limit of the range.
[0085] Where websites are provided, URL addresses are provided as non-browser-executable codes, with periods of the respective web address in parentheses. The actual web addresses do not contain the parentheses.
[0086] In addition, it is to be understood that any particular embodiment of the present disclosure may be explicitly excluded from any one or more of the claims. Where ranges are given, any value within the range may explicitly be excluded from any one or more of the claims. Any embodiment, element, feature, application, or aspect of the compositions and/or methods of the disclosure, can be excluded from any one or more claims. For purposes of brevity, all of the embodiments in which one or more elements, features, purposes, or aspects is excluded are not set forth explicitly herein.