GENE RELATED TO BIOSYNTHESIS OF ERGOTHIONEINE, AND USE THEREOF
20250059553 ยท 2025-02-20
Inventors
- Jianjie Gao (Shanghai, CN)
- Yongdong Deng (Shanghai, CN)
- Quanhong Yao (Shanghai, CN)
- Rihe Peng (Shanghai, CN)
- Yongsheng Tian (Shanghai, CN)
- Bo Wang (Shanghai, CN)
- Zhenjun Li (Shanghai, CN)
- Jing Xu (Shanghai, CN)
- Hongjuan Han (Shanghai, CN)
- Lijuan Wang (Shanghai, CN)
- Xiaoyan Fu (Shanghai, CN)
- Yu Wang (Shanghai, CN)
- Wenhui Zhang (Shanghai, CN)
- Zhihao ZUO (Shanghai, CN)
- Cen QIAN (Shanghai, CN)
Cpc classification
C12N9/80
CHEMISTRY; METALLURGY
C12Y201/01044
CHEMISTRY; METALLURGY
C12N15/8251
CHEMISTRY; METALLURGY
International classification
C12N15/82
CHEMISTRY; METALLURGY
C12N9/00
CHEMISTRY; METALLURGY
C12N9/80
CHEMISTRY; METALLURGY
Abstract
A gene related to biosynthesis of ergothioneine is provided. Based on five synthesis genes of ergothioneine in Mycobacteroides abscessus, only an encoding sequence of each of the five genes is retained, and a gene structure of an encoding region in each gene is optimized to obtain genes related to the biosynthesis of the ergothioneine that are stably expressed in rice. These genes have sequences set forth in SEQ ID NO: 1 to SEQ ID NO: 5, and encoded proteins thereof have amino acid sequences set forth in SEQ ID NO: 6 to SEQ ID NO: 10. The gene is transferred into rice to construct a transgenic rice molecular farm to produce the ergothioneine. As a molecular farm, rice seeds do not contain alkaloids or allergens that are harmful to the human body. Moreover, biosynthesized ergothioneine shows the advantages of easy extraction and processing and of low production cost.
Claims
1. A gene related to biosynthesis of ergothioneine, wherein the gene is one or more selected from the group consisting of an EgtA gene, an EgtB gene, an EgtC gene, an EgtD gene, and an EgtE gene; wherein: the EgtA gene has the nucleotide sequence set forth in SEQ ID NO: 1; the EgtB gene has the nucleotide sequence set forth in SEQ ID NO: 2; the EgtC gene has the nucleotide sequence set forth in SEQ ID NO: 3; the EgtD gene has the nucleotide sequence set forth in SEQ ID NO: 4; and the EgtE gene has the nucleotide sequence set forth in SEQ ID NO: 5.
2. The gene according to claim 1, wherein the gene further comprises sequences that are highly homologous to the EgtA gene, the EgtB gene, the EgtC gene, the EgtD gene, and the EgtE gene and encode same proteins of the EgtA gene, the EgtB gene, the EgtC gene, the EgtD gene, and the EgtE gene, respectively; wherein: the protein encoded by the EgtA gene has the amino acid sequence set forth in SEQ ID NO: 6; the protein encoded by the EgtB gene has the amino acid sequence set forth in SEQ ID NO: 7; the protein encoded by the EgtC gene has the amino acid sequence set forth in SEQ ID NO: 8; the protein encoded by the EgtD gene has the amino acid sequence set forth in SEQ ID NO: 9; and the protein encoded by the EgtE gene has the amino acid sequence set forth in SEQ ID NO: 10.
3. A gene expression unit, comprising the gene according to claim 1 and an endosperm-specific rice globulin-1 promoter and a terminator.
4. The gene expression unit according to claim 3, wherein the gene further comprises sequences that are highly homologous to the EgtA gene, the EgtB gene, the EgtC gene, the EgtD gene, and the EgtE gene and encode same proteins of the EgtA gene, the EgtB gene, the EgtC gene, the EgtD gene, and the EgtE gene, respectively; wherein: the protein encoded by the EgtA gene has the amino acid sequence set forth in SEQ ID NO: 6; the protein encoded by the EgtB gene has the amino acid sequence set forth in SEQ ID NO: 7; the protein encoded by the EgtC gene has the amino acid sequence set forth in SEQ ID NO: 8; the protein encoded by the EgtD gene has the amino acid sequence set forth in SEQ ID NO: 9; and the protein encoded by the EgtE gene has the amino acid sequence set forth in SEQ ID NO: 10.
5. A vector, comprising one or more of the genes according to claim 1 or a gene expression unit.
6. The vector according to claim 5, wherein the gene expression unit is present in a form of a tandem sequence.
7. The vector according to claim 5, wherein the gene further comprises sequences that are highly homologous to the EgtA gene, the EgtB gene, the EgtC gene, the EgtD gene, and the EgtE gene and encode same proteins of the EgtA gene, the EgtB gene, the EgtC gene, the EgtD gene, and the EgtE gene, respectively; wherein: the protein encoded by the EgtA gene has the amino acid sequence set forth in SEQ ID NO: 6; the protein encoded by the EgtB gene has the amino acid sequence set forth in SEQ ID NO: 7; the protein encoded by the EgtC gene has the amino acid sequence set forth in SEQ ID NO: 8; the protein encoded by the EgtD gene has the amino acid sequence set forth in SEQ ID NO: 9; and the protein encoded by the EgtE gene has the amino acid sequence set forth in SEQ ID NO: 10.
8. The vector according to claim 6, wherein the tandem sequence is an EgtA-containing expression unit-EgtB-containing expression unit-EgtC-containing expression unit-EgtD-containing expression unit-EgtE-containing expression unit.
9. A method for constructing the vector according to claim 8, comprising sequentially cloning the gene expression units into a plant expression vector to obtain a recombinant plasmid vector.
10. A host bacterium comprising the vector according to claim 4.
11. The host according to claim 10, wherein the vector comprises a gene expression unit or one or more of the genes selected from the group consisting of an EgtA gene, an EgtB gene, an EgtC gene, an EgtD gene, and an EgtE gene; wherein: the EgtA gene has the nucleotide sequence set forth in SEQ ID NO: 1; the EgtB gene has the nucleotide sequence set forth in SEQ ID NO: 2; the EgtC gene has the nucleotide sequence set forth in SEQ ID NO: 3; the EgtD gene has the nucleotide sequence set forth in SEQ ID NO: 4; and the EgtE gene has the nucleotide sequence set forth in SEQ ID NO: 5.
12. The vector according to claim 11, wherein the gene expression unit is present in a form of a tandem sequence.
13. The vector according to claim 11, wherein the gene further comprises sequences that are highly homologous to the EgtA gene, the EgtB gene, the EgtC gene, the EgtD gene, and the EgtE gene and encode same proteins of the EgtA gene, the EgtB gene, the EgtC gene, the EgtD gene, and the EgtE gene, respectively; wherein: the protein encoded by the EgtA gene has the amino acid sequence set forth in SEQ ID NO: 6; the protein encoded by the EgtB gene has the amino acid sequence set forth in SEQ ID NO: 7; the protein encoded by the EgtC gene has the amino acid sequence set forth in SEQ ID NO: 8; the protein encoded by the EgtD gene has the amino acid sequence set forth in SEQ ID NO: 9; and the protein encoded by the EgtE gene has the amino acid sequence set forth in SEQ ID NO: 10.
14. The vector according to claim 12, wherein the tandem sequence is an EgtA-containing expression unit-EgtB-containing expression unit-EgtC-containing expression unit-EgtD-containing expression unit-EgtE-containing expression unit.
15. A method for biosynthesis of ergothioneine, comprising: transforming rice with a vector to obtain a rice plant capable of biosynthesizing ergothioneine, and then isolating the ergothioneine from a rice seed on the rice plant; wherein the vector comprises one or more of the genes according to claim 1.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
DETAILED DESCRIPTION OF THE EMBODIMENTS
[0040] Based on five synthesis genes of ergothioneine in Mycobacteroides abscessus, only an encoding sequence of each of the five genes is retained, and a gene structure of an encoding region in each gene is optimized following the principles below: [0041] (I) The gene codons are optimized to improve gene translation efficiency. [0042] (II) The recognition sites of commonly used restriction endonucleases within the gene are eliminated to facilitate the construction of expression cassettes. [0043] (III) The inverted repeat sequences, stem-loop structures, and transcription termination signals are eliminated to balance GC/AT within the gene and improve RNA stability. [0044] (IV) The gene-encoded protein is made in conformity to the N-terminal principle to improve the stability of the translated protein. [0045] (V) The free energy of mRNA secondary structure is optimized to improve gene expression efficiency. The optimized nucleotide sequences of the five genes related to the synthesis of ergothioneine are as follows: [0046] the EgtA gene has the nucleotide sequence set forth in SEQ ID NO: 1; [0047] the EgtB gene has the nucleotide sequence set forth in SEQ ID NO: 2; [0048] the EgtC gene has the nucleotide sequence set forth in SEQ ID NO: 3; [0049] the EgtD gene has the nucleotide sequence set forth in SEQ ID NO: 4; and [0050] the EgtE gene has the nucleotide sequence set forth in SEQ ID NO: 5.
[0051] The gene further includes sequences that are highly homologous to the EgtA gene, the EgtB gene, the EgtC gene, the EgtD gene, and the EgtE gene and encode same proteins of the EgtA gene, the EgtB gene, the EgtC gene, the EgtD gene, and the EgtE gene, respectively; [0052] the protein encoded by the EgtA gene has the amino acid sequence set forth in SEQ ID NO: 6; [0053] the protein encoded by the EgtB gene has the amino acid sequence set forth in SEQ ID NO: 7; [0054] the protein encoded by the EgtC gene has the amino acid sequence set forth in SEQ ID NO: 8; [0055] the protein encoded by the EgtD gene has the amino acid sequence set forth in SEQ ID NO: 9; and [0056] the protein encoded by the EgtE gene has the amino acid sequence set forth in SEQ ID NO: 10.
[0057] The highly homologous refers to a sequence similarity of not less than 95%.
[0058] The present disclosure further provides a gene expression unit, including the gene and an endosperm-specific rice globulin-1 promoter and a terminator.
[0059] Preferably, an endosperm-specific rice globulin-1 promoter and a terminator are ligated to both ends of each gene to form a gene expression unit.
[0060] More preferably, two ends of the expression unit are ligated with restriction sites, including Sac I, Xho I, BamH I, Sal I, Hind III, and EcoR I restriction sites.
[0061] Most preferably, two ends of the expression unit containing EgtA are ligated to the Sac I and Xho I restriction sites; [0062] two ends of the expression unit containing EgtB are ligated to the Xho I and BamH I restriction sites; [0063] two ends of the expression unit containing EgtC are ligated to the BamH I and Sal I restriction sites; [0064] two ends of the expression unit containing EgtD are ligated to the Sac I and Hind III restriction sites; and [0065] two ends of the expression unit containing EgtE are ligated to the Hind III and EcoR I restriction sites.
[0066] The present disclosure further provides a vector, including one or more of the EgtA gene, the EgtB, the EgtC, the EgtD, and the EgtE gene, or the gene expression unit.
[0067] Preferably, the gene expression units containing the EgtA gene, the EgtB gene, the EgtC gene, the EgtD gene, and the EgtE gene in the vector are presented as a tandem sequence; and [0068] most preferably, the tandem sequence is an EgtA-containing expression unit-EgtB-containing expression unit-EgtC-containing expression unit-EgtD-containing expression unit-EgtE-containing expression unit.
[0069] The present disclosure further provides a method for constructing the vector, including sequentially cloning the gene expression units into a plant expression vector to obtain a recombinant plasmid vector.
[0070] Optionally, the plant expression vector uses a pCamBIA series expression vector.
[0071] Preferably, the plant expression vector uses pCamBIA-1301 or a plant binary vector pYP694 that is obtained by using pCamBIA-1301 as a backbone and modifying the backbone by introducing a new multiple cloning site.
[0072] The plant binary vector pYP694 is from the Shanghai Academy of Agricultural Sciences, Tian Y S et al. Enhancing carotenoid biosynthesis in rice endosperm by metabolic engineering. Plant Biotechnol J. 2019 May; 17(5): 849-851.
[0073] The present disclosure further provides a host bacterium including the vector; optionally, the host bacterium is Agrobacterium EHA105.
[0074] The present disclosure further provides the use of the gene in biosynthesis of ergothioneine by rice.
[0075] The present disclosure further provides a method for biosynthesis of ergothioneine, including: transforming rice with the vector to obtain a rice plant capable of biosynthesizing ergothioneine, and then isolating the ergothioneine from a rice seed on the rice plant.
[0076] In the present disclosure, unless otherwise specified, all raw material components are commercially available products well known to persons skilled in the art. All experiments involving molecular biology are referred to the book Molecular Cloning (written by J. Sambrook, E. Fritsch, and T. Maniatis, 1994, Science Press) unless otherwise noted. The rice seeds (Nipponbare) used are preserved by the Agricultural Synthetic Biology Research Center of the Institute of Biotechnology, Shanghai Academy of Agricultural Sciences. Unless otherwise specified, the reagents used are purchased from Sangon Biotech (Shanghai) Co., Ltd. or Shanghai Sinopharm Group Co., Ltd.
[0077] The technical solutions in the present disclosure are clearly and completely described below with reference to the examples of the present disclosure. Apparently, the described examples are merely a part rather than all of the examples of the present disclosure. All other embodiments obtained by those skilled in the art based on the embodiments of the present disclosure without creative efforts shall fall within the protection scope of the present disclosure.
Example 1
Optimization and synthesis of Five Genes Required for the Synthesis of Ergothioneine in Rice Endosperm
[0078] In the present disclosure, an ergothioneine synthesis pathway suitable for rice chassis was first designed (
Example 2
Construction of pYB4087 Rice-Specific Expression Vector
[0079] A plant binary vector pYP694 was selected as an initial vector backbone to construct a rice-specific expression vector. The plant binary vector pYP694 was from the Shanghai Academy of Agricultural Sciences, Tian Y S et al. Enhancing carotenoid biosynthesis in rice endosperm by metabolic engineering. Plant Biotechnol J. 2019 May; 17(5): 849-851.
[0080] The EgtA-containing expression unit in Example 1 was integrated into the pYP694 vector through Sac I and Xho I restriction enzymes to generate a construct pYP694-GEgtA; [0081] the EgtB-containing expression unit in Example 1 was integrated into the pYP694-GEgtA vector through Xho I and BamH I restriction enzymes to generate a two-gene construct pYP694-GEgtA-EgtB; [0082] the EgtC-containing expression unit in Example 1 was integrated into the pYP694-GEgtA-EgtB vector through BamH I and Sal I restriction enzymes to generate a three-gene construct pYP694-GEgtA-EgtB-EgtC; [0083] the EgtD-containing expression unit in Example 1 was integrated into the pYP694-GEgtA-EgtB-EgtC vector through Sal I and Hind III restriction enzymes to generate a four-gene construct pYP694-GEgtA-EgtB-EgtC-EgtD; and [0084] the EgtE-containing expression unit in Example 1 was integrated into the pYP694-GEgtA-EgtB-EgtC-EgtD vector through Hind III and EcoR I restriction enzymes to generate a five-gene construct pYP694-GEgtA-EgtB-EgtC-EgtD-EgtE.
[0085] The construct pYB4087 containing five genes was successfully obtained (
Example 3
Agrobacterium-Mediated Transformation of Rice
1) Preparation of Agrobacterium
[0086] The pYB4087 vector containing the target gene in Example 2 was transformed into Agrobacterium EHA105 by electroporation. The target Agrobacterium was re-cultivated to a concentration of OD.sub.600=0.3-0.5, and an Agrobacterium suspension was prepared for co-cultivation and transformation of rice.
2) Genetic Transformation of Rice
[0087] Rice seeds were sterilized with 0.1% mercury and then subcultured on an induction medium to produce callus with light yellow color (
Example 4
Detection of Transgenic Positive Plants
[0088] DNA was extracted from the rice cultured in Example 3 and the expression of each gene was detected according to the following PCR reaction system: [0089] 10PCR buffer 5.0 L; dNTPs 4 L (2.5 mmol/L); template 1 L (20 ng to 50 ng); primer Z 1 L; primer F 1 L; Taq enzyme 0.2 L; diluted with sterile water to a volume of 50 L.
[0090] The PCR primers corresponding to the five genes are shown in Table 1.
TABLE-US-00001 TABLE1 PCRprimers Gene PrimerZ PrimerF EgtA GGTTCGTAACAAGGATGGT AACAAGGTAGTCAGATGGTAG (SEQIDNO:11) (SEQIDNO:12) EgtB TCTGTGCTGGTTCCTGAG TTCCTGACGACGGTATCC (SEQIDNO:13) (SEQIDNO:14) EgtC CTCGTCGTCCAGTCATAC CAGCAGCAACAACACATC (SEQIDNO:15) (SEQIDNO:16) EgtD CGTTGGAATGGTGATGAAG CAAGTGACAGTCCGAAGT (SEQIDNO:17) (SEQIDNO:18) EgtE CTGCCATCACCACTCTTG GCTCCTCATCAGTTCCATC (SEQIDNO:19) (SEQIDNO:20)
[0091] The reaction program included: 94 C. for 5 min; 94 C. for 20 s, 56 C. for 30 s, 72 C. for 30 s; 72 C. for 10 min; 32 cycles. The detection results are shown in
Example 5
Construction of a Rice Molecular Farm for the Production of Ergothioneine
[0092] The rice plants that tested positive in Example 4 were planted into farmland according to the following steps: [0093] 1) The suitable land was selected to allow plowing, fertilization, irrigation and the like to ensure that the soil fertility and moisture met the needs of rice growth. [0094] 2) The selected rice seeds were sown in the field. Sowing methods included direct seeding and field planting. The direct seeding was to sow the seeds directly in the field; while the field planting was to plant the seedlings in the field and then transplant same to the field after the seedlings grew to a certain height. [0095] 3) After sowing, the fields needed to be regularly managed, including weeding, irrigation, fertilization, and pest and disease control. [0096] 4) The rice was harvested after maturing. The harvesting included manual harvesting and machine harvesting. [0097] 5) After harvesting, the rice needed to be threshed: the rice was separated from the husk for easy storage and extraction (
Example 6
UPLC-MS/MS Targeted Metabolomics Detection of Ergothioneine Content
[0098] After the rice in Example 5 was grown for 60 days, the UPLC-MS/MS targeted metabolomics was conducted to detect the ergothioneine content, specifically including:
1) Metabolite Extraction
[0099] A sample was thawed in a refrigerator at 4 C., vortexed for 2 min, and 1 mL of the sample was transferred into an EP tube and centrifuged at 8,000 rpm for 10 min at 4 C. The supernatant was then removed to retain a precipitate, and 100 L of pre-cooled 80% methanol was added into the EP tube containing the precipitate, vortexed for 1 min, sonicated in ice water for 5 min, and then centrifuged at 13,000 rpm at 4 C. for 15 min. 80 L of the resulting supernatant was collected into an injection vial.
[0100] This project used an ultra-high performance liquid chromatograph to conduct chromatographic separation of target compounds through a liquid chromatography column. The liquid chromatograph was Waters Acquity I class UPLC. The mass spectrometer was Waters XEVO TQD. The chromatographic column was Waters Acquity UPLC R BEH C18 (2.1 mm100 mm, 1.7 m). The centrifuge was Thermo Scientific Heraeus Fresco17 centrifuge. The vortex meter was VXMAL OHAUS Germany. The balance was BSA124S-CW Sartorius Germany. The ultrasound machine was SB-3200 DT Ningbo Xinzhi, China. Methanol was of LC-MS grade, purchased from Thermo fisher (Thermo fisher scientific Inc, MA USA), acetonitrile was of LC-MS grade, purchased from Thermo fisher (Thermo fisher scientific Inc, MA USA). Formic acid was of LC-MS grade, purchased from Shanghai Aladdin Biochemical Technology Co., Ltd., China. Ultrapure water was Watsons purified water.
2) The Parameters Were as Follows
TABLE-US-00002 Mobile phase A Water + 0.1% formic acid Mobile phase B ACN + 0.1% formic acid Column temperature/ C. 35 Sample vial rack temperature/ C. 8 Injection volume/L 5
[0101] The liquid phase gradient was:
TABLE-US-00003 Time/min Flow rate mL/min B % 0 0.3 10 0.2 0.3 10 1.0 0.3 80 1.2 0.3 80 1.5 0.3 10 2.0 0.3 10
3) MS Parameters
[0102] This project used a Waters triple quadrupole mass spectrometer equipped with an ESI ion source to conduct mass spectrometry analysis in dynamic multiple reaction monitoring (MRM) mode. The ion source parameters were as follows:
TABLE-US-00004 Ion source mode ESI+ Capillary voltage/kV 3.7 Ion source temperature/ C. 150 Desolvation gas temperature/ C. 400 Desolvation gas flow rate/(L/hour) 800 Cone gas flow rate/(L/hour) 20
[0103] The MRM channels were as follows:
TABLE-US-00005 Compound Parent ion Daughter ion Cone Collision name (m/z) (m/z) voltage (V) energy (V) ET* 230.1 186.0000 30 10 ET 230.1 127.0008 50 20
[0104] The results showed that ergothioneine accumulation could be detected in the engineered rice seeds, while there was no ergothioneine in the wild-type rice seeds (
Example 7
Detection of Ergothioneine Production
[0105] Methanol was used to prepare an ergothioneine standard, and a calibration solution was analyzed by UPLC-MS/MS using the method in Example 6. y represented the peak area of the target compound, and x represented the concentration of the target compound (ng/ml). Linear regression was conducted using a least squares method. When the weight was set to NULL, the recovery rate (accuracy) and linear coefficient (R.sup.2) of the calibration solution were the best and both R and R.sup.2 were greater than 0.99. If a signal-to-noise ratio (S/N) of a certain calibration concentration was approximately to or less than 10, the calibration point for that concentration should be excluded. The final calibration curve included a minimum of 5 calibration points. The ergothioneine production in the rice seeds of different rice lines in Example 6 was detected, and the results are shown in
[0106] The above descriptions are merely preferred implementations of the present disclosure. It should be noted that a person of ordinary skill in the art may further make several improvements and modifications without departing from the principle of the present disclosure, but such improvements and modifications should be deemed as falling within the protection scope of the present disclosure.