<i>Stenotrophomonas maltophilia </i>GYH and application thereof in degradation of chlorinated hydrocarbon pollutants

Abstract

The present invention discloses Stenotrophomonas maltophilia GYH and its application in degrading chlorinated hydrocarbon pollutants, and the application is carried out as follows: resting cells obtained by spreading cultivation of Stenotrophomonas maltophilia GYH are added to a pH=5-8 inorganic salt medium, and then a chlorinated hydrocarbon pollutant is added, and the cells are cultured at 20-35 C. and 140-180 rpm to degrade the pollutant. The concentration of chlorinated hydrocarbon pollutant which can be removed by Stenotrophomonas maltophilia GYH ranges from 2.9 mg/L to 8.93 mg/L. Therefore, the Stenotrophomonas maltophilia has a highly efficient degradation ability for similar industrial pollutants and is able to withstand high concentrations of these pollutants.

Claims

1. A method of degrading a chlorinated hydrocarbon pollutant with Stenotrophomonas maltophilia GYH, comprising: adding cells obtained by large-scale cultivation of Stenotrophomonas maltophilia GYH to an inorganic salt medium with a pH of 5-8; adding the chlorinated hydrocarbon pollutant; and culturing the cells at 20-35 C. while shaking at 140-180 rpm to degrade the chlorinated hydrocarbon pollutant, wherein the Stenotrophomonas maltophilia GYH is preserved in China Center for Type Culture Collection with the preservation number CCTCC NO: M 20191025.

2. The method of claim 1, wherein the chlorinated hydrocarbon pollutant is at least one selected from the group consisting of chloroform, chlorobenzene, 1,2-dichloroethane, 1,1,1-trichloroethane and dichloromethane.

3. The method of claim 1, wherein the dry weight of cells in the inorganic salt medium is 50-100 mg/L.

4. The method of claim 1, wherein the concentration of the chlorinated hydrocarbon pollutant added to the inorganic salt medium is 1-10 mg/L.

5. The method of claim 1, wherein the inorganic salt medium comprises 2 g/L KH.sub.2PO.sub.4, 2 g/L (NH.sub.4).sub.2SO.sub.4, 0.025 g/L MgSO.sub.4 and 0.18 g/L NaOH in ultrapure water at a pH of 5-8.

6. The method of claim 1, further comprising preparing cells of Stenotrophomonas maltophilia GYH by inoculating Stenotrophomonas maltophilia GYH onto an LB agar slant medium and culturing at 30 C. in an incubator, thereby obtaining a bacterial slant culture, wherein the LB slant agar medium consists of: 5 g/L yeast extract, 10 g/L NaNO3, 10 g/L peptone and 15-20 g/L agar in deionized water at a neutral pH; and inoculating the slant cells into an LB liquid medium and incubating at 30 C. while shaking at 160 rpm for 12 h to obtain large-scale cultivation solution; centrifuging the solution to collect cells, and washing the cells with the inorganic salt medium to obtain the cells of Stenotrophomonas maltophilia GYH, wherein the LB liquid medium contains 5 g/L yeast extract, 10 g/L NaNO.sub.3 and 10 g/L peptone in deionized water at a neutral pH.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 is a colony morphology image of the strain GYH on LB medium.

(2) FIG. 2 is a transmission electron microscopy image of the strain GYH.

(3) FIG. 3 is a dendrogram of the strain GYH.

(4) FIG. 4 shows the time required for complete degradation by different concentrations of the strain GYH.

(5) FIG. 5 shows degradation rate of different concentrations of the substrates within 84 h by the strain GYH.

(6) FIG. 6 shows degradation rate at different pH within 84 h by the strain GYH.

SPECIFIC EMBODIMENTS

(7) The present invention is further illustrated below with specific examples, but the scope of the present invention is not limited thereto:

(8) The materials and reagents used in the following examples can be obtained from commercial sources unless otherwise specified.

Example 1: Isolation, Purification and Identification of Stenotrophomonas maltophilia GYH

(9) 1. Isolation and Purification of Stenotrophomonas maltophilia GYH

(10) Stenotrophomonas maltophilia GYH is Gram-negative bacteria domesticated and isolated from activated sludge. The specific steps are as follows:

(11) 50 mL of inorganic salt medium was added to a 300 mL shake flask, and 10 mL of activated sludge and 8.9 mg/L of chloroform were added for enrichment culture. When the concentration of chloroform reached 50% of the initial concentration, 5 mL of the enrichment solution was taken out and added to 50 ml of fresh inorganic salt medium and chloroform was added with a final concentration of 8.9 mg/L, after the above enrichment process had been repeated 5 times, the last enrichment solution was spread on LB agar medium after gradient dilution. A single colony was selected and inoculated to an isolation agar medium by streaking for purification (FIG. 1), the resulting colony was inoculated to inorganic salt medium, and chloroform was added as the only carbon source and energy with a final concentration of 8.9 mg/L for verification, thereby obtaining the target strain with chloroform degradation ability, which was denoted as strain GYH. Its morphology was identified by transmission electron microscope (FIG. 2).

(12) The inorganic salt medium composition was as follows: KH.sub.2PO.sub.4 2 g/L, (NH.sub.4).sub.2SO.sub.4 2 g/L, MgSO.sub.4 0.025 g/L, NaOH 0.18 g/L, the solvent was ultrapure water, pH 5-8.

(13) The LB agar medium composition was as follows: 5 g/L yeast extract, 10 g/L NaNO.sub.3, 10 g/L peptone, 18 g/L agar, natural pH, and the solvent is deionized water.

(14) The LB liquid medium composition was as follows: 5 g/L yeast extract, 10 g/L NaNO.sub.3, 10 g/L peptone, natural pH, and the solvent is deionized water.

(15) The isolation agar medium was prepared as follows: agar was added to inorganic salt medium with the final concentration of 18 g/L, thereby obtaining the isolation agar medium, and when the isolation agar medium was used, chloroform was added as a carbon source with the final concentration of 8.9 mg/L.

(16) 2. Identification of the Strain GYH

(17) (1) The Characteristics of the Strain GYH

(18) The colonies were light yellow with neat edges, opaque, smooth, moist, and easy to pick. Under a transmission electron microscope, the bacteria were ellipsoidal, had flagella and a cell size of 6552577 nm, and were Gram-negative. Through 16S rRNA sequence analysis and physiological and biochemical identification, the strain was determined to be Stenotrophomonas maltophilia. The specific steps were as follows:

(19) (2) 16S rRNA Sequencing

(20) The DNA of the strain GYH was extracted and purified using Ezup Column Bacteria Genomic DNA Purification Kit, and stored at 4 C. The purified DNA was amplified by PCR with bacterial universal primers which were 27F (AGAGTTTGATCCTGGCTCAG) and 1492 R (GGTTACCTTGTTACGACTT). The PCR reaction program was set as follows: pre-denaturation at 94 C. for 4 min, 30 cycles of denaturation at 94 C. for 45 s, annealing at 55 C. for 45 s and extension at 72 C. for 1 min, and finally extension at 72 C. for 10 min. The PCR product was purified and recovered for sequencing (Zhejiang Tianke High Technology Development Co. Ltd.). The sequence homology of the 16S rRNA sequencing result (the nucleotide sequence is shown in SEQ ID NO.1, it was uploaded to GenBank, thereby obtaining the NCBI gene accession No: MN860228) and the gene sequences uploaded to Genbank was compared, it was found that it belonged to the genus Stenotrophomonas and had the highest homology with Stenotrophomonas maltophilia, reaching 99%. From the results, 15 representative strains of Stenotrophomonas were selected and a phylogenetic tree shown in FIG. 3 was constructed using MEGA7 software based on the sequence homology of their 16S rRNA genes.

(21) (3) Utilization Ability of the Strain GYH on 63 Carbon Sources on Mrieux GN Card.

(22) BioMrieux automated microbial analyzer was used to investigate metabolism of 63 different carbon sources by the strain (entrusted to Zhejiang Tianke High Technology Development Co. Ltd. (formerly Zhejiang Institute of Microbiology)). The identification results were shown in Table 1. According to the biochemical reaction of BioMrieux automated microbial analyzer VITEK, the strain GYH can consume 11 kinds of carbon sources, but cannot consume the other 52 kinds of carbon sources.

(23) TABLE-US-00001 TABLE 1 Biochemical reaction results of the strain GYH detected by BioMerieux automated microbial analyzer VITEK (GN card) Testing Number Abbreviation Chinese name results 2 APPA Ala-Phe-Pro-arylamidase + 3 ADO Adonitol 4 PyrA L-Pyrrolydonyl-arylamidase 5 IARL L-Arabitol 7 dCEL D-cellobiose 9 BGAL -Galactosidase 10 H2S H2S production 11 BNAG -N-Acetyl-glucosaminidase 12 AGLTp Glutamyl arylamidase pNA 13 dGLU D-Glucose 14 GGT -Glutamyl-transferase + 15 OFF Fermentation/Glucose 17 BGLU -Glucosidase + 18 dMAL D-Maltose 19 dMAN D-Mannitol 20 dMNE D-Mannose 21 BXYL -Xylosidase 22 BAIap -Alanine Arylamidase pNA 23 ProA L-Proline Arylamidase + 26 LIP Lipase + 27 PLE Palatinose 29 TyrA Tyrosine Arylamidase 31 URE Urease 32 dSOR D-Sorbrtol 33 SAC Sucrose 34 dTAG D-Tagatose 35 dTRE D-Trehalose 36 CIT Citrate (sodium) + 37 MNT Malonate 39 5KG 5-Keto-D-gluconate 40 ILATk L-Lactate alkalinisation + 41 AGLU -Glucosidase + 42 SUCT Succinate alkalinisation + 43 NAGA -N-Acetyl-galactosaminidase 44 AGAL -Galactosidase 45 PHOS Phosphatase + 46 GlyA Glycine Arylamidase 47 ODC Ornithine decarboxylase 48 LDC Lysine decarboxylase 53 IHISa L-Histidine assimilation 56 CMT Courmarate 57 BGUR -Glucoronidase 58 O129R O/129 Resistance (comp. vibrio.) 59 GGAA Glu-Gly-Arg-arylamidase + 61 IMLTa L-Malate assimilation 62 ELLM ELLMAN 64 ILATa L-lactate assimilation Symbols: +, positive; , negative

(24) Through physiological and biochemical characteristics, genetic distance and comparison of 16S rRNA sequence, the strain GYH was identified as Stenotrophomonas maltophilia, named Stenotrophamonas maltophilia GYH, and stored in China Center for Type Collection, the preservation number is CCTCC NO: M20191025, and the preservation date is Dec. 9, 2019.

Example 2 Obtaining the Resting Cells of Stenotrophomonas maltophilia

(25) 1. Slant Cultivation:

(26) Stenotrophomonas maltophilia CCTCC NO: M 20191025 was inoculated into LB liquid medium and incubated at 30 C., 160 rpm for 2 d, and then the activated bacteria were streaked on an LB agar plate and incubated at 30 C. in an incubator for 24 hours. The resulting single colonies were picked out, streaked on a plate to examine their purification, and stored on a slant of an LB test tube (4 C.).

(27) 2. Spreading Cultivation

(28) The slant cells of step 1 were inoculated into LB liquid medium and incubated at 30 C. 160 rpm for 12 h, then the obtained spreading cultivation solution was centrifuged to collect wet cells, and the wet cells were washed with inorganic salt medium, thereby obtaining the resting cells of Stenotrophomonas maltophilia GYH.

Example 3: Detection of Degradation Performance of Stenotrophomonas maltophilia GYH on Chloroform with Different Concentrations

(29) Each 50 mL of inorganic salt medium were put into a 330 mL shake flask, and sterilized at 110 C. for 40 min. After sterilization, the inorganic salt mediums were place at room temperature for 2 days to confirm no bacteria growth. Resting cells of Stenotrophomonas maltophilia GYH obtained by the method in Example 2 were added with the final concentration of 80 mg/L (calculated by dry cell weight), and then chloroform was added as the only carbon source with the final concentrations of 2.98 mg/L, 5.93 mg/L, 8.93 mg/L, 14.85 mg/L, 20.97 mg/L and 29.8 mg/L respectively, after sealing the shake flask, the resulting solutions were cultured on a shaker at 30 C., 160 rpm, and a blank control without bacteria was taken. The concentration of residual chloroform in the shake flask was determined regularly, and the generation of chloride ions in the solution was determined regularly. Bar graphs of time required for complete degradation of different substrate concentrations and degradation rate under different substrate concentrations within 84 h were drawn. The results were shown in FIG. 4 and FIG. 5. The results showed that when the concentration of chloroform was lower than 8.93 mg/L, the strain GYH could quickly degrade the added substrate.

Example 4: Studies on Broad Spectrum of Substrates of Stenotrophomonas maltophilia CCTCC NO: M 20191025

(30) The substrate in Example 3 was changed to that shown in Table 2, and the final concentration of the substrate was 10 mg/L. Other operations were the same as in Example 3. The results were shown in Table 2. It can be seen from Table 2 that Stenotrophomonas maltophilia CCTCC NO: M 20191025 has a degrading effect on all the chlorinated hydrocarbon organics. It can completely degrade 10 mg/L of chlorobenzene within 48 hours, can completely degrade 10 mg/L 1.2-dichloroethane within 72 hours, and also has a certain degradation effect on the other three chlorinated hydrocarbons.

(31) TABLE-US-00002 TABLE 2 Degradation effects of different substrates Substrate (10 mg/L) Degradation time (h) Removal rate (%) Chlorobenzene 48 100 1.2-Dichloroethane 72 100 1.1.1-Trichloroethane 72 82.90 Dichloromethane 72 71.52 Trichloroethylene 72 41.35

Example 5: Degradation Performance Detection of Stenotrophomonas maltophilia CCTCC NO: M 20191025 on Chloroform with Different pH

(32) Each 50 mL of inorganic salt medium was put into a 330 mL shake flask, and sterilized at 110 C. for 40 min; wherein the pH value of the inorganic salt medium in each shake flask was 5, 6, 7 and 8 respectively. After sterilization, the inorganic salt mediums were placed at room temperature for 2 days to confirm no bacteria growth. The resting cells of Stenotrophomonas maltophilia GYH obtained by the method in Example 2 were added with the final concentration of 80 mg/L (calculated by dry cell weight), and then chloroform was added as the only carbon source with the final concentrations of 8.93 mg/L, after sealing the shake flask, the resulting solution was cultured on a shaker at 30 C., 160 rpm, and a blank control without bacteria was taken. The concentration of residual chloroform in the shake flask was determined regularly, and the generation of chloride ions in the solution was determined regularly, thereby obtaining time for complete degradation under different pH. The results were shown in FIG. 6. It showed that the best pH for the strain GYH to degrade chloroform was 7.

(33) Although the present invention has disclosed the above examples, it is not intended to limit the scope of protection of the present invention. Changes and modifications made by any technical person familiar with the technology, without departing from the concept and scope of the present invention, should be involved in the scope of protection of the present invention.