Biomarker composition for predicting cancer malignant prognosis induced by microplastic exposure
12228575 ยท 2025-02-18
Assignee
Inventors
Cpc classification
G01N2333/70596
PHYSICS
G01N33/57484
PHYSICS
G01N2333/726
PHYSICS
C12Q2600/112
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention relates to a biomarker composition for predicting the prognosis of cancer malignancy induced by exposure to microplastics and use thereof, and more particularly, it was confirmed that the expression level of CD44, E-cadherin, N-cadherin, PD-L1, NPAS2, NR1D1, DNMT1, SLC7A2, PCDH7 and CLDN7 was changed in cancer cell lines and animal models treated with polystyrene microspheres which are the one type of microplastic for 4 weeks, and malignancy was induced due to an increase in proliferation, migration and invasion of cancer cells by the change in the expression level of the gene, and 5-year overall survival rates in gastric cancer patients decreased and thus the genes may be provided as a biomarker composition for predicting the prognosis of cancer malignancies by exposure to microplastics.
Claims
1. A method of detecting changes in protein expression in gastric cancer cells exposed to microplastic, comprising: culturing gastric cancer cell lines obtained from subjects in medium; treating the cultured gastric cancer cell lines with 500 ppm of the microplastic for 4 weeks; and detecting protein levels of CD44, E-cadherin, N-cadherin, and PD-L1 (programmed death-ligand 1) in the cultured gastric cancer cell lines treated with the microplastic.
2. The method of claim 1, wherein the microplastic is.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
DETAILED DESCRIPTION OF THE EMBODIMENTS
(10) Hereinafter, the present invention will be described in more detail.
(11) As microplastics with diameters less than 5 mm are being recognized as a new environmental treat and human health risk, the present inventors investigated the effects of the microplastic polystyrene (PS) on the hallmarks of cancer changes and 5-year overall survival (OS) to study the risks that may occur when PS, a type of microplastic, are ingested in vivo and as a result, they confirmed that when PS is ingested in vivo, the gastric cancer was exacerbated through the change in the expression level of the gene in the stomach tissue, which is the primary site of exposure and completed the present invention.
(12) In the present invention, the present invention is at least one protein selected from the group consisting of CD44, E-cadherin, N-cadherin, PD-1, NPAS2, NR1D1, DNMT1, SLC7A2, PCDH7 and CLDN7, and it is possible to provide a biomarker composition for predicting prognosis of cancer malignancy induced by exposure to microplastics.
(13) In more detail, the biomarker composition may be one or two or more selected from the group consisting of CD44 (NCBI No. 960), E-cadherin (NCBI No. 999), N-cadherin (NCBI No. 1000), PD-L1 (programmed death-ligand 1, NCBI No. 29126), NPAS2 (Neuronal PAS domain protein 2, NCBI No. 4862), NR1D1 (nuclear receptor subfamily 1 group D member 1, NCBI No. 9572), DNMT1 (DNA (cytosine-5)-methyltransferase 1, NCBI No. 1786), SLC7A2 (Solute Carrier Family 7 Member 2, NCBI No. 6542), PCDH7 (Protocadherin-7, NCBI No. 5099) and CLDN7 (Claudin 7, NCBI No. 1366).
(14) The microplastics may be selected from the group consisting of polystyrene, polypropylene, polyethylene, polyamide (PA), acrylonitrile-butadiene-styrene (ABS), polytetrafluoroethylene (PTFE), cellulose acetate (CA), polycarbonate (PC), polymethyl methacrylate (PMMA), polyvinyl chloride (PVC) and polyethylene terephthalate (PET).
(15) The CD44, N-cadherin, PD-L1, NR1D1, SLC7A2 and PCDH7 may increase in the expression in cancer cells exposed to the microplastics.
(16) The E-cadherin, NPAS2, DNMT1 and CLDN7 may reduce in the expression in cancer cells exposed to the microplastics.
(17) The cancer may be selected from the group consisting of gastric cancer, breast cancer, uterine cancer, liver cancer, colon cancer, kidney cancer, lung cancer, prostate cancer, oral cancer and pancreatic cancer.
(18) The present invention may provide a diagnostic kit for predicting prognosis of cancer malignancy induced by exposure to microplastics comprising at least one protein selected from the group consisting of CD44, E-cadherin, N-cadherin, PD-L1, NPAS2, NR1 D1, DNMT1, SLC7A2, PCDH7 and is CLDN7, and an agent for detecting expression or activity level of the protein, or expression level of gene encoding the protein as an active ingredient.
(19) The agent may be selected from the group consisting of primers, probes, antibodies, peptides and aptamers.
(20) In addition, the present invention may provide a method of providing information for predicting prognosis of cancer malignancy induced by exposure to microplastics comprising detecting expression or activity level of at least one protein selected from the group consisting of CD44, E-cadherin, N-cadherin, PD-L1, NPAS2, NR1D1, DNMT1, SLC7A2, PCDH7 and CLDN7, or expression level of gene encoding the protein in a sample isolated from specimen.
(21) As used herein, biomarker refers to a substance capable of diagnosing a tissue or cell of a subject with gastric cancer by distinguishing it from a tissue or cell of a normal control group and includes organic biomolecules such as proteins, nucleic acids, lipids, glycolipids, glycoproteins, and the like, which show an increase or decrease in tissues or cells of a diseased object compared to the normal control group.
(22) As used herein, prognosis includes determining whether an object for a specific disease or symptom, that is, the subject to be tested will have the autologous disease in the future, or determining the responsiveness of the subject to be tested to the treatment.
(23) Hereinafter, the present invention will be described in more detail through examples. These examples are only intended to illustrate the present invention in more detail, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention.
(24) The following experimental examples are intended to provide experimental examples commonly applied to each of the examples according to the present invention.
Experimental Example
(25) 1. Animal Model for Microplastic Accumulation in Gastric Tissue
(26) To identify the microplastic accumulation in gastric tissue, fluorescent green polyethylene microspheres (100 ppm/100 L; 10-20 m; Cospheric, USA) was used. Fluorescent green polyethylene microspheres were orally administered to 5-week-old BALB/c nude mice daily for 4 weeks.
(27) After 4 weeks, mice were euthanized using CO.sub.2. The stomach was isolated and fixed overnight with 4% PFA at 4 C.
(28) Frozen slides (8 m thick) were generated using optimal cutting temperature (OCT) compound, and the slides were attached to slide glass. Cell nuclei were stained with DAPI (ThermoFisher Scientific, USA), and images were obtained using an IN cell analyzer 2200 (GE Healthcare, USA)
(29) 2. Polystyrene Microspheres (PS)
(30) To identify the effect of microplastic to gastric cancer cells, polystyrene microspheres (PS) (500 mg, 9.5-11.5 m, Cospheric, USA) was used. PS were mixed with 10 mL of normal RPMI culture medium containing 10% FBS and 1% antibiotics.
(31) Ultrasonic grinding and vortexing were repeatedly performed to create a 5% PS suspension, which was then aliquoted to cell culture media to the desired concentration during subculture.
(32) The PS was removed by washing three times with PBS. EDTA-trypsin was used during subculture.
(33) 3. Cell Culture
(34) The human gastric cancer cell lines, AGS, MKN1, MKN45, KATO Ill, were obtained from the Korea Cell-Line Bank (KLCB, Korea). NCI-N87 was obtained from the American Type Culture Collection (ATCC, USA).
(35) All cell lines maintained in RPMI 1640 medium (Corning, USA) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin at 37 C. in 5% CO.sub.2.
(36) 4. Invasion and Migration Assay
(37) Cells (110.sup.5 cells per mL) were suspended in 0.2 mL of serum-free RPMI for invasion and motility assays.
(38) For the invasion assay, the cells were loaded in the upper well of the Transwell chamber (8-um pore size; SPL, Korea) that was pre-coated with Matrigel (Corning, USA) on an upper side of the chamber; the lower well was filled with 0.75 mL of RPMI with 20% serum.
(39) After incubation for 48 h at 37 C., non-invaded cells on the upper surface of the filter were removed with a cotton swab, and migrated cells on the lower surface of the filter were fixed and stained with a Crystal violet menthol solution (Sigma-Aldrich, USA) and photographed at 20 magnification.
(40) Invasiveness was determined by counting cells in four microscopic fields per well, and the extent of invasion was expressed as an average number of cells per microscopic field.
(41) For migration studies, we used invasion chambers with control inserts that contained Matrigel. Cells (510.sup.4 cells per mL) in 0.2 mL of serum-free RPMI were added to the apical side of each insert, and 0.75 mL of RPMI with 20% serum was added to the basal side of each insert. The inserts were processed as described above for the invasion assay.
(42) 5. Flow Cytometry
(43) To detect N-cadherin, CD44, and PD-L1 expression, cells were exposed to PS for 4 weeks, dislodged with EDTA-trypsin, and then collected in 5-mL FACS tubes (110.sup.6 cells/tube).
(44) Cells were centrifuged, the supernatant was aspirated, and 4% paraformaldehyde was added and allowed to incubate for 30 min at room temperature. After removing the fixation buffer, permeabilization buffer (0.02% Triton-X in distilled water) was added to the cells.
(45) After removing the buffer, cells were incubated with blocking buffer containing 1% BSA with 10% normal goat serum for 1 h at room temperature. Cells were then incubated with primary antibody (anti-N-cadherin, anti-CD44, or anti-PD-L1 antibody) overnight at 4 C. After washing 3 times by PBS, cells were incubated with Alexa Fluor-647 goat anti-rabbit IgG (H+L) at room temperature in the dark for 60 min.
(46) After, washing 3 times by PBS, antibody signals were detected by flow cytometry (BD Accuri C6 Plus, Becton Dickinson Biosciences, USA).
(47) 6. Immunocytochemistry (ICC)
(48) Briefly, cells were seeded onto a 2-well chamber slide (Falcon, USA) with RPMI 1640 medium (Corning, USA) supplemented with 10% FBS at a density of 110.sup.5 cells/mL and treated with PS at 500 ppm.
(49) Cells were incubated overnight at 37 C. in 5% CO.sub.2, the culture medium was removed, and cells were washed 3 times with PBS and fixed with 4% paraformaldehyde for 20 min at room temperature.
(50) After fixation, the samples were permeabilized by incubation with 0.02% Triton-X in distilled water for 20 min at room temperature. After the buffer was removed, cells were incubated with blocking buffer (1% BSA and 10% normal goat serum) for 1 h at room temperature and cells were incubated with primary antibody overnight at 4 C.
(51) N-cadherin and E-cadherin were detected with Alexa Fluor-488 goat anti-rabbit IgG (H+L) and Alexa Fluor-647 goat anti-mouse IgG (H+L), respectively. PD-L1 was detected with Alexa Fluor-647 goat anti-rabbit IgG (H+L), and CD44 was detected with Alexa Fluor-488 goat anti-mouse IgG (H+L).
(52) The slides were treated with DAPI and analyzed by confocal microscopy (LSM-710, Zeiss, Germany).
(53) 7. Quantitative Real-Time PCR (qPCR)
(54) Total RNA was extracted from cells using TRIzol (Molecular Research Center, USA) in accordance with the manufacturer's instructions.
(55) RNA was quantified by spectrophotometry and then diluted in RNase-free dH.sub.2O (ThermoFisher Scientific, USA).
(56) For the PCR reaction, a SuperScript Ill cDNA Synthesis Kit (Invitrogen, USA) was used to generate cDNA from 5 g of mRNA following the manufacturer's instructions.
(57) qPCR was performed on an ABI PCR system (Applied Biosystems, USA) using SYBR Green PCR Master Mix (Applied Biosystems, USA) following the manufacturer's instructions. The reaction conditions were: 10 min at 95 C. followed by 50 cycles of 95 C. for 15 s, 60 C. for 60 s.
(58) The primer sequences are described in Supplementary Table 1. mRNA values were normalized to GAPDH, relative quantity values of mRNA (RQ value) were calculated with the following equation:
RQ=2.sup.Ct
(59) TABLE-US-00001 TABLE1 Primers Target Sequence GAPDH Forward GCCTCAAGATCATCAGCAATGCCT N.A (SEQIDNO:1) Reverse TGTGGTCATGAGTCCTTCCACGAT N.A (SEQIDNO:2) N-cadherin Forward AGAGGCTTCTGGTGAAATCGC N.A (SEQIDNO:3) Reverse TGGAAAGCTTCTCACGGCAT N.A (SEQIDNO:4) CD44 Forward CCAATGCCTTTGATGGACC N.A (SEQIDNO:5) Reverse TCTGTCTGTGCTGTCGGTGAT N.A (SEQIDNO:6) PD-L1 Forward TTGGGAAATGGAGGATAAGA N.A (SEQIDNO:7) Reverse GGATGTGCCAGAGGTAGTTCT N.A (SEQIDNO:8) NR1D1 Forward CTGGACTCCAACAACAACACAG N.A (SEQIDNO:9) Reverse GGGGATGGTGGGAAGTAGGT N.A (SEQIDNO:10) NPAS2 Forward GTATCACGCCTCTCCTTGGG N.A (SEQIDNO:11) Reverse ATTACAGGAGGGGCTAGGCA N.A (SEQIDNO:12) ACE2 Forward CATTGGAGCAAGTGTTGGATCTT N.A (SEQIDNO:13) Reverse GAGCTAATGCATGCCATTCTCA N.A (SEQIDNO:14)
8. Western Blot
(60) Cell extracts were obtained using Extraction Cell Lysis Buffer 1 (Abcam, UK) containing Extraction Enhancer Buffer (Abcam, UK), and protein concentration was determined by BCA assay (ThermoFisher Scientific, USA).
(61) Western blot analysis was performed using the antibodies listed in Table 2.
(62) TABLE-US-00002 TABLE 2 Material or Reagent Source Cat. No. Antibody N-cadherin Abcam, UK, ab76057(for ICC, Flow cytometer) ab76011 (for WB) E-cadherin Abcam, UK, ab1416 CD44 Abcam, UK, ab1416 (for ICC/IF, Flow cytometer) ab157107 (for WB) PD-L1 Abcam, UK, ab205921 DNMT1 Abcam, UK, ab134148 AGTR1 Abcam, UK, ab124734 Beta Actin Abcam, UK, ab6276 Anti-Rabbit/- Abcam, UK, ab205718ab205719 Mouse-HRP Anti-Rabbit/Mouse- Abcam, UK, ab150077ab150113 Alexa488 Anti-Rabbit/Mouse- Abcam, UK, ab150079ab150115 Alexa647
9. Cytotoxicity
(63) To investigate PS cytotoxicity, cell proliferation was measured by the alamarBlue assay (ThermoFisher Scientific, USA) following the manufacturer's instructions.
(64) Briefly, cells were seeded onto 96-well culture plates with RPMI-1640 medium supplemented with 10% FBS at a density of 5000 cells/well and treated PS microspheres.
(65) Cell viability was measured at ex=560 nm and em=590 nm using a microplate reader (i3X, Molecular Devices, USA).
(66) The emission values are stated as percentages of controls, yielding the percent cell proliferation after 72 h of seeding the plate.
(67) 10. Assessment of Drug Resistance
(68) To assess the drug resistance due to CD44, cytotoxicity was measured using bortezomib or cisplatin. Cytotoxicity was determined by the alamarBlue assay (Thermo Fisher Scientific, Waltham, MA) following the manufacturer's instructions.
(69) Briefly, Cells were exposed to PS for 4 weeks, collected in tube. After, cells were seeded onto 96-well culture plates with medium supplemented with 10% FBS at a density of 110.sup.5 cells/mL concertation with 500 ppm PS.
(70) After overnights, removed culture media and treated with Bortezomib (Takeda Oncology, USA, 10 nM in PBS), or Cisplatin (United states Pharmacopeia, USA, 1.5 ug/mL in DMSO) with RPMI-1640 medium supplemented with 5% FBS and/or PS 500 ppm.
(71) Cytotoxicity was measured at an emission of 590 nm using a microplate reader.
(72) The emission values are stated as percentages of vehicle controls, yielding percentage cell viability after 72 h of treatment.
(73) Then, cytotoxicity was calculated as followings:
(74) cytotoxicity=cytotoxicity with PScytotoxicity without PS
(75) 11. RNAseq
(76) To confirm changes in gene expression in gastric tissues due to PS exposure, mice were orally administered 10-m PS microspheres (100 ppm/100 L PBS) for 4 weeks.
(77) Total RNA was extracted from the stomach tissues.
(78) The RNA was randomly fragmented for sequencing with short reads, which were then reverse transcribed to cDNA with different adapters attached to the 5 and 3 ends.
(79) PCR amplification was performed to the extent that sequencing was possible, and size selection was performed to obtain an insert size of 200-400 bp, which was used for NovaSeq 6000 Sequencing System (illumina, USA) with the manufacturer's instructions.
(80) The expression profile was extracted with FPKM (Fragments Per Kilobase of transcript per Million mapped reads), which is a normalization value that accounts for read count, transcript length, and depth of coverage.
(81) 12. Data Analysis of TCGASTAD
(82) Overall survival analysis was performed using The Human Protein ATLAS web toolkit (https://www.proteinatlas.org/) using the RNAseq data from 354 patients in The Cancer Genome Atlas-Stomach Adenocarcinoma (TCGA-STAD) dataset.
(83) The demographic data was listed in Table 3.
(84) Based on the FPKM value of each gene, patients were classified into two expression groups (high and low), and the correlation between expression level and patient survival was examined.
(85) To classify the two expression categories, the best expression cutoff value in the Protein ATLAS web-toolkit was used. The prognosis of each group of patients was examined by Kaplan-Meier survival estimators, and the survival outcome of the two groups were compared by log-rank test.
(86) The overall survival (OS) results included all Stage I-IV and N/A patients. FPKM values above 1, which was recommended by The Human Protein ATLAS, and p<0.0001, indicated a significant OS.
(87) TABLE-US-00003 TABLE 3 Variables Counts ( n= 354) Age( years) 60 241 68.1% >60 107 30.2% N/A 6 1.7% Gender Female 125 35.3% Male 229 64.7% Pathologic stage Stage I 48 13.6% Stage II 110 31.1% Stage III 146 41.2% Stage IV 35 9.9% N/A 15 4.2% N/A: not available.
13. Cytoscape Network Analysis
(88) Gene sets were downloaded from the MSigDB database of the Broad Institute (http://software/broadinstitute.org/gsea/msigdb), and hallmark gene signature (H) sets and oncogene signatures (C6) gene sets were selected to perform quantification of RNAseq gene lists (Fold change>2, p<0.05).
(89) All top-ranked gene sets were manually curated to confirm their accurate functional and pathway categorizations (p<0.05, top 20).
(90) The interaction network was analyzed with STRING software.
(91) Briefly, Cytocape String App (Version 1.4.0) were downloaded from the official website. In this study, we selected significant RNAseq gene lists for network analysis (Fold change>2, p<0.05).
<Example> Confirmation of Effect of Microplastic Exposure on Gastric Cancer Onset and Malignancies
(92) Microplastics with diameters less than 5 mm are being recognized as a new environmental threat and human health risk. Polystyrene microspheres (PS) are the one type of microplastic. In vivo studies using mice reported that deposition of PS in the liver, kidney, and gut was observed after oral administration of PS particles sized 1-10 m. Moreover, exposure of mice to PS led to disturbed intestinal microbiome
(93) However, it has not been revealed whether PS induce changes in cancer hallmarks and the effect of 5-year overall survival (OS). The stomach is the primary site of exposure when PS are ingested in vivo and given the deleterious effects of PS exposure, it was hypothesized that it may exacerbate gastric cancer.
(94) The important hallmarks of cancer include cancer cell proliferation and metastasis, circadian clock, immunosuppressive environment, and expression of stem cell markers. This study aimed to evaluate the effects of PS on gastric cancer. To confirm accumulation of PS into the digestive tract, BALB/nude mice were fed daily with 100 ppm/100 L of 10-20-m sized fluorescent green polyethylene for 4 weeks.
(95) Fluorescent green polyethylene signals were observed in the gastric tissue (
(96) After confirming PS can directly interact with the stomach, PS was exposed to human gastric cancer cell lines (AGS, MKN1, MKN45, NCI-N87, and KATOIII) for 4 weeks. As a result, it was confirmed that increases of proliferation were observed (*P<0.05, **P<0.005) as shown in
(97) Next, to determine whether PS exposure induces changes in invasion, migration, and epithelial mesenchymal transition, the migration and invasion rates were measured
(98) As a result, it was confirmed that 2.12, 3.24, 1.74, 3.78, and 3.71-fold increases of migration rate were observed in AGS, MKN1, MKN45, NCI-N87, and KATOIII cells, respectively and invasion rates were elevated by 1.33, 2.47, 3.48, and 11.4-fold in AGS, MKN1, MKN45, and KATOIII cells, respectively (*P<0.05, **P<0.005) as shown in
(99) In addition,
(100) Quantitatively, qPCR results showed 3.84, 1.47, 4.40, 1.61, and 1.71-fold increases of N-cadherin gene expression after PS exposure in AGS, MKN1, MKN45, NCI-N87 and KATOIII cells, respectively (
(101) The correlated gene expression was investigated in Cancer Genome Atlas Stomach Adenocarcinoma (TCGA-STAD) datasets using finding of RNAseq in mouse model. In the TCGA-STAD datasets, it is confirmed that high N-cadherin expression showed poor 5-year overall survival rate (OS) in stage II (P=0.079), III (P 5=0.00055), IV (P=0.00069), and low E-cadherin expression showed poor 5-year OS in stage II (P=0.0081) as shown in
(102) Upregulated CD44 expression was found by immunohistochemistry (
(103) To assess the drug resistance due to CD44, cytotoxicity was measured using bortezomib or cisplatin. Then cytotoxicity was calculated as followings, cytotoxicity=cytotoxicity with PScytotoxicity without PS.
(104) As upregulation of programmed death-ligand 1 (PD-L1) is reported to mediate potent immunosuppressive effects in tumor microenvironments, flow cytometry analysis was performed to confirm the change in PD-L1 expression in gastric cancer cells treated with PS for 4 weeks.
(105) Flow cytometry results indicated that PD-L1 expression was elevated for AGS, MKN1, MKN45, NCI-N87 and KATOIII cell lines (
(106) RNAseq was performed using mouse stomach tissue 4 weeks after exposure of PS (
(107) Gene set enrichment analysis using MSigDB identified the genes in cancer hallmark (H) and oncogenic signatures (C6) set. To identify the effect of PS exposure to OS in patients, 145 genes that were common between the PS-exposed mouse model and the 354 patients in the TCGA-STAD dataset were identified (
(108) To examine whether the change in OS correlates with changes in expression of these genes, the significantly expressed prognostic factors were identified based on a FPKM value>1 and log-rank p value<0.001, and gene overlapped by MSigDB H and C6.
(109) Finally, 3 genes, SLC7A2, PCDH7, and CLDN7, were identified (
(110) Next, it was confirmed hazard ratio for 3 common genes; SLC7A2 (HR=1.4250-3.281, P=0.00031), PCDH7 (HR=1.284-2.487, P=0.00064), and CLDN7 (HR=0.3497-0.7396, P=0.00041) (
(111) An increase of 2.42-fold SLC7A2, 2.08-fold PCDH expression, and decrease of CLDN7 were observed in mouse RNAseq datasets. In the TCGA-STAD datasets, high expression of SLC7A2 (P=0.00031) or PCDH (P=0.00064), and low expression of CLDN7 (P=0.00041) showed poor 5-year OS.
(112) Disruption of the circadian clock was known as cancer hallmarks and in fact, as shown in
(113) Decrease of mRNA expression of NPAS2 in MKN45, NCI-N87, and KATOIII cells following PS exposure was also found (**P<0.005, * P<0.05) (
(114) It was confirmed that low expression of NPAS2 (P=0.070) and high expression of NR1 D1 (P=0.0045) showed poor 5-year OS in TCGA-STAD datasets.
(115) Next, it was confirmed whether PS exposure induces changes of methylation.
(116) The western blot results indicated protein level of DNMT1 decreased in AGS, MKN1, N45, and KATOIII cells (
(117) According to the present invention, it was confirmed that the expression level of CD44, E-cadherin, N-cadherin, PD-L1, NPAS2, NR1D1, DNMT1, SLC7A2, PCDH7 and CLDN7 was changed in cancer cell lines and animal models treated with polystyrene microspheres which are the one type of microplastic for 4 weeks, and malignancy was induced due to an increase in proliferation, migration and invasion of cancer cells by the change in the expression level of the gene, and 5-year overall survival rates in gastric cancer patients decreased and thus the genes may be provided as a biomarker composition for predicting the prognosis of cancer malignancies by exposure to microplastics.
(118) While the present invention has been particularly described with reference to specific embodiments thereof, it is apparent that this specific description is only a preferred embodiment and that the scope of the present invention is not limited thereby to those skilled in the art. That is, the practical scope of the present invention is defined by the appended claims and their equivalents.