ANTIVIRAL USE OF BISEPOXYLIGNAN COMPOUND, AND BISEPOXYLIGNAN COMPOSITION AND PREPARATION OF BISEPOXYLIGNAN COMPOUND
20250049831 ยท 2025-02-13
Inventors
- Xin GE (Liaoning, CN)
- Shuo WANG (Liaoning, CN)
- Mingming LU (Liaoning, CN)
- Rongxin LIN (Liaoning, CN)
- Zifeng YANG (Liaoning, CN)
- Nanshan ZHONG (Liaoning, CN)
- Dayun SUI (Liaoning, CN)
- Wei YANG (Liaoning, CN)
- Qinhai MA (Liaoning, CN)
- Kesi LU (Liaoning, CN)
Cpc classification
A61K31/7048
HUMAN NECESSITIES
A61K31/34
HUMAN NECESSITIES
A61P29/00
HUMAN NECESSITIES
A23L33/105
HUMAN NECESSITIES
Y02P20/55
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C07H1/00
CHEMISTRY; METALLURGY
C07H15/26
CHEMISTRY; METALLURGY
A61K31/7034
HUMAN NECESSITIES
A23L33/125
HUMAN NECESSITIES
International classification
A61K31/7048
HUMAN NECESSITIES
A61K31/341
HUMAN NECESSITIES
Abstract
The present invention provides an application of a bisepoxylignan compound or a bisepoxylignan composition in prevention and treatment of infections with influenza viruses, parainfluenza viruses, COVID-19 viruses and COVID-19 virus variants, an application thereof in prevention and treatment of pulmonary hemorrhage caused by the COVID-19 viruses and the COVID-19 virus variants (e.g., Delta), an application thereof in anti-inflammatory effects on pneumonia caused by influenza viruses, parainfluenza viruses, COVID-19 viruses and COVID-19 virus variants. In addition, the present invention further provides a chemical synthesis method of a bisepoxylignan compound lianqiaoxinside.
Claims
1. An application of a bisepoxylignan compound or a bisepoxylignan composition in the preparation of health food or drug for prevention or treatment of infections with influenza viruses, parainfluenza viruses, COVID-19 viruses or COVID-19 virus variants.
2. An application of a bisepoxylignan compound or a bisepoxylignan composition in the preparation of health food or drug for prevention or treatment of pulmonary hemorrhage caused by COVID-19 viruses or COVID-19 virus variants.
3. An application of a bisepoxylignan compound or a bisepoxylignan composition in the preparation of health food or drug for resisting pneumonia caused by influenza viruses, parainfluenza viruses, COVID-19 viruses and COVID-19 virus variants.
4. The application according to claim 1, wherein the bisepoxylignan compound refers to a bisepoxylignan monomer compound.
5. The application according to claim 4, wherein the bisepoxylignan compound is phillyrin, lianqiaoxinside, phillygenin, phillygenin sulfate, phillygenin glucuronate or phillygenin ibuprofenate.
6. The application according to claim 1, wherein the bisepoxylignan composition is a composition consisting of phillyrin and one or more of liangiaoxinside, phillygenin sulfate, phillygenin glucuronate and phillygenin ibuprofenate respectively.
7. The application according to claim 6, wherein the bisepoxylignan composition is a composition consisting of liangiaoxinside and phillyrin, a composition consisting of phillyrin and phillygenin sulfate, a composition consisting of phillyrin and phillygenin glucuronate, a composition consisting of phillyrin and phillygenin ibuprofenate, a composition consisting of phillyrin, lianqiaoxinside and phillygenin sulfate, or a composition consisting of liangiaoxinside, phillyrin and phillygenin ibuprofenate.
8. The application according to claim 1, wherein the bisepoxylignan composition is a composition consisting of any two or more of liangiaoxinside, phillygenin, phillygenin sulfate, phillygenin glucuronate and phillygenin ibuprofenate.
9. The application according to claim 8, wherein the bisepoxylignan composition is a composition consisting of liangiaoxinside and phillygenin, a composition consisting of liangiaoxinside and phillygenin sulfate, a composition consisting of liangiaoxinside and phillygenin glucuronate, a composition consisting of lianqiaoxinside and phillygenin ibuprofenate, a composition consisting of phillygenin and phillygenin sulfate, a composition consisting of phillygenin and phillygenin glucuronate, a composition consisting of phillygenin and phillygenin ibuprofenate, a composition of phillygenin sulfate and phillygenin glucuronate, a composition consisting of phillygenin sulfate and phillygenin ibuprofenate, a composition consisting of phillygenin glucuronate and phillygenin ibuprofenate, or a composition consisting of phillygenin, liangiaoxinside and phillygenin glucuronate.
10. The application according to claim 1, wherein the COVID-19 virus variant is a COVID-19 virus variant Beta or a COVID-19 virus variant Delta.
11. The application according to claim 1, wherein the bisepoxylignan compound and the bisepoxylignan composition are applied as a sole active ingredient.
12. The application according to claim 1, wherein the drug is present in the form of tablets, capsules, pills, powders, granules, a syrup, a solution, an emulsion, an injection, a spray, an aerosol, a gel, a cream, cataplasm, a rubber plaster or plaster; or, the health food is present in the food form of tablets, capsules, pills, powders, granules, a syrup, a solution, an emulsion, a spray, an aerosol, a gel, a cream, cataplasm, a rubber plaster or plaster, candies and preserved fruits, tea, a beverage, baked food or a wine product.
13. A synthesis method of liangiaoxinside, comprising the following steps: 1) obtaining corresponding -keto esters (a compound of formula 4) and (a compound of formula 9) by taking vanillin (a compound of formula 1) and 3-hydroxy-5 methoxybenzaldehyde (a compound of formula 6) as raw materials via phenolic hydroxyl protection, oxidization and Claisen condensation reaction; then converting the -keto esters into corresponding sodium salt (a compound of formula 5) and bromide (a compound of formula 10) respectively, and then performing a coupling reaction on the two fragments to obtain an intermediate (a compound of formula 11); 2) obtaining aglycone (a compound of formula 14) from the intermediate (the compound of formula 11) via a reduction reaction and a ring-closing reaction; 3) obtaining a target product (a compound of formula 17) from the aglycone (the compound of formula 14) via glycosylation and protecting group removal; and a reaction formula is as follows: ##STR00006## ##STR00007## in which: a. benzyl chloride; b. potassium permanganate; c. thionyl chloride/ethyl acetoacetate/sodium ethoxide; d. sodium ethoxide; e. tert-butyldimethylchlorosilane; f. bromine water; g. methylene chloride; h. lithium aluminum hydride; i. methylsulfonyl chloride/pyridine; j. palladium carbon/hydrogen; k. acetylglucosyl trichloroethanimidate; l. sodium methoxide; and m. tetrabutylammonium fluoride.
14. The synthesis method according to claim 13, wherein in step 1): synthesis of a compound of formula 2 comprises: dissolving vanillin in acetonitrile, adding potassium carbonate, potassium iodide and benzyl chloride, and performing a reflux reaction for 5 h to obtain the compound of formula 2; synthesis of a compound of formula 3 comprises: dissolving the compound of formula 2 in hot water, adding potassium permanganate, and reacting at 70-80 C. for 1 h to obtain the compound of formula 3; synthesis of a compound of formula 4 comprises: dissolving the compound of formula 3 in thionyl chloride, reacting at 95 C. for 8 h, removing thionyl chloride by distillation, adding anhydrous tetrahydrofuran and a sodium salt of ethyl acetoacetate, refluxing for 8 h, removing tetrahydrofuran, then adding ammonium chloride and 95% ethanol solution containing 1% ammonia water directly to residues, and refluxing for 4 h to obtain the compound of formula 4; synthesis of a compound of formula 7 comprises: dissolving 3-hydroxy-5 methoxybenzaldehyde in N,N-dimethylformamide, adding imidazole and tert-butyldimethylchlorosilane, and reacting at 35 C. for 10 h to obtain the compound of formula 7; synthesis of a compound of formula 8 comprises: dissolving the compound of formula 7 in hot water, adding potassium permanganate, and reacting at 70-80 C. for 1 h to obtain the compound of formula 8; synthesis of a compound of formula 9 comprises: adding the compound of formula 8 to thionyl chloride, reacting at 95 C. for 8 h, removing thionyl chloride by distillation, adding anhydrous tetrahydrofuran and a sodium salt of ethyl acetoacetate, refluxing for 8 h, removing tetrahydrofuran, then adding ammonium chloride and 95% ethanol solution containing 1% ammonia water directly to residues, and refluxing for 4 h to obtain the compound of formula 9; and/or, synthesis of a compound of formula 11 comprises: adding the compound of formula 4 to an absolute ethanol solution dissolved with the same amount of metal sodium, and stirring and reacting at room temperature for 3 h to obtain a compound of formula 5; dissolving the compound of formula 9 in an anhydrous tetrahydrofuran solution, adding bromine water, and stirring and reacting at room temperature for 3 h to obtain a compound of formula 10; and dissolving the compound of formula 5 and the compound of formula 10 in a dichloromethane solution, and stirring and reacting at room temperature for 10 h to obtain the compound of formula 11.
15. The synthesis method according to claim 13, wherein in step 2): synthesis of a compound of formula 12 comprises: dissolving the compound of formula 11 in anhydrous tetrahydrofuran, adding an anhydrous tetrahydrofuran solution containing lithium aluminum hydride, performing a reflux reaction for 6 h, and stirring at room temperature overnight to obtain the compound of formula 12; synthesis of a compound of formula 13 comprises: dissolving the compound of formula 12 in re-distilled benzene, adding pyridinium p-toluenesulfonate salt powder, and performing a reflux reaction for 3 h to obtain the compound of formula 13; and/or, synthesis of a compound of formula 14 comprises: dissolving the compound of formula 13 in methanol under a hydrogen condition, adding 10% palladium carbon, and stirring and reacting at room temperature for 10 h to obtain the compound of formula 14.
16. The synthesis method according to claim 13, wherein in step 3): synthesis of a compound of formula 15 comprises: dissolving the compound of formula 14 in anhydrous dichloromethane under the protection of nitrogen, adding tetraacetylglucosyl trichloroethanimidate, trimethylsilyl trifluoromethanesulfonate and a 4 -type aluminosilicate molecular sieve, and stirring and reacting at 0 C. for 10 h to obtain the compound of formula 15; synthesis of a compound of formula 16 comprises: dissolving the compound of formula 15 in a mixed solution of dichloromethane and methanol, adding sodium methoxide, and stirring and reacting at 25 C. for 4 h to obtain the compound of formula 16; and/or synthesis of a compound of formula 17 comprises: dissolving the compound of formula 16 in anhydrous tetrahydrofuran, adding tetrabutylammonium fluoride, and stirring and reacting at 35 C. for 3 h to obtain the compound of formula 17.
Description
DETAILED DESCRIPTION OF THE INVENTION
[0072] The present invention is further illustrated by the examples below. Unless otherwise specified, the methods used in the examples are recorded in the technical literatures in the art and in the specification documents of the drug regulatory agencies, and the instruments, raw materials and reagents are purchased in the open market.
Example 1 Synthesis and Preparation Method of Lianqiaoxinside
[0073] 1. Vanillin (15.2 g, 100 mmol) was dissolved in 100 ml of acetonitrile, added with potassium carbonate (6.9 g, 50 mmol), potassium iodide (0.66 g, 4 mmol) and benzyl chloride (14 g, 110 mmol), subjected to a reflux reaction for 5 h, quenched with saturated ammonium chloride, reduced in pressure to remove acetonitrile, extracted with dichloromethane, spin-dried and allowed to pass through a column to obtain a compound of formula 2, with a yield of 92%; [0074] 2. the compound of formula 2 (21.8 g, 92 mmol) was dissolved in 200 ml of hot water, added with potassium permanganate (24.1 g, 150 mmol), reacted at 70-80 C. for 1 h, and alkalized to pH=10; filtrate was acidified and subjected to suction filtration to obtain a compound of formula 3, with a yield of 90%; [0075] 3. the compound of formula 3 (20.6 g, 81 mmol) was added with 50 ml of thionyl chloride, reacted at 95 C. for 8 h, distilled to remove thionyl chloride, and added with 50 ml of anhydrous tetrahydrofuran; this solution was dropwise added to the same amount of 100 ml of tetrahydrofuran solution of sodium salt of ethyl acetoacetate, and refluxed for 8 h; tetrahydrofuran was removed; then ammonium chloride (8 g) and 100 ml of 95% ethanol solution containing 1% ammonia were directly added to residues, refluxed for 4 h, reduced in pressure to remove ethanol, extracted with dichloromethane, spin-dried and allowed to pass through a column to obtain a compound of formula 4, with a yield of 75%; [0076] 4. 3-hydroxy-5-methoxybenzaldehyde (15.2 g, 100 mmol) was dissolved in 30 ml of N,N-dimethylformamide, added with imidazole (13.6 g, 200 mmol) and tert-butyldimethylchlorosilane (16.6 g, 110 mmol), reacted at 35 C. for 10 h, then quenched with saturated ammonium chloride, extracted with dichloromethane, spin-dried and allowed to pass through a column to obtain a compound of formula 7, with a yield of 94%; [0077] 5. the compound of formula 7 (24.1 g, 92 mol) was dissolved in hot water, added with potassium permanganate (24.1 g, 150 mmol), reacted at 70-80 C. for 1 h, and alkalized to pH=10; filtrate was acidified and subjected to suction filtration to obtain a compound of formula 8, with a yield of 93%; [0078] 6. the compound of formula 8 (22.6 g, 83 mmol) was added with 50 ml of thionyl chloride, reacted at 95 C. for 8 h, distilled to remove thionyl chloride, and added with 50 ml of anhydrous tetrahydrofuran; this solution was dropwise added to the same amount of 100 ml of tetrahydrofuran solution of sodium salt of ethyl acetoacetate, and refluxed for 8 h; tetrahydrofuran was removed; then ammonium chloride (8 g) and 100 ml of 95% ethanol solution containing 1% ammonia were directly added to residues, refluxed for 4 h, reduced in pressure to remove ethanol, extracted with dichloromethane, spin-dried and allowed to pass through a column to obtain a compound of formula 9, with a yield of 72%; [0079] 7. the compound of formula 4 (17.1 g, 52 mmol) was added to 150 ml of absolute ethanol solution dissolved with metal sodium (1.2 g, 52 mmol), stirred and reacted at room temperature for 3 h, and distilled at reduced pressure to remove ethanol to obtain a compound of formula 5; the compound of formula 9 (17.6 g, 50 mmol) was added in an anhydrous tetrahydrofuran solution, added with bromine water (11.5 g, 72 mmol), stirred and reacted at room temperature for 3 h and distilled at reduced pressure to remove tetrahydrofuran to obtain a compound of formula 10; and the compound of formula 5 and the compound of formula 10 were dissolved in 100 ml of dichloromethane solution, stirred and reacted at room temperature for 3 h, spin-dried and allowed to pass through a column to obtain a compound of formula 11, with a yield of 65%; [0080] 8. the compound of formula 11 (20.3 g, 31 mmol) was dissolved in 100 ml of anhydrous tetrahydrofuran, added with an anhydrous tetrahydrofuran solution containing 15 g of lithium aluminum hydride, subjected to a reflux reaction for 6 h, stirred at room temperature overnight, added with 100 ml of ethyl acetate to decompose excess lithium aluminum hydride, adjusted with concentrated hydrochloric acid to neutral, spin-dried and allowed to pass through a column to a compound of formula 12, with a yield of 82%; [0081] 9. the compound of formula 12 (11.3 g, 21 mmol) was dissolved in 20 mL of re-distilled benzene, added with pyridinium p-toluenesulfonate salt powder, subjected to a reflux reaction for 3 h, then cooled to room temperature, directly spin-dried and allowed to pass through a column to obtain a compound of formula 13, with a yield of 32%; [0082] 10. the compound of formula 13 (3.0 g, 6 mmol) was dissolved in 20 mL of methanol under a hydrogen condition, added with 2 g of 10% palladium carbon, stirred and reacted at room temperature for 3 h, filtered, spin-dried and allowed to pass through a column to obtain a compound of formula 14, with a yield of 90%; [0083] 11. the compound of formula 14 (2.1 g, 5 mmol) was dissolved in anhydrous dichloromethane under the protection of nitrogen, added with 2,3,4,6-tetra-O-acyl-D-glucopyranosyl trichloroethanimidate (3.7 g, 7.5 mmol), trimethylsilyl trifluoromethanesulfonate (0.3 ml, 15 mmol) and a 4 -type aluminosilicate molecular sieve (4.2 g), stirred and reacted at 0 C. for 10 h, quenched with triethylamine (1.5 mmol), filtered, spin-dried and allowed to pass through a column to obtain a compound of formula 15, with a yield of 72%; [0084] 12. the compound of formula 15 (2.2 g, 3 mmol) was dissolved in a mixed solution of dichloromethane and methanol (a volume ratio of 1: 2), added with sodium methoxide, stirred and reacted at 25 C. for 4 h, adjusted with acetic acid to pH=7, spin-dried and allowed to pass through a column to obtain a compound of formula 16, with a yield of 90%; and [0085] 13. the compound of formula 16 (1.1 g, 2 mmol) was dissolved in anhydrous tetrahydrofuran, added with tetrabutylammonium fluoride, stirred and reacted at 35 C. for 3 h, quenched with saturated ammonium chloride, extracted with dichloromethane, spin-dried and allowed to pass through a column to obtain a compound of formula 17, with a yield of 90%. The purity in a high-performance liquid chromatography test was 99.95%. [0086] 14. An m/z 543.18309 peak in a high-resolution mass spectrum of the compound of the present invention was a [M+Na]+ peak of a sample, so the compound had a molecular weight of 520, and the NMR data was as follows:
[0087] Complete assignment of chemical structure .sup.13CNMR spectrum:
TABLE-US-00001 .sup.13C chemical 1H-related chemical Structural Serial No. shift () shift () signs 1 148.90 / 16 2 147.26 / 2 3 145.87 / 17 4 145.25 / 6 5 135.28 / 14 6 129.58 / 4 7 118.11 6.86 18 8 117.87 6.74 3 9 115.14 7.04, 6.74 1, 19 10 110.38 6.96 15 11 109.73 6.89 5 12 100.10 4.88 21 13 86.64 4.37 11 14 81.36 4.76 8 15 77.00 3.27 25 16 76.84 3.27 22 17 73.19 3.27 23 18 70.23 4.08, 3.74 10 19 69.65 3.16 24 20 68.95 3.74, 3.11 13 21 60.66 3.67, 3.45 26 22 55.64 3.77 20 23 55.56 3.76 7 24 53.99 2.82 12 25 49.33 3.35 9
[0088] .sup.1HNMR data: .sup.1HNMR (600 MHz, d6-DMSO): 8.85(br, 1H, OH), 7.04 (d, 1H, J=8.49 Hz, CH), 6.96(d, 1H, J=1.94 Hz, CH), 6.89(s, 1H, CH), 6.86(dd, 1H, J=8.49 Hz, 1.94 Hz, CH), 6.74(d, 2H, J=0.77 Hz, CH), 5.19 (d, 1H, J=4.92 Hz, OH), 5.05(d, 1H, J=4.47 Hz, OH), 4.99(d, 1H, J=5.36 Hz, OH), 4.88(d, 1H, J=7.45 Hz, >OH), 4.76(d, 1H, J=5.81 Hz, >OH), 4.51(t, 1H, J=5.51 Hz, OH), 4.37(d, 1H, J=6.85 Hz, >OH), 4.08(d, 1H, J=9.39 Hz, CH2-), 3.77 (s, 3H, OCH3), 3.76(s, 3H, OCH3), 3.74(m, 2H, CH2-), 3.67(m, 1H, CH2-), 3.45(m, 1H, CH2-), 3.35(m, 1H, >OH), 3.27(m, 3H, >OH), 3.16(m, 1H, >OH), 3.11(t, 1H, J=8.49 Hz, CH2-), 2.82(m, 1H, >OH).
[0089] Therefore, it can be determined that the compound synthesized in this experiment is the illustrated structure:
##STR00005##
Example 2 Experimental Study of In-Vitro Efficacy of Drugs of the Present Invention Against COVID-19 Virus and Variants Thereof
1 In-Vitro Antiviral Test
1.1 Test Materials
[0090] (1) Drugs
[0091] Bisepoxylignan compounds include: lianqiaoxinside (having a purity of 99.95%), phillyrin (having a purity of 99.96%), phillygenin (having a purity of 99.96%), phillygenin sulfate (having a purity of 99.95%), phillygenin glucuronate (having a purity of 99.95%), or phillygenin ibuprofenate (having a purity of 99.95%).
[0092] Bisepoxylignan compositions include: lianqiaoxinside/phillyrin, lianqiaoxinside/phillygenin, lianqiaoxinside/phillygenin sulfate, lianqiaoxinside/phillygenin glucuronate, lianqiaoxinside/phillygenin ibuprofenate, phillyrin/phillygenin sulfate, phillyrin/phillygenin glucuronate, phillyrin/phillygenin ibuprofenate, phillygenin/phillygenin sulfate, phillygenin/phillygenin glucuronate, phillygenin/phillygenin ibuprofenate, phillygenin sulfate/phillygenin glucuronate, phillygenin sulfate/phillygenin ibuprofenate, phillygenin glucuronate/phillygenin ibuprofenate, phillyrin/lianqiaoxinside/phillygenin sulfate, lianqiaoxinside/phillyrin/phillygenin ibuprofenate, and phillygenin/lianqiaoxinside/phillygenin glucuronate.
[0093] The above test drugs were provided by Dalian Fusheng Natural Medicine Development Co., Ltd. Positive drug: (1) Remdesivir, provided by Guangzhou Institute of Biomedicine and Health, Chinese Academy of Sciences (synthesized by Professor Zhang Jiancun's team), specification: 1 g. Preparation method: during an in-vitro test, DMSO was prepared into mother liquor which was aliquoted, stored at 4 C. for later use and diluted to a required concentration with a cell working solution before use. During an in-vivo test, 0.5% sodium carboxymethyl cellulose was prepared into a required concentration. (2) Oseltamivir phosphate, China Institute for the Control of Pharmaceutical and Biological Products. Product batch number: 101096-201901, 100 mg/piece as a positive control drug in this test.
[0094] (2) Cell line: Vero E6 cells (African green monkey kidney cells), State Key Laboratory of Respiratory Diseases, Guangzhou Institute of Respiratory Medicine.
[0095] (3) Virus strains: COVID-19 virus strain, COVID-19 virus Beta variant, and COVID-19 virus Delta variant: P3 Laboratory of Guangzhou Customs Technology Center (Laboratory of Highly Pathogenic Microorganisms of the State Key Laboratory of Respiratory Diseases).
1.2 Experimental Method
[0096] The test was conducted in the BSL-3 Laboratory. A cell control group, a blank control (solvent control) group, a virus control (negative control) group, and tested drug groups of different concentrations were set. A VeroE6 cell suspension with a cell density of 210.sup.5 cells/mL was plated in a sterile 96-well culture plate respectively (100 L/well), and cultured at 37 C., 5% CO.sub.2 for 24 h; a culture supernatant was discarded, and a 100 TCID50 virus solution was added to an experimental group and a virus control group (100 L/well), and then subjected to routine culture adsorption for 2 h; and a culture supernatant was discarded, 100 L of drugs of different concentrations (250, 125, 62.5, 31.25, 15.62 g/mL) were added to per well (100 L/well, 3 replicates per concentration), and incubated for 3-4 days in routine culture. Cytopathogenic effect (CPE) was observed under a light microscope, and the degrees of cell lesions were recorded according to the following 6-level criteria: means that the cells are free of lesions; + means that the degree of cell lesions was less than 10%; + means that the degree of cell lesions was about 25%; ++ means that the degree of cell lesions was about 50%; +++ means that the degree of cell lesions was about 75%; and ++++ means that the degree of cell lesions was more than 75%. Amedian inhibitory concentration (IC50) and a selection index (SI) were calculated.
1.3 Experimental Results
[0097] The results of Table 2-1 showed that the tested drugs had obvious inhibitory effects on both COVID-19 and variants thereof.
TABLE-US-00002 TABLE 2-1 Results of in-vitro efficacy experiments of bisepoxylignan compounds and compositions against COVID-19 and variants thereof COVID-19 COVID-19 COVID-19 Serial Composition virus Beta virus Delta virus No. Test drugs proportion IC.sub.50 SI IC.sub.50 SI IC.sub.50 SI 1 Lianqiaoxinside. 62.1 31.61 337.4 7.64 238.8 7.14 2 Phillyrin 63.3 30.50 334.6 7.10 286.9 6.86 3 Phillygenin 166.5 5.33 84.5 2.12 240.1 2.11 4 Phillygenin sulfate 202.2 5.86 394.6 2.37 458.3 1.63 5 Phillygenin glucuronate 164.5 2.95 274.6 2.96 336.3 1.16 6 Phillygenin ibuprofenate. 161.8 4.72 276.8 3.43 339.0 1.79 7 Lianqiaoxinside and 99.9:0.1 61.8 32.58 338.2 7.59 238.2 7.84 phillyrin 8 Lianqiaoxinside and 0.1:99.9 62.9 32.47 335.0 7.99 286.2 6.79 phillyrin 9 Lianqiaoxinside and 99.9:0.1 62.0 31.58 338.1 7.09 238.3 7.09 phillygenin 10 Lianqiaoxinside and 0.1:99.9 166.3 5.96 85.1 2.10 240.3 2.10 phillygenin 11 Lianqiaoxinside and 99.9:0.1 62.5 31.66 337.8 7.93 238.9 7.54 phillygenin sulfate 12 Lianqiaoxinside and 0.1:99.9 201.8 5.35 394.9 2.94 458.9 1.60 phillygenin sulfate 13 Lianqiaoxinside and 99.9:0.1 66.4 31.54 89.1 7.58 243.0 7.81 phillygenin glucuronate 14 Lianqiaoxinside and 0.1:99.9 164.3 2.75 275.0 2.90 336.1 1.10 phillygenin glucuronate 15 Lianqiaoxinside and 99.9:0.1 62.5 32.64 337.7 7.67 238.6 8.01 phillygenin ibuprofenate 16 Lianqiaoxinside and 0.1:99.9 162.3 4.92 277.0 3.40 338.8 1.93 phillygenin ibuprofenate 17 Phillyrin and 99.9:0.1 63.2 30.22 334.2 6.89 286.3 6.19 phillygenin sulfate 18 Phillyrin and 0.1:99.9 202.6 5.97 394.5 2.30 458.8 1.71 phillygenin sulfate 19 Phillyrin and 99.9:0.1 62.8 30.73 334.3 7.09 286.6 6.73 phillygenin glucuronate 20 Phillyrin and 0.1:99.9 163.9 2.87 274.3 2.97 336.6 1.20 phillygenin glucuronate 21 Phillyrin and 99.9:0.1 63.6 30.42 334.5 7.88 286.7 6.58 phillygenin ibuprofenate 22 Phillyrin and 0.1:99.9 162.3 4.82 276.6 3.57 338.6 1.64 phillygenin ibuprofenate 23 Phillygenin and 99.9:0.1 165.8 5.32 84.3 2.13 240.6 2.10 phillygenin sulfate 24 Phillygenin and 0.1:99.9 202.6 5.92 395.0 2.88 458.7 1.60 phillygenin sulfate 25 Phillygenin and 99.9:0.1 165.8 5.37 85.2 2.42 240.4 2.74 phillygenin glucuronate 26 Phillygenin and 0.1:99.9 164.4 3.03 274.9 2.90 336.2 1.10 phillygenin glucuronate 27 Phillygenin and 99.9:0.1 165.7 6.05 84.6 2.54 240.7 2.56 phillygenin ibuprofenate 28 Phillygenin and 0.1:99.9 161.8 5.14 276.7 3.40 338.6 1.92 phillygenin ibuprofenate 29 Phillygenin sulfate and 99.9:0.1 202.0 6.01 395.0 2.64 458.5 1.53 phillygenin ibuprofenate 30 Phillygenin sulfate and 0.1:99.9 162.1 4.95 277.0 3.53 338.4 1.70 phillygenin ibuprofenate 31 Phillygenin sulfate and 99.9:0.1 202.6 5.85 395.1 2.31 458.6 1.62 phillygenin glucuronate 32 Phillygenin sulfate and 0.1:99.9 164.4 3.41 274.4 2.85 336.6 1.54 phillygenin glucuronate 33 Phillygenin glucuronate 99.9:0.1 164.6 2.95 274.7 2.90 336.8 1.13 and phillygenin ibuprofenate 34 Phillygenin glucuronate 0.1:99.9 161.9 5.53 276.2 3.66 338.9 1.58 and phillygenin ibuprofenate 35 Phillyrin/lianqiaoxinside/ 99.8:0.1:0.1 63.0 34.23 335.0 7.47 286.4 7.01 phillygenin 36 Lianqiaoxinside/phillyrin/ 99.8:0.1:0.1 62.6 35.42 337.1 7.69 238.7 6.97 phillygenin 37 Phillygenin/lianqiaoxinside/ 99.8:0.1:0.1 165.8 5.93 84.9 2.53 240.2 2.64 phillyrin 38 Phillyrin/lianqiaoxinside/ 99.8:0.1:0.1 62.9 32.57 334.5 7.87 286.4 7.15 phillygenin sulfate 39 Lianqiaoxinside/phillyrin/ 99.8:0.1:0.1 62.4 36.53 337.5 7.92 238.9 7.16 phillygenin ibuprofenate 40 Phillygenin/lianqiaoxinside/ 99.8:0.1:0.1 166.6 6.58 84.7 2.88 240.5 2.84 phillygenin glucuronate
Example 3 Efficacy Test Results of Drugs of the Present Invention Against Influenza Viruses and Parainfluenza Viruses In Vitro
1 In-Vitro Antiviral Test
1.1 Test Materials
(1) Drugs
[0098] Bisepoxylignan compounds include: lianqiaoxinside (having a purity of 99.95%), phillyrin (having a purity of 99.96%), phillygenin (having a purity of 99.96%), phillygenin sulfate (having a purity of 99.95%), phillygenin glucuronate (having a purity of 99.95%), or phillygenin ibuprofenate (having a purity of 99.95%).
[0099] Bisepoxylignan compositions include: lianqiaoxinside/phillyrin, lianqiaoxinside/phillygenin, lianqiaoxinside/phillygenin sulfate, lianqiaoxinside/phillygenin glucuronate, lianqiaoxinside/phillygenin ibuprofenate, phillyrin/phillygenin sulfate, phillyrin/phillygenin glucuronate, phillyrin/phillygenin ibuprofenate, phillygenin/phillygenin sulfate, phillygenin/phillygenin glucuronate, phillygenin/phillygenin ibuprofenate, phillygenin sulfate/phillygenin glucuronate, phillygenin sulfate/phillygenin ibuprofenate, phillygenin glucuronate/phillygenin ibuprofenate, phillyrin/lianqiaoxinside/phillygenin sulfate, lianqiaoxinside/phillyrin/phillygenin ibuprofenate, and phillygenin/lianqiaoxinside/phillygenin glucuronate.
[0100] The above test drugs were provided by Dalian Fusheng Natural Medicine Development Co., Ltd. Oseltamivir phosphate: China Institute for the Control of Pharmaceutical and Biological Products. Product batch number: 101096-201901, 100 mg/piece as a positive control drug in this test.
[0101] The above drugs were dissolved in purified water, filtered, sterilized and aliquoted, and set aside at 4 C., which were the drugs to be tested in this test.
[0102] (2) Cell line: Vero (African green monkey kidney cells): School of Basic Medical Sciences, Jilin University.
[0103] (3) Virus strain: (1) influenza virus strains, parainfluenza virus strains: Institute of Virology, Chinese Academy of Preventive Medicine.
[0104] (4) Main equipment and reagents:
[0105] Biological Safety Cabinet: BHC-1300II.A/B3, AIRTECH; CO2 Incubator: MCO-18AIC, SANYO; Inverted Microscope: CKX41, OLYMPUS; Electronic Analytical Balance: AR1140/C, DHAUS; Medium: DMEM, HyClone; Fetal Bovine Serum: HyClone; Trypsin: Gibco; MTT: Sigma; DMSO: Tianjin Beilian Fine Chemicals Development Co., Ltd.
1.2 Test Method
(1) Cell Preparation
[0106] Vero cells were subcultured for 1-2 d to make them into flakes, and trypsinized in the presence of clear boundaries, strong three-dimensional sense and strong refractive power, until needle-like holes appeared on the cell surfaces; after the trypsinization solution was absorbed completely, a few milliliters of culture medium were taken to blow away the cells; the cells were counted, diluted to about 510.sup.7/L with a culture medium (DMEM containing 10% fetal bovine serum), and then inoculated in a 96-well culture plate; and the cells grew into a monolayer.
(2) Drug Toxicity Assay
[0107] Cytotoxicity test: the drugs were diluted at the concentrations shown in Table 3-1 for cytotoxicity assay.
TABLE-US-00003 TABLE 3-1 Drug dilution reference table (unit:g/L) Concentration gradients Drugs Gradient 1 Gradient 2 Gradient 3 Gradient 4 Gradient 6 Gradient 7 Gradient 8 Test drugs 1 0.5 0.25 0.125 0.03125 0.015625 0.078125 Oseltamivir 2 1 0.5 0.25 0.0625 0.03125 0.015625 phosphate Note: the test drugs were a bisepoxylignan compound and a bisepoxylignan composition. The above drugs of different concentrations diluted with a maintenance solution (DMEM containing 2% fetal bovine serum) were added dropwise to Vero monolayer cells (0.2 ml/well, 6 replicate wells per concentration), and a 6-well normal control (a normal control group free of drug) and a 6-well blank control (a culture medium) were additionally provided and cultured in a 37 C., 5% CO2 incubator, and CPE was observed and recorded under an inverted microscope every day. After 72 h, 20 L of MTT solution (5 mg .Math. mL1) was added to each well and continued to incubate for 4 h; the culture medium of each well was pipetted and discarded; 100 L of DMSO was added to each well and shaken for 5 min; and an OD value was measured at 492 nm and the cell viability was calculated. In SPSS 18.0 statistical software, the cell viability was subjected to Probit regression analysis, and a maximum non-toxic concentration (TC0) and a median toxic concentration (TC50) of the drug to the Vero cells were calculated.
(3) Determination of Influenza Virus TCID50
[0108] The virus was diluted in 10-fold decrease to different dilutions of 10-1, 10-2, 10-3, 10-4, 10-5, and 10-6, and sequentially inoculated on a monolayer Vero cell 96-well culture plate (100 L/well and 6 wells per dilution), and a normal cell control group was set at the same time. The virus was incubated at 37 C., 5% CO2 for 2 h, a virus solution was discarded, and 100 L of cell maintenance solution was added per well, and cultured at 37 C. in 5% CO2. Cytopathic results were observed under the microscope at the beginning of Day 3, and results were determined and recorded on Days 7-8; and the virus titer was calculated using a Karber method by taking the maximum dilution that could cause positive lesions in 50% of cell wells as an endpoint.
[0109] Formula
(TCID.sub.50: 50% histiocyte infection dose; XM: logarithm of the maximum concentration dilution of the virus; d: logarithm of dilution factor (fold); pi: a sum of the percentages of lesions per dilution).
(4) Effect of Drug on the Cytopathogenic Effects of Virus
[0110] The culture plate that has been overgrown with monolayer cells was taken, and a culture solution was pipetted and discarded; the cells were inoculated at a virus attack amount corresponding to 100TCID50, adsorbed in a 37 C., 5% CO2 incubator for 2 h, added with a specific concentration (approximately the maximum non-toxic concentration) of each drug solution, and cultured in 6 duplicate wells per concentration (200 L/well). Oseltamivir phosphate was provided as a positive drug control group, and meanwhile a normal control group (free of virus and drug) and a virus control group (a control group with virus but no drug) were provided; and the effect of the drug on virus-induced CPE was observed. After 72 h, an OD value was measured at a wavelength of 492 nm by a MTT colorimetric method, and the antiviral effective rate (ER %) of the drug was calculated. In SPSS 18.0 statistical software, an ANOVA method was used to compare the significant differences in antiviral effective rates of various drugs.
ER %=(mean OD value of drug treatment groupmean OD value of virus control group)/(mean OD value of cell control groupmean OD value of virus control group)100%
1.3. Test Results
[0111] (1) TCID.sub.50
(2) Drug Toxicity Determination
1) Determination of the Cytotoxicity of Drugs
[0112] A maximum non-toxic concentration (TC.sub.0), a median toxic concentration (TC.sub.50) and a concentration of each drug in antiviral experiments to Vero cells were shown in the following table.
TABLE-US-00004 TABLE 3-2 Results of drug cytotoxicity experiment (unit: g/L) Maximum Serial Composition non-toxic Median toxic Experimental No. Test drugs Proportion concentration concentration concentration Oseltamivir phosphate 0.29 0.831 0.30 1 Lianqiaoxinside. 0.0067 0.56 0.01 2 Phillyrin 0.0067 0.56 0.01 3 Phillygenin 0.012 0.31 0.02 4 Phillygenin sulfate 0.012 0.31 0.01 5 Phillygenin glucuronate 0.012 0.31 0.01 6 Phillygenin ibuprofenate. 0.012 0.31 0.01 7 Lianqiaoxinside and 99.9:0.1 0.0067 0.56 0.01 phillyrin 8 Lianqiaoxinside and 0.1:99.9 0.0067 0.56 0.01 phillyrin 9 Lianqiaoxinside and 99.9:0.1 0.0067 0.56 0.01 phillygenin 10 Lianqiaoxinside and 0.1:99.9 0.012 0.31 0.02 phillygenin 11 Lianqiaoxinside and 99.9:0.1 0.0067 0.56 0.01 phillygenin sulfate 12 Lianqiaoxinside and 0.1:99.9 0.012 0.31 0.01 phillygenin sulfate 13 Lianqiaoxinside and 99.9:0.1 0.0067 0.56 0.01 phillygenin glucuronate 14 Lianqiaoxinside and 0.1:99.9 0.012 0.31 0.01 phillygenin glucuronate 15 Lianqiaoxinside and 99.9:0.1 0.0067 0.56 0.01 phillygenin ibuprofenate 16 Lianqiaoxinside and 0.1:99.9 0.012 0.31 0.01 phillygenin ibuprofenate 17 Phillyrin and 99.9:0.1 0.0067 0.56 0.01 phillygenin sulfate 18 Phillyrin and 0.1:99.9 0.012 0.31 0.01 phillygenin sulfate 19 Phillyrin and 99.9:0.1 0.0067 0.56 0.01 phillygenin glucuronate 20 Phillyrin and 0.1:99.9 0.012 0.31 0.01 phillygenin glucuronate 21 Phillyrin and 99.9:0.1 0.0067 0.56 0.01 phillygenin ibuprofenate 22 Phillyrin and 0.1:99.9 0.012 0.31 0.01 phillygenin ibuprofenate 23 Phillygenin and 99.9:0.1 0.012 0.31 0.02 phillygenin sulfate 24 Phillygenin and 0.1:99.9 0.012 0.31 0.01 phillygenin sulfate 25 Phillygenin and 99.9:0.1 0.012 0.31 0.02 phillygenin glucuronate 26 Phillygenin and 0.1:99.9 0.012 0.31 0.01 phillygenin glucuronate 27 Phillygenin and 99.9:0.1 0.012 0.31 0.02 phillygenin ibuprofenate 28 Phillygenin and 0.1:99.9 0.012 0.31 0.01 phillygenin ibuprofenate 29 Phillygenin sulfate and 99.9:0.1 0.012 0.31 0.01 phillygenin ibuprofenate 30 Phillygenin sulfate and 0.1:99.9 0.012 0.31 0.01 phillygenin ibuprofenate 31 Phillygenin sulfate and 99.9:0.1 0.012 0.31 0.01 phillygenin glucuronate 32 Phillygenin sulfate and 0.1:99.9 0.012 0.31 0.01 phillygenin glucuronate 33 Phillygenin glucuronate 99.9:0.1 0.012 0.31 0.01 and phillygenin ibuprofenate 34 Phillygenin glucuronate 0.1:99.9 0.012 0.31 0.01 and phillygenin ibuprofenate 35 Phillyrin/lianqiaoxinside/ 99.8:0.1:0.1 0.0067 0.56 0.01 phillygenin 36 Lianqiaoxinside/phillyrin/ 99.8:0.1:0.1 0.0067 0.56 0.01 phillygenin 37 Phillygenin/lianqiaoxinside/ 99.8:0.1:0.1 0.012 0.31 0.02 phillyrin 38 Phillyrin/lianqiaoxinside/ 99.8:0.1:0.1 0.0067 0.56 0.01 phillygenin sulfate 39 Lianqiaoxinside/phillyrin/ 99.8:0.1:0.1 0.0067 0.56 0.01 phillygenin ibuprofenate 40 Phillygenin/lianqiaoxinside/ 99.8:0.1:0.1 0.012 0.31 0.02 phillygenin glucuronate
2) The Results of Protective Effects of Drugs on Virus-Induced Cytopathy
[0113] The bisepoxylignan compound and composition both had obvious inhibitory effects on influenza virus and parainfluenza virus, and had a higher effective rate than Oseltamivir phosphate. Specific data was shown in the following table.
TABLE-US-00005 TABLE 3-3 Efficacy results of drugs against influenza and parainfluenza viruses (effective rate, ER %) Composition Influenza Parainfluenza Serial No. Test drugs Proportion Virus Virus Oseltamivir phosphate 81.92 91.16 1 Lianqiaoxinside. 89.02 99.92 2 Phillyrin 85.94 94.43 3 Phillygenin 83.10 91.41 4 Phillygenin sulfate 92.38 99.92 5 Phillygenin glucuronate 84.47 93.52 6 Phillygenin ibuprofenate. 84.51 93.96 7 Lianqiaoxinside and phillyrin 99.9:0.1 88.77 97.35 8 Lianqiaoxinside and phillyrin 0.1:99.9 85.87 94.26 9 Lianqiaoxinside and phillygenin 99.9:0.1 88.51 97.86 10 Lianqiaoxinside and phillygenin 0.1:99.9 82.14 89.45 11 Lianqiaoxinside and phillygenin sulfate 99.9:0.1 88.42 98.66 12 Lianqiaoxinside and phillygenin sulfate 0.1:99.9 92.36 99.90 13 Lianqiaoxinside and phillygenin glucuronate 99.9:0.1 88.42 96.66 14 Lianqiaoxinside and phillygenin glucuronate 0.1:99.9 84.11 91.82 15 Lianqiaoxinside and phillygenin ibuprofenate 99.9:0.1 89.06 97.97 16 Lianqiaoxinside and phillygenin ibuprofenate 0.1:99.9 83.98 91.78 17 Phillyrin and phillygenin sulfate 99.9:0.1 85.56 93.62 18 Phillyrin and phillygenin sulfate 0.1:99.9 92.66 100.53 19 Phillyrin and phillygenin glucuronate 99.9:0.1 85.35 93.19 20 Phillyrin and phillygenin glucuronate 0.1:99.9 84.59 93.75 21 Phillyrin and phillygenin ibuprofenate 99.9:0.1 85.70 94.87 22 Phillyrin and phillygenin ibuprofenate 0.1:99.9 83.84 91.52 23 Phillygenin and phillygenin sulfate 99.9:0.1 82.40 90.94 24 Phillygenin and phillygenin sulfate 0.1:99.9 93.03 100.33 25 Phillygenin and phillygenin glucuronate 99.9:0.1 82.32 90.85 26 Phillygenin and phillygenin glucuronate 0.1:99.9 84.12 91.83 27 Phillygenin and phillygenin ibuprofenate 99.9:0.1 82.36 90.90 28 Phillygenin and phillygenin ibuprofenate 0.1:99.9 84.51 92.96 29 Phillygenin sulfate and phillygenin ibuprofenate 99.9:0.1 92.93 100.12 30 Phillygenin sulfate and phillygenin ibuprofenate 0.1:99.9 84.09 92.00 31 Phillygenin sulfate and phillygenin glucuronate 99.9:0.1 92.72 100.69 32 Phillygenin sulfate and phillygenin glucuronate 0.1:99.9 84.69 92.96 33 Phillygenin glucuronate and phillygenin ibuprofenate 99.9:0.1 83.91 91.40 34 Phillygenin glucuronate and phillygenin ibuprofenate 0.1:99.9 84.03 92.93 35 Phillyrin/lianqiaoxinside/phillygenin 99.8:0.1:0.1 85.15 92.77 36 Lianqiaoxinside/phillyrin/phillygenin 99.8:0.1:0.1 88.32 96.45 37 Phillygenin/lianqiaoxinside/phillyrin 99.8:0.1:0.1 82.38 90.92 38 Phillyrin/lianqiaoxinside/phillygenin sulfate 99.8:0.1:0.1 85.68 93.85 39 Lianqiaoxinside/phillyrin/phillygenin ibuprofenate 99.8:0.1:0.1 89.05 97.96 40 Phillygenin/lianqiaoxinside/phillygenin glucuronate 99.8:0.1:0.1 82.87 91.96
2 In-Vivo Antiviral Test
2.1 Experimental Materials
(1) Experimental Animals
[0114] Kunming mice were provided by the Laboratory Animal Center of Bethune Medical Center, Jilin University.
(2) Detection Instruments and Reagents
TABLE-US-00006 Instrument name Model Manufacturer Quantitative 7300 ABI PCR Instrument PCR Instrument ES-60J Shenyang Longteng Electronic Weighing Instrument Co., Ltd Electronic FA1004 Shenyang Longteng Electronic Analytical Weighing Instrument Co., Ltd Balance CO2 Incubator HG303-5 Nanjing Experimental Instrument Factory Superclean bench SW-CJ-IF Suzhou Antai AIRTECH Co., Ltd Inverted Microscope CKX41 Olympus Instrument 80 C. Ultra-low TECON-5082 Australia Temperature Freezer Water Bath Shaker HZS-H Harbin Donglian Electronic Technology Development Co., Ltd Microplate Reader TECAN Australia A-5082 Spectrophotometer 7550 type Japan
2.2 Experimental Method
(1) Determination of Median Lethal Doses of Influenza Virus and Parainfluenza Virus in Mice
[0115] Influenza virus and parainfluenza virus (cell lysate) were diluted in 10-fold into virus solutions having concentrations of 10.sup.1, 10.sup.2, 10.sup.3, 10.sup.4 and 10.sup.5. A total of 120 Kunming mice, including 60 mice in a influenza virus group and 60 mice in a parainfluenza virus group, were randomly divided into 6 groups, which were mildly anesthetized with ether, and infected with different dilutions of virus solutions at 0.03 mL/mouse by nasal dripping. Meanwhile, a blank control was provided, and normal saline was used instead of the virus suspension. Death and survival were regarded as observation indexes daily until 14 days after infection. Death within 24 h of infection was non-specific death which was not counted, and the LD50 of the virus solution was calculated by a Karber method. Calculation formula:
[LD.sub.50: median lethal dose; XM: logarithm of the highest concentration dilution of the virus; d: logarithm of dilution factor (fold); pi: a sum of the percentages of lesions per dilution].
(2) Study of Phillyrin/Phillygenin Composition Against Pneumonia Caused by Infections with Influenza Virus and Parainfluenza Virus
1) Test Animals and Groups
[0116] Four-week-old Kunming mice were randomly divided into groups (10 mice in each group) and used for a determination test for lung indexes and lung index inhibition rates of a bisepoxylignan compound and composition on mice infected with influenza and parainfluenza viruses.
[0117] Further mice were randomly divided into groups (10 mice in each group) and used for a determination test for hemagglutination titers of the bisepoxylignan compound and composition against lung suspension virus.
2) Infection Method
[0118] A lump of absorbent cotton was put into a beaker of 200-300 mL, and then poured with an appropriate amount of ether (till the absorbent cotton was wetted). The beaker filled with the absorbent cotton was inverted, and added with the mice for anesthesia. When the mice were extremely excited and then obviously weak, the mice were placed on their backs, and then infected with 15LD.sub.50 influenza virus and parainfluenza virus by nasal dripping at 0.03 mL/nostril. A normal control group was administrated with normal saline, instead of a virus suspension.
(3) Administration Method and Administration Dose
[0119] A bisepoxylignan compound and composition drug group and an Oseltamivir phosphate control group were administrated by routine gavage on one day before infection, respectively; the bisepoxylignan compound and composition drug group was divided into a high-dose group and a low-dose group; the administration doses of the high-dose group and the low-dose group were 13.0 mg/kg and 3.25 mg/kg, respectively, and an administration dose of the Oseltamivir phosphate was 19.5 mg/kg, once a day, for 5 consecutive days; and the normal control group and the virus control group were perfused with the same volume of normal saline.
4) Observation Indexes
(1) Lung Index Determination
[0120] On Day 5 after the administration of each mouse, the mouse was fasted with solids and liquids for 8 h, weighed and then sacrificed by bleeding from the eyeballs; the chest cavity was opened to remove the whole lung which was then washed twice with normal saline; the moisture on the surface was removed by absorption with filter paper; the lung was weighed with an electronic balance; and the lung index and the lung index inhibition rate was calculated according to the following formula:
(2) Determination of Hemagglutination Titer of Lung Suspension Virus
[0121] The lungs of the mouse in each group on Day 5 after treatment were taken, and ground with a homogenizer at low temperature into a homogenate; the homogenate was diluted with normal saline into a 10% lung tissue suspension; a supernatant was taken by centrifugation, diluted by multiple ratios, and dropped on a titration plate according to 0.2 ml/well; 1% chicken red blood cell suspension was added to each well (0.2 ml/well), mixed well, and placed at room temperature for 30 min; and the hemagglutination titer was observed and recorded. The aggregation of red blood cells (++) was taken as an endpoint, and the titer was expressed by a dilution factor of the suspension.
2.3 Test Results and Analysis
(1) Determination Results of Median Lethal Doses of Influenza Virus and Parainfluenza Virus in Mice
[0122] The Kunming mice in a test group were respectively infected with 30 L of influenza virus and parainfluenza virus solutions of different concentrations by nasal dripping, and the mice in three groups (a 10.sup.1 virus concentrations group, a 10.sup.2 virus concentration group, and a 10.sup.3 concentration group) before Day 3 of infection all showed different degrees of symptoms: hair standing, trembling, reduced diet, etc.; on Day 5, the mice showed swaying walking; the mice in a group with a maximum concentration began to die on Day 6; and the rest of the groups died on Day 7 after infection. After 14 days of observation, the number of mice in each group was counted, and the results were shown in the following table. LD.sub.50 of this influenza virus was calculated as a dilution of 10.sup.2.9 and that of the parainfluenza virus as 10.sup.2.5.
TABLE-US-00007 TABLE 3-4 Statistics of median lethal dose test results of influenza virus Influenza Cumulative Cumulative Cumulative virus group death survival mortality 10.sup.1 group 9 1 90% 10.sup.2 group 7 3 70% 10.sup.3 group 4 6 40% 10.sup.4 group 3 7 30% 10.sup.5 group 1 9 10% Blank group 0 10 0%
[0123] A Karber method was used to calculate LD.sub.50 of the virus. LogLD.sub.50 of the influenza virus was as follows:
TABLE-US-00008 TABLE 3-5 Statistics of median lethal dose test results of Parainfluenza virus Parainfluenza Cumulative Cumulative Cumulative virus group death survival mortality 10.sup.1 group 8 2 80% 10.sup.2 group 6 4 60% 10.sup.3 group 4 6 40% 10.sup.4 group 2 8 20% 10.sup.5 group 0 10 0% Blank group 0 10 0%
[0124] A Karber method was used to calculate LD.sub.50 of the virus. LogLD.sub.50 of parainfluenza virus was as follows:
(2) Effect Results of Phillyrin/Phillygenin Composition Against Pneumonia Caused by Infections with Influenza Virus and Parainfluenza Virus
(1) Lung Index Determination
[0125] After the mice were infected with influenza virus and parainfluenza virus, and the mean lung index results showed that compared with an infection model group, the lung index of each of a normal control group, a bisepoxylignan compound and composition drug group and an Oseltamivir phosphate group was significantly reduced (P<0.05 or P<0.01). The high-dose drug group had a lung index lower than that of Oseltamivir phosphate, a lung index inhibition rate higher than that of Oseltamivir phosphate, and efficacy better than that of Oseltamivir phosphate (P<0.01 or P<0.05), and the results were shown in the following table.
TABLE-US-00009 TABLE 3-6 Lung index inhibition rate of bisepoxylignan compound and composition drug group against mice infected with influenza virus Lung index Lung index inhibition Test group Division (
TABLE-US-00010 TABLE 3-7 Lung index inhibition rates of phillyrin/phillygenin composition against mice infected with parainfluenza virus Lung index Lung index inhibition Test group Division (
(2) Determination of Hemagglutination Titer of Lung Suspension Virus
[0126] After the mice were infected with influenza virus and parainfluenza virus, the hemagglutination titers (InX) of lung tissue virus in the infection model group were 35.47 and 34.62, respectively; and the hemagglutination titer of lung tissue virus decreased after 5 days of treatment in the bisepoxylignan compound and composition drug group, and the inhibition rate was significant. Compared with the infection model group, the high- and low-dose groups of the drug group each had the hemagglutination titer lower than that of the Oseltamivir phosphate group, and the inhibition rate significantly higher than that of Oseltamivir phosphate. The test results were shown in the following table.
TABLE-US-00011 TABLE 3-8 Effect of bisepoxylignan compound and composition on hemagglutination titer in lung suspension of mice infected with influenza virus Hemagglutination Hemagglutination titer inhibition Test group Division titer rate (%) P-value Normal control group 0 Virus control group 0 35.47 0.183 Oseltamivir phosphate group 19.5 22.07 0.235 37.78 ** Lianqiaoxinside. High dose 20.08 0.381 43.39 ** Low dose 21.84 0.511 38.43 * Phillyrin High dose 20.11 0.351 43.30 * Low dose 21.88 0.639 38.31 * Phillygenin High dose 20.50 0.489 42.20 * Low dose 22.07 0.455 37.78 * Lianqiaoxinside and phillyrin 99.9:0.1 High dose 20.13 0.307 43.25 * Low dose 21.81 0.471 38.51 ** Phillyrin and lianqiaoxinside 99.9:0.1 High dose 20.07 0.808 43.42 ** Low dose 21.80 0.340 38.54 * Phillygenin and lianqiaoxinside 99.9:0.1 High dose 20.51 0.664 42.18 ** Low dose 22.05 0.327 37.83 * Phillyrin/lianqiaoxinside/ High dose 20.07 0.518 43.42 ** phillygenin sulfate 99.8:0.1:0.1 Low dose 21.84 0.713 38.43 ** Lianqiaoxinside/phillyrin/ High dose 20.12 0.528 43.28 * phillygenin ibuprofenate 99.8:0.1:0.1 Low dose 21.84 0.896 38.43 ** Phillygenin/lianqiaoxinside/ High dose 20.54 0.834 42.09 ** phillygenin glucuronate 99.8:0.1:0.1 Low dose 22.02 0.058 37.92 ** *P < 0.05, **P < 0.01.
TABLE-US-00012 TABLE 3-9 Effect of phillyrin/phillygenin composition on hemagglutination titer in lung suspension of of mice infected with parainfluenza virus Hemagglutination Hemagglutination titer inhibition Test group Division titer rate (%) P-value Normal control group 0 Virus control group 0 34.62 0.092 Oseltamivir phosphate group 19.5 23.22 0.648 32.93 * Lianqiaoxinside. High dose 21.65 0.238 37.46 ** Low dose 23.25 0.847 32.84 * Phillyrin High dose 21.63 0.330 37.52 * Low dose 23.26 0.219 32.81 ** Phillygenin High dose 22.06 0.310 36.28 ** Low dose 23.47 0.893 32.21 ** Lianqiaoxinside and phillyrin 99.9:0.1 High dose 21.66 0.645 37.44 ** Low dose 23.22 0.512 32.93 ** Phillyrin and lianqiaoxinside 99.9:0.1 High dose 21.64 0.843 37.49 ** Low dose 23.26 0.187 32.81 ** Phillygenin and lianqiaoxinside 99.9:0.1 High dose 22.01 0.747 36.42 ** Low dose 23.40 0.853 32.41 * Phillyrin/lianqiaoxinside/ High dose 21.67 0.881 37.41 ** phillygenin sulfate 99.8:0.1:0.1 Low dose 23.28 0.210 32.76 * Lianqiaoxinside/phillyrin/phillygenin High dose 21.67 0.771 37.41 ** ibuprofenate 99.8:0.1:0.1 Low dose 23.22 0.477 32.93 ** Phillygenin/lianqiaoxinside/phillygenin High dose 22.03 0.302 36.37 * glucuronate 99.8:0.1:0.1 Low dose 23.45 0.364 32.26 * *P < 0.05, **P < 0.01.
Example 4 Study on In-Vivo Efficacy of Drug of the Present Invention for Treatment of COVID-19 Delta Virus
[0127] 1.1: Mice: hACE2 mice, aged 6-7 weeks and weighing 20-40 g, laboratory animal supplier: Jiangsu Gempharmatech Co., Ltd., laboratory animal production license: SCXK (Su) 2018-0008, and feed supplier: Jiangsu Medicience Biopharmaceutical Co., Ltd.
[0128] 1.2 Virus: COVID-19 Delta virus (BSL-3 Laboratory, Guangzhou Customs Technology Center (Laboratory of Highly Pathogenic Microorganisms, State Key Laboratory of Respiratory Diseases).
(1.3) Drugs
[0129] Bisepoxylignan compounds: lianqiaoxinside (a purity of 99.95%), phillyrin (content of 99.96%), and phillygenin (a purity of 99.96%); a bisepoxylignan composition: lianqiaoxinside/phillyrin, phillyrin/lianqiaoxinside, phillygenin/liangiaoxinside, phillyrin/lianqiaoxinside/phillygenin sulfate, lianqiaoxinside/phillyrin/phillygenin ibuprofenate, and phillygenin/lianqiaoxinside/phillygenin glucuronate. The above test drugs were provided by Dalian Fusheng Natural Medicine Development Co., Ltd. The above drugs were provided by Dalian Fusheng Natural Medicine Development Co., Ltd.
[0130] Remdesivir: a specification of 1 g. Preparation method: during an in-vitro test, DMSO was prepared into mother liquor which was aliquoted, stored at 4 C. for later use and diluted to a required concentration with a cell working solution before use. During an in-vivo test, 0.5% sodium carboxymethyl cellulose was prepared into a required concentration.
1.4 Experimental Method
[0131] 1.4.1 hACE2 transgenic C57BL/6 mice were divided into a normal group, a COVID-19 Delta virus infection group, drug groups (a 40 mg/kg low-dose group, and a 80 mg/kg high-dose group), and a positive control group (Remdesivir, 50 mg/kg), with eight mice in each group. Except for the mice in the normal group who were administrated with PBS by nasal dripping, the mice in the other groups were infected with COVID-19 Delta virus in 10 PFU by nasal dripping. 2 h after infection, the mice in each drug group were administrated with the drug by gavage for 5 consecutive days, once a day. Dying or dead animals were dissected and lungs were picked after euthanasia; and surviving animals were dissected on the Day 5 after infection, and lungs were picked.
[0132] 1.4.2 In the infection group, four animals in each group were dissected for lung tissues for pathological study. Four animals were dissected, and lung tissues were picked. Total RNA was extracted from a homogenate supernatant of the lung tissues by a Trizol method, and inflammatory factor interleukin 1P (IL-1$) and monocyte chemoattractant protein 1 (MCP-1) were detected by RT-qPCR.
[0133] 1.4.3 The specific operation steps of histopathological study of lung tissues were as follows:
[0134] (1) fixation and embedding: fixation (fixed with 4% paraformaldehyde).fwdarw.washing and trimming, trimming tissue to obtain a flat section.fwdarw.dehydration with 50%, 70%, 80%, 95% and 100% ethanol solutions.fwdarw.immersion in xylene I and xylene II respectively for transparentizing.fwdarw.immersion with 60 C. wax I and II respectively for wax penetration.fwdarw.paraffin embedding; and (2) slice staining: sectioning (a thickness of about 4 um).fwdarw.immersion of paraffin section in a clarifying agent I, a clarifying agent II, and a clarifying agent III for deparaffinization.fwdarw.soaking in 100%, 90%, 80%, 70% and other levels of alcohol solutions for 5 min each.fwdarw.washing with water.fwdarw.staining with hematoxylin for 3 min.fwdarw.washing with water.fwdarw.differentiating with 0.5% hydrochloric acid alcohol for a few seconds.fwdarw.washing with tap water for 15 min for bluing.fwdarw.staining with eosin for 2 min.fwdarw.immersion in 95% ethanol I, 95% ethanol II, 100% ethanol I, 100% ethanol II, a clarifying agent I, a clarifying agent II, and a clarifying agent III respectively for dehydration and transparentizing.fwdarw.sealing with neutral gum for storage.fwdarw.observing and photographing under a microscope. 1.4.4 The specific operation steps for the detection of inflammatory factors in mouse lung tissues by RT-qPCR were as follows:
(1) Extraction of RNA
[0135] 100 mg of mouse lung tissue was placed in a 1.5 mL EP tube, 1 mL of Trizol Reagent was added to the EP tube, the EP tube was inserted into ice, and a grinder was quickly shredded and placed for 5 min at room temperature. The EP tube was added with 200 L of chloroform, covered tightly, shaken vigorously for 1 min, and set aside at room temperature for 5 min. Centrifugation was performed at 4 C., 10000 rpm/min for 10 min; a suspension was divided into three layers, wherein the upper layer was an aqueous clear liquid; about 500 L of aqueous phase at the upper layer was pipetted carefully and transferred to a new 1.5 mL EP tube; the EP tube was added with an equal volume of isopropanol, shaken and mixed well, and set aside at room temperature for 10 min. Centrifugation was performed at 4 C., 10000 rpm/min for 10 min. After centrifugation, a milky white translucent gelatinous pellet, i.e., the total RNA, might be seen on a bottom side wall of the EP tube. A supernatant was poured off; 500 L of 75% ethanol was added to the pellet, cleaned by repeated inversion, and centrifuged at 4 C., 10,000 rpm/min for 10 min. A supernatant was poured off; 500 L of 75% ethanol was added, cleaned by repeated inversion, and centrifuged at 4 C., 10,000 rpm/min for 5 min. After drying, the ethanol was set aside for 5 min at room temperature, added with RNase-free ddH.sub.2O to dissolve the RNA, and reversely transcribed into cDNA. Q
(2) Reverse Transcription Reaction
[0136] The RNA was subjected to a genomic DNA removal reaction before reverse transcription, and the reaction system was shown in the following table:
TABLE-US-00013 TABLE 4-1 Reaction system table Reagent Dosage 5 gDNA Eraser Buffer 2.0 L gDNA Eraser 1.0 L Total RNA 1.0 L RNase Free dH.sub.2O up to 10 L
[0137] Reaction conditions: 42 C., 2 min; RNA from which genomic DNA was removed was stored at 4 C. Reverse transcription of mRNA into cDNA; and a reverse transcription reaction system was configured in the following table:
TABLE-US-00014 TABLE 4-2 Configured reaction system table Reagent Dosage The above was a genome-removed RNA 10.0 L reaction solution PrimeScript RT Enzyme Mix I 1.0 L RT Primer Mix 1.0 L 5 Prime Script Buffer 2 (for Real Time) 4.0 L RNase Free dH.sub.2O 4.0 L Total 20.0 L
[0138] Reverse transcription reaction condition were as follows: 37 C., 15 min; 85 C., 5 s; 4 C.
(3) Real-Time PCR Detection
[0139] The reaction system and reaction conditions were as follows:
TABLE-US-00015 TABLE 4-3 Real-time PCR detection reaction system Reagent Dosage Premix Ex Taq (2*) 10.0 L Upstream primer (20 M) 0.5 L Downstream primer (20 M) 0.5 L Rox Reference Dye II 0.2 L Template 1.0 L ddH.sub.2O 7.8 L
TABLE-US-00016 TABLE 4-4 PCR reaction conditions Number of cycles Steps Temperature Time 1 Pre-denaturatation 95 C. 5 min Denaturation 95 C. 10 s 40 Annealing 55 C. 30 s Extension 72 C. 20 s Solubility curve 95 C. 1 min 1 55 C. 30 s 95 C. 30 s
(4) Design and Synthesis of Primers
[0140] Primer design software Primer Premier 5.0 was used for primer design, and the primer sequence was as follows:
TABLE-US-00017 TABLE4-5 RT-qPCRprimersequencetable TargetGene Direction Sequence(5-3) IL-1 Forward TTGTGTTTGATCTAGAGACCCGCCA Reverse TGTGCTGATGCGAGTGCATGATT MCP-1 Forward ATCTCAGAAGTGAGGCAGCGTC Reverse CGGCAGGTACAGATGGTTGTCAA
(5) Data Statistical Processing
[0141] Statistical analysis was performed with SPSS23.0 software. which was exnressed as meanstandard deviation (
1.5. Test Results
[0142] The pathological results of the lungs of the mice showed that compared with the normal group, the lung tissues of the infection model group presented pathological changes such as pulmonary hemorrhage and interstitial pneumonia. The specific types and degrees of lesions of infected animals in various groups were as follows:
TABLE-US-00018 TABLE 4-6 Pathomorphological observation results of lungs of mice infected with COVID-19 Delta virus Pulmonary hemorrhage Interstitial pneumonia Test group Division Mild Moderate Severe Mild Moderate Severe Virus group 0 3 1 0 3 1 Positive drug group 2 2 0 2 2 0 Lianqiaoxinside. High dose 3 1 0 4 0 0 Low dose 2 2 0 2 2 0 Phillyrin High dose 3 1 0 3 1 0 Low dose 2 2 0 2 2 0 Phillygenin High dose 4 0 0 4 0 0 Low dose 2 2 0 2 2 0 Lianqiaoxinside and High dose 4 0 0 4 0 0 phillyrin 99.9:0.1 Low dose 2 2 0 2 2 0 Phillyrin and High dose 4 0 0 4 0 0 lianqiaoxinside 99.9:0.1 Low dose 2 2 0 2 2 0 Phillygenin and High dose 4 0 0 4 0 0 lianqiaoxinside 99.9:0.1 Low dose 2 2 0 2 2 0 Phillyrin/lianqiaoxinside/ High dose 3 1 0 3 1 0 phillygenin sulfate 99.8:0.1:0.1 Low dose 2 2 0 2 2 0 Lianqiaoxinside/phillyrin/ High dose 4 0 0 3 1 0 phillygenin ibuprofenate 99.8:0.1:0.1 Low dose 2 2 0 2 2 0 Phillygenin/lianqiaoxinside/ High dose 4 0 0 4 0 0 phillygenin glucuronate 99.8:0.1:0.1 Low dose 2 2 0 2 2 0
[0143] Based on the comparison of the above lesions in various groups, drugs (40 mg/kg and 80 mg/kg) had a significant improvement effect on lung lesions and pulmonary hemorrhage caused by COVID-19 Delta virus, and had pathological improvements of pulmonary hemorrhage and interstitial pneumonia remarkably superior to Remdesivir.
[0144] (2) The mRNA expression results of lung inflammatory factors showed that on the Day 5 of COVID-19 Delta virus infection for mice, the expressions of IL-1 and MCP-1 in a virus model group were significantly higher than that in the normal group; compared with the virus model group, IL-1 and MCP-1 inflammatory factors in the high- and low-dose groups (40 mg/kg and 80 mg/kg) were significantly reduced; and the ability to inhibit the overexpression of inflammatory mediators in an 80 mg/kg administration group was superior to that of Remdesivir.
TABLE-US-00019 TABLE 4-7 Expression levels of IL-1 and MCP-1 in lung homogenate of mouse infected with COVID-19 Delta virus (
Example 5 Study on In-Vivo Efficacy of Drug of the Present Invention for Treatment of Influenza Virus
[0145] 1.1 Mice: ICR mice, weighing 20-30 g, laboratory animal supplier: Hunan SJA Laboratory Animal Co., Ltd., laboratory animal production license: SCXK (Xiang) 2019-0004, and feed supplier: Jiangsu Medicience Biopharmaceutical Co., Ltd.
[0146] 1.2 Virus: influenza virus (BSL-3 Laboratory, Guangzhou Customs Technology Center (Laboratory of Highly Pathogenic Microorganisms, State Key Laboratory of Respiratory Diseases).
(1.3) Drugs
[0147] Bisepoxylignan compounds: lianqiaoxinside (a purity of 99.95%), phillyrin (content of 99.96%), and phillygenin (a purity of 99.96%); and bisepoxylignan compositions: lianqiaoxinside/phillyrin, phillyrin/lianqiaoxinside, phillygenin/liangiaoxinside, phillyrin/lianqiaoxinside/phillygenin sulfate, lianqiaoxinside/phillyrin/phillygenin ibuprofenate, and phillygenin/lianqiaoxinside/phillygenin glucuronate. The above test drugs were provided by Dalian Fusheng Natural Medicine Development Co., Ltd.
[0148] Oseltamivir phosphate: China Institute for the Control of Pharmaceutical and Biological Products. Product batch number: 101096-201901, 100 mg/piece as a positive control drug in this test.
1.4 Experimental Method
(1) Virus Inoculation
[0149] Influenza virus intranasal vaccination: a lump of absorbent cotton was put into a beaker of 200-300 mL, and then poured with an appropriate amount of ether (till the absorbent cotton was wetted). The beaker filled with the absorbent cotton was inverted, and added with the mice for anesthesia. When the mice were extremely excited and then obviously weak, that is, the anesthesia depth was moderate, the mice were taken out. The ether-anesthetized mice were placed on their backs, with the mouse head facing upward, and then were subjected to intranasal infection. A diluted influenza virus was added to nostrils at 0.03 mL/nostril (15LD.sub.50). A blank control was administrated with normal saline, instead of a virus suspension.
(2) Administration Method
[0150] A bisepoxylignan composition and composition drug groups (high dose of 26.0 mg/kg, low dose of 13.0 mg/kg), a model group and an Oseltamivir phosphate drug control group were administrated by routine gavage on one day before infection, once a day, for 5 consecutive days; and the positive control group and the model group were perfused with the same volume of 0.5% sodium carboxymethylcellulose.
(3) IL-2 and TNF- Detection
[0151] On the Day 5 after influenza virus infection, that is, Day 6 after administration, after the mice were fasted with solids for 8 h and weighed, venous blood was collected from the plexus ophthalmicus, and blood from mice in each group was preserved, subjected to serum separation, and stored in a refrigerator for later use. According to the instructions of a test kit, various detection and analysis were carried out, and IL-2 and TNF- concentrations were calculated based on the standard detection and standard curve plotting.
(4) TNF- and IL-2 Detection
[0152] The results showed that different concentrations of drugs intervened in both TNF- and IL-2. The efficacy of the high-dose group was better than that of Oseltamivir phosphate.
TABLE-US-00020 TABLE 5-1 Expression levels of TNF-a and IL-2 in mice infected with influenza virus (
(5) Histological and Pathological Examination of Lung Lesions
[0153] 4 mouse lungs in various experimental groups were taken for fixation, embedding, section staining, microscopic examination, and the like. The pathological results of the lungs of the mice showed that compared with the normal group, the lung tissues of the infection model group presented pathological changes such as pulmonary hemorrhage and interstitial pneumonia. The specific types and degrees of lesions of infected animals in various groups were as follows:
TABLE-US-00021 TABLE 5-2 Pathomorphological observation results of lungs of mice infected with influenza virus Pulmonary hemorrhage Interstitial pneumonia Test group Division Mild Moderate Severe Mild Moderate Severe Virus group 0 4 0 0 4 0 Positive drug group 2 2 0 2 2 0 Lianqiaoxinside. High dose 4 0 0 4 0 0 Low dose 2 2 0 2 2 0 Phillyrin High dose 4 0 0 4 0 0 Low dose 2 2 0 2 2 0 Phillygenin High dose 3 1 0 3 1 0 Low dose 2 2 0 2 2 0 Lianqiaoxinside and High dose 4 0 0 4 0 0 phillyrin 99.9:0.1 Low dose 2 2 0 2 2 0 Phillyrin and High dose 4 0 0 4 0 0 lianqiaoxinside 99.9:0.1 Low dose 2 2 0 2 2 0 Phillygenin and High dose 3 1 0 3 1 0 lianqiaoxinside 99.9:0.1 Low dose 2 2 0 2 2 0 Phillyrin/lianqiaoxinside/ High dose 4 0 0 4 0 0 phillygenin sulfate 99.8:0.1:0.1 Low dose 2 2 0 2 2 0 Lianqiaoxinside/phillyrin/ High dose 4 0 0 4 0 0 phillygenin ibuprofenate 99.8:0.1:0.1 Low dose 2 2 0 2 2 0 Phillygenin/lianqiaoxinside/ High dose 3 1 0 3 1 0 phillygenin glucuronate 99.8:0.1:0.1 Low dose 2 2 0 2 2 0
[0154] Based on the comparison of lesions in various groups, the pathological changes of the surviving animals in the various groups were milder than dead animals; lesion degrees of the drug low-dose group and the drug high-dose group were milder than those of the virus group, and drugs (13.0 mg/kg and 26 mg/kg) had good improvement effects on lung lesions caused by influenza virus and had an effect better than Oseltamivir phosphate.
Example 6 Study on the Efficacy of the Drug of the Present Invention for the Prevention of Influenza Virus
1. Drugs
[0155] Bisepoxylignan compounds include: lianqiaoxinside (having a purity of 99.95%), phillyrin (content of 99.96%), phillygenin (having a purity of 99.96%), phillygenin sulfate (having a purity of 99.95%), phillygenin glucuronate (having a purity of 99.95%), or phillygenin ibuprofenate (having a purity of 99.95%).
[0156] Bisepoxylignan compositions include: lianqiaoxinside/phillyrin, lianqiaoxinside/phillygenin, lianqiaoxinside/phillygenin sulfate, lianqiaoxinside/phillygenin glucuronate, lianqiaoxinside/phillygenin ibuprofenate, phillyrin/phillygenin sulfate, phillyrin/phillygenin glucuronate, phillyrin/phillygenin ibuprofenate, phillygenin/phillygenin sulfate, phillygenin/phillygenin glucuronate, phillygenin/phillygenin ibuprofenate, phillygenin sulfate/phillygenin glucuronate, phillygenin sulfate/phillygenin ibuprofenate, phillygenin glucuronate/phillygenin ibuprofenate, phillyrin/lianqiaoxinside/phillygenin sulfate, lianqiaoxinside/phillyrin/phillygenin ibuprofenate, and phillygenin/lianqiaoxinside/phillygenin glucuronate.
[0157] The above test drugs were provided by Dalian Fusheng Natural Medicine Development Co., Ltd.
[0158] (2) Cell line: Vero E6 cells (African green monkey kidney cells), State Key Laboratory of Respiratory Diseases, Guangzhou Institute of Respiratory Medicine.
[0159] (3) Virus strain: influenza virus FM1 strains of influenza virus and parainfluenza virus: Institute of Virology, Chinese Academy of Preventive Medicine.
2. The Specific Action Links of the Drugs were Discussed, and an Administration Method and a Test Purpose were as Follows:
[0160] Group I: a virus solution was added after 24 h of drug administration; whether the drug could enter the cell or be adsorbed on the cell surface to prevent the adsorption and entry of the virus and to play a preventive role in the virus was observed, which is equivalent to administrating the drug first and then infecting the influenza virus; and the efficacy of the drug in preventing influenza was observed.
[0161] Group II: a virus solution was added first, a drug was added 1 h after adsorption, and whether the drug can work on the virus entering the cell, inhibit its biosynthesis and mature release and play a therapeutic role was observed, which was equivalent to being infected with the influenza virus before administration, and observing the therapeutic effect.
[0162] Group III: a drug solution and a virus solution were added at the same time, the effects of the drug and the virus under different conditions were observed, and whether the drug had a direct inactivation effect on the virus was observed, which was equivalent to immediate administration after infection with influenza, and observation of the therapeutic effect.
[0163] Group IV: a drug solution and a virus solution were mixed and adsorbed for 2 h and then added with cells, and the effects of the drug and the virus under different conditions and whether the drug had a direct inactivation effect on the virus were observed, which was equivalent to administration after infection with influenza, and observation of the therapeutic effect.
3. Experimental Results
[0164] Group I: the test results showed that the bisepoxylignan compound and composition could enter the cell or be adsorbed on the cell surface, prevent the adsorption and entry of influenza virus and parainfluenza virus, with a blocking effect of more than 75%.
[0165] Group II: the test results showed that the bisepoxylignan compound and composition could play a role in the virus entering the cell, and had an effect of inhibiting the synthesis and release of influenza virus and parainfluenza virus, with an inhibition rate of more than 75%.
[0166] Groups III and IV: the test results showed that the bisepoxylignan compound and composition had a direct inactivation effect on influenza virus and parainfluenza virus. A bisepoxylignan compound and composition solution and a virus solution were added at the same time, and an inactivation rate of influenza and parainfluenza viruses reached about 100%. The bisepoxylignan compound and composition solution and the virus were mixed and adsorbed for 2 h, and then added with cells, with inactivation rates for the parainfluenza virus of about 100%. Therefore, regardless of the length of time for the virus to interact with the bisepoxylignan compound and composition, as long as the bisepoxylignan compound and composition had the opportunity to be in direct contact with the above-mentioned viruses, they had obvious inactivation effects, and also had effects significantly better than those of other pathways of action. Details were shown in the following Table.
TABLE-US-00022 TABLE 6-1 Comparison of protection rates of phillyrin against virus-infected tissue cells (ER %) Protection rate Group Group Group Group Tested drug Virus I II III IV Lianqiaoxinside. Influenza 75.49 75.77 100.52 100.76 Parainfluenza 84.39 85.95 100.49 100.82 Phillyrin Influenza 75.86 75.58 100.68 100.86 Parainfluenza 84.48 85.94 100.67 100.93 Phillygenin Influenza 75.46 75.51 100.86 100.38 Parainfluenza 84.15 85.11 100.46 100.18 Lianqiaoxinside and phillyrin 99.9:0.1 Influenza 75.63 75.37 100.52 100.44 Parainfluenza 84.75 85.57 100.13 100.30 Phillyrin and lianqiaoxinside 99.9:0.1 Influenza 75.22 75.96 100.40 100.47 Parainfluenza 84.98 85.45 100.16 100.31 Phillygenin and lianqiaoxinside 99.9:0.1 Influenza 75.43 75.15 100.51 100.94 Parainfluenza 84.95 85.89 100.65 100.41 Phillyrin/lianqiaoxinside/ Influenza 75.51 75.26 100.40 100.26 phillygenin sulfate 99.8:0.1:0.1 Parainfluenza 84.23 85.19 100.85 100.86 Lianqiaoxinside/phillyrin/ Influenza 75.84 75.59 100.93 100.42 phillygenin ibuprofenate 99.8:0.1:0.1 Parainfluenza 84.34 85.32 100.49 100.86 Phillygenin/lianqiaoxinside/ Influenza 75.42 75.82 100.21 100.50 phillygenin glucuronate 99.8:0.1:0.1 Parainfluenza 84.57 85.31 100.20 100.25
Example 7 Study on Efficacy of Drug of the Present Invention for the Prevention of COVID-19 Delta Virus
[0167] 1.1 Mice: hACE2 male mice, aged 6-7 weeks and weighing 20-40 g, laboratory animal supplier: Jiangsu Gempharmatech Co., Ltd., laboratory animal production license: SCXK (Su) 2018-0008, and feed supplier: Jiangsu Medicience Biopharmaceutical Co., Ltd.
[0168] 1.2 COVID-19 Delta virus (P3 Laboratory, Guangzhou Customs Technology Center (Laboratory of Highly Pathogenic Microorganisms, State Key Laboratory of Respiratory Diseases)
(1.3) Drugs
[0169] Bisepoxylignan compounds: lianqiaoxinside (a purity of 99.95%), phillyrin (content of 99.96%), and phillygenin (a purity of 99.96%); bisepoxylignan compositions: lianqiaoxinside/phillyrin, phillyrin/lianqiaoxinside, phillygenin/liangiaoxinside, phillyrin/lianqiaoxinside/phillygenin sulfate, lianqiaoxinside/phillyrin/phillygenin ibuprofenate, and phillygenin/lianqiaoxinside/phillygenin glucuronate. The above test drugs were provided by Dalian Fusheng Natural Medicine Development Co., Ltd.
[0170] Remdesivir: a specification of 1 g. Preparation method: during an in-vitro test, DMSO was prepared into mother liquor which was aliquoted, stored at 4 C. for later use and diluted to a required concentration with a cell working solution before use. During an in-vivo test, 0.5% sodium carboxymethyl cellulose was prepared into a required concentration.
1.4 Experimental Method
[0171] hACE2 transgenic C57BL/6 mice were divided (8 mice in each group) into a normal group (NC), a virus infection group (Virus), and drug groups (a COVID-19 Delta virus low-dose (40 mg/kg) group, high-dose (80 mg/kg) group; and a positive control group (Remdesivir 50 mg/kg). Before nasal dripping infection, the drug was administered by gavage 5 days in advance, once a day. After 5 days of continuous gavage, nasal dripping infection was performed, and mice in each COVID-19 virus infection group were infected with COVID-19 Delta virus with 10 PFU by nasal dripping, except for the normal group who were given PBS by nasal dripping.
[0172] After infection, the body weight change was recorded every day, the death of animals within 5 days of infection was recorded, and the mean survival days and mortality rate of 5 days were calculated. On the Day 5 after infection, the lungs were dissected, and half of the lung tissues was homogenized for virus titer detection.
[0173] The virus titer detection for mouse lung homogenate included: picking lung tissues of mice, placing in a petri dish, shredding and transferring into a homogenization tube, diluting with normal saline 1:10 (w/v), and homogenizing at 8000 rpm/min for 10 min. The above operations were all done in an ice bath. The homogenate was transferred to a 1.5 mL EP tube and centrifuged at 4 C., 10,000 rpm for 10 min. The supernatant was pipetted, aliquoted, and stored at 80 C. for later use.
[0174] VERO E6 cells with good growth status were inoculated in a 96-well plate at 110.sup.4 cells/well, and continued to be cultured for 24 h. After the cells grew into a complete monolayer adherently, a supernatant was discarded and the cells were washed twice in PBS. The cryopreserved lung homogenate supernatant was thawed, and then diluted to five concentrations of 10.sup.1 to 10.sup.5 in a 10-fold ratio; the diluted lung homogenate supernatant of the mouse in each group was added in a 96-well plate; 100 L of lung supernatant was added to each well; blank control wells are set at the same time; a cell culture medium was added to the blank control wells; and 8 duplicate wells were made in parallel for each concentration and cultured in the incubator. A cytopathic effect (CPE) was observed daily for 4 consecutive days, the number of lesion wells at each gradient concentration was recorded, and its TCID50 value for VERO E6 cells was calculated.
1.5 Experimental Results
(1) The Results of Protective Study on Prophylactic Administration of Drug of the Present Invention on the Death Caused by COVID-19 Virus
[0175] The specific data was shown in Table 14. 100% of mice died in the virus group, the death protection rate of the mouse in a Remdesivir administration group was 75%, and the drug of the present invention had a protective effect of up to 87.50% on the mouse infected with the COVID-19 virus; and the drug group of the present invention with prophylactic administration had a higher death protection rate than the Remdesivir group.
[0176] The prophylactic administration of the drug of the present invention had a virus titer for the pneumovirus of mice infected with COVID-19 Delta virus.
[0177] The results of viral titer detection were shown in the following table. The results showed that the pneumovirus titer of mice in the drug administration group of the present invention was significantly reduced.
TABLE-US-00023 TABLE 7-1 Experimental results of prophylactic administration on the death protection of Delta-infected mice (
TABLE-US-00024 TABLE 7-2 Detection results of virus titer in lung tissues of mice infected with COVID-19 Delta (