Signaling and antigen-presenting bifunctional receptors (SABR)
12221465 ยท 2025-02-11
Assignee
Inventors
- Alok V Joglekar (Pasadena, CA, US)
- Michael T Leonard (Pasadena, CA, US)
- Michael T Bethune (Pasadena, CA, US)
- David Baltimore (Pasadena, CA)
Cpc classification
C07K14/705
CHEMISTRY; METALLURGY
G01N33/566
PHYSICS
A61K40/11
HUMAN NECESSITIES
C07K2319/70
CHEMISTRY; METALLURGY
C40B40/02
CHEMISTRY; METALLURGY
A61K40/416
HUMAN NECESSITIES
International classification
C07K14/705
CHEMISTRY; METALLURGY
A61K39/00
HUMAN NECESSITIES
C40B40/02
CHEMISTRY; METALLURGY
G01N33/566
PHYSICS
Abstract
Described herein are compositions and methods for signaling and antigen-presenting bifunctional receptors (SABRs) comprising one or more antigen presenting domains; and one or more signal transduction domains, wherein the one or more antigen presenting domains comprise a binding fragment of a major histocompatibility complex (MHC) molecule. Various immunological functions of the SABRs are also described.
Claims
1. A signaling and antigen-presenting bifunctional receptor (SABR) comprising: an antigen presenting domain comprising a binding domain of a major histocompatibility complex (MHC) molecule, a peptide epitope covalently linked to the binding domain of the MHC molecule for extracellular presentation of the peptide epitope to a first cell expressing at least one antigen receptor, and a transmembrane domain; one or more linkers; and a signal transduction domain fused to the antigen presenting domain, wherein the SABR is made by a method comprising expressing, in a second cell that is an isolated cell, a nucleic acid sequence encoding the antigen presenting domain, the signal transduction domain, and the one or more linkers, and wherein the peptide epitope is synthesized and cloned, from pooled single stranded oligonucleotide libraries, into the nucleic acid sequence, wherein the transmembrane domain comprises a transmembrane domain from one or more of 4-1BB (CD137), CD28, CD27, DAP10, ICOS, OX40, PD1, CTLA4, TIM3, CD3zeta, Notch, synNotch, CD79A, CD79B, CD72, CD22, CD5, CD19, CD45, IL2, IL4, EPO, GM-CSF, JAK-STAT, CCL10, a G protein coupled receptor, a receptor of the TNF Receptor superfamily, a NK cell receptor, a Fc receptor, a toll-like receptor, a RIG-I-like receptor, a NOD-like receptor, or a MHC molecule, and wherein the signal transduction domain comprises an intracellular signaling domain of CD137, CD27, DAP10, ICOS, OX40, PD1, CTLA4, TIM3, an IL2, an IL4, an EPO, a GM-CSF, JAK-STAT, a CCL10, a G protein coupled receptor, or a receptor of the TNF Receptor superfamily, or a fragment thereof.
2. The SABR of claim 1, wherein the antigen presenting domain comprises the MHC.
3. The SABR of claim 1, wherein the MHC comprises a Class I MHC, and wherein the MHC comprises HLA-A*0201 or HLA-B*2705.
4. The SABR of claim 1, wherein the MHC comprises a Class II MHC.
5. The SABR of claim 1, wherein the second cell is a reporter cell, and wherein the reporter cell provides a detectable marker upon binding of the SABR to the antigen receptor.
6. The SABR of claim 5, wherein the reporter cell comprises NFAT-GFP-Jurkat cells.
7. The SABR of claim 5, wherein the first cell is a T cell comprising TCR.
8. The SABR of claim 5, wherein the first cell expresses an orphan TCR.
9. The SABR of claim 1, wherein the oligonucleotide libraries encode pathogen epitopes.
10. A signaling and antigen-presenting bifunctional receptor (SABR) comprising: an antigen presenting domain comprising a major histocompatibility complex (MHC) molecule, a peptide epitope covalently linked to the MHC molecule for extracellular presentation of the peptide epitope to a first cell expressing at least one antigen receptor, and a transmembrane domain; one or more linkers; and a signal transduction domain fused to the antigen presenting domain, wherein the SABR is made by a method comprising expressing, in a second cell that is an isolated cell, a nucleic acid sequence encoding the antigen presenting domain and the signal transduction domain, wherein the MHC molecule is class I or class II, wherein the peptide epitope is synthesized and cloned, from pooled single stranded oligonucleotide libraries, into the nucleic acid sequence, wherein the peptide epitope comprises a cancer peptide epitope, wherein the transmembrane domain comprises a transmembrane domain from one or more of 4-1BB (CD137), CD28, CD27, DAP10, ICOS, OX40, PD1, CTLA4, TIM3, CD3zeta, Notch, synNotch, CD79A, CD79B, CD72, CD22, CD5, CD19, CD45, IL2, IL4, EPO, GM-CSF, JAK-STAT, CCL10, a G protein coupled receptor, a receptor of the TNF Receptor superfamily, a NK cell receptor, a Fc receptor, a toll-like receptor, a RIG-I-like receptor, a NOD-like receptor, or an MHC molecule, and wherein the signal transduction domain comprises an intracellular signaling domain of CD137, CD27, DAP10, ICOS, OX40, PD1, CTLA4, TIM3, an IL2, an IL4, an EPO, a GM-CSF, JAK-STAT, a CCL10, a G protein coupled receptor, or a receptor of the TNF Receptor superfamily, or a fragment thereof.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
(25)
(26)
(27)
(28)
(29)
(30)
(31)
(32)
(33)
(34)
(35)
(36)
(37)
(38)
(39)
(40)
(41)
(42)
(43)
(44)
(45)
(46)
(47)
(48)
(49)
(50)
(51)
(52)
(53)
(54)
(55)
(56)
(57)
(58)
(59)
(60)
(61)
(62)
(63)
(64)
(65)
(66)
(67)
(68)
(69)
(70)
(71)
(72)
(73)
(74)
(75)
(76)
(77)
(78)
(79)
(80)
DETAILED DESCRIPTION
(81) MHC molecules that present antigens lack signaling domains, and hence cannot induce a response in the target cells. Therefore, a TCR-Antigen-MHC interaction results in a unidirectional signal towards the T cell. Lack of signaling towards the target cells is a major limitation in the potential use of TCR-Antigen-MHC interactions for various functions. Thus, new, scalable techniques and molecules that expand the utilization of TCR-Antigen-MHC interactions are needed and are provided herein (in some embodiments).
(82) Described herein are compositions and methods for signaling and antigen-presenting bifunctional receptors (SABRs) comprising: one or more antigen presenting domains, and one or more signal transduction domains, wherein the one or more antigen presenting domains comprise a binding fragment of a major histocompatibility complex (MHC) molecule. Various immunological functions of the SABRs are also described. Various uses and functions of the SABRs are provided herein. For example, in some embodiments, the SABRs described herein may be used for antigen discovery, for suppressing and/or destroying pathogenic T cells, for initiating therapeutic responses, in methods of treatment, for construction of SABR libraries, for neoantigen discovery, as well as other uses.
Definitions and Various Embodiments
(83) As used herein, the section headings are for organizational purposes only and are not to be construed as limiting the described subject matter in any way. All literature and similar materials cited in this application, including but not limited to, patents, patent applications, articles, books, treatises, and internet web pages are expressly incorporated by reference in their entirety for any purpose. When definitions of terms in incorporated references appear to differ from the definitions provided in the present teachings, the definition provided in the present teachings shall control.
(84) In this application, the use of the singular includes the plural unless specifically stated otherwise. Also, the use of comprise, comprises, comprising, contain, contains, containing, include, includes, and including are not intended to be limiting. It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive. Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. See, for example Singleton et al., Dictionary of Microbiology and Molecular Biology 2.sup.nd ed., J. Wiley & Sons (New York, N.Y. 1994); Sambrook et al., Molecular Cloning, A Laboratory Manual, Cold Springs Harbor Press (Cold Springs Harbor, N.Y. 1989). For purposes of the present invention, the following terms are defined below. It is to be understood that both the foregoing general description and the following detailed description. are exemplary and explanatory only and are not restrictive of the invention as claimed. In this application, the use of the singular includes the plural unless specifically stated otherwise. In this application, the use of or means and/or unless stated otherwise. Furthermore, the use of the term including, as well as other forms, such as includes and included, is not limiting. As used in this specification and claims, the singular forms a, an and the include plural references unless the content clearly dictates otherwise.
(85) As used herein, about means a quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length that varies by as much as 30, 25, 20, 15, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1% to a reference quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length.
(86) As used herein, an antigen presenting domain refers to an extracellular domain that functions to present antigen peptide fragments to T cells responsible for cell-mediated immune responses.
(87) As used herein, a signal transduction domain refers to any domain that can transmit an extracellular signal intracellularly.
(88) As used herein, a major histocompatibility molecule (MHC) refers to a set of cell surface proteins essential for the acquired immune system to recognize foreign molecules. Unless otherwise noted, MHC refers to both Class I MHC and Class II MHC.
(89) As used herein, peptide refers to a chain of amino acids linked to each other by peptide bonds.
(90) As used herein, epitope refers to a part of an antigen that is recognized by the immune system. This can be by, for example, antibodies, B cells, or T cells.
(91) As used herein, T cell signaling domain refers to a cytoplasmic T cell domain that functions to transmit an intracellular signal.
(92) As used herein, cytokine receptor refers to any receptor that bind cytokines.
(93) As used herein, transmembrane domain refers to an amino acid sequence that traverses and is present in the cell membrane.
(94) As used herein, a linker refers to a peptide sequence occurring between protein domains.
(95) As used herein, a signaling cell refers to any cell any cell that is capable for transmitting an extracellular signal intracellularly through a signaling domain.
(96) As used herein, a target cell refers to a cell that bears receptors recognized by a signaling molecule.
(97) As used herein, a reporter cell refers to a cell expressing reporter genes, which, when exposed to a stimulus, induces a measurable signal activity that can be readily assessed qualitatively and quantitatively.
(98) As used herein, a measurable signal refers to any reporter activity that can be assessed qualitatively or quantitatively.
(99) As used herein, antigen discovery refers to the process of discovering the antigens targeted by T cell responses.
(100) As used herein, a soluble molecule refers to a compound soluble in a liquid.
(101) As used herein, a library refers to a collection of cells having one or more signaling molecules.
(102) As used herein, a detectable marker refers to any discernable characteristic in response to signal transduction.
(103) As used herein, flow cytometry refers to a laser- or impedance-based, biophysical technology employed in cell counting, cell sorting, biomarker detection and protein engineering, by suspending cells in a stream of fluid and passing them through an electronic detection apparatus.
(104) As used herein, a therapeutic cell refers to a cell transduced with a SABR, wherein the SABR directs a cellular response in a subject upon binding to an antigen receptor in the subject.
(105) As used herein, a cellular response refers to any biochemical reaction within a cell in response to a received signal.
(106) As used herein, a pathogenic T cell refers to any T cell that causes or contributes to a disease, for example, in an autoimmune disease.
(107) As used herein, a cytoplasmic domain refers to amino acid sequences within the cytoplasm of a cell.
(108) As used herein, a vector, interchangeably referred to as a transgenic construct, a targeting construct, or simply a construct, is a nucleic acid. As used herein, nucleic acid refers to deoxyribonucleic acid (DNA). In some embodiments, nucleic acid may refer to ribonucleic acid (RNA). In some embodiments, the construct as provided herein comprise one or more regulatory elements. Exemplary regulatory elements in prokaryotes include promoters, operators and ribosome binding sites. Regulatory elements that are used in eukaryotic cells can include, without limitation, transcriptional and translational control sequences, such as promoters, terminators, enhancers, insulators, splicing signals, polyadenylation signals, terminators, protein degradation signals, internal ribosome-entry element (IRES), 2A sequences, and the like, that provide for and/or regulate expression of a coding sequence and/or production of an encoded polypeptide in a host cell. For example, a promoter is a nucleotide sequence that permits binding of RNA polymerase and directs the transcription of a gene. Typically, a promoter is located in the 5 non-coding region of a gene, proximal to the transcriptional start site of the gene. Sequence elements within promoters that function in the initiation of transcription are often characterized by consensus nucleotide sequences. Examples of promoters include, but are not limited to, promoters from bacteria, yeast, plants, viruses, and mammals (including humans). A promoter can be inducible, repressible, and/or constitutive. Inducible promoters initiate increased levels of transcription from DNA under their control in response to some change in culture conditions (for example, a change in temperature). Treating or treatment of a condition may refer to preventing the condition, slowing the onset and/or rate of development of the condition, reducing the risk of developing the condition, preventing and/or delaying the development of symptoms associated with the condition, reducing or ending symptoms associated with the condition, generating a complete or partial regression of the condition, or some combination thereof. The term prevent does not require the absolute prohibition of the disorder or disease.
(109) A therapeutically effective amount or a therapeutically effective dose is an amount that produces a desired therapeutic effect in a subject, such as preventing, treating a target condition, delaying the onset of the disorder and/or symptoms, and/or alleviating symptoms associated with the condition. This amount will vary depending upon a variety of factors, including but not limited to the characteristics of the therapeutic compound (including activity, pharmacokinetics, pharmacodynamics, and bioavailability), the physiological condition of the subject (including age, sex, disease type and stage, general physical condition, responsiveness to a given dosage, and type of medication), the nature of the pharmaceutically acceptable carrier or carriers in the formulation, and/or the route of administration. One skilled in the clinical and pharmacological arts will be able to determine a therapeutically effective amount through routine experimentation, for example by monitoring a subject's response to administration of a compound and adjusting the dosage accordingly, given the present disclosure. For additional guidance, see Remington: The Science and Practice of Pharmacy 21.sup.st Edition, Univ. of Sciences in Philadelphia (USIP), Lippincott Williams & Wilkins, Philadelphia, Pa., 2005.
(110) The term antibody includes, but is not limited to, genetically engineered or otherwise modified forms of immunoglobulins, such as intrabodies, chimeric antibodies, fully human antibodies, humanized antibodies, antibody fragments, and heteroconjugate antibodies (e.g., bispecific antibodies, diabodies, triabodies, tetrabodies, etc.). The term antibody includes cys-diabodies and minibodies. The term antibody includes a polypeptide of the immunoglobulin family or a polypeptide comprising fragments of an immunoglobulin that is capable of noncovalently, reversibly, and in a specific manner binding a corresponding antigen. An exemplary antibody structural unit comprises a tetramer. In some embodiments, a full-length antibody can be composed of two identical pairs of polypeptide chains, each pair having one light and one heavy chain (connected through a disulfide bond. The recognized immunoglobulin genes include the kappa, lambda, alpha, gamma, delta, epsilon, and mu constant region genes, as well as the myriad immunoglobulin variable region genes. For full length chains, the light chains are classified as either kappa or lambda. For full length chains, the heavy chains are classified as gamma, mu, alpha, delta, or epsilon, which in turn define the immunoglobulin classes, IgG, IgM, IgA, IgD, and IgE, respectively. The N-terminus of each chain defines a variable region of about 100 to 110 or more amino acids primarily responsible for antigen recognition. The terms variable light chain (VL) and variable heavy chain (VH) refer to these regions of light and heavy chains respectively. As used in this application, an antibody encompasses all variations of antibody and fragments thereof. Thus, within the scope of this concept are full length antibodies, chimeric antibodies, humanized antibodies, single chain antibodies (scFv), Fab, Fab, and multimeric versions of these fragments (e.g., F(ab)2) with the same binding specificity. In some embodiments, the antibody binds specifically to a desired target.
(111) The term isolated, when applied to a nucleic acid or protein, denotes that the nucleic acid or protein is essentially free of other cellular components with which it is associated in the natural state. In some embodiments, it can be in either a dry or aqueous solution. Purity and homogeneity can be determined using analytical chemistry techniques such as polyacrylamide gel electrophoresis or high performance liquid chromatography. A protein that is the predominant species present in a preparation is substantially purified. In particular, an isolated gene is separated from open reading frames that flank the gene and encode a protein other than the gene of interest. The term purified denotes that a nucleic acid or protein gives rise to essentially one band in an electrophoretic gel. In some embodiments, this can denote that the nucleic acid or protein is at least 85% pure, more preferably at least 95% pure, and most preferably at least 99% pure of molecules that are present under in vivo conditions.
(112) The term nucleic acid or polynucleotide refers to deoxyribonucleic acids (DNA) or ribonucleic acids (RNA) and polymers thereof in either single- or double-stranded form. Unless specifically limited, the term encompasses nucleic acids containing known analogues of natural nucleotides that have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions), alleles, orthologs, SNPs, and complementary sequences as well as the sequence explicitly indicated. Specifically, degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and/or deoxyinosine residues (Batzer et al., Nucleic Acid Res. 19:5081 (1991); Ohtsuka et al., J. Biol. Chem. 260:2605-2608 (1985); and Rossolini et al., Mol. Cell. Probes 8:91-98 (1994)).
(113) The term amino acid refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to the naturally occurring amino acids. Naturally occurring amino acids are those encoded by the genetic code, as well as those amino acids that are later modified, e.g., hydroxyproline, gamma-carboxyglutamate, and O-phosphoserine. Amino acid analogs refer to compounds that have the same basic chemical structure as a naturally occurring amino acid, i.e., an alpha.-carbon that is bound to a hydrogen, a carboxyl group, an amino group, and an R group, e.g., homoserine, norleucine, methionine sulfoxide, methionine methyl sulfonium. Such analogs have modified R groups (e.g., norleucine) or modified peptide backbones, but retain the same basic chemical structure as a naturally occurring amino acid. Amino acid mimetics refers to chemical compounds that have a structure that is different from the general chemical structure of an amino acid, but that functions in a manner similar to a naturally occurring amino acid.
Signaling and Antigen-Presenting Bifunctional Receptors
(114) Some embodiments provided herein relate to a signaling and antigen-presenting bifunctional receptor (SABR) comprising: an antigen presenting domain, and a signal transduction domain. The antigen presenting domain comprises a binding fragment of a major histocompatibility complex (MHC) molecule. In some embodiments, the SABRs herein allow transduction of a signal within a target cell, which has various application as describe herein. Some embodiments provided herein relate to a SABR comprising: one or more antigen presenting domains, and a signal transduction domain, wherein the one or more antigen presenting domains comprise a binding fragment of a MHC molecule. Some embodiments provided herein relate to a SABR comprising: an antigen presenting domain, and one or more signal transduction domains, wherein the antigen presenting domain comprises a binding fragment of a MHC molecule. Some embodiments provided herein relate to a SABR comprising: one or more antigen presenting domains, and one or more signal transduction domains, wherein the one or more antigen presenting domains comprises a binding fragment of a MHC molecule.
(115)
(116)
(117)
(118) Some embodiments provided herein relate to a SABR comprising: an antigen presenting domain, and a signal transduction domain, wherein the antigen presenting domain comprises a binding fragment of a MHC molecule, and wherein the antigen presenting domain comprises a MHC.
(119) Some embodiments provided herein relate to a nucleic acid encoding for any of the SABRs described herein. Some embodiments provided herein relate to a nucleic acid encoding for a SABR comprising: an antigen presenting domain, and a signal transduction domain, wherein the antigen presenting domain comprises a binding fragment of a MHC molecule.
(120) Some embodiments provided herein relate to a cell comprising a nucleic acid encoding for any of the SABRs described herein. Some embodiments provided herein relate to a nucleic acid encoding for a SABR comprising: an antigen presenting domain, and a signal transduction domain, wherein the antigen presenting domain comprises a binding fragment of a MHC molecule.
(121) Some embodiments provided herein relate to a SABR comprising: an antigen presenting domain, and a signal transduction domain, wherein the antigen presenting domain comprises a binding fragment of a MHC molecule, and wherein the MHC comprises a Class I MHC.
(122) Some embodiments provided herein relate to a SABR comprising: an antigen presenting domain, and a signal transduction domain, wherein the antigen presenting domain comprises a binding fragment of a MHC molecule, and wherein the MHC comprises a Class II MHC.
(123) Some embodiments provided herein relate to any of the SABRs described herein, further comprising a peptide. Some embodiments provided herein relate to a SABR comprising: an antigen presenting domain, a signal transduction domain, wherein the antigen presenting domain comprises a binding fragment of a MHC molecule, and a peptide. Some embodiments provided herein relate to a SABR wherein the peptide comprises an epitope. In some embodiments, any of the epitopes in tables 6.3 or 6.4 can be employed. Some embodiments provided herein relate to a SABR comprising: an antigen presenting domain, a signal transduction domain, wherein the antigen presenting domain comprises a binding fragment of a MHC molecule, and a peptide, wherein the peptide comprises an epitope, and wherein the peptide epitope is covalently linked to the SABR. Some embodiments provided herein relate to a SABR comprising: an antigen presenting domain, a signal transduction domain, wherein the antigen presenting domain comprises a binding fragment of a MHC molecule, and a peptide, wherein the peptide comprises an epitope, wherein the peptide epitope is covalently linked to the SABR, and wherein the antigen presenting domain binds to the peptide. Some embodiments provided herein relate to a SABR comprising: an antigen presenting domain, a signal transduction domain, wherein the antigen presenting domain comprises a binding fragment of a MHC molecule, and a peptide, wherein the peptide comprises an epitope, wherein the peptide epitope is covalently linked to the SABR, and wherein the antigen presenting domain does not bind to the peptide.
(124) Some embodiments provided herein relate to a SABR comprising: an antigen presenting domain, and a signal transduction domain, wherein the antigen presenting domain comprises a binding fragment of a MHC molecule, and wherein the signal transduction domain comprises a T cell signaling domain. Some embodiments provided herein relate to a SABR comprising: an antigen presenting domain, and a signal transduction domain, wherein the antigen presenting domain comprises a binding fragment of a MHC molecule. Some embodiments provided herein relate to a SABR wherein the signal transduction domain comprises a T cell signaling domain. Some embodiments provided herein relate to a SABR wherein the T cell signaling domain comprises 4-1BB (CD137), CD28, CD27, DAP10, ICOS, OX40, PD1, CTLA4, TIM3, or CD3zeta. Some embodiments provided herein relate to a SABR comprising: an antigen presenting domain, and a signal transduction domain, wherein the antigen presenting domain comprises a binding fragment of a MHC molecule, wherein the signal transduction domain comprises a T cell signaling domain, and wherein the T cell signaling domain comprises PMID: 23667569, PMID: 22437870, PMID: 23667569, PMID: 22437870, PMID: 23667569, PMID: 22437870, PMID: 23667569, PMID: 22437870, PMID: 23667569, PMID: 22437870, PMID: 23667569, or PMID: 22437870. Some embodiments provided herein relate to a SABR comprising: an antigen presenting domain, and a signal transduction domain, wherein the antigen presenting domain comprises a binding fragment of a MHC molecule, wherein the signal transduction domain comprises a T cell signaling domain. Some embodiments provided herein relate to a SABR wherein the T cell signaling domain comprises one or more of the domains of Table 0.1. In some embodiments, fragments of one or more of the following items in Table 0.1 can also be employed.
(125) TABLE-US-00001 TABLE 0.1 Class/ Domain Source Function Ref 4-1BB T cell Antigen discovery, PMID: 23667569, (CD137) signaling Fratricide Immunotherapy, PMID: 22437870 Tolerogenic Immunotherapy CD28 T cell Antigen discovery, PMID: 23667569, signaling Fratricide Immunotherapy, PMID: 22437870 Tolerogenic Immunotherapy CD27 T cell Antigen discovery, PMID: 23667569, signaling Fratricide Immunotherapy, PMID: 22437870 Tolerogenic Immunotherapy DAP10 T cell Antigen discovery, PMID: 23667569, signaling Fratricide Immunotherapy, PMID: 22437870 Tolerogenic Immunotherapy ICOS, T cell Antigen discovery, PMID: 23667569, OX40, signaling Fratricide Immunotherapy, PMID: 22437870 PD1, Tolerogenic Immunotherapy, CTLA4, Modulating exhaustion TIM3 CD3zeta T cell Antigen discovery, PMID: 23667569, signaling Fratricide Immunotherapy, PMID: 22437870 Tolerogenic Immunotherapy
(126) Some embodiments provided herein relate to a SABR comprising: an antigen presenting domain, and a signal transduction domain, wherein the antigen presenting domain comprises a binding fragment of a MHC molecule. Some embodiments provided herein relate to a SABR wherein the signal transduction domain is derived from a cytokine receptor. Some embodiments provided herein relate to a SABR comprising: an antigen presenting domain, and a signal transduction domain, wherein the antigen presenting domain comprises a binding fragment of a MHC molecule, wherein the signal transduction domain is derived from a cytokine receptor. Some embodiments provided herein relate to a SABR wherein the cytokine receptor comprises IL2, IL4, EPO, GM-CSF, JAK-STAT, CCL10, a G protein coupled receptor, or a receptor of the TNF Receptor superfamily. Some embodiments provided herein relate to a SABR wherein the signal transduction domain is derived from a cytokine receptor, wherein the cytokine receptor comprises PMID: 17934481, PMID: 10808165, PMID: 27317733, PMID: 17934481, PMID: 10808165, PMID: 27317733, PMID: 24679437, PMID: 24679437, PMID: 19239902. Some embodiments provided herein relate to a SABR wherein the cytokine receptor comprises one or more of the domains of Table 0.2. In some embodiments, a fragment of the cytokine receptor can be employed.
(127) TABLE-US-00002 TABLE 0.2 Domain Class/Source Function Ref Cytokines Cytokine Tolerogenic Immunotherapy, PMID: 17934481; such as IL2, signaling Immunomodulation, Vaccine boost PMID: 10808165; IL4, EPO, PMID: 27317733 GM-CSF JAK-STAT Cytokine Tolerogenic Immunotherapy, PMID: 17934481; signaling Immunomodulation, Vaccine boost PMID: 10808165; PMID: 27317733 Chemokines Cytokine Tolerogenic Immunotherapy, PMID: 24679437 such as signaling Immunomodulation, Vaccine boost CCL10 G protein Cytokine Tolerogenic Immunotherapy, PMID: 24679437 coupled signaling Immunomodulation, Vaccine boost receptors TNF Receptor Cytokine Immunomodulation, Vaccine boost PMID: 19239902 superfamily signaling
(128) Some embodiments provided herein relate to a SABR wherein the signal transduction domain comprises 4-1BB (CD137), CD28, CD27, DAP10, ICOS, OX40, PD1, CTLA4, TIM3, CD3zeta, Notch, synNotch, chemical-induced dimerization, CD79A, CD79B, CD72, CD22, CD5, CD19, CD45, IL2, IL4, EPO, GM-CSF, JAK-STAT, CCL10, a G protein coupled receptor, a receptor of the TNF Receptor superfamily, a NK cell receptor, a Fc receptor, a toll-like receptor, a RIG-I-like receptor, or a NOD-like receptor. Some embodiments provided herein relate to a SABR comprising: an antigen presenting domain, and a signal transduction domain, wherein the antigen presenting domain comprises a binding fragment of a MHC molecule, and wherein the signal transduction domain comprises PMID: 23667569, PMID: 22437870, PMID: 23667569, PMID: 22437870, PMID: 23667569, PMID: 22437870, PMID: 23667569, PMID: 22437870, PMID: 23667569, PMID: 22437870, PMID: 23667569, PMID: 22437870, PMID: 26830878, U.S. Pat. No. 9,670,281, PMID: 26431673, PMID: 21816833, PMID: 17934481, PMID: 10808165, PMID: 27317733, PMID: 17934481, PMID: 10808165, PMID: 27317733, PMID: 24679437, PMID: 19239902, PMID: 20567250, PMID: 25045879, PMID: 15932016, PMID: 21616437, or PMID: 26632377. Some embodiments provided herein relate to a SABR and wherein the signal transduction domain comprises one or more of the domains of Table 0.3. In some embodiments, a fragment of the signal transduction domain in Table 0.3 can be employed.
(129) TABLE-US-00003 TABLE 0.3 Domain Class/Source Function Ref 4-1BB T cell Antigen discovery, PMID: 23667569, (CD137) signaling Fratricide Immunotherapy, PMID: 22437870 Tolerogenic Immunotherapy CD28 T cell Antigen discovery, PMID: 23667569, signaling Fratricide Immunotherapy, PMID: 22437870 Tolerogenic Immunotherapy CD27 T cell Antigen discovery, PMID: 23667569, signaling Fratricide Immunotherapy, PMID: 22437870 Tolerogenic Immunotherapy DAP10 T cell Antigen discovery, PMID: 23667569, signaling Fratricide Immunotherapy, PMID: 22437870 Tolerogenic Immunotherapy ICOS, OX40, T cell Antigen discovery, PMID: 23667569, PD1, CTLA4, signaling Fratricide Immunotherapy, PMID: 22437870 TIM3 Tolerogenic Immunotherapy, Modulating exhaustion CD3zeta T cell Antigen discovery, PMID: 23667569, signaling Fratricide Immunotherapy, PMID: 22437870 Tolerogenic Immunotherapy Notch and Synthetic Antigen discovery, PMID: 26830878; synNotch domains Immunomodulation, Vaccine boost, U.S. Pat. No. Modulating exhaustion 9,670,281 Chemical- Synthetic Antigen discovery, PMID: 26431673 induced domains Immunomodulation dimerization CD79A, B B cell Tolerogenic Immunotherapy, PMID: 21816833 signaling Immunomodulation, Vaccine boost CD72 B cell Tolerogenic Immunotherapy, PMID: 21816833 signaling Immunomodulation, Vaccine boost CD22 B cell Tolerogenic Immunotherapy, PMID: 21816833 signaling Immunomodulation, Vaccine boost CD5 B cell Tolerogenic Immunotherapy, PMID: 21816833 signaling Immunomodulation, Vaccine boost CD19 B cell Tolerogenic Immunotherapy, PMID: 21816833 signaling Immunomodulation, Vaccine boost CD45 B cell Tolerogenic Immunotherapy, PMID: 21816833 signaling Immunomodulation, Vaccine boost Cytokines Cytokine Tolerogenic Immunotherapy, PMID: 17934481; such as IL2, signaling Immunomodulation, Vaccine boost PMID: 10808165; IL4, EPO, PMID: 27317733 GM-CSF JAK-STAT Cytokine Tolerogenic Immunotherapy, PMID: 17934481; signaling Immunomodulation, Vaccine boost PMID: 10808165; PMID: 27317733 Chemokines Cytokine Tolerogenic Immunotherapy, PMID: 24679437 such as signaling Immunomodulation, Vaccine boost CCL10 G protein Cytokine Tolerogenic Immunotherapy, PMID: 24679437 coupled signaling Immunomodulation, Vaccine boost receptors TNF Receptor Cytokine Immunomodulation, Vaccine boost PMID: 19239902 superfamily signaling NK cell Innate Immunomodulation, Vaccine boost PMID: 20567250 receptors immune signaling Fc Receptors Innate Immunomodulation, Vaccine boost PMID: 25045879 immune signaling Toll-like Innate Immunomodulation, Vaccine boost PMID: 15932016 Receptors immune signaling RIG-I-like Innate Immunomodulation, Vaccine boost PMID: 21616437 receptors immune signaling NOD-like Innate Immunomodulation, Vaccine boost PMID: 26632377 receptors immune signaling
(130) In some embodiments, any of the options in table 0.1 can be combined with any of the options in table 0.2 and with any of the options in table 0.3. In some embodiments, any of the options in tables 0.1-0.3 can be combined with any antigen presenting domain (MHC I or MHC II or binding domain thereof). In some embodiments, any of the SABRs provided herein can have any of the components provided in tables 0.1-0.3 in it.
(131) Some embodiments provided herein relate to a SABR comprising a transmembrane domain.
(132) Some embodiments provided herein relate to a SABR comprising a transmembrane domain, wherein the transmembrane domain comprises a transmembrane domain from one or more of 4-1BB (CD137), CD28, CD27, DAP10, ICOS, OX40, PD1, CTLA4, TIM3, CD3zeta, Notch, synNotch, chemical-induced dimerization, CD79A, CD79B, CD72, CD22, CD5, CD19, CD45, IL2, IL4, EPO, GM-CSF, JAK-STAT, CCL10, a G protein coupled receptor, a receptor of the TNF Receptor superfamily, a NK cell receptor, a Fc receptor, a toll-like receptor, a RIG-I-like receptor, or a NOD-like receptor, or a MHC molecule. Some embodiments provided herein relate to a SABR comprising a transmembrane domain, wherein the transmembrane domain comprises a transmembrane domain from one or more of PMID: 23667569, PMID: 22437870, PMID: 23667569, PMID: 22437870, PMID: 23667569, PMID: 22437870, PMID: 23667569, PMID: 22437870, PMID: 23667569, PMID: 22437870, PMID: 23667569, PMID: 22437870, PMID: 26830878, U.S. Pat. No. 9,670,281, PMID: 26431673, PMID: 21816833, PMID: 17934481, PMID: 10808165, PMID: 27317733, PMID: 17934481, PMID: 10808165, PMID: 27317733, PMID: 24679437, PMID: 19239902, PMID: 20567250, PMID: 25045879, PMID: 15932016, PMID: 21616437, or PMID: 26632377. Some embodiments provided herein relate to a SABR comprising a transmembrane domain, wherein the transmembrane domain comprises a transmembrane domain from one or more of the domains of Table 0.3.
(133) Some embodiments provided herein relate to a SABR comprising: an antigen presenting domain, a signal transduction domain, wherein the antigen presenting domain comprises a binding fragment of a MHC molecule, and a transmembrane domain, wherein the transmembrane domain comprises any one or more of the transmembrane domains of Tables 0.1, 0.2, or 0.3.
(134) Some embodiments provided herein relate to a SABR comprising: an antigen presenting domain, and a signal transduction domain, wherein the antigen presenting domain comprises a binding fragment of a MHC molecule, wherein the antigen presenting domain comprises any one or more of the antigen presenting domains of Tables 0.1, 0.2, or 0.3.
(135) Some embodiments provided herein relate to a SABR comprising: an antigen presenting domain, and a signal transduction domain, wherein the antigen presenting domain comprises a binding fragment of a MHC molecule, and wherein the signal transduction domain comprises any one or more of the signal transduction domains of Tables 0.1, 0.2, or 0.3.
(136) Some embodiments provided herein relate to a SABR wherein the antigen presenting domain is fused to the signal transduction domain. In some embodiments, the MHC portion of the SABR includes some or all of a MHC. In some embodiments, the MHC is a human MHC. In some embodiments, the MHC includes one or more or all of the conserved sequences of the MHC (e.g., the conserved residues within any one of
(137) Some embodiments provided herein relate to a SABR comprising one or more linkers.
Cell Compositions
(138) Each of the embodiments provided herein with regard to Signaling and Antigen-Presenting Bifunctional Receptors (SABRs) can be used within the present embodiments described herein with regard to Cell Compositions.
(139) Some embodiments provided herein relate to a cell comprising: an extracellular peptide-MHC complex comprising: an antigen presenting domain linked to a signal transduction domain, wherein the antigen presenting domain comprises an MHC molecule.
(140) Some embodiments herein relate to a cell comprising any of the SABRs described herein. Some embodiments herein relate to a cell comprising a SABR comprising: an antigen presenting domain, and a signal transduction domain, wherein the antigen presenting domain comprises a binding fragment of a MHC molecule. Some embodiments herein relate to a cell comprising any of the SABRs described herein, wherein the antigen presenting domain comprises a MHC. Some embodiments herein relate to a cell comprising any of the SABRs described herein, wherein the MHC comprises a Class I MHC. Some embodiments herein relate to a cell comprising any of the SABRs described herein, wherein the MHC comprises a Class II MHC. Some embodiments herein relate to a cell comprising any of the SABRs described herein, the SABR further comprising a peptide, wherein the peptide comprises an epitope, wherein the peptide epitope is covalently linked to the SABR, and wherein the antigen presenting domain binds to the peptide. Some embodiments herein relate to a cell comprising any of the SABRs described herein, wherein the signal transduction domain comprises a T cell signaling domain. Some embodiments herein relate to a cell comprising any of the SABRs described herein, the SABR further comprising a transmembrane domain. Some embodiments herein relate to a cell comprising any of the SABRs described herein, the SABR further comprising a transmembrane domain comprising any one or more of the transmembrane domains of Tables 0.1, 0.2, or 0.3. Some embodiments herein relate to a cell comprising any of the SABRs described herein, wherein the antigen presenting domain comprises any one or more of the antigen presenting domains of Tables 0.1, 0.2, or 0.3. Some embodiments herein relate to a cell comprising any of the SABRs described herein, wherein the signal transduction domain comprises any one or more of the signal transduction domains of Tables 0.1, 0.2, or 0.3. Some embodiments herein relate to a cell comprising any of the SABRs described herein, wherein the antigen presenting domain is fused to the signal transduction domain. Some embodiments herein relate to a cell comprising any of the SABRs described herein, the SABR further comprising one or more linkers.
(141) Some embodiments herein relate to a cell comprising any of the SABRs described herein, wherein the cell is sourced from any T cell line such as Jurkat cells, NFAT-GFP-Jurkat cells. Some embodiments herein relate to a cell comprising any of the SABRs described herein, wherein the cell is sourced from primary T cells from a patient or healthy donors or Natural Killer cells. Some embodiments herein relate to a cell comprising any of the SABRs described herein, wherein the cell is sourced from regulatory T cells, dendritic cells, B cells, macrophages, or Natural Killer cells.
Nucleic Acid Encoding
(142) Each of the embodiments provided herein with regard to Signaling and Antigen-Presenting Bifunctional Receptors can be used within the present embodiments described herein with regard to Nucleic Acid Encoding.
(143) Some embodiments herein relate to an isolated nucleic acid molecule comprising a nucleotide sequence encoding any one of the SABRs described herein. Some embodiments herein relate to an isolated nucleic acid molecule comprising a nucleotide sequence encoding any one of the SABRs described herein, the SABR comprising: an antigen presenting domain, and a signal transduction domain, wherein the antigen presenting domain comprises a binding fragment of a MHC molecule. Some embodiments herein relate to an isolated nucleic acid molecule comprising a nucleotide sequence encoding any one of the SABRs described herein, wherein the antigen presenting domain comprises a MHC. Some embodiments herein relate to an isolated nucleic acid molecule comprising a nucleotide sequence encoding any one of the SABRs described herein, wherein the MHC comprises a Class I MHC. Some embodiments herein relate to an isolated nucleic acid molecule comprising a nucleotide sequence encoding any one of the SABRs described herein, wherein the MHC comprises a Class II MHC. Some embodiments herein relate to an isolated nucleic acid molecule comprising a nucleotide sequence encoding any one of the SABRs described herein, the SABR further comprising a peptide, wherein the peptide comprises an epitope, wherein the peptide epitope is covalently linked to the SABR, and wherein the antigen presenting domain binds to the peptide. Some embodiments herein relate to an isolated nucleic acid molecule comprising a nucleotide sequence encoding any one of the SABRs described herein, wherein the signal transduction domain comprises a T cell signaling domain. Some embodiments herein relate to an isolated nucleic acid molecule comprising a nucleotide sequence encoding any one of the SABRs described herein, the SABR further comprising a transmembrane domain. Some embodiments herein relate to an isolated nucleic acid molecule comprising a nucleotide sequence encoding any one of the SABRs described herein, the SABR further comprising a transmembrane domain, wherein the transmembrane domain comprises any one or more of the transmembrane domains of Tables 0.1, 0.2, or 0.3. Some embodiments herein relate to an isolated nucleic acid molecule comprising a nucleotide sequence encoding any one of the SABRs described herein, wherein the antigen presenting domain comprises any one or more of the antigen presenting domains of Tables 0.1, 0.2, or 0.3. Some embodiments herein relate to an isolated nucleic acid molecule comprising a nucleotide sequence encoding any one of the SABRs described herein, wherein the signal transduction domain comprises any one or more of the signal transduction domains of Tables 0.1, 0.2, or 0.3. Some embodiments herein relate to an isolated nucleic acid molecule comprising a nucleotide sequence encoding any one of the SABRs described herein, wherein the antigen presenting domain is fused to the signal transduction domain. Some embodiments herein relate to an isolated nucleic acid molecule comprising a nucleotide sequence encoding any one of the SABRs described herein, the SABR further comprising one or more linkers.
Methods for Signaling Cell Preparation
(144) Each of the embodiments provided above with regard Signaling and Antigen-Presenting Bifunctional Receptors (SABRs) can be used within the present embodiments described herein with regard to Methods for Signaling Cell Preparation.
(145) Some embodiments herein relate to a method for preparing a signaling cell. The method comprises: providing a target cell, and introducing into the target cell a nucleic acid molecule comprising a nucleotide sequence coding for an SABR directed against at least one T-cell receptor (TCR) expressed at the surface of a T-cell, wherein the SABR comprises a MHC linked to a signal transduction domain.
Methods for Antigen Discovery
(146) Each of the embodiments provided above with regard Signaling and Antigen-Presenting Bifunctional Receptors (SABRs) can be used within the present embodiments described herein with regard to Methods for Antigen Discovery.
(147) Antigen discovery refers to identifying one or more peptide sequences of a protein. In some embodiments, the identified antigens can be used in making vaccines for treatment of patients. In some embodiments, antigen receptor discovery refers to identifying one or more antigen receptors that recognizes a specific antigen. For example, antigen receptor discovery may comprise identifying one or more specific TCRs of a plurality of TCRs that recognize a specific antigen. In some embodiments, identified antigen receptors (e.g. TCRs) can be used for immunotherapy. In some embodiments, the SABRs described herein can be used for both antigen discovery and antigen receptor discovery.
(148) Some embodiments herein relate to a method for antigen discovery, the method comprising: expressing any of the SABRs described herein in at least one reporter cell, wherein the reporter cell produces a measurable signal upon a signal transduction event that occurs upon binding of a an antigen receptor to the antigen presenting domain, incubating the at least one reporter cell with an antigen receptor to be tested for binding to the SABR, detecting a presence of a measurable signal in the at least one reporter cell when the antigen receptor binds, and identifying the at least one reporter cells producing the measurable signal, thereby identifying an antigen by associating the SABR in the cell with the reporter, with the antigen receptor.
(149) Some embodiments herein relate to a method for antigen discovery, the method comprising: expressing any of the SABRs described herein in at least one reporter cell, wherein the at least one reporter cell produces a measurable signal upon a signal transduction event that occurs upon binding of a an antigen receptor to the antigen presenting domain, incubating the at least one reporter cell with an antigen receptor to be tested for binding to the SABR, detecting a presence of a measurable signal in the at least one reporter cell when the antigen receptor binds, identifying the at least one reporter cells producing the measurable signal, thereby identifying an antigen by associating the SABR in the cell with the reporter, with the antigen receptor, and identifying at least one peptide in the at least one reporter cell producing the measurable signal, thereby associating the peptide with the SABR with the antigen receptor.
(150)
(151)
(152) Some embodiments herein relate to a method for antigen discovery, the method comprising: expressing any of the SABRs described herein in at least one reporter cell, wherein the at least one reporter cell produces a measurable signal upon a signal transduction event that occurs upon binding of an antigen receptor to the antigen presenting domain, incubating the at least one reporter cell with an antigen receptor to be tested for binding to the SABR, detecting a presence of a measurable signal in the at least one reporter cell when the antigen receptor binds, and identifying the at least one reporter cell producing the measurable signal, thereby identifying an antigen by associating the SABR in the cell with the reporter, with the antigen receptor, wherein the antigen receptor comprises a soluble molecule.
(153) Some embodiments herein relate to a method for antigen discovery, the method comprising: expressing any of the SABRs described herein in at least one reporter cell, wherein the reporter cell produces a measurable signal upon a signal transduction event that occurs upon binding of a an antigen receptor to the antigen presenting domain, incubating the at least one reporter cell with an antigen receptor to be tested for binding to the SABR, detecting a presence of a measurable signal in the at least one reporter cell when the antigen receptor binds, and identifying the at least one reporter cell producing the measurable signal, thereby identifying an antigen by associating the SABR in the cell with the reporter, with the antigen receptor, wherein the antigen receptor comprises a soluble molecule, wherein the soluble molecule comprises an antibody.
(154) Some embodiments herein relate to a method for antigen discovery, the method comprising: expressing any of the SABRs described herein in at least one reporter cell, wherein the reporter cell produces a measurable signal upon a signal transduction event that occurs upon binding of a an antigen receptor to the antigen presenting domain, incubating the at least one reporter cell with an antigen receptor to be tested for binding to the SABR, detecting a presence of a measurable signal in the at least one reporter cell when the antigen receptor binds, and identifying the at least one reporter cell producing the measurable signal, thereby identifying an antigen by associating the SABR in the cell with the reporter, with the antigen receptor, wherein the antigen receptor is expressed on a cell.
(155) Some embodiments herein relate to a method for antigen discovery, the method comprising: expressing any of the SABRs described herein in at least one reporter cell, wherein the reporter cell produces a measurable signal upon a signal transduction event that occurs upon binding of a an antigen receptor to the antigen presenting domain, incubating the at least one reporter cell with an antigen receptor to be tested for binding to the SABR, detecting a presence of a measurable signal in the at least one reporter cell when the antigen receptor binds, and identifying the at least one reporter cell producing the measurable signal, thereby identifying an antigen by associating the SABR in the cell with the reporter, with the antigen receptor, wherein the antigen receptor is expressed on a cell, and wherein the antigen receptor comprises a TCR expressed on a T cell.
(156) Some embodiments herein relate to a method for antigen discovery, the method comprising: expressing any of the SABRs described herein in at least one reporter cell, wherein the reporter cell produces a measurable signal upon a signal transduction event that occurs upon binding of a an antigen receptor to the antigen presenting domain, incubating the at least one reporter cell with an antigen receptor to be tested for binding to the SABR, detecting a presence of a measurable signal in the at least one reporter cell when the antigen receptor binds, and identifying the at least one reporter cell producing the measurable signal, thereby identifying an antigen by associating the SABR in the cell with the reporter, with the antigen receptor, wherein the at least one reporter cell comprises a library of cells, wherein the library of cells have numerous different SABRs, and wherein the numerous different SABRs can bind to different antigen receptors.
(157) Some embodiments herein relate to a method for antigen discovery, the method comprising: expressing any of the SABRs described herein in at least one reporter cell, wherein the reporter cell produces a measurable signal upon a signal transduction event that occurs upon binding of a an antigen receptor to the antigen presenting domain, incubating the at least one reporter cell with an antigen receptor to be tested for binding to the SABR, detecting a presence of a measurable signal in the at least one reporter cell when the antigen receptor binds, and identifying the at least one reporter cell producing the measurable signal, thereby identifying an antigen by associating the SABR in the cell with the reporter, with the antigen receptor, wherein the antigen receptor comprises numerous antigen receptors
(158) Some embodiments herein relate to a method for antigen discovery, the method comprising: expressing any of the SABRs described herein in at least one reporter cell, wherein the reporter cell produces a measurable signal upon a signal transduction event that occurs upon binding of a an antigen receptor to the antigen presenting domain, incubating the at least one reporter cell with an antigen receptor to be tested for binding to the SABR, detecting a presence of a measurable signal in the at least one reporter cell when the antigen receptor binds, and identifying the at least one reporter cell producing the measurable signal, thereby identifying an antigen by associating the SABR in the cell with the reporter, with the antigen receptor, wherein numerous different SABRs are expressed and one determines which SABR a particular antigen receptor binds to (antigen discovery) by monitoring the measurable signal and identifying which SABR is in the cell that exhibited the measurable signal.
(159) Some embodiments herein relate to a method for antigen discovery (and/or antigen receptor discovery), the method comprising: expressing any of the SABRs described herein in at least one reporter cell, wherein the reporter cell produces a measurable signal upon a signal transduction event that occurs upon binding of an antigen receptor to the antigen presenting domain, incubating the at least one reporter cell with an antigen receptor to be tested for binding to the SABR, detecting a presence of a measurable signal in the at least one reporter cell when the antigen receptor binds, and identifying the at least one reporter cell producing the measurable signal, thereby identifying an antigen by associating the SABR in the cell with the reporter, with the antigen receptor, wherein more than one antigen receptor is present and one determines which antigen receptor binds to a particular SABR.
(160) Some embodiments herein relate to a method for antigen discovery (and/or antigen receptor discovery_, the method comprising: expressing any of the SABRs described herein in at least one reporter cell, wherein the reporter cell produces a measurable signal upon a signal transduction event that occurs upon binding of a an antigen receptor to the antigen presenting domain, incubating the at least one reporter cell with an antigen receptor to be tested for binding to the SABR, detecting a presence of a measurable signal in the at least one reporter cell when the antigen receptor binds, and identifying the at least one reporter cell producing the measurable signal, thereby identifying an antigen by associating the SABR in the cell with the reporter, with the antigen receptor, wherein more than one antigen receptor and more than one SABR are present.
(161) Some embodiments herein relate to a method for antigen discovery, the method comprising: expressing any of the SABRs described herein in at least one reporter cell, wherein the reporter cell produces a measurable signal upon a signal transduction event that occurs upon binding of a an antigen receptor to the antigen presenting domain, incubating the at least one reporter cell with an antigen receptor to be tested for binding to the SABR, detecting a presence of a measurable signal in the at least one reporter cell when the antigen receptor binds, and identifying the at least one reporter cell producing the measurable signal, thereby identifying an antigen by associating the SABR in the cell with the reporter, with the antigen receptor, wherein the reporter cells comprise NFAT-GFP-Jurkat cells.
(162) Some embodiments herein relate to a method for antigen discovery, the method comprising: expressing any of the SABRs described herein in at least one reporter cell, wherein the reporter cell produces a measurable signal upon a signal transduction event that occurs upon binding of a an antigen receptor to the antigen presenting domain, incubating the at least one reporter cell with an antigen receptor to be tested for binding to the SABR, detecting a presence of a measurable signal in the at least one reporter cell when the antigen receptor binds, and identifying the at least one reporter cell producing the measurable signal, thereby identifying an antigen by associating the SABR in the cell with the reporter, with the antigen receptor, wherein the reporter cells comprise NFAT-GFP-Jurkat cells, cells of any T cell line, cells of any B cell line, cells of any NK cell line, monocytic cell line, or myeloid cell line
(163) Some embodiments herein relate to a method for antigen discovery, the method comprising: expressing any of the SABRs described herein in at least one reporter cell, wherein the reporter cell produces a measurable signal upon a signal transduction event that occurs upon binding of a an antigen receptor to the antigen presenting domain, incubating the at least one reporter cell with an antigen receptor to be tested for binding to the SABR, detecting a presence of a measurable signal in the at least one reporter cell when the antigen receptor binds, and identifying the at least one reporter cell producing the measurable signal, thereby identifying an antigen by associating the SABR in the cell with the reporter, with the antigen receptor, wherein the measureable signal comes from expression of a detectable marker.
(164) Some embodiments herein relate to a method for antigen discovery, the method comprising: expressing any of the SABRs described herein in at least one reporter cell, wherein the reporter cell produces a measurable signal upon a signal transduction event that occurs upon binding of a an antigen receptor to the antigen presenting domain, incubating the at least one reporter cell with an antigen receptor to be tested for binding to the SABR, detecting a presence of a measurable signal in the at least one reporter cell when the antigen receptor binds, and identifying the at least one reporter cell producing the measurable signal, thereby identifying an antigen by associating the SABR in the cell with the reporter, with the antigen receptor, wherein the reporter cells expressing the measurable signal are identified using flow cytometry.
(165) Some embodiments herein relate to a method for antigen discovery, the method comprising: expressing any of the SABRs described herein in at least one reporter cell, wherein the reporter cell produces a measurable signal upon a signal transduction event that occurs upon binding of a an antigen receptor to the antigen presenting domain, incubating the at least one reporter cell with an antigen receptor to be tested for binding to the SABR, detecting a presence of a measurable signal in the at least one reporter cell when the antigen receptor binds, and identifying the at least one reporter cell producing the measurable signal, thereby identifying an antigen by associating the SABR in the cell with the reporter, with the antigen receptor, wherein the antigen receptor cells comprise cells expressing orphan T-cell receptors (TCR).
(166) Some embodiments herein relate to a method for antigen discovery, the method comprising: expressing any of the SABRs described herein in at least one reporter cell, wherein the reporter cell produces a measurable signal upon a signal transduction event that occurs upon binding of a an antigen receptor to the antigen presenting domain, incubating the at least one reporter cell with an antigen receptor to be tested for binding to the SABR, detecting a presence of a measurable signal in the at least one reporter cell when the antigen receptor binds, and identifying the at least one reporter cell producing the measurable signal, thereby identifying an antigen by associating the SABR in the cell with the reporter, with the antigen receptor, wherein the antigen receptor comprises an expressed orphan T-cell receptors (TCR).
(167) Some embodiments herein relate to a method for antigen discovery, the method comprising: expressing any of the SABRs described herein in at least one reporter cell, wherein the reporter cell produces a measurable signal upon a signal transduction event that occurs upon binding of a an antigen receptor to the antigen presenting domain, incubating the at least one reporter cell with an antigen receptor to be tested for binding to the SABR, detecting a presence of a measurable signal in the at least one reporter cell when the antigen receptor binds, and identifying the at least one reporter cell producing the measurable signal, thereby identifying an antigen by associating the SABR in the cell with the reporter, with the antigen receptor, wherein the at least one reporter cell expresses a genetically encoded antigen or antigenic epitope.
(168) Some embodiments herein relate to a method for antigen discovery, the method comprising: expressing any of the SABRs described herein in at least one reporter cell, wherein the reporter cell produces a measurable signal upon a signal transduction event that occurs upon binding of a an antigen receptor to the antigen presenting domain, incubating the at least one reporter cell with an antigen receptor to be tested for binding to the SABR, detecting a presence of a measurable signal in the at least one reporter cell when the antigen receptor binds, and identifying the at least one reporter cell producing the measurable signal, thereby identifying an antigen by associating the SABR in the cell with the reporter, with the antigen receptor, wherein the at least one reporter cell expresses a genetically encoded antigen or antigenic epitope, and further comprising identifying the genetically encoded antigen or antigenic epitope by DNA sequencing.
Cell Libraries
(169) Each of the embodiments provided herein with regard Signaling and Antigen-Presenting Bifunctional Receptors can be used within the present embodiments described herein with regard to Cell Libraries.
(170) Some embodiments herein relate to a library comprising: any of the SABRs described herein, and at least one candidate antigen receptor.
(171) Some embodiments herein relate to a library comprising: any of the SABRs described herein, and at least one candidate antigen receptor, wherein the at least one antigen receptor is expressed on a cell, wherein the cell is an antigen receptor cell. Some embodiments herein relate to a library comprising: any of the SABRs described herein, and at least one candidate antigen receptor, wherein the at least one antigen receptor is expressed on a cell, wherein the cell is a reporter cell.
(172) Some embodiments herein relate to a library comprising: any of the SABRs described herein, and at least one candidate antigen receptor, wherein the at least one antigen receptor is expressed on a cell, wherein the SABR is expressed on a reporter cell, such that the cell provides a detectable marker upon binding of the SABR to the antigen receptor.
(173) Some embodiments herein relate to a library comprising: any of the SABRs described herein, and at least one candidate antigen receptor, wherein the at least one antigen receptor is expressed on a cell, wherein the reporter cell comprises NFAT-GFP-Jurkat cells.
(174) Some embodiments herein relate to a library comprising: any of the SABRs described herein, and at least one candidate antigen receptor, wherein the at least one antigen receptor is expressed on a cell, wherein the at least one antigen receptor is expressed on a cell, wherein the cell is an antigen receptor cell, and wherein the antigen receptor cell comprises T cells comprising TCR.
(175) Some embodiments herein relate to a library comprising: any of the SABRs described herein, and at least one candidate antigen receptor wherein the at least one antigen receptor is expressed on a cell, wherein the cell is an antigen receptor cell, and wherein the antigen receptor cell comprises a cell expressing orphan TCR.
(176)
Therapeutic Methods
(177) Each of the embodiments provided above with regard Signaling and Antigen-Presenting Bifunctional Receptors can be used within the present embodiments described herein with regard to Therapeutic Methods.
(178) Some embodiments herein relate to a method for initiating a therapeutic response, the method comprising: transducing a therapeutic cell with any one or more of the SABRs described herein, and administering the therapeutic cell to a subject in need of treatment, wherein the SABR directs a cellular response in the subject upon binding to an antigen receptor in the subject. Some embodiments herein relate to a method for initiating a therapeutic response, the method comprising: transducing a therapeutic cell with any one or more of the SABRs described herein, and administering the therapeutic cell to a subject in need of treatment, wherein the SABR directs a cellular response in the subject upon binding to an antigen receptor in the subject, and wherein the therapeutic cell comprises CD8+ T cells, CD4+ T cells, Regulatory T cells, B cells, NK cells, Dendritic cells, Macrophages, Monocytes, or any hematopoietic cells including, for example hematopoietic stem cells, progenitors, lymphoid and myeloid cells.
(179) Some embodiments herein relate to a method for initiating a therapeutic response, the method comprising: transducing a therapeutic cell with any one or more of the SABRs described herein, and administering the therapeutic cell to a subject in need of treatment, wherein the SABR directs a cellular response in the subject upon binding to an antigen receptor in the subject, and wherein the cellular response results in one or more of: cell mediated cytotoxicity, release of inflammatory cytokines, release of suppressive cytokines, direct suppression of target cells, release of anti-inflammatory cytokines, induction of pro-proliferative signals, induction of anti-proliferative signals, induction of apoptosis, induction of cell exhaustion markers, or direct target cell activation.
(180) Some embodiments herein relate to a method for initiating a therapeutic response, the method comprising: transducing a therapeutic cell with any one or more of the SABRs described herein, and administering the therapeutic cell to a subject in need of treatment, wherein the SABR directs a cellular response in the subject upon binding to an antigen receptor in the subject, and wherein the therapeutic cell destroys a pathogenic T cell.
(181) Some embodiments herein relate to a method for initiating a therapeutic response, the method comprising: transducing a therapeutic cell with any one or more of the SABRs described herein, and administering the therapeutic cell to a subject in need of treatment, wherein the SABR directs a cellular response in the subject upon binding to an antigen receptor in the subject, and wherein the therapeutic cell activates a target T cell.
(182) Some embodiments herein relate to a method for initiating a therapeutic response, the method comprising: transducing a therapeutic cell with any one or more of the SABRs described herein, and administering the therapeutic cell to a subject in need of treatment, wherein the SABR directs a cellular response in the subject upon binding to an antigen receptor in the subject, and wherein the therapeutic cell suppresses a pathogenic T cell.
(183) Some embodiments herein relate to a method for treating a patient comprising introducing into the patient a therapeutic T-cell comprising an extracellular peptide-MHC complex, the peptide-MHC complex comprising an antigen presenting domain linked to a signal transduction domain, wherein the antigen presenting domain comprises an MHC.
Therapeutic T Cell Compositions
(184) Each of the embodiments provided herein with regard Signaling and Antigen-Presenting Bifunctional Receptors can be used within the present embodiments described herein with regard to Therapeutic T Cell Compositions.
(185) Some embodiments herein relate to a composition comprising: a therapeutic T-cell comprising any of the SABRs described herein.
Additional SABR Compositions
(186) Provided in this section are additional options for arrangements and combinations of SABRs and uses thereof.
(187) Some embodiments herein relate to a SABR comprising: an extracellular binding domain comprising an MHC and a peptide epitope, a transmembrane domain, and a cytoplasmic signaling domain.
Cell-based Platform for T cell Antigen Discovery
(188) Each of the embodiments provided herein with regard Signaling and Antigen-Presenting Bifunctional Receptors can be used within the present embodiments described herein with regard to a Cell-Based Platform for T cell Antigen Discovery.
(189) Some embodiments herein relate to chimeric SABRs in a novel cell-based platform for TCR antigen discovery. In some embodiments, SABRs present an extracellular peptide-MHC complex and induce intracellular signaling via a TCR-like signal upon binding with a cognate TCR. Some embodiments herein relate to antigen discovery using SABR libraries to screen, for example, thousands of antigenic epitopes. This platform was verified by identifying the targets recognized by public TCRs of known specificities. Moreover, this approach can be extended for personalized neoantigen discovery. In some embodiments, the antigen discovery platform described herein can provide a scalable and versatile way to develop novel targets for immunotherapy.
(190) A CD8+ T cell encodes a unique surface T Cell Receptor (TCR) that recognizes 8-12 residue long peptide epitopes presented on class I MHC molecules, also known as Human Leukocyte Antigens (HLA) in humans. When a TCR complex binds cognate peptide-MHC (pMHC), the CD3 chains associated with the TCR complex dimerize to initiate downstream signaling. Multiple signaling cascades are activated, leading to rapid gene expression driven by the transcription factors NF-B, AP-1, and NFAT7. In CD8+ T cells, TCR signaling induces expression of early activation markers (CD69 and CD107a), release of cytotoxic granules, and secretion of cytokines (IFN, IL2, and TNF), ultimately killing the target cell. The interaction of cognate TCR and pMHC complexes generates a high degree of specificity towards a target antigen. T cells can recognize epitopes presented by tumor cells and infiltrate the tumor microenvironment. Antitumor T cells respond to two kinds of tumor-derived epitopes: 1) Public or private epitopes originating from non-mutated, tissue specific antigens or cancer-testis antigens, and 2) Private neoantigens originating from non-synonymous mutations. Both endogenous antigens and neoantigens can be used to provide targets of immunotherapies.
(191) One of the bottlenecks in the field of tumor immunology is the identification of the antigen recognized by a particular antitumor CD8+ T cell. Several techniques have been developed to identify cognate antigens for T cells. The most common approach uses pMHC multimers to identify antigen-specific T cells by flow cytometry. However, antigen discovery using pMHC multimers requires ab initio knowledge of the antigenic landscape, is not scalable beyond 10.sup.3 antigens, but can identify multiple antigenic specificities simultaneously. This approach has been used to discover public tumor antigens as well as private neoantigens. One approach uses degenerate libraries of covalently linked. Following multiple rounds of selection, outgrowth, sequencing, and referencing tumor exome data, the cognate antigen of the TCR is identified. However, this approach is technically challenging because of the requirement of soluble TCR, does not represent the physiological TCR-pMHC interaction, but is antigen-agnostic and scalable to 106-108 epitopes. These limitations underscore the need for new techniques for T cell antigen discovery.
(192) Some embodiments herein thus relate to novel antigen discovery techniques to address the unmet need. In some embodiments, cell-based platforms for T cell antigen discovery are presented. In some embodiments, by combining antigen presentation by pMHC complexes with intracellular signaling, SABRs allow identification of a successful TCR-pMHC interaction. Some embodiments relate to TCR antigen discovery using SABR libraries and its use for known public TCRs. Some embodiments relate to adaptation of SABR libraries for a personalized neoantigen-directed approach. Some embodiments describe a flexible and scalable method for T cell antigen discovery.
Additional Contemplated Embodiments
(193) Each of the embodiments provided above with regard Signaling and Antigen-Presenting Bifunctional Receptors can be used within the present embodiments described herein with regard to Additional Contemplated Embodiments.
(194) Various embodiments described herein address the limitations of the TCR-Antigen-MHC interaction through the introduction of SABRs. The use of SABRs, as discussed herein, allows for the utilization of TCR-Antigen-MHC interactions for various functions.
(195) In some embodiments, a function enabled by the SABRs disclosed herein comprises uncovering T cell antigenic specificities in cancers, infectious diseases, and autoimmune diseases. T cell-mediated responses to cancers target multitude of antigens expressed on cancer cells. Knowing the antigens that are targeted is immensely useful for immunotherapy approaches to treat cancers. There are several technologies to uncover epitopes that are targeted by T cells. The most widely used technologies are based on using MHC-peptide-multimers. The use of MHC multimers has several drawbacksit is labor intensive and not easily scalable, it is not trivial for class II MHC-peptide complexes, and it is not sensitive towards low-affinity interactions. Yeast display has also been tested for TCR antigen discovery but suffers from several drawbacks as well. Yeast display relies on using peptide-MHC-b2microglobulin single chain trimers (SCTs), which mimic antigen presentation and link the antigen genetically to MHC. However, the use of SCT Yeast display technology requires production of soluble TCR molecules, which is not robust, and which cannot be scaled to multiple TCRs easily. Moreover, because yeast lacks endogenous MHC, the SCTs may not fold correctly and may not represent physiological TCR binding. Other technologies that are antigen-directed require prior knowledge of antigenic epitopes from patient samples, or that require expansion of patient T cells that may bias the antigen specificity, or that require large amounts of patient samples that may not be available. The SABR technology described here uses an unbiased approach that will use a library of target cells that are recognized by a given T cell or a TCR. SABRs allow scalability of this approach to, for example, over 10.sup.6 epitopes and virtually all MHC alleles, including class I and class II alleles, does not require soluble TCR production, allows for low-affinity TCR-pMHC interactions, and can be used without patient tumor samples.
(196) In some embodiments, another function enabled by the SABRs disclosed herein comprises studying T cell receptor cross-reactivity and heteroclitic ligands. TCRs display considerable promiscuity in recognition of the variants of their cognate epitope. The study of TCR cross-reactivity is important to understand the safety and efficacy of a TCR or a T cell bearing a particular TCR. In cancer immunotherapy, the knowledge of the cross-reactivity of a TCR can help understand the off-target or on-target, but unintended effects of using that TCR therapeutically without undesirable side effects. In immunotherapy for viruses such as HIV, the knowledge of TCR cross-reactivity can help understand the propensity of immune escape of the pathogen from that TCR. The current technologies of studying TCR cross-reactivity are based either on low-throughput methods using individual variant peptides, or on yeast display technologies that are laborious and require production of soluble TCRs. In some embodiments, the SABR technology described herein allows for construction of libraries of, for example, 10.sup.3-10.sup.6 antigenic epitope variants for any given MHC-peptide combination, and for subsequent identification of variants that are recognized, without the requirement for soluble TCR production. In addition, this approach can be used to identify variants of a given epitope that may have different binding properties, such as heteroclitic ligands with higher affinity and antagonists.
(197) In some embodiments, yet another function enabled by the SABRs disclosed herein comprises inducing specific T cell responses. Vaccination approaches that elicit T cell responses require presentation of antigen epitopes to T cells and subsequent stimulation of those T cells. Professional antigen presenting cells (APCs) process endogenous or foreign antigens and present them to T cells. Antigen-specific immunity can be elicited by using live attenuated or inactive viruses, soluble antigenic proteins, or by using vectors. However, in these approaches, the antigenic epitopes are processed by the natural cellular machinery, and hence there is no control over whether a given epitope will elicit a strong immune response. To elicit a response to a given epitope, it is expressed in APCs via expression cassettes for entire proteins of via tandem minigenes encoding epitopes. Single chain trimers can also be used to express a given MHC-peptide complex on APCs to elicit an immune response. As single chain trimers cannot signal in the APC, they cannot manipulate how the APC will stimulate T cells. In some embodiments, the SABRs described herein can be coupled to specific signaling molecules that can allow the APCs to secrete cytokines and activate T cells that recognize them. In some embodiments, SABRs can be configured to elicit immunosuppressive cytokines in APCs, which can cause suppression of particular responses.
(198) In some embodiments, yet another function enabled by the SABRs disclosed herein comprises eliminating T cell specificities. Pathogenic T cell clonal specificities may play a central role in T cell leukemias and autoimmune disorders. In T cell leukemia, the outgrown and transformed clones can be specifically targeted based on the antigenic epitopes recognized by them. In autoimmune disorders, T cell clones that are autoreactive can also be targeted based on their cognate epitopes Eliminating T cell clones based on their antigenic specificities allows for precise targeting with minimal off-target effects. The approaches tested so far have relied on monoclonal antibodies that recognize particular TCR variable regions. Targeting specific TCR variable regions provides precision but does not allow for targeting TCRs that may comprise of different variable regions while recognizing the same antigenic specificity. In addition, this approach can result in depletion of all TCRs comprising of a given variable region without regard for their specificities. In some embodiments, SABRs can allow for targeting of TCRs based on their antigen specificity. T cells transduced with SABRs presenting a given epitope can be used therapeutically to eliminate pathogenic T cell specificities. In addition, the identification of antigens that can be recognized by clonal T cells can be used for developing SABRs even without the knowledge of their natural cognate antigen. In some embodiments, the drawbacks of existing technologies can be overcome by linking signaling and antigen presentations through SABRs. By combining antigen presentation and signaling, SABRs allow a robust, scalable, high-throughput, and sensitive approach to initiate signal transduction in cells recognized by given TCRs, therefore allowing a functional output to be generated by them.
(199) In some embodiments, MHC molecules present peptide epitopes on a cell surface for recognition by T cells. In their native form, MHC molecules lack signaling domains, and cannot transduce any signal into the antigen presenting cell. Some embodiments described herein relate to a chimeric construct (e.g. SABR) that adds a signal transduction domain to the intracellular end of MHC molecules. In some embodiments, these SABRs are able to present antigen, and induce an intracellular signal upon recognition by a T cell. In some embodiments, SABRs have two or more distinct functional parts including, for example, including one or more antigen recognition domains that are based on MHC molecules, which present peptide epitopes to T cells. In some embodiments, these can either be genetically encoded and covalently linked to the MHC molecule or expressed in the cell and presented naturally by the MHC molecule. Additionally, in some embodiments, the SABRs comprise one or more signal transduction domains that induce an intracellular signal to induce a transcriptional response upon binding of the SABRs to their cognate T cells. The SABRs constructs can be used for multiple different purposes, such as for antigen-discovery in cancer, autoimmune disorders, and infectious diseases, for immunotherapeutic approaches to eliminate T cell specificities, for inducing antigen specific cytokine signaling.
(200)
(201) As shown in
(202)
(203)
(204) In summary, in various embodiments described herein, SABRs can be used as a robust, scalable, specific, and versatile way to couple antigen presentation and signaling. In various embodiments, this function can be exploited in several different ways to understand and manipulate T cell specificities.
(205) In certain embodiments, SABRs can be used for antigen discovery. Current technologies for antigen discovery include MHC multimers, functional assays, yeast display, mass spectrometry, and DNA barcoding/NACS. These technologies have several disadvantages including a lack of scalability, lack of ability to expand to many MHC alleles, need for specialized instrumentation, and lack of robustness. Moreover, all the current technologies focus on cancer-specific T cells, and MHC-I antigens. There is a severe dearth of approaches/strategies to identify MHC-II antigens.
(206) MHC multimers are produced by synthesizing peptide epitopes and re-folding them with biotinylated MHC molecules. However, MHC multimers are limited to 10-100 antigens at one time are therefore are not scalable. Moreover, making multimers for MHC-II antigens is technically challenging due to their inherent instability. Functional assays such as ELISPOT also rely on synthesizing peptide epitopes and presenting them on target cells. While it has been a popular technology, the scale up to include numerous MHC-I and MHC-II alleles, as well as a broad range of epitopes is complex. Yeast display techniques use MHC-peptide presentation on yeast cell surface followed by staining the yeast using a soluble TCR. Production of soluble TCRs is highly non-robust and time consuming, and therefore not easily scalable. Mass spectrometry techniques identify prospective antigenic epitopes based on mass spectrometry of antigen presenting cells. However, mass spectrometry requires a large amount of tissue, which is difficult to obtain for many diseases such as Type 1 Diabetes. Moreover, it also requires validation based on MHC multimers. Finally, DNA barcoding/NACS uses specialized barcoded MHC multimers that are immobilized on chips or beads. While effective, this technique is limited by the requirement for specialized equipment to capture cells and read their barcode, and by the inability to handle multiple sample at once.
(207) Some embodiments herein are directed to novel technologies for discovering and validating antigen reactivity of T cells. T cells are an essential part of the adaptive immune system that fights infections and cancers. T cells use their surface TCR to recognize antigenic peptide epitopes presented by MHC proteins. Antigens displayed on MHC can be either from pathogens (e.g. peptides from Influenza virus), from cancerous cells (e.g. MART1/MelanA peptide expressed on Melanoma cells), or from normal cells (e.g. ProInsulin peptide from normal pancreatic cells). T cell responses are protective in their normal form but can be pathogenic if dysregulated.
(208) T-cells are essential for immunity against viral infections and cancers but can cause autoimmune diseases like Type 1 Diabetes if they become dysfunctional. One of the biggest challenges in studying T cells is in the discovery of the specific protein antigens they recognize. In some embodiments, SABRs can be used to present protein antigens and induce a readable output of a T cell that recognizes them. In some embodiments, this ability of SABRs can solve the challenge of antigen identification and benefit the development of T cell mediated therapies. Some embodiments herein relate to using SABR technology for use in antigen discovery in numerous diseases including, for example, cancers, Type 1 Diabetes, multiple sclerosis, HIV/AIDS, and others. For example,
(209) Protective cell responses, such as those towards pathogens or cancers, are manipulated for prevention/therapy via vaccines or immunotherapies. Dysfunctional T cell responses specific for autoantigens can be pathogenic, such as those targeting normal pancreatic cells in Type 1 Diabetes. Two types of T cells mediate the immune response: CD8+ T cells that recognize 8-12 residue long peptides presented on class I MHC (MHC-I) molecules and initiate direct killing of infected or cancerous cells, and CD4+ T cells that recognize 12-17 residue long peptides presented on class II MHC (MHCII) molecules and provide immunologic help to CD8+ T cells. Both CD8+ and CD4+ T cells play important roles in protective and pathogenic immunity. Understanding the antigens targeted by these cells is an important factor for manipulating these responses. There is a growing need for technologies to identify and validate targeted antigens.
(210) Various embodiments herein are directed to novel technologies to identify and/or validate antigenic epitopes targeted by a given T cell. In some embodiments, the technology relies on synthetic proteins called SABRs.
(211) In some embodiments, SABRs perform various functions including presenting an antigenic epitope via an extracellular MHC domain and initiating a readable cellular signal upon recognition of that epitope via an intracellular signaling domain. In some embodiments, by combining these two functions, SABRs can present an antigen, and then transduce a signal if a T cell recognizes that antigen. In some embodiments, the transduced signal is converted to a readable output, such as expression of a reporter gene, e.g. GFP, to mark a recognized cell.
(212) In some embodiments, the various abilities of SABRs described herein can be used to screen for or validate reactivity to a given antigen, similar to ELISPOT assays. Example uses of this strategy according to various embodiments include monitoring vaccine/disease induced T cell responses in Influenza infection and screening for pathogenic autoreactive T cells in Type 1 Diabetes. Alternatively, in some embodiments, libraries of SABRs presenting numerous antigens can be constructed to identify antigens recognized by T cells of unknown specificity. Example uses of this strategy according to various embodiments include identification of tumor antigens recognized by tumor infiltrating lymphocytes and identification of neoantigen-specific T cell responses in cancer patients.
(213) In accordance with various embodiments herein, The SABR technologies present major advantages over existing technologies including scalability, ease of use, ability to identify MHC-II antigens, and easier commercialization. Therefore, in some embodiments, SABR technology can be used into a commercial method or kit that can enable T cell antigen discovery, diagnostics, and validation for infectious diseases, cancers, and autoimmune diseases. In some embodiments, the SABR technology can be commercialized include pre-packaged lentiviral vectors to express SABRs and cell-based libraries expressing SABRs.
Advantages of SABR Technology
(214) In some embodiments, the SABR library technology described herein has multiple advantages. In some embodiments, the SABR libraries described herein can be built at a flexible scale, from, for example, 1 to 10.sup.6 antigens or more, 100, 200, 300, 400, 1000, or more antigens in a library, depending on the disease in question. In some embodiments, the library can include hundreds of antigens for identifying a full protein's epitope, a couple of thousand antigens for diseases (neoantigen, listeria), or hundreds of thousands of antigens for broad identification
(215) Moreover, in some embodiments, this scale up/down can be performed in a standard immunology laboratory without the need for specialized equipment. SABR libraries can also be built for any given number of MHC alleles, making it easier to toggle between universal or patient-specific antigen libraries. Additionally, in some embodiments, the intended product and its use is in a format that requires routine laboratory procedures. Therefore, the turnaround time for using the product can be as low as 3-5 days. Furthermore, unlike yeast display or DNA barcoding, the SABR technology can be used on multiple samples at a time, increasing the throughput. Finally, in some embodiments, SABR libraries can be built for both MHC-I and MHC-II antigens, unlike the current technologies, which are restricted largely to MHC-I antigens. In some embodiments, this versatility allows the use of the SABR technology to a large number of autoimmune diseases.
(216) In some embodiments, The SABR technology may have a significant cost advantage over other approaches. In some embodiments, the implementation of the technology does not require the use of any specialized equipment that a standard immunology laboratory would not have. For instance, in some embodiments, a flow cytometry-based cell sorter and access to Illumina sequencing facilities is sufficient to implement the technology in an academic/industrial laboratory. Current technologies are limited by the need for specialized equipment, for instance, access to Mass Spectrometer (MS), or specialized chips for DNA barcoding/NACS. Also, in some embodiments, unlike other technologies, the SABR technology does not require synthesizing any specialized reagents that are critical to its implementation. For example, yeast display technology requires synthesizing a soluble TCR, which is highly non-robust and requires time consuming/expensive protein purification. In some embodiments, SABRs are used in simple cell-based assays which can be performed in a general BSL2 laboratory setting. In some embodiments, the SABR technology offers a higher throughput because of its ability to process multiple samples at once. Most of the current technologies can handle only one patient sample at a time.
(217) In some embodiments, the SABR technology can be manufactured on a mass scale. In some embodiments, the number of antigens that can be encoded in the library can be scaled up/down as per the requirements that are diseases/user specific. For example, a library for cancer neoantigens for patient-specific screening may encode for 6000 peptides, whereas a universal library for multiple class I HLA alleles may have 10.sup.6 peptides. In some embodiments, the scalability at this level is dependent on large scale oligonucleotide synthesis. In some embodiments, a given SABR library, for instance, can be around 10.sup.5-10.sup.6 cells. In some embodiments, this number can be scaled up relatively easily, similar to commercially available cell lines.
(218) Any one or more of the embodiments described herein can be combined with another one or more of the embodiments described below. Any one or more of the compositions described below can be combined or substituted into any one of the methods and/or mechanisms described below.
EXAMPLES
Example 1
SABRs, Peptide Fusion, Signaling Domain-MHC, MHC-Peptide Antigen
(219) T cell activation upon recognizing a target antigen induces detectable gene expression. However, as MHC molecules lack signaling domains, detection of recognized APCs is challenging. Fusing an intracellular signaling domain to pMHC complexes enables signal transduction. Chimeric receptors called SABRs were constructed. The extracellular domain of a SABR was a covalently linked peptide-2microglobulin-MHC trimer, fused to an intracellular CD3 signaling domain with a CD28 co-stimulatory domain. Two variations of SABRs, SABR-F and SABR-E, were constructed which contained the entire MHC molecule or only the extracellular part of the MHC molecule respectively, as seen in
(220) Upon interaction with a TCR, SABRs presenting its cognate antigen can induce an intracellular signal.
(221) To detect the signal induced by SABRs, NFAT-GFP-Jurkat cells were used, which express GFP upon receiving a signal via CD3. NFAT-GFP-Jurkat cells were transduced with SABRs presenting the EAAGIGILTV epitope (from the MART1 protein) on HLA-A*0201 (hereafter known as A2-MART1-SABR) or the KRWIILGLNK epitope (KK10, from the HIV-1 Gag protein) from HIV-1 on HLA-B*2705 (hereafter known as B27-KK10-SABR). NFAT-GFP-Jurkat cells were co-incubated and transduced with Jurkat cells expressing TCRs and GFP expression was measured by flow cytometry after 8 hours. Specifically, F5 (recognizes A2-MART1), EC27 (recognizes B27-KK10), SL9 (recognizes A2-SLYNTVATL) TCRs or untransduced Jurkat cells were used. Robust GFP expression was detected only in co-culture assays with the cognate TCR-SABR-F pairs.
(222) The SABR-F construct showed higher signal than SABR-E construct, and therefore, was used for further experiments. To test if SABRs can detect T cell specificities in a polyclonal population, a number of Jurkat cells expressing F5 TCR were titrated with untranduced Jurkat cells and co-incubated them with NFAT-GFP-Jurkat cells expressing A2-MART1-SABR. SABR signaling was titratable and sensitive enough to detect at least as low as 10 F5+ Jurkat cells mixed with 10,000 mock-transduced Jurkat cells.
(223)
(224) SABR signaling was also rapid, as GFP signal was detectable within 3 hours of co-incubation, and reached saturation within 6-8 hours, as shown in
(225) Taken together, these results show that SABRs can induce signaling upon successful and specific TCR-pMHC interaction, allowing identification of recognized APCs.
Example 2
SABRs Allow Different Modes of Antigen Presentation
(226) The endogenous MHC complexes described above present epitopes from newly translated proteins or endocytosed proteins via cross-presentation. To test if SABRs can also utilize these pathways for antigen presentation, an empty version of SABRs was constructed that linked 2-microglobulin with A2 or B27 but did not genetically encode for an epitope.
(227) SABR-APCs were incubated with soluble peptides to test presentation and recognition of those peptides.
(228)
(229) Endogenously processed peptide epitopes were tested to determine if they could be presented on empty SABRs. Therefore, pentameric TMGs were constructed to express the KK10 epitope along with four irrelevant CMV-derived epitopes.
(230) NFAT-GFP-Jurkat cells were co-transduced with the empty B27-SABR and the KK10 TMG. Following co-incubation with EC27- or F5-expressing Jurkat cells, the empty SABRs were able to present the endogenously expressed epitopes and induce specific signaling, as illustrated in
(231) SABRs can present non-covalently linked epitopes generated through endogenous antigen processing and presentation pathways.
(232)
Example 3
SABRs Initiating Bona Fide TCR Signal
(233) To use SABRs as a therapeutic target, a SABR that binds to a pathogenic T cell in a patient can be identified. The SABR can be cloned into appropriate vectors for immunotherapy, such as lentiviral or retroviral vectors. The patient's own blood can be subjected to leukapheresis followed by isolation of T cells. The T cells can be activated and expanded using commercial methods such as using the OKT3 antibody. The expanded T cells can be transduced with the vector containing the SABR. The transduced cells can be reinfused into the patient as a therapeutic. The expanded T cells expressing the appropriate SABRs should target the pathogenic T cells in the patient and lead to elimination of the pathogenic T cells, leading to disease amelioration.
(234) This can be done for type 1 diabetes, where a pathogenic T cell can target an insulin-derived epitope in the context of HLA-A2.1 (A2.1-Insulin). In this case, a SABR comprising of HLA-A2.1, presenting the Insulin epitope, and a signaling domain can be cloned into a lentiviral vector. The patient's own T cells can be expanded and transduced with the A2.1-Insulin-SABR expressing vector. The cells can be reinfused into the patient, where they can eliminate the pathogenic T cells that target A2.1-Insulin.
(235) SABRs use a CD3-CD28 domain for intracellular signaling, similar to chimeric antigen receptors (CARs) and TCRs. Therefore, intracellular signaling ability of SABRs is comparable to TCRs was tested. SABRs ability to induce early activation markers in NFAT-GFP-Jurkat cells was tested. NFAT-GFP-Jurkat cells transduced with the A2-MART1-SABR expressed CD69, an early T cell activation marker, upon co-culture with Jurkat cells transduced with F5 TCR. Co-expression of reporter-driven GFP and endogenous CD69 in cells expressing A2-MART1-SABR, but not the A2-MART1 single chain trimer implies that SABR signaling activates endogenous gene expression, as shown in
(236) In some embodiments, if SABRs induce a bona fide TCR signal, they can confer cytotoxic capabilities to primary T cells. Activated primary T cells were transduced with A2-MART1-SABR and incubated with CFSE-labeled target cells expressing F5 TCR. Transduced primary T cells lysed Jurkat cells or primary T cells expressing the F5 TCR specifically, as shown in
(237) The antigen sensitivity of SABRs and TCRs was compared. To that end, NFAT-GFP-Jurkat cells were transduced with either empty A2-SABR or F5 TCR and used as effectors. As targets, Jurkat cells transduced with A2-SABR or F5 TCR were used, as shown in
(238) Effectors were co-cultured with their cognate targets in presence of a range of concentrations of the MART1 peptide, and GFP expression was measured. Antigen sensitivity was determined as the concentration of the peptide required for half-maximal signaling. The antigen sensitivity of SABRs was 30-fold lower as compared to TCRs, as shown in in
(239) Taken together, these results show that SABRs signal similar to TCRs, albeit, in some examples, with lower antigen sensitivity.
(240) Example 3 above is also an example of SABRs as a therapeutic. For example, in a case where the F5 TCR can be substituted with a pathogenic TCR, such as a TCR recognizing type 1 diabetes antigens. In the therapeutic scenario, a similar experiment to show efficacy can be done where the SABR is presenting the antigen recognized by the pathogenic TCR. Primary T cells expressing the said SABR can then be used to induce cytotoxicity against the pathogenic TCR, and subsequently eliminate them for therapeutic benefit
Example 4
Antigen Discovery using SABR Libraries
(241) In some embodiments, by virtue of genetically linking the peptide epitope with MHC, SABRs can be used to present a defined antigen and to report its successful recognition by a TCR. Therefore, SABR libraries ability to present a large number of epitopes to be used to screen successful TCR-pMHC interactions was tested. A strategy to construct and use SABR libraries for T cell antigen discovery of orphan antitumor TCRs with unknown antigens was created. First, a list of target epitopes was generated from an existing database or from tumor exome data followed by prediction of MHC binding. Pooled oligonucleotide libraries encoding for target epitopes were synthesized and cloned into the SABR plasmid, according to
(242) The SABR libraries were packaged into lentiviral vectors and used to transduce NFAT-GFP-Jurkat cells. NFAT-GFP-Jurkat cells expressing the SABR library were co-cultured with Jurkat cells expressing an orphan TCR. GFP+CD69+ NFAT-GFP-Jurkat cells were sorted using fluorescence activated cell sorting (FACS), followed by genomic DNA extraction. The epitope portion of the SABRs was amplified and subjected to high throughput sequencing, as shown in
(243) The sequencing reads were aligned with the SABR vector backbone using Burrows-Wheeler alignment. Aligned reads were translated to reveal the epitope. The number of reads corresponding to each epitope was counted and reported in a list. A minimum of three replicates of the co-incubation assay were performed. For each replicate, a numerical rank was given to each epitope based on descending order of the number of reads. The rank from three replicates for each assay was averaged and reported as Average Rank, according to the flowchart in
(244) The top ranked epitopes were putative antigens for that TCR and are subsequently validated by constructing individual SABRs presenting each of the epitopes and measuring GFP expression in co-culture assays.
(245) To demonstrate proof-of-concept of the approach detailed in
(246) The average ranks of each of the epitopes from the SL9 sort against those from F5 sort were plotted.
(247) Six epitopes formed a distinct cluster by their rank in the F5 sort. In the SL9 sort, the top ranks were outliers, but did not form a separate cluster.
(248)
(249) The noise observed in the SL9 sort was presumably due to the higher number of analogs of the SLYNTVATL peptide. The A2-SABR library contains 22 analogs EAAGIGILTV and 60 analogs of SLYNTVATL. A higher number of recognized analogs would lower the average rank for each of the epitopes because of competition among the epitopes.
(250) The ranks of all the analogs of EAAGIGILTV and SLYNTVATL in the sorts were compared. Six out of twenty-two EAAGIGILTV analogs were identified in the F5 sort, as shown in
Example 5
Personalized Neoantigen Discovery Using SABRs
(251) SABRs can be implemented to identify candidate T cell receptors (TCRs) for immunotherapy of a tumor. Genomic DNA or RNA from a tumor biopsy would first be sequenced and compared to non-tumor tissue from that patient. Mutations specific to the tumor, termed neo-antigens, would be an ideal target for immunotherapy, with the hope of not inducing an immune response anywhere else in the patient's body. A list of these mutations would be generated, filtering out mutations that do not change the amino acid sequence of the patient's proteins. This list would be used to generate a list of short peptides (8-12 amino acids for class I MHC and 12-17 amino acids for class II MHC) that would contain these mutations. The peptide list would then be converted to short oligonucleotide sequences that contain the genetic encoding of those peptides flanked by the nucleotide sequences required for cloning into the SABR vector. These oligonucleotides would be synthesized and then cloned into the vector, using whatever molecular techniques are appropriate. Then that vector will be put in cells, using appropriate techniques. In our case, we used the In-Fusion kit that simplifies Gibson assembly to clone the vector. We generated lentivirus from the resultant plasmid, and infected NFAT-GFP-Jurkat cells. This batch of cells, each expressing a unique SABR, is what we call the SABR library. Overall, each cell contains an MHC molecule linked to a unique short peptide with a tumor mutation, and those MHC molecules are directly linked to a signaling domain, creating a SABR. Enough cells were infected with lentivirus so that the batch of cells cover all mutations in the list of short peptides.
(252) To use the library to find a patient-specific therapy, the same tumor biopsy would be sequenced for RNA of TCR alpha and beta fragments. These fragments are from T cells that were invading the tumor in an attempt to suppress the tumor, known as tumor-infiltrating lymphocytes (TILs). Individual TCRs from these cells would be reconstructed from the sequencing, a fragment of DNA containing that TCR sequence would be synthesized and cloned into a vector, using whatever techniques are appropriate. Lentivirus of that plasmid would be generated and Jurkat cells (without the NFAT-GFP reporter) would be infected with that virus. The candidate TCR cells would then be co-incubated with the SABR library, for about 8 hours, then sorted on FACS sort for cells that show positive signal. In our case, the reporters were GFP and expression of CD69 cell marker. Genomic DNA from the sorted cells would be extracted, sequenced, and analyzed to determine which specific antigen is recognized by the candidate TCR. In our case, the genomic DNA was extracted with the NucleoSpin column extraction kit, PCR amplified with primers flanking the genetically encoded antigen sequence, re-amplified with primers specific for illumina sequencing, and sequenced. The resultant sequencing data was compared to a database of the short peptide sequences, and if the TCR recognizes those peptides, we expect to see an enriched genetic sequence in the pool of extracted genomic DNA.
(253) If the TCR recognizes a mutation sequence, but not the unmutated sequence, it would be a good candidate for immunotherapy. That would involve extracting immune cells from the patient, using whatever technique desired to make those cells express the desired TCR, and infusing those adoptive cells back into the patient so that they can start attacking the tumor.
(254) To further demonstrate the versatility of SABR libraries, a personalized approach for neoantigen discovery was tested. A recent study identified a neoantigen-specific, tumor-reactive TCR from a melanoma patient using DNA-barcoded tetramers. The identified TCR (neoTCR) was shown to recognize a neoantigen epitope created by a non-synonymous mutation in the USP7 protein. The SABR library approach was used to identify the neoantigen epitope recognized by the neoTCR by screening all possible neoepitopes identified in the tumor sample. To that end, a SABR library presenting 3291 predicted HLA-A*0201-restricted epitopes (NeoAg-SABR library) corresponding to 108 non-synonymous mutations found in the tumor was generated. The neoTCR was used as a surrogate for a tumor-reactive orphan TCR and the NeoAg-SABR library was used to identify its antigen. Jurkat cells transduced with neoTCR were co-cultured with NFAT-GFP-Jurkat cells expressing the NeoAg-SABR library, GFP+CD69+ cells were sorted, and epitopes from the sorted cells were sequenced and ranked.
(255) For each epitope, the average ranks from the neoTCR sort against a mock-sort were plotted.
(256)
(257)
(258) These results demonstrate validation as well as successful personalization of the antigen discovery approach presented herein. Collectively, the results demonstrate that the SABRs are powerful tools for T cell antigen discovery.
Example 6
Materials and Methods
(259) The specific reagents used in Examples 1-5 are detailed in Table 6.1. The oligonucleotide primers used for cloning and sequencing are listed in Table 6.2. The lists of epitopes in the A2-SABR libraries are listed in Tables 6.3
(260) TABLE-US-00004 TABLE 6.1 Product Name Manufacturer/Source Cat. No Jurkat Cells, Clone E6-1 ATCC, Manassas, VA TIB-152 NFAT-GFP-Jurkat Cells Provided by Arthur Weiss and Yvonne N/A Chen Primary T Cells UCLA, CFAR Virology Core N/A HEK-293T Cells ATCC, Manassas, VA CRL-3216 RPMI 1640, 1X with L- Corning, Corning, NY 10-040-CV glutamine 10% Fetal Bovine Serum Corning, Corning, NY 35-015-CV Penicillin-Streptomycin Corning, Corning, NY 30-002-CI Solution, 100X G-418 Sulfate Corning, Corning, NY 30-234-CI Immunocult CD3/28 T Cell StemCell Technologies, Vancouver, 10991 Activator Canada Human IL-2 IS, premium grade MACS Miltenyi Biotec, Bergisch 130-097-746 Gladbach, Germany EAAGIGILTV Synthesized by Pierce Thermo Fisher N/A KRWIILGLNK Synthesized by Pierce Thermo Fisher N/A DMEM, 1X with L-Glutamine, Corning, Corning, NY 10-013-CV 4.5 g/L Glucose and Sodium Pyruvate Clontech In-Fusion HD Clontech, Takara Bio USA, Mountain 639650 Cloning Kit View, CA BsmBI New England BioLabs, Inc, Ipswich, R0580S MA Clontech Stellar Competent Clontech, Takara Bio USA, Mountain 636763 Cells View, CA Zyppy Plasmid Miniprep Kit Zymo Research, Irvine, CA D4036 Carbenicillin (disodium) Gold Biotechnology, Saint Louis, MO C-103-SL10 NucleoBond Xtra Maxi EF Clontech, Takara Bio USA, Mountain 740424.50 Kit View, CA TransIT-293 Transfection Mirus Bio, LLC Madison, WI MIR 2704 Reagent Gibco Opti-MEM I Life Technologies, Thermo Fisher 31985-062 Reduced Serum Medium Scientific, Waltham, MA Millex-HV Syringe Filter EMD Millipore, Burlington, MA SLHV033RS Unit, 0.45 m, PVDF, 33 mm, gamma sterilized MACSQuant Analyzer 10 MACS Miltenyi Biotec, Bergisch 130-096-343 Gladbach, Germany APC/Cy7 anti-human CD69 BioLegend, San Diego, CA 310913 Clone: FN50 BD FACSort Becton Dickinson, Franklin Lakes, NJ CFSE Cell Division Tracker Kit BioLegend, San Diego, CA 423801 Invitrogen PureLink Invitrogen Life Technologies, Thermo K182001 Genomic DNA Mini Kit Fisher Scientific, Waltham, MA KOD DNA Polymerase EMD Millipore, Burlington, MA 71085 Macherey-Nagel NucleoSpin Clontech, Takara Bio USA, Mountain 740609.250 Gel and PCR Purification Kit View, CA 2100 Bioanalyzer Instrument Agilent, Santa Clara, CA G2939BA Ilumina HiSeq 2500 Illumina San Diego, CA SY-401-2501 Sequencing System TreeStar FlowJo Flow FlowJo, LLC Ashland, Oregon N/A Cytometric Data Analysis Software v10 GraphPad Prism v7 GraphPad, San Diego, California N/A
(261) TABLE-US-00005 TABLE6.2 Primername Sequence(5-3) Purpose SS-Fwd AGCTCCTCGAGATGGCGACGGGTTCAAG SABRcloning (SEQIDNO:12138) CD28-Overlap- CCACCGCGAGACCTCTTGCTCCGCACTTTA SABRcloning HLA-A2-Rev CAAGCTGTGAGAGACACA (SEQIDNO:12139) CD28-Overlap- CCACCGCGAGACCTCTTGCTCCGAGCTGTG SABRcloning HLA-B27-Rev AGAGACACATCAGAGC (SEQIDNO:12140) CD28Intracell- CGGAGCAAGAGGTCTCGC SABRcloning Fwd (SEQIDNO:12141) XhoI-CD3z- TTGACCTCGAGTCATCTTGGTGGCAGAGCC SABRcloning Rev (SEQIDNO:12142) Oligo-Insert- CAGGAGGGCTCGGCA Cloningepitopesin Fwd (SEQIDNO:12143) SABRs Oligo-Insert- GGACCCTCCGCATCC Cloningepitopesin Rev (SEQIDNO:12144) SABRs Epitope-Oligo CAGGAGGGCTCGGCANNN...NNN Cloningepitopesin GGATGCGGAGGGTCC SABRs (SEQIDNO:12145) TruSeq-Univ- AATGATACGGCGACCACCGAGATCTACAC Highthroughput SCTfixed-F TCTTTCCCTACACGACGCTCTTCCGATCTG sequencing GCCTGCTTTGTTTGCC (SEQIDNO:12146) TruSeq-Read2- GTGACTGGAGTTCAGACGTGTGCTCTTCCG Highthroughput SCTfixed-R ATCTCCTCCACCACCGCTACCTC sequencing (SEQIDNO:12147) Truseq- CAAGCAGAAGACGGCATACGAGAT[index] Highthroughput Adapter-Index GTGACTGGAGTTCAGACGTGTGCTCTTCCG sequencing ATCT (SEQIDNO:12148)
(262) Within Table 6.2, NNN . . . NNN indicates a back-translated epitope and [index] indicates the 6-nucleotide unique index used for sequencing.
(263) For Examples 1-5, Jurkat cells (ATCC) were cultured in R10 (RPMI1640 (Corning) supplemented with 10% fetal bovine serum (Corning) and Penicillin/Streptomycin (Corning)). NFAT-GFP-Jurkat cells were cultured in R10 supplemented with 2 mg/ml G-418 (Corning). Primary T cells were activated in R10 supplemented with Immunocult CD3/28 (StemCell Technologies) and 40 U/ml IL-2 (Miltenyi Biotec). HEK-293T cells (ATCC) were cultured in D10 (DMEM (Corning) supplemented with 10% fetal bovine serum (Corning) and Penicillin/Streptomycin (Corning)). Peptides EAAGIGILTV and KRWIILGLNK were synthesized by Pierce Thermo Fisher.
(264) For constructing the SABRs of Examples 1-5, single molecules encoding for 2-microglobulin and HLA were synthesized as gBlocks (IDT) and amplified using primers SS-Fwd and CD28-Overlap-HLA-Rev. CD3/CD28 signaling domains were cloned from the J3 CAR using primers CD28Intracell-Fwd and XhoI-CD3z-Rev. The two parts of SABRs were assembled via PCR or via InFusion HD cloning kit (Takara). A synthetic 2 kb fragment of non-specific stuffer DNA (IDT) flanked by BsmBI sites was cloned in place of the epitope. To clone a given epitope into a SABR vector, the vector was first linearized by BsmBI digestion (NEB) and gel purified using Nucleospin Gel and PCR kit (Takara). A single stranded oligonucleotide containing overlaps with the vector and the epitope was synthesized (IDT). The oligonucleotides were amplified using KOD polymerase (Milipore) and Oligo-Insert-Fwd and Oligo-Insert-Rev. Amplified oligonucleotide was cloned into the linearized SABR vector using InFusion HD cloning kit (Takara). All cloning reactions were transformed into Stellar competent cells (Takara), grown on LB+Agar plates containing 100 g/ml Carbenicillin (Life Technologies), and individual colonies were inoculated in liquid culture. Plasmid minipreps were performed using Zyppy Miniprep kit (Zymo). Plasmids were verified by Sanger sequencing (Laragen).
(265) For TCR cloning of Examples 1-5, sequences for the F5, SL9, and neoTCR were synthesized as gBlocks (IDT) and cloned in the pCCLc-MND-X backbone along with a truncated form of LNGFR gene as previously described. EC27 TCR was cloned as described previously.
(266) To generate lists of epitopes to be cloned into SABR vectors in Examples 1-5, two approaches were taken. In the universal A2-SABR library, all HLA-A*0201-restricted epitopes from Immune Epitope Database (IEDB) were downloaded. In the neoantigen SABR library, HLA-A*0201-restricted neoepitopes generated from the tumor mutanome data were used. Protein sequences were back-translated to nucleotide sequences using the most abundant codon for each amino acid based on the GenScript Codon Usage Frequency Table Tool (GenScript). Oligonucleotides encoding for the epitopes and containing overlaps with the SABR vector were synthesized in pooled single stranded oligonucleotide libraries (Twist Biosciences). Oligonucleotide libraries were amplified and cloned into the SABR vector as described previously. To ensure sufficient coverage, bacterial cells transformed with the cloning reaction were inoculated directly into 500 ml liquid cultures overnight. The plasmid DNA containing the libraries was prepared using Nucleobond Xtra Maxi Plus EF.
(267) Lentiviral vectors to express SABRs or TCRs were packaged using previously described procedures. Briefly, 5,000,000 HEK-293T cells were plated on poly-L-Lysine coated plates for 24 hours, followed by transfection of a mixture of the lentiviral shuttle plasmid, pMDG-VSVG, and pCMV-RD8.9 using TransIT-293 (Mirus Bio) and OPTI-MEM (Life Technologies). Viruses were filtered through 0.45 micron syringe filters (Milipore) and stored at 80 C. until further use. To transduce Jurkat, NFAT-GFP-Jurkat, or Primary T cells, 2-510.sup.5 cells were plated in culture medium and mixed with an equal volume of thawed virus in 12-well plates for three days. For NFAT-GFP-Jurkat cells, G-418 was added to the transduction mixture 48 hours later.
(268) For the co-culture assays to test SABR signaling in Examples 1-5, 1-510.sup.4 transduced NFAT-GFP-Jurkat cells were incubated with equal number of transduced Jurkat cells on 96 well flat or round bottom plates for 8-10 hours. The cells were then acquired on MACSQuant (Miltenyi) or stained with anti-CD69-APC-Cy7 (Biolegend Clone #) and then acquired on MACSQuant (Miltenyi). For the SABR library assays, 1.510.sup.6 SABR library cells were incubated with 1.510.sup.6 Jurkat cells in each well of a 6 well plate. At 8-10 hours after co-culture, cells were harvested, stained with anti-CD69-APC-Cy7 (Biolegend), and sorted on a BD FACS SORP (Becton-Dickinson). Cytotoxicity assays were performed using target cells labeled with CFSE (Biolegend) as described previously. For the empty SABR assays, transduced NFAT-GFP-Jurkat cells were incubated with 100 mg/ml of soluble peptide for 2 hours at 37 C. Equal numbers of transduced Jurkat cells were then added to the cells, followed by 8-10 hours of co-culture. Gating strategies for these assays is shown in
(269) For the high-throughput sequencing and analysis of Examples 1-5, genomic DNA was extracted from sorted cells immediately following sorting using PureLink genomic DNA extraction kit (Life Technologies). The SABR vectors were amplified using KOD polymerase (Milipore) and 10:1:10 mixture of primers TruSeq-Univ-SCTfixed-F, TruSeq-Read2-SCTfixed-R, and Truseq-Adapter-Index respectively. For each sample, 5-10 reactions using 1-30 ng of genomic DNA were performed for 30-35 cycles. The reactions were pooled and purified using Nucleospin Gel and PCR purification kit (Takara). The purified PCR product was analyzed on Bioanalyzer (Agilent) and subjected to sequencing on HiSeq 2500 (Illumina). Unaligned reads generated by the sequencer were stored in FASTQ files. The reads were first aligned to the SABR vector using Burrows-Wheeler Alignment with a mismatch penalty of 1.sup.22. For each aligned read, the epitope was translated and counted. All epitopes were ranked according to the number of reads, and an average rank was calculated for each read. The average rank was then used for further analysis.
(270) Flow cytometry plots were analyzed on FlowJo (Treestar). Statistical analyses and graphical representations were generated by Microsoft Excel (Microsoft) and GraphPad Prism (Graphpad).
(271) The list of epitopes in the SABR libraries can be found in Tables 6.3.
(272) TABLE-US-00006 Lengthy table referenced here US12221465-20250211-T00001 Please refer to the end of the specification for access instructions.
(273) In some embodiments, any of the epitopes in Table 6.3 can be employed as the epitope in the SABR arrangement provided herein. In some embodiments, any of the epitopes in table 6.4 can be used as the epitope in the SABR arrangements provided herein.
(274) TABLE-US-00007 TABLE6.4 Parent Epitope NucleicAcid AminoAcid Organism CMV AATCTGGTTCCGATGGTTGCCACAGTA NLVPMVATV Cytomegalovirus pp65 (SEQIDNO:12149) (SEQID (CMV) (495- NO:12150) 503) EBV GGCCTGTGTACGTTGGTGGCTATGCTG GLCTLVAML Epstein- BMLF- (SEQIDNO:12151) (SEQID BarrVirus 1(280- NO:12152) (EBV) 288) GAD65 GTTATGAACATTTTGCTGCAGTACGTGGTG VMNILLQYVV Homo (114- (SEQIDNO:12153) (SEQID sapiens 123) NO:12154) GAD65 ACAGTCTACGGGGCATTCGACCCTCTGCTGG TVYGAFDPLL Homo (339- CCGTAGCAGAT AVAD sapiens 352) (SEQIDNO:12155) (SEQID NO:12156) glia-a TCAGGGGAGGGCAGCTTCCAGCCGTCTCAAG SGEGSFQPSQ Common (228- AAAATCCG ENP wheat 240) (SEQIDNO:12157) (SEQID (Triticum NO:12158) aestivum) glia-a1a CCCTTCCCCCAGCCCGAGCTGCCCTAC PFPQPELPY Common (60- (SEQIDNO:12159) (SEQID wheat 68) NO:12160) (Triticum aestivum) IA-2 ATGGTATGGGAGAGCGGATGTACTGTG MVWESGCTV Homo (797- (SEQIDNO:12161) (SEQID sapiens 805) NO:12162) IGRP GTCCTCTTTGGTCTTGGGTTCGCAATC VLFGLGFAI Homo (265- (SEQIDNO:12163) (SEQID sapiens 273) NO:12164) Insulin CACCTCGTCGAGGCATTGTACCTCGTG HLVEALYLV Homo B(10- (SEQIDNO:12165) (SEQID sapiens 18) NO:12166) Insulin AGCCACCTGGTGGAGGCCCTGTACCTGGTGT SHLVEALYLV Homo B(9- GCGGCGAGAGGGGC CGERG sapiens 23) (SEQIDNO:12167) (SEQID NO:12168) KK10 AAAAGATGGATAATCCTGGGATTAAATAAA KRWIILGLNK human (SEQIDNO:12169) (SEQID immunode- NO:12170) ficiency virus (HIV) LLO AACGAGAAGTACGCCCAGGCCTACCCCAACG NEKYAQAYP Listeria (190- TGAGCGCCAAGATCGAC NVSAKID monocyto 205) (SEQIDNO:12171) (SEQID genes NO:12172) MART1 GAGGCCGCCGGCATCGGCATCCTGACCGTG EAAGIGILTV Homo (SEQIDNO:12173) (SEQID sapiens NO:12174) MART1- GAGCTGGCCGGCATCGGCATCCTGACCGTG ELAGIGILTV Synthetic A27L (SEQIDNO:12175) (SEQID NO:12176) NYESO AGCCTGCTGATGTGGATCACCCAGTGC SLLMWITQC Homo (SEQIDNO:12177) (SEQID sapiens NO:12178) NYESO- TCCCTGCTGATGTGGATCACCCAGGTG SLLMWITQV Synthetic 1V (SEQIDNO:12179) (SEQID NO:12180) OVA AGCATCATCAACTTCGAGAAGCTG SIINFEKL chicken (257- (SEQIDNO:12181) (SEQID (Gallus 264) NO:12182) gallus domesticus) OVA ATAAGCCAGGCCGTTCATGCTGCACATGCAG ISQAVHAAHA chicken (323- AAATAAACGAGGCTGGCAGA EINEAGR (Gallus 339) (SEQIDNO:12183) (SEQID gallus NO:12184) domesticus) PPI(15- GCACTCTGGGGTCCTGATCCGGCTGCGGCT ALWGPDPAA Homo 24) (SEQIDNO:12185) A sapiens (SEQID NO:12186) ProIns GGCGCCGGCAGCCTGCAGCCCCTGGCCCTGG GAGSLQPLAL Homo C19-35 AGGGCAGCCTGCAGAAGAGG EGSLQKR sapiens (SEQIDNO:12187) (SEQID NO:12188) ProIns GGAAGTTTGCAGCCATTGGCTCTGGAAGGGA GSLQPLALEG Homo C19-A3 GCCTGCAAAAACGCGGCATTGTA SLQKRGIV sapiens (SEQIDNO:12189) (SEQID NO:12190) ProIns GGAAGTTTGCAGCCATTGGCTTGGGAAGGGA GSLQPLAWEG Synthetic C19-A3 GCCTGCAAAAACGCGGCATTGTA SLQKRGIV L3W (SEQIDNO:12191) (SEQID NO:12192) SL9 TCATTATATAATACAGTAGCAACCCTC SLYNTVATL human (SEQIDNO:12193) (SEQID immunode- NO:12194) ficiency virus (HIV)
Example 7
Antigen presenting Cells to Detect Islet Autoimmunity in Type 1 Diabetes
(275) Type 1 Diabetes (T1D) is an autoimmune disorder caused by progressive destruction of insulin-producing pancreatic cell islets. The role of T cells in pathology of T1D is well established by immunological studies and discovery of genetic risk factors. However, there is an unmet need for tools to link the immune manifestations of these genetic risk factors.
(276) An immune-reactive cell, such as a pancreatic cell in T1D, presents antigenic epitopes on human leukocyte antigen molecules (pHLA complexes) on its surface. T cells use their unique TCR to specifically recognize pHLA. In T1D, both CD4+ and CD8+ T cells recognize and respond to self-antigens on pancreatic cells. CD8+ T cells recognize Class I pHLA and induce a cytotoxic response, whereas, CD4+ T cell recognize Class II pHLA and induce a helper response that modulates immune function. A bottleneck in studying T cells is at the identification of the antigens they target. Two major tools to detect the antigen-specific T cells are pHLA-multimers and functional assays. pHLA multimers are purified HLA molecules complexed with peptides and conjugated to fluorophores and are used to identify antigen-specific T cells by flow cytometry. Despite their extensive use, they have several limitations: Class II pHLA multimers are inherently unstable, in particular, those for alleles associated with increased risk for T1D (HLA-DQ2 and -DQ8) and are therefore difficult and non-robust to use, they do not represent the physiological immune synapse, and they fail to detect low-avidity T cells inherently associated with autoimmunity. Functional assays, such as ELISAs and ELISPOTs, efficiently detect T cell function by measuring cytokine production upon stimulation with Antigen Presenting Cells (APCs) presenting desired epitopes. However, these assays do not allow distinction between different pHLAs, as APCs have three to ten different HLA alleles. They are also reliant on the induction of a strong functional response such as IFN secretion and thus cannot detect functionally impaired autoimmune T cells. The detection of antigen-specific regulatory T cells (Tregs) is particularly challenging as their activity inhibits typically measured responses, and therefore is masked in functional assays as negative response. Indeed, there is an unmet need for detection of antigen-specific Tregs.
(277) To that end, SABRs to detect pHLA-TCR interactions were constructed.
(278) The SABR-APCs can be used to understand the immunological mechanism of protective and susceptible genetic risk factors. Several Class II HLA alleles are associated with either protection from or susceptibility to T1D. Both HLA-DQ2 and DQ8 are risk factors for T1D, and particularly, patients who carry both alleles are at significantly higher risk than those carrying either allele alone. This phenomenon is thought to be due to cross-pairing of DQ2 and DQ8 chains (known as DQ2trans or DQ8trans) that may present peptide epitopes and induce autoimmunity. APCs from these patients express correctly paired and cross-paired molecules simultaneously, which cannot be distinguished by current methods, as shown in
(279) The function of islet autoreactive effector and regulatory T cells using SABR-APCs can also be studied. Autoimmune T cells exhibit unusual modes of antigen recognition and subsequent functional output. For instance, regulatory T cells specific for HLA-DR4-Proinsulin (C19-A3) bind with reversed polarity compared to effector T cells specific for the same epitope. Because of the inherent limitations in pHLA multimers, studying these distinctions has been extremely challenging. Therefore, SABR-APCs presenting these epitopes as substrates can be used for measuring the functional differences between islet-specific T cell clones derived from T1D patients. These studies can be used understand the functional basis of distinct T cell subtypes from the perspective of the APC.
(280) Natural and immunotherapy-induced islet-specific T cell responses can be detected using SABRs. In scenarios of suppressed immune function, current methods fail to detect antigen-specific T cells. This is particularly relevant in scenarios of islet transplantation or immune tolerance observed in healthy individuals or in patients successfully treated with tolerogenic immunotherapy, such as vaccination with Proinsulin C19-A3. Since the technology platform described herein only relies on TCR/epitope/HLA interaction, islet specific effector or regulatory T-cells can be detected and enumerated, even if their response is suppressed. SABR-APCs can be used to diagnose C19-A3-specific T cell responses from patients receiving immunotherapy with tolerogenic dendritic cells pulsed with this immunodominant proinsulin peptide. The use of SABRs can be extended for immunomonitoring by multiplexing detection of several epitopes from the same patient sample, allowing identification of immune signatures in the islet-specific autoimmune responses that may correlate with response to this novel type of tissue specific immune intervention therapy.
Example 8
Class II MHC SABRs
(281) SABRs comprising antigen presenting domains comprising class II MHC were also tested to determine signaling induction capability. The experimental methods described in Example 1 and 6 were used to test the capacity of class II MHC SABRs.
(282) Furthermore,
Example 9
SABRs Recognize Primary Cells
(283) SCDR constructs were constructed to express, for example, either A2-NYESO (a cancer-specific MHCT antigen combination) or B27-KK10 (an HIV-specific MHC-antigen combination). In some embodiments, the SCDR constructs for A2 and B27 can be constructed and a peptide can be used to present, for example, either NYESO or KK10 antigen. NFAT-GFP-Jurkats, can be transduced with the SCTR constructs or with SCDR constructs and pulsed with peptide antigen as reporter cells. The reporter cells can be transduced with Jurkat cells expressing, for example, either A2-NYESO-specific TCR or B27-KK10-specific TCR, and the frequency of GFP+ cells can be measured with flow cytometry.
(284) The results show that a signal was induced in about 30% of reporter cells within 4 hours of incubation and about 50% of reporter cells within 8 hours of incubation. Also, about 50% of the maximal signal was attained at 4 hours and about 100% of the maximal signal was attained by 8 hours.
(285) Using the experimental results of Examples 3 and 6, TCR-transduced Jurkat cells were co-incubated with SCTR-transduced NFAT-GFP-Jurkat cells.
(286) As illustrated in
Species, Variants, Deletions, or Modified Versions of Embodiments
(287) In some embodiments, any species, variant, deletion, or modified version of each of the noted protein components (especially MHC fragment) can be employed, as long as they function as described herein. In some embodiments, this is achieved if the sequence employed is a human sequence for the component provided herein. In some embodiments, the sequence of the component can be mammalian. In some embodiments, the sequence of the component can be 80% or greater identity to a sequence provided herein or the human sequence of the component provided herein, for example, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.9% or greater identity to the human sequence of the component (e.g., MHC, epitope, etc.). In some embodiments, the component can be a variant, as long as those sequences that are conserved between organisms are maintained. Examples of such permissible variants are described in the logo based sequence alignments provided in
(288) The images in
REFERENCES
(289) All references are incorporated by reference in their entireties. Shankar an, V. et al. IFNgamma and lymphocytes prevent primary tumour development and shape tumour immunogenicity. Nature 410, 1107-1111, doi:10.1038/35074122 (2001). Lollini, P. L., Cavallo, F., Nanni, P. & Forni, G. Vaccines for tumour prevention. Nature reviews. Cancer 6, 204-216, doi:10.1038/nrc1815 (2006). Leach, D. R., Krummel, M. F. & Allison, J. P. Enhancement of antitumor immunity by CTLA-4 blockade. Science 271, 1734-1736 (1996). Dong, H. et al. Tumor-associated B7-H1 promotes T-cell apoptosis: a potential mechanism of immune evasion. Nature medicine 8, 793-800, doi:10.1038/nm730 (2002). Yee, C. et al. Adoptive T cell therapy using antigen-specific CD8+ T cell clones for the treatment of patients with metastatic melanoma: in vivo persistence, migration, and antitumor effect of transferred T cells. Proceedings of the National Academy of Sciences of the United States of America 99, 16168-16173, doi:10.1073/pnas.242600099 (2002). Davis, M. M. & Bjorkman, P. J. T-cell antigen receptor genes and T-cell recognition. Nature 334, 395-402, doi:10.1038/334395a0 (1988). Weiss, A. & Littman, D. R. Signal transduction by lymphocyte antigen receptors. Cell 76, 263-274 (1994). Bethune, M. T. & Joglekar, A. V. Personalized T cell-mediated cancer immunotherapy: progress and challenges. Curr Opin Biotechnol 48, 142-152, doi:10.1016/j.copbio.2017.03.024 (2017). Woodsworth, D. J., Castellarin, M. & Holt, R. A. Sequence analysis of T-cell repertoires in health and disease. Genome Med 5, 98, doi:10.1186/gm502 (2013). Buchholz, V. R., Schumacher, T. N. & Busch, D. H. T Cell Fate at the Single-Cell Level. Annual review of immunology 34, 65-92, doi:10.1146/annurev-immunol-032414-112014 (2016). Klenerman, P., Cerundolo, V. & Dunbar, P. R. Tracking T cells with tetramers: new tales from new tools. Nature reviews. Immunology 2, 263-272, doi:10.1038/nri777 (2002). Castle, J. C. et al. Exploiting the mutanome for tumor vaccination. Cancer research 72, 1081-1091, doi:10.1158/0008-5472.CAN-11-3722 (2012). Boon, T. & van der Bruggen, P. Human tumor antigens recognized by T lymphocytes. The Journal of experimental medicine 183, 725-729 (1996). Matsushita, H. et al. Cancer exome analysis reveals a T-cell-dependent mechanism of cancer immunoediting. Nature 482, 400-404, doi:10.1038/nature10755 (2012). Gee, M. H. et al. Antigen Identification for Orphan T Cell Receptors Expressed on Tumor-Infiltrating Lymphocytes. Cell 172, 549-563 e516, doi:10.1016/j.cell.2017.11.043 (2018). Birnbaum, M. E. et al. Deconstructing the Peptide-MHC Specificity of T Cell Recognition. Cell 157, 1073-1087, doi:10.1016/j.cell.2014.03.047 (2014). Yu, Y. Y., Netuschil, N., Lybarger, L., Connolly, J. M. & Hansen, T. H. Cutting edge: single-chain trimers of MHC class I molecules form stable structures that potently stimulate antigen-specific T cells and B cells. Journal of immunology 168, 3145-3149 (2002). Morgan, R. A. et al. Cancer regression in patients after transfer of genetically engineered lymphocytes. Science 314, 126-129 (2006). Joglekar, A. V. et al. T cell receptors for the HIV KK10 epitope from patients with differential immunologic control are functionally indistinguishable. Proceedings of the National Academy of Sciences of the United States of America 115, 1877-1882, doi:10.1073/pnas.1718659115 (2018). Bennett, M. S., Joseph, A., Ng, H. L., Goldstein, H. & Yang, O. O. Fine-tuning of T-cell receptor avidity to increase HIV epitope variant recognition by cytotoxic T lymphocytes. Aids 24, 2619-2628, doi:10.1097/QAD.0b013e32833f7b22 (2010). Sahin, U. et al. Personalized RNA mutanome vaccines mobilize poly-specific therapeutic immunity against cancer. Nature 547, 222-226, doi:10.1038/nature23003 (2017). Li, H. & Durbin, R. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics 25, 1754-1760, doi:10.1093/bioinformatics/btp324 (2009). Vita, R. et al. The immune epitope database (IEDB) 3.0. Nucleic acids research 43, D405-412, doi:10.1093/nar/gku938 (2015). Yokomaku, Y. et al. Impaired processing and presentation of cytotoxic-T-lymphocyte (CTL) epitopes are major escape mechanisms from CTL immune pressure in human immunodeficiency virus type 1 infection. Journal of virology 78, 1324-1332 (2004). Dorrell, L. et al. Distinct recognition of non-clade B human immunodeficiency virus type 1 epitopes by cytotoxic T lymphocytes generated from donors infected in Africa. Journal of virology 73, 1708-1714 (1999). Peakman, M. et al. T cell clones generated from patients with type 1 diabetes using interleukin-2 proliferate to human islet antigens. Autoimmunity 17, 31-39 (1994). Tang, Q. & Bluestone, J. A. The Foxp3+ regulatory T cell: a jack of all trades, master of regulation. Nature immunology 9, 239-244, doi:10.1038/ni1572 (2008). Garcia, K. C. et al. Structural basis of plasticity in T cell receptor recognition of a self peptide-MHC antigen. Science 279, 1166-1172 (1998). Taguchi, T. et al. Detection of individual mouse splenic T cells producing IFN-gamma and IL-5 using the enzyme-linked immunospot (ELISPOT) assay. Journal of immunological methods 128, 65-73 (1990). Suwandi, J. S., Nikolic, T. & Roep, B. O. Translating Mechanism of Regulatory Action of Tolerogenic Dendritic Cells to Monitoring Endpoints in Clinical Trials. Frontiers in immunology 8, 1598, doi:10.3389/fimmu.2017.01598 (2017). Bentzen, A. K. & Hadrup, S. R. Evolution of MHC-based technologies used for detection of antigen-responsive T cells. Cancer immunology, immunotherapy: CII 66, 657-666, doi:10.1007/s00262-017-1971-5 (2017). Tran, E. et al. Cancer immunotherapy based on mutation-specific CD4+ T cells in a patient with epithelial cancer. Science 344, 641-645, doi:10.1126/science.1251102 (2014). Bassani-Sternberg, M. et al. Direct identification of clinically relevant neoepitopes presented on native human melanoma tissue by mass spectrometry. Nature communications 7, 13404, doi:10.1038/ncomms13404 (2016). Roep B O (2003) The role of T-cells in the pathogenesis of Type 1 diabetes: from cause to cure. Diabetologia 46(3):305-321. Sharma G & Holt R A (2014) T-cell epitope discovery technologies. Human immunology 75(6):514-519. Bentzen A K & Hadrup S R (2017) Evolution of MHC-based technologies used for detection of antigen-responsive T cells. Cancer immunology, immunotherapy: CII 66(5):657-666. Pike K A, Hui C, & Krawczyk C M (2016) Detecting Secreted Analytes from Immune Cells: An Overview of Technologies. Methods in molecular biology 1458:111-124. Nepom G T, et al. (2002) HLA class II tetramers: tools for direct analysis of antigen-specific CD4+ T cells. Arthritis and rheumatism 46(1):5-12. Arif S, et al. (2004) Autoreactive T cell responses show proinflammatory polarization in diabetes but a regulatory phenotype in health. The Journal of clinical investigation 113(3):451-463. Van Lummel M, et al. (2012) Type 1 diabetes-associated HLA-DQ8 transdimer accommodates a unique peptide repertoire. The Journal of biological chemistry 287(12):9514-9524. Kracht M J, et al. (2017) Autoimmunity against a defective ribosomal insulin gene product in type 1 diabetes. Nature medicine 23(4):501-507. Beringer D X, et al. (2015) T cell receptor reversed polarity recognition of a self-antigen major histocompatibility complex. Nature immunology 16(11):1153-1161. Alhadj Ali M, et al. (2017) Metabolic and immune effects of immunotherapy with proinsulin peptide in human new-onset type 1 diabetes. Science translational medicine 9(402).
(290) TABLE-US-LTS-00001 LENGTHY TABLES The patent contains a lengthy table section. A copy of the table is available in electronic form from the USPTO web site (). An electronic copy of the table will also be available from the USPTO upon request and payment of the fee set forth in 37 CFR 1.19(b)(3).