Method for promoting n-acetylglucosamine synthesis by using GlcN6P responsive element
12221640 ยท 2025-02-11
Assignee
Inventors
- Long Liu (Wuxi, CN)
- Jian Chen (Wuxi, CN)
- Guocheng Du (Wuxi, CN)
- Yaokang WU (Wuxi, CN)
- Taichi CHEN (Wuxi, CN)
- Jianghua Li (Wuxi, CN)
Cpc classification
C12N15/74
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
C12N9/1029
CHEMISTRY; METALLURGY
C12P19/26
CHEMISTRY; METALLURGY
C12N15/67
CHEMISTRY; METALLURGY
C12Y203/01004
CHEMISTRY; METALLURGY
International classification
C12P19/26
CHEMISTRY; METALLURGY
C12N15/67
CHEMISTRY; METALLURGY
Abstract
The present invention provides a method for promoting N-acetylglucosamine synthesis by using the GlcN6P responsive element. In the present invention, Bacillus subtilis BSGNY-P.sub.veg-glmS-P.sub.43-GNA1 is used as a starting strain, in which a CRISPRi system regulated by GlcN6P responsive element is integrated into the genome to dynamically weaken the N-acetylglucosamine synthesis competitive pathway; a GlcN6P responsive promoter is used to regulate the expression of GNA1 on the plasmid to dynamically regulate the N-acetylglucosamine synthesis pathway; and the key gene alsSD involved in the acetoin synthesis pathway is knocked out. During fed-batch fermentation with this strain in a 15 L fermenter, the production of N-acetylglucosamine reaches 131.6 g/L and no by-product acetoin is accumulated, which lays a foundation for the production of GlcNAc by industrial fermentation.
Claims
1. A method for promoting N-acetylglucosamine synthesis, comprising controlling the expression of glucosamine 6-phosphate N-acetyltransferase GNA4 by GNA1 by using a GlcN6P responsive element to dynamically regulate the N-acetylglucosamine synthesis pathway; and using the GlcN6P responsive element to regulate a compound formed by binding a dCas9 protein to three sgRNA expression fragments acting on zwf, pfkA and glmM genes, to dynamically weaken the glycolysis pathway, the pentose phosphate pathway and the peptidoglycan synthesis pathway, wherein the GlcN6P responsive element comprises the transcription factor GamR and a promoter containing a GamR binding site, where the transcription factor GamR has an amino acid sequence comprising positions 1-235 of an amino acid sequence deposited under NCBI Accession No.: WP_015382651.1, and the promoter is a P.sub.gamA promoter or a hybrid promoter constructed by adding a GamR binding site to a constitutive promoter.
2. The method according to claim 1, wherein the promoter P.sub.gamA has the nucleotide sequence of SEQ ID NO: 5.
3. The method according to claim 1, wherein the glucosamine 6-phosphate N-acetyltransferase GNA1 has the amino acid sequence of SEQ ID NO: 2.
4. The method according to claim 3, wherein the vector pSTg-GNA1 is used as an expression vector of glucosamine 6-phosphate N-acetyltransferase GNA1, and the vector pSTg-GNA1 has the nucleotide sequence of SEQ ID NO:1.
5. The method according to claim 1, wherein the vector pLCg-dCas9 is used as an expression vector of the dCas9 protein, and the vector pLCg-dCas9 has the nucleotide sequence of SEQ ID NO: 3.
6. The method according to claim 1, wherein the method further comprises knocking out the key gene alsSD for the synthesis of by-product acetoin.
7. The method according to claim 6, wherein the key gene alsSD is knocked out by transforming an alsSD knockout frame having the nucleotide sequence of SEQ ID NO: 4.
8. A recombinant Bacillus subtilis, wherein a GlcN6P responsive element is used to control the expression of glucosamine 6-phosphate N-acetyltransferase GNA1 to dynamically regulate the N-acetylglucosamine synthesis pathway; and the GlcN6P responsive element is also used to regulate a compound formed by binding a dCas9 protein to three sgRNA expression fragments acting on zwf, pfkA and glmM genes, to dynamically weaken the glycolysis pathway, the pentose phosphate pathway and the peptidoglycan synthesis pathway, wherein the GlcN6P responsive element comprises the transcription factor GamR and a promoter containing a GamR binding site, where the transcription factor GamR comprises positions 1-235 of an amino acid sequence deposited under NCBI Accession No.: WP_015382651.1, and the promoter is a P.sub.gamA promoter or a hybrid promoter constructed by adding a GamR binding site to a constitutive promoter.
9. The recombinant Bacillus subtilis according to claim 8, wherein Bacillus subtilis BSGNY-P.sub.veg-glmS-P.sub.43-GNA1 is used as a starting strain, and the starting strain is based on Bacillus subtilis 168 in which the genotype was engineered as follows: nagPgamPgamnagnagBldhptaglcKpckpyk::lox72; and the promoter P.sub.veg is used to regulate the expression of the phosphatase yqaB from E. coli and the glmS of Bacillus subtilis 168, and the promoter P.sub.43 is used to regulate the expression of GNA1.
10. A method for producing acetylglucosamine, comprising fermentation of the recombinant Bacillus subtilis strain according to claim 8.
11. The method according to claim 10, wherein the method comprises inoculating the seed of the recombinant Bacillus subtilis strain cultured at 35-39 C. and 200-220 rpm for 10-15 h into a fermentation medium in a shake flask at an inoculation amount of 1-10%, and culturing at 35-39 C. and 200-220 rpm for 50-70 h.
12. The method according to claim 10, wherein the method comprises inoculating the seed of the recombinant Bacillus subtilis strain cultured at 35-39 C. and 200-220 rpm for 10-15 h into a fermentation medium in a fermenter at an inoculation amount of 1-10%, and culturing in the fermenter with a liquid volume of 30-50% at 35-39 C. and pH 6.5-7.5, where the rate of aeration is 1-2 vvm, the rotational speed is controlled to 500-900 rpm to maintain dissolved oxygen at 30% or higher, and glucose of 750 g/L is continuously added to control the glucose concentration between 1-30 g/L.
13. The method according to claim 10, wherein the method comprises promoting N-acetylglucosamine synthesis in the fields of food, pharmaceuticals, nutraceuticals and health products, or cosmetics.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3) The partial sequences of promoters shown in
(4) TABLE-US-00001 P.sub.gamA: (SEQIDNO:21) CAGAAATTAATATTGACAGTTTGATAAGGGCGGTGCTAAATTCGTAATG ACAAGTATCATAAATTGGTCATAACAA P.sub.veg: (SEQIDNO:22) CGTTGATATAATTTAAATTTTATTTGACAAAAATGGGCTCGTGTTGTAC AATAAATGTCG P.sub.vg1: (SEQIDNO:23) CGTTGATATAATTTAAATTTTATTTGACAAAAATGGGCTCGTGTTGTAC AATAAATGTCGTAAATTGGTCATAACAA P.sub.vg2,: (SEQIDNO:24) CGTTGATATAATTTAAATTTTATTTGACATAAATTGGTCATAACAATAC AATAAATGTCG P.sub.vg3: (SEQIDNO:25) CGTTGATAAATTGGTCATAACAATTGACAAAAATGGGCTCGTGTTGTAC AATAAATGTCG P.sub.vg4: (SEQIDNO:26) CGTTGATATAATTTAAATTTTATTTGACATAAATTGGTCATAACAATAC AATAAATGTCGTAAATTGGTCATAACAA P.sub.vg5: (SEQIDNO:27) CGTTGATAAATTGGTCATAACAATTGACAAAAATGGGCTCGTGTTGTAC AATAAATGTCGTAAATTGGTCATAACAA P.sub.vg6: (SEQIDNO:28) CGTTGATAAATTGGTCATAACAATTGACATAAATTGGTCATAACAATAC AATAAATGTCG P.sub.vg7: (SEQIDNO:29) CGTTGATAAATTGGTCATAACAATTGACATAAATTGGTCATAACAATAC AATAAATGTCGTAAATTGGTCATAACAA P.sub.rg: (SEQIDNO:30) TTGAACTTCTGCTCTTTACATCTTTCGTTTTTTTCTTGTAAATTCGTAA TGACAAGTATCATAAATTGGTCATAACAA P.sub.lg: (SEQIDNO:31) AATCTTTACAATCCTATTGATATAATCTAAGCTAGTGTATAAATTCGTA ATGACAAGTATCATAAATTGGTCATAACAA P.sub.vg: (SEQIDNO:32) AATGTTTAGTGGAAATGATTGCGGCATCCCGCAAAAAATATTGCTGTAA ATAAACTGGAATCTTTCGGCATCCCGCATGAAACTTTTCACCCATTTTT CGTTGACAAAAACATTTTTTTCATTTAAATTCGTAATGACAAGTATCAT AAATTGGTCATAACAAATATGGTGCTTGTCTATCTC P.sub.sg: (SEQIDNO:33) TTTCACCCATTTTTCGTTGACAAAAACATTTTTTTCATTTAAATTCGTA ATGACAAGTATCATAAATTGGTCATAACAA P.sub.sg1: (SEQIDNO:34) TTTCACCCATTTTTCGTTGACATAAATTGGTCATAACAATAAATTCGTA ATGACAAGTATCATAAATTGGTCATAACAA P.sub.sg2: (SEQIDNO:35) TAAATTGGTCATAACAATTGACAAAAACATTTTTTTCATTTAAATTCGT AATGACAAGTATCATAAATTGGTCATAACAA P.sub.sg3: (SEQIDNO:36) TAAATTGGTCATAACAATTGACATAAATTGGTCATAACAATAAATTCGT AATGACAAGTATCATAAATTGGTCATAACAA
(5)
(6)
(7)
(8)
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
(9) Seed culture medium (g/L): tryptone 10, powdery yeast 5, and NaCl 10.
(10) Fermentation medium (g/L) in shake flask: tryptone 6, powdery yeast 12, urea 6, K.sub.2HPO.sub.4.Math.3H.sub.2O 12.5, KH.sub.2PO.sub.4 2.5, CaCO.sub.3 5, and trace element 10 ml/L, where the solution of trace elements comprises, by g/L, MnSO.sub.4.Math.5H.sub.2O 1.0, CoCl.sub.2.Math.6H.sub.2O 0.4, NaMoO.sub.4.Math.2H.sub.2O 0.2, ZnSO.sub.4.Math.7H.sub.2O 0.2, AlCl.sub.3.Math.6H.sub.2O 0.1, CuCl.sub.2.Math.H.sub.2O 0.1, and H.sub.3BO.sub.4 0.05, and 5M HCl.
(11) Fermentation medium (g/L) in fermenter: tryptone 20, powdery yeast 20, urea 10, K.sub.2HPO.sub.4.Math.3H.sub.2O 12.5, KH.sub.2PO.sub.4 2.5, CaCO.sub.3 5, and trace element 10 ml/L, where the solution of trace elements comprises, in g/L, MnSO.sub.4.Math.5H.sub.2O 1.0, CoCl.sub.2.Math.6H.sub.2O 0.4, NaMoO.sub.4.Math.2H.sub.2O 0.2, ZnSO.sub.4.Math.7H.sub.2O 0.2, AlCl.sub.3.Math.6H.sub.2O 0.1, CuCl.sub.2.Math.H.sub.2O 0.1, and H.sub.3BO.sub.4 0.05, and 5M HCl.
(12) Determination method of acetylglucosamine: High performance liquid chromatography (HPLC): Agilent 1260, RID detector, HPX-87H column (Bio-Rad Hercules, CA), mobile phase: 5 mM H.sub.2SO.sub.4, flow rate 0.6 mL/min, column temperature 35 C., and volume of injection: 10 L.
Example 1: Construction of GlcN6P Responsive Element
(13) Working mechanism of the present invention: In Bacillus subtilis, glucosamine 6-phosphate (GlcN6P) is an important metabolic regulator. When glucose is used as a carbon source, its intracellular concentration is amenable to feedback regulation mediated by glmS riboswitch. When glucosamine (GlcN) or N-acetylglucosamine (GlcNAc) is used as a carbon source, GlcN6P activates the expression of operons related to the catabolism of these two carbon sources, respectively. This process is achieved with transcription factor GamR or NagR (
(14) The GlcN6P responsive element constructed in the present invention includes the transcription factor GamR and a promoter containing a GamR binding site, where part of the sequence of the promoter containing a GamR binding site is shown in
(15) To construct responsive elements of different abilities, a series of hybrid promoters containing a GamR binding site (having a nucleotide sequence as shown in SEQ ID NO: 6-SEQ ID NO: 19) were designed, and ligated to a vector containing a green fluorescent protein after synthesis. Also, the gamR gene in the wild-type Bacillus subtilis 168 (BS168) was knocked out to obtain a recombinant strain BS01(BS168gamR), and the plasmids including a hybrid promoter above were respectively transformed into BS168 and BSO1, respectively. The expression of the promoters before and after GamR binding was verified.
(16)
Example 2: Regulation of GlcNAc Synthesis by GlcN6P Responsive Element
(17) To regulate the GlcNAc synthesis by using the constructed GlcN6P responsive element, the gamR gene in recombinant Bacillus subtilis BSGNY-P.sub.veg-glmS-P.sub.43-GNA1 constructed in Patent Publication No. CN107699533A was knocked out, to obtain the recombinant strain BNDR000. The vector pLCg-dCas9 (having a nucleotide sequence as shown in SEQ ID NO: 3) and paga-zpg (having a nucleotide sequence as shown in SEQ ID NO: 7 in Patent Publication No. CN108148797A) were linearized with endonuclease Eco91I and transformed into BNDR000 to obtain BNDR020. The GNA1 expression vector pSTg-GNA1 (having a nucleotide sequence as shown in SEQ ID NO: 1) regulated by P.sub.gamA was transformed into BNDR020 to obtain the recombinant strain BNDR022. Finally, the key gene alsSD responsible for the synthesis of by-product acetoin was knocked out to obtain the recombinant strain BNDR122.
Example 3: Fermentation Production of Acetylglucosamine with Recombinant Bacillus subtilis BNDR122
(18) The recombinant Bacillus subtilis BNDR022 constructed in Example 2 was used for shake-flask fermentation. Bacillus subtilis BSGNY-P.sub.veg-glmS-P.sub.43-GNA1 was used as a control, and was cultured and fermented under the same conditions. The seed cultured at 37 C. and 220 rpm for 12 h was inoculated into a fermentation medium at an inoculation amount of 5%, and cultured at 37 C. and 220 rpm for 60 h. The GlcNAc content in the final fermentation supernatant reaches 28.0 g/L, which is 53.0% higher than that produced by the starting strain (BSGNY-P.sub.veg-glmS-P.sub.43-GNA1). Moreover, the yield of N-acetylglucosamine by fermentation with the recombinant Bacillus subtilis provided in the present invention is increased from 0.244 g/g glucose to 0.373 g/g glucose, but the strain BNDR still produces 10 g/L of by-product acetoin. To eliminate the production of acetoin, alsSD, a key gene responsible for acetoin synthesis, was knocked out to obtain the recombinant strain BNDR122, which was verified in 15 L fermenter. The seed cultured at 37 C. and 220 rpm for 12 h was inoculated into a fermentation medium in a fermenter at an inoculation amount of 5%, and cultured in a 15 L fermenter at 37 C. and pH 7.0, where the rate of aeration was 1.5 vvm, and the rotational speed was controlled to 500-900 rpm to maintain dissolved oxygen at 30% or higher. The initial liquid volume was 7.5 L, and glucose of 750 g/L was continuously added to control the glucose concentration between 1-30 g/L. The final acetylglucosamine content in the fermentation supernatant reaches 131.6 g/L, which is the highest level of fermentation production at present, and lays a foundation for its industrialization.
Comparative Example 1: Regulation of GlcNAc Synthesis by Different GlcN6P Responsive Elements
(19) In the method of the present invention, the GlcN6P responsive element was used to enhance the key gene GNA1 responsible for GlcNAc synthesis, and the key genes zwf, pfkA and glmM in the main competition pathways were weakened (
Comparative Example 2: Effect of Knockout of Acetoin Synthesis Pathway
(20) Compared with BNDR022, BNDR122 causes no accumulation of by-product acetoin. In order to compare the effect of knocking out the key gene alsSD responsible for acetoin synthesis, fed-batch fermentation was carried out with BNDR022 and BNDR122 in a 15 L fermenter. The results of fermentation are shown in
(21) While the present invention has been described above by way of preferred examples, the present invention is not limited thereto. Various modifications and changes can be made by those skilled in the art without departing from the spirit and scope of the present invention as defined by the appended claims.