Method for promoting n-acetylglucosamine synthesis by using GlcN6P responsive element

12221640 ยท 2025-02-11

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention provides a method for promoting N-acetylglucosamine synthesis by using the GlcN6P responsive element. In the present invention, Bacillus subtilis BSGNY-P.sub.veg-glmS-P.sub.43-GNA1 is used as a starting strain, in which a CRISPRi system regulated by GlcN6P responsive element is integrated into the genome to dynamically weaken the N-acetylglucosamine synthesis competitive pathway; a GlcN6P responsive promoter is used to regulate the expression of GNA1 on the plasmid to dynamically regulate the N-acetylglucosamine synthesis pathway; and the key gene alsSD involved in the acetoin synthesis pathway is knocked out. During fed-batch fermentation with this strain in a 15 L fermenter, the production of N-acetylglucosamine reaches 131.6 g/L and no by-product acetoin is accumulated, which lays a foundation for the production of GlcNAc by industrial fermentation.

Claims

1. A method for promoting N-acetylglucosamine synthesis, comprising controlling the expression of glucosamine 6-phosphate N-acetyltransferase GNA4 by GNA1 by using a GlcN6P responsive element to dynamically regulate the N-acetylglucosamine synthesis pathway; and using the GlcN6P responsive element to regulate a compound formed by binding a dCas9 protein to three sgRNA expression fragments acting on zwf, pfkA and glmM genes, to dynamically weaken the glycolysis pathway, the pentose phosphate pathway and the peptidoglycan synthesis pathway, wherein the GlcN6P responsive element comprises the transcription factor GamR and a promoter containing a GamR binding site, where the transcription factor GamR has an amino acid sequence comprising positions 1-235 of an amino acid sequence deposited under NCBI Accession No.: WP_015382651.1, and the promoter is a P.sub.gamA promoter or a hybrid promoter constructed by adding a GamR binding site to a constitutive promoter.

2. The method according to claim 1, wherein the promoter P.sub.gamA has the nucleotide sequence of SEQ ID NO: 5.

3. The method according to claim 1, wherein the glucosamine 6-phosphate N-acetyltransferase GNA1 has the amino acid sequence of SEQ ID NO: 2.

4. The method according to claim 3, wherein the vector pSTg-GNA1 is used as an expression vector of glucosamine 6-phosphate N-acetyltransferase GNA1, and the vector pSTg-GNA1 has the nucleotide sequence of SEQ ID NO:1.

5. The method according to claim 1, wherein the vector pLCg-dCas9 is used as an expression vector of the dCas9 protein, and the vector pLCg-dCas9 has the nucleotide sequence of SEQ ID NO: 3.

6. The method according to claim 1, wherein the method further comprises knocking out the key gene alsSD for the synthesis of by-product acetoin.

7. The method according to claim 6, wherein the key gene alsSD is knocked out by transforming an alsSD knockout frame having the nucleotide sequence of SEQ ID NO: 4.

8. A recombinant Bacillus subtilis, wherein a GlcN6P responsive element is used to control the expression of glucosamine 6-phosphate N-acetyltransferase GNA1 to dynamically regulate the N-acetylglucosamine synthesis pathway; and the GlcN6P responsive element is also used to regulate a compound formed by binding a dCas9 protein to three sgRNA expression fragments acting on zwf, pfkA and glmM genes, to dynamically weaken the glycolysis pathway, the pentose phosphate pathway and the peptidoglycan synthesis pathway, wherein the GlcN6P responsive element comprises the transcription factor GamR and a promoter containing a GamR binding site, where the transcription factor GamR comprises positions 1-235 of an amino acid sequence deposited under NCBI Accession No.: WP_015382651.1, and the promoter is a P.sub.gamA promoter or a hybrid promoter constructed by adding a GamR binding site to a constitutive promoter.

9. The recombinant Bacillus subtilis according to claim 8, wherein Bacillus subtilis BSGNY-P.sub.veg-glmS-P.sub.43-GNA1 is used as a starting strain, and the starting strain is based on Bacillus subtilis 168 in which the genotype was engineered as follows: nagPgamPgamnagnagBldhptaglcKpckpyk::lox72; and the promoter P.sub.veg is used to regulate the expression of the phosphatase yqaB from E. coli and the glmS of Bacillus subtilis 168, and the promoter P.sub.43 is used to regulate the expression of GNA1.

10. A method for producing acetylglucosamine, comprising fermentation of the recombinant Bacillus subtilis strain according to claim 8.

11. The method according to claim 10, wherein the method comprises inoculating the seed of the recombinant Bacillus subtilis strain cultured at 35-39 C. and 200-220 rpm for 10-15 h into a fermentation medium in a shake flask at an inoculation amount of 1-10%, and culturing at 35-39 C. and 200-220 rpm for 50-70 h.

12. The method according to claim 10, wherein the method comprises inoculating the seed of the recombinant Bacillus subtilis strain cultured at 35-39 C. and 200-220 rpm for 10-15 h into a fermentation medium in a fermenter at an inoculation amount of 1-10%, and culturing in the fermenter with a liquid volume of 30-50% at 35-39 C. and pH 6.5-7.5, where the rate of aeration is 1-2 vvm, the rotational speed is controlled to 500-900 rpm to maintain dissolved oxygen at 30% or higher, and glucose of 750 g/L is continuously added to control the glucose concentration between 1-30 g/L.

13. The method according to claim 10, wherein the method comprises promoting N-acetylglucosamine synthesis in the fields of food, pharmaceuticals, nutraceuticals and health products, or cosmetics.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 shows the principle underlying regulation of related genes by GlcN6P. FIG. 1A shows the catabolism-related genes of glucose (Glc), glucosamine (GlcN), and N-acetylglucosamine (GlcNAc) in Bacillus subtilis, FIG. 1B shows the regulation of catabolism-related genes of GlcN and GlcNAc by GlcN6P, and FIG. 1C shows the mechanism of regulation on promoter PgamA by GlcN6P.

(2) FIG. 2 shows the constructed GlcN6P responsive element. FIG. 2A shows part of the sequence of promoters including a GamR binding site, and FIG. 2B shows the change in expression of these promoters before and after GamR binding.

(3) The partial sequences of promoters shown in FIG. 2A are as follows.

(4) TABLE-US-00001 P.sub.gamA: (SEQIDNO:21) CAGAAATTAATATTGACAGTTTGATAAGGGCGGTGCTAAATTCGTAATG ACAAGTATCATAAATTGGTCATAACAA P.sub.veg: (SEQIDNO:22) CGTTGATATAATTTAAATTTTATTTGACAAAAATGGGCTCGTGTTGTAC AATAAATGTCG P.sub.vg1: (SEQIDNO:23) CGTTGATATAATTTAAATTTTATTTGACAAAAATGGGCTCGTGTTGTAC AATAAATGTCGTAAATTGGTCATAACAA P.sub.vg2,: (SEQIDNO:24) CGTTGATATAATTTAAATTTTATTTGACATAAATTGGTCATAACAATAC AATAAATGTCG P.sub.vg3: (SEQIDNO:25) CGTTGATAAATTGGTCATAACAATTGACAAAAATGGGCTCGTGTTGTAC AATAAATGTCG P.sub.vg4: (SEQIDNO:26) CGTTGATATAATTTAAATTTTATTTGACATAAATTGGTCATAACAATAC AATAAATGTCGTAAATTGGTCATAACAA P.sub.vg5: (SEQIDNO:27) CGTTGATAAATTGGTCATAACAATTGACAAAAATGGGCTCGTGTTGTAC AATAAATGTCGTAAATTGGTCATAACAA P.sub.vg6: (SEQIDNO:28) CGTTGATAAATTGGTCATAACAATTGACATAAATTGGTCATAACAATAC AATAAATGTCG P.sub.vg7: (SEQIDNO:29) CGTTGATAAATTGGTCATAACAATTGACATAAATTGGTCATAACAATAC AATAAATGTCGTAAATTGGTCATAACAA P.sub.rg: (SEQIDNO:30) TTGAACTTCTGCTCTTTACATCTTTCGTTTTTTTCTTGTAAATTCGTAA TGACAAGTATCATAAATTGGTCATAACAA P.sub.lg: (SEQIDNO:31) AATCTTTACAATCCTATTGATATAATCTAAGCTAGTGTATAAATTCGTA ATGACAAGTATCATAAATTGGTCATAACAA P.sub.vg: (SEQIDNO:32) AATGTTTAGTGGAAATGATTGCGGCATCCCGCAAAAAATATTGCTGTAA ATAAACTGGAATCTTTCGGCATCCCGCATGAAACTTTTCACCCATTTTT CGTTGACAAAAACATTTTTTTCATTTAAATTCGTAATGACAAGTATCAT AAATTGGTCATAACAAATATGGTGCTTGTCTATCTC P.sub.sg: (SEQIDNO:33) TTTCACCCATTTTTCGTTGACAAAAACATTTTTTTCATTTAAATTCGTA ATGACAAGTATCATAAATTGGTCATAACAA P.sub.sg1: (SEQIDNO:34) TTTCACCCATTTTTCGTTGACATAAATTGGTCATAACAATAAATTCGTA ATGACAAGTATCATAAATTGGTCATAACAA P.sub.sg2: (SEQIDNO:35) TAAATTGGTCATAACAATTGACAAAAACATTTTTTTCATTTAAATTCGT AATGACAAGTATCATAAATTGGTCATAACAA P.sub.sg3: (SEQIDNO:36) TAAATTGGTCATAACAATTGACATAAATTGGTCATAACAATAAATTCGT AATGACAAGTATCATAAATTGGTCATAACAA

(5) FIG. 3 shows the verification of the regulatory effect of the GlcN6P responsive element. FIG. 3A shows the activation verification, FIG. 3B shows the inhibition verification, and FIG. 3C shows the simultaneous activation and inhibition verification.

(6) FIG. 4 shows the cell growth and product synthesis under the regulation of GlcN6P responsive element. FIG. 4A shows a process of regulation with the GlcN6P responsive element, FIG. 4B shows the dry weight of cells 24 h after regulation with the GlcN6P responsive element, FIG. 4C shows the dry weight of cells at 36 h, FIG. 4D shows the synthesis of GlcNAc, and FIG. 4E shows the synthesis of by-product acetoin.

(7) FIG. 5 shows the results of fed-batch fermentation in a 15 L tank with BNDR022.

(8) FIG. 6 shows the results of fed-batch fermentation in a 15 L tank with BNDR122.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

(9) Seed culture medium (g/L): tryptone 10, powdery yeast 5, and NaCl 10.

(10) Fermentation medium (g/L) in shake flask: tryptone 6, powdery yeast 12, urea 6, K.sub.2HPO.sub.4.Math.3H.sub.2O 12.5, KH.sub.2PO.sub.4 2.5, CaCO.sub.3 5, and trace element 10 ml/L, where the solution of trace elements comprises, by g/L, MnSO.sub.4.Math.5H.sub.2O 1.0, CoCl.sub.2.Math.6H.sub.2O 0.4, NaMoO.sub.4.Math.2H.sub.2O 0.2, ZnSO.sub.4.Math.7H.sub.2O 0.2, AlCl.sub.3.Math.6H.sub.2O 0.1, CuCl.sub.2.Math.H.sub.2O 0.1, and H.sub.3BO.sub.4 0.05, and 5M HCl.

(11) Fermentation medium (g/L) in fermenter: tryptone 20, powdery yeast 20, urea 10, K.sub.2HPO.sub.4.Math.3H.sub.2O 12.5, KH.sub.2PO.sub.4 2.5, CaCO.sub.3 5, and trace element 10 ml/L, where the solution of trace elements comprises, in g/L, MnSO.sub.4.Math.5H.sub.2O 1.0, CoCl.sub.2.Math.6H.sub.2O 0.4, NaMoO.sub.4.Math.2H.sub.2O 0.2, ZnSO.sub.4.Math.7H.sub.2O 0.2, AlCl.sub.3.Math.6H.sub.2O 0.1, CuCl.sub.2.Math.H.sub.2O 0.1, and H.sub.3BO.sub.4 0.05, and 5M HCl.

(12) Determination method of acetylglucosamine: High performance liquid chromatography (HPLC): Agilent 1260, RID detector, HPX-87H column (Bio-Rad Hercules, CA), mobile phase: 5 mM H.sub.2SO.sub.4, flow rate 0.6 mL/min, column temperature 35 C., and volume of injection: 10 L.

Example 1: Construction of GlcN6P Responsive Element

(13) Working mechanism of the present invention: In Bacillus subtilis, glucosamine 6-phosphate (GlcN6P) is an important metabolic regulator. When glucose is used as a carbon source, its intracellular concentration is amenable to feedback regulation mediated by glmS riboswitch. When glucosamine (GlcN) or N-acetylglucosamine (GlcNAc) is used as a carbon source, GlcN6P activates the expression of operons related to the catabolism of these two carbon sources, respectively. This process is achieved with transcription factor GamR or NagR (FIG. 1). The principle of regulation on GamR is shown in FIG. 1C. GamR can recognize and bind to a specific site (gamO) on the promoter P.sub.gamA to prevent the binding of RNA polymerase and the initiation of transcription. When the intracellular GlcN6P concentration is higher than its response threshold, RNA polymerase will bind to gamO and change its structure so that GamR cannot bind to the promoter P.sub.gamA, and transcription can proceed normally (Gaugue, I., Oberto, J., Plumbridge, J., 2014. Regulation of amino sugar utilization in Bacillus subtilis by the GntR family regulators, NagR and GamR. Mol. Microbiol. 92, 100-115. doi.org/10.1111/mmi.12544). Therefore, this regulatory system can be used for engineering and to realize automatic regulation of N-acetylglucosamine and its main competitive pathways, thereby promoting the continuous and efficient flow of glucose to the synthesis of N-acetylglucosamine.

(14) The GlcN6P responsive element constructed in the present invention includes the transcription factor GamR and a promoter containing a GamR binding site, where part of the sequence of the promoter containing a GamR binding site is shown in FIG. 2A. The mechanism of regulation of the responsive element by intracellular GlcN6P is shown in FIG. 1C. When the concentration of GlcN6P is low, GamR binds to the promoter containing a GamR binding site, which limits the transcription of a downstream gene. As the concentration of GlcN6P increases, the binding between GamR and the promoter becomes weaker, so the transcription of the downstream gene is gradually enhanced.

(15) To construct responsive elements of different abilities, a series of hybrid promoters containing a GamR binding site (having a nucleotide sequence as shown in SEQ ID NO: 6-SEQ ID NO: 19) were designed, and ligated to a vector containing a green fluorescent protein after synthesis. Also, the gamR gene in the wild-type Bacillus subtilis 168 (BS168) was knocked out to obtain a recombinant strain BS01(BS168gamR), and the plasmids including a hybrid promoter above were respectively transformed into BS168 and BSO1, respectively. The expression of the promoters before and after GamR binding was verified.

(16) FIG. 2B shows the change in expression of various hybrid promoters when GamR is expressed or deleted. Among these promoters, the expression of P.sub.vg6, P.sub.gamA, and P.sub.sg2 changes by 2.4, 5.7, and 11.9 times before and after GamR binding, respectively. To further verify the response of these three promoters to GlcN6P, relevant genes nagB and gamA allowing GlcN6P to enter the glycolysis pathway were knocked out in BSO1 to obtain the recombinant strain BSO3 (BS168gamRnagBgamA). In this way, different concentrations of GlcN could be added to control the concentration of intracellular GlcN6P. By using the regulation mechanisms shown in FIGS. 3A and 3B, the activation and inhibition of genes mediated by GlcN6P responsive elements were verified. When activation is verified, GamR and a promoter containing a GamR binding site were both positioned on the same vector, and the effect of the addition amount of GlcN on the promoter expression was verified by GFP. P.sub.vg6, P.sub.gamA, and P.sub.sg2 enhance with the increase of the addition amount of GlcN, reach the maximum when the amount of addition is 1 g/L, and will not increase any more when the concentration exceeds this concentration. The expression levels of these three promoters are at about 1:3:4. When inhibition is verified, the repressor XylR and xylose-inducible promoter on pLCx-dCas9 were respectively replaced by gamR and P.sub.vg6, gamR and P.sub.gamA, and gamR and P.sub.sg2, to obtain the vector pLCv-dCas9, pLCg-dCas9, and pLCs-dCa9. The three vectors were linearized with Eco91I and transformed into B503, and then GFP-specific sgRNA expression vector psga-GFP (having a nucleotide sequence as shown in SEQ ID NO:20)linearized with Eco31I and a plasmid with constitutively expressed GFP were transformed to obtain the strain BS13, BS23 and BS33. The expression of fluorescent protein was measured by adding GlcN. The inhibition also increases with the increase of the addition amount of GlcN, and the weakening effect of the three promoters is also P.sub.vg6<P.sub.gamA<P.sub.sg2. As shown in FIG. 3C, the green fluorescent protein (GFP) and red fluorescent protein (mCherry) are used to verify the effects of simultaneous activation and inhibition of GlcN6P responsive element.

Example 2: Regulation of GlcNAc Synthesis by GlcN6P Responsive Element

(17) To regulate the GlcNAc synthesis by using the constructed GlcN6P responsive element, the gamR gene in recombinant Bacillus subtilis BSGNY-P.sub.veg-glmS-P.sub.43-GNA1 constructed in Patent Publication No. CN107699533A was knocked out, to obtain the recombinant strain BNDR000. The vector pLCg-dCas9 (having a nucleotide sequence as shown in SEQ ID NO: 3) and paga-zpg (having a nucleotide sequence as shown in SEQ ID NO: 7 in Patent Publication No. CN108148797A) were linearized with endonuclease Eco91I and transformed into BNDR000 to obtain BNDR020. The GNA1 expression vector pSTg-GNA1 (having a nucleotide sequence as shown in SEQ ID NO: 1) regulated by P.sub.gamA was transformed into BNDR020 to obtain the recombinant strain BNDR022. Finally, the key gene alsSD responsible for the synthesis of by-product acetoin was knocked out to obtain the recombinant strain BNDR122.

Example 3: Fermentation Production of Acetylglucosamine with Recombinant Bacillus subtilis BNDR122

(18) The recombinant Bacillus subtilis BNDR022 constructed in Example 2 was used for shake-flask fermentation. Bacillus subtilis BSGNY-P.sub.veg-glmS-P.sub.43-GNA1 was used as a control, and was cultured and fermented under the same conditions. The seed cultured at 37 C. and 220 rpm for 12 h was inoculated into a fermentation medium at an inoculation amount of 5%, and cultured at 37 C. and 220 rpm for 60 h. The GlcNAc content in the final fermentation supernatant reaches 28.0 g/L, which is 53.0% higher than that produced by the starting strain (BSGNY-P.sub.veg-glmS-P.sub.43-GNA1). Moreover, the yield of N-acetylglucosamine by fermentation with the recombinant Bacillus subtilis provided in the present invention is increased from 0.244 g/g glucose to 0.373 g/g glucose, but the strain BNDR still produces 10 g/L of by-product acetoin. To eliminate the production of acetoin, alsSD, a key gene responsible for acetoin synthesis, was knocked out to obtain the recombinant strain BNDR122, which was verified in 15 L fermenter. The seed cultured at 37 C. and 220 rpm for 12 h was inoculated into a fermentation medium in a fermenter at an inoculation amount of 5%, and cultured in a 15 L fermenter at 37 C. and pH 7.0, where the rate of aeration was 1.5 vvm, and the rotational speed was controlled to 500-900 rpm to maintain dissolved oxygen at 30% or higher. The initial liquid volume was 7.5 L, and glucose of 750 g/L was continuously added to control the glucose concentration between 1-30 g/L. The final acetylglucosamine content in the fermentation supernatant reaches 131.6 g/L, which is the highest level of fermentation production at present, and lays a foundation for its industrialization.

Comparative Example 1: Regulation of GlcNAc Synthesis by Different GlcN6P Responsive Elements

(19) In the method of the present invention, the GlcN6P responsive element was used to enhance the key gene GNA1 responsible for GlcNAc synthesis, and the key genes zwf, pfkA and glmM in the main competition pathways were weakened (FIG. 4A), thereby promoting the recombinant Bacillus subtilis to continuously synthesize GlcNAc efficiently with glucose. In the present invention, three GlcN6P responsive promoters P.sub.vg6, P.sub.gamA, and P.sub.sg2 of different expression levels were obtained. In the recombinant strain BNDR122, the enhancement and weakening are both regulated by the promoter P.sub.gamA with a moderate expression level among the three promoters. In order to compare the effects of promoters of different expression levels, the vectors pLCs-dCas9 (where the P.sub.gamA promoter in the vector pLCg-dCas9 was replaced by P.sub.sg2) and pLCv-dCas9 (where the P.sub.gamA promoter in the vector pLCg-dCas9 was replaced by P.sub.vg6) were integrated with dCas9 expressed by P.sub.sg2 and P.sub.vg6. The vectors pSTs-GNA1 (where the P.sub.gamA promoter in the vector pSTg-GNA1 was replaced by P.sub.sg2) and pSTv-GNA1 (the P.sub.gamA promoter in the vector pSTg-GNA1 was replaced by P.sub.vg6) that use P.sub.sg2 and P.sub.vg6 to regulate the expression of GNA1 were transformed. FIGS. 4B-4E show the results of enhancement and weakening using combinations of promoters with different expression levels. Only when the enhancement and weakening are both carried out using the promoter P.sub.gamA of moderate expression level, the GlcNAc production is the highest and reaches 28.0 g/L.

Comparative Example 2: Effect of Knockout of Acetoin Synthesis Pathway

(20) Compared with BNDR022, BNDR122 causes no accumulation of by-product acetoin. In order to compare the effect of knocking out the key gene alsSD responsible for acetoin synthesis, fed-batch fermentation was carried out with BNDR022 and BNDR122 in a 15 L fermenter. The results of fermentation are shown in FIGS. 5 and 6. The by-product acetoin produced by BNDR022 can finally reach 22.9 g/L, and the GlcNAc production can reach 96.3 g/L. In contrast, the GlcNAc production of BNDR122 can reach 131.6 g/L, and no by-product acetoin is produced. This not only lays a foundation for further fermentation production therewith, but also is more conducive to the subsequent separation and purification process.

(21) While the present invention has been described above by way of preferred examples, the present invention is not limited thereto. Various modifications and changes can be made by those skilled in the art without departing from the spirit and scope of the present invention as defined by the appended claims.