Antigen-surface-coupled liposome vaccine for non-human animals

12220458 ยท 2025-02-11

Assignee

Inventors

Cpc classification

International classification

Abstract

Disclosed is a vaccine for non-human animals, which vaccine enables effective immune induction in non-human animals such as livestock or poultry. The vaccine for non-human animals of the present invention comprises liposomes each comprising an antigen molecule(s) bound to the surface thereof, the antigen molecule(s) being derived from a pathogen infectious to the non-human animals. The non-human animals are, for example, livestock or poultry. One most preferred example of the vaccine according to the present invention is an infectious bronchitis virus (IBV) vaccine, which is effective against various isolated IBV strains, and which is expected to be sufficiently applicable even to cases where a mutant strain appeared. Another preferred example of the vaccine according to the present invention is a PRRSV vaccine, which was confirmed to have an effect that reduces fever, lung lesion development, and the like caused by the infection. The present invention enables development of liposome vaccines effective for prevention of infections caused by various non-human animal pathogens including PRRSV as well as IBV.

Claims

1. A method for vaccinating poultry comprising: administering a vaccine to poultry by fine spray administration with a droplet size of not more than 150 m, said vaccine comprising liposomes each comprising an antigen molecule(s) bound to the surface thereof, the antigen molecule(s) being a full-length nucleocapsid protein of infectious bronchitis virus whose amino acid sequence is shown in SEQ ID NO:2.

2. The method according to claim 1, wherein the droplet particle size is not more than 120 m.

3. A method for vaccinating pigs, comprising: administering a vaccine to a pig, said vaccine comprising liposomes each comprising an antigen molecule(s) bound to the surface thereof, the antigen molecule(s) being a full-length nucleocapsid protein of porcine reproductive and respiratory syndrome virus whose amino acid sequence is shown in SEQ ID NO: 28.

4. The method according to claim 3, wherein said vaccine is administered by intravenous administration, subcutaneous administration, intradermal administration, intramuscular administration, transnasal administration, transdermal administration, rectal administration, intratracheal administration, inhalation administration, or ocular instillation administration.

5. The method according to claim 1, wherein the antigen molecule(s) is/are bound to the liposome surface by covalent bonding.

6. The method according to claim 5, wherein the antigen molecule(s) is/are bound to the liposome surface by reaction between an amino group in the antigen molecule and a succinimide group in a suberic acid succinimide group represented by CO(CH.sub.2).sub.6COOC.sub.4H.sub.4NO.sub.2 on the liposome surface.

7. The method according to claim 1, wherein said vaccine is administered to poultry two or more times at intervals of at least one week.

8. The method according to claim 3, wherein the antigen molecule(s) is/are bound to the liposome surface by covalent bonding.

9. The method according to claim 8, wherein the antigen molecule(s) is/are bound to the liposome surface by reaction between an amino group in the antigen molecule and a succinimide group in a suberic acid succinimide group represented by CO(CH.sub.2).sub.6COOC.sub.4H.sub.4NO.sub.2 on the liposome surface.

10. The method according to claim 3, wherein said vaccine is administered to a pig two or more times at intervals of at least one week.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 shows the result of SDS-PAGE for confirmation of induction of expression, and purification, of a recombinant IBV N protein (IBV-rNp).

(2) FIG. 2 shows the result of SDS-PAGE for confirmation of induction of expression, and purification, of a recombinant IBV M protein (IBV-rMp).

(3) FIG. 3-1 shows the result of measurement of the antigen-specific IFN- production-inducing ability in test chickens to which a test vaccine (BV-rNp-DSS or IBV-rNp-GA) was administered, which measurement was carried out by collecting lymphocytes from the spleen and then performing ELISPOT for detection of chicken IFN-.

(4) FIG. 3-2 shows the result of measurement of the antigen-specific IFN- production-inducing ability in test chickens to which a test vaccine (IBV-rMp-DSS or IBV-rMp-GA) was administered, which measurement was carried out by collecting lymphocytes from the spleen and then performing ELISPOT for detection of chicken IFN-.

(5) FIG. 3-3 shows the result of measurement of the blood antibody titers before and after immunization of test chickens by inoculation of test vaccines, which measurement was carried out by ELISA using IBV-rNp as an antigen.

(6) FIG. 3-4 shows the result of measurement of the blood antibody titers before and after immunization of test chickens by inoculation of test vaccines, which measurement was carried out by ELISA using IBV-rMp as an antigen.

(7) FIG. 4-1 shows the result of evaluation of the effect of vaccine administration in chickens subjected to administration of test vaccines and viral challenge according to the test group setting and the schedule shown in Table 4-1 and Table 4-2, which evaluation was based on the tracheal ciliary movement score.

(8) FIG. 4-2 shows the result of measurement of the amount of viral gene in organs of chickens subjected to administration of test vaccines and viral challenge according to the test group setting and the schedule shown in Table 4-1 and Table 4-2.

(9) FIG. 4-3 shows the result of investigation of the virus isolation rates from organs and the virus titers in isolation-positive samples, which investigation was carried out for chickens subjected to administration of test vaccines and viral challenge according to the test group setting and the schedule shown in Table 4-1 and Table 4-2.

(10) FIG. 4-4 shows the result of measurement of the neutralizing antibody titer in chickens subjected to administration of test vaccines and viral challenge according to the test group setting and the schedule shown in Table 4-1 and Table 4-2, which measurement was carried out at the times of the challenge and autopsy.

(11) FIG. 5-1 shows the result of evaluation of the effect of vaccine administration in chickens subjected to administration of test vaccines and viral challenge according to the test group setting and the schedule shown in Table 5-1 and Table 5-2, which evaluation was based on the tracheal ciliary movement score.

(12) FIG. 5-2 shows the result of measurement of the amount of viral gene in organs of chickens subjected to administration of test vaccines and viral challenge according to the test group setting and the schedule shown in Table 5-1 and Table 5-2.

(13) FIG. 5-3 shows the result of investigation of the virus isolation rates from organs of chickens subjected to administration of test vaccines and viral challenge according to the test group setting and the schedule shown in Table 5-1 and Table 5-2.

(14) FIG. 5-4 shows the result of investigation of the virus titers in organs of chickens subjected to administration of test vaccines and viral challenge according to the test group setting and the schedule shown in Table 5-1 and Table 5-2.

(15) FIG. 6-1 shows the result of evaluation of the effect of vaccine administration in chickens subjected to administration of a test vaccine and viral challenge according to the test group setting and the schedule shown in Table 6-1 and Table 6-2, which evaluation was based on the tracheal ciliary movement score.

(16) FIG. 6-2 shows the result of measurement of the amount of viral gene in organs of chickens subjected to administration of a test vaccine and viral challenge according to the test group setting and the schedule shown in Table 6-1 and Table 6-2.

(17) FIG. 6-3 shows the result of investigation of the virus isolation rates from organs of chickens subjected to administration of a test vaccine and viral challenge according to the test group setting and the schedule shown in Table 6-1 and Table 6-2.

(18) FIG. 6-4 shows the result of investigation of the virus titers in organs of chickens subjected to administration of a test vaccine and viral challenge according to the test group setting and the schedule shown in Table 6-1 and Table 6-2.

(19) FIG. 7-1 shows the result of evaluation of the effect of vaccine administration in chickens subjected to administration of a test vaccine and viral challenge according to the test group setting and the schedule shown in Table 7-1 and Table 7-2, which evaluation was based on the tracheal ciliary movement score.

(20) FIG. 7-2 shows the result of measurement of the amount of viral gene in organs of chickens subjected to administration of a test vaccine and viral challenge according to the test group setting and the schedule shown in Table 7-1 and Table 7-2.

(21) FIG. 7-3 shows the result of investigation of the virus isolation rates from organs of chickens subjected to administration of a test vaccine and viral challenge according to the test group setting and the schedule shown in Table 7-1 and Table 7-2.

(22) FIG. 7-4 shows the result of investigation of the virus titers in organs of chickens subjected to administration of a test vaccine and viral challenge according to the test group setting and the schedule shown in Table 7-1 and Table 7-2.

(23) FIG. 8-1 is a schematic diagram illustrating the recombinant IBV N protein fragments prepared in Examples.

(24) FIG. 8-2 is a schematic diagram illustrating the chimeric protein of IBV N protein and IBV M protein prepared in Examples.

(25) FIG. 8-3 shows the result of evaluation of the effect of vaccine administration in chickens subjected to administration of test vaccines and viral challenge according to the test group setting and the schedule shown in Table 8-1 and Table 8-2, which evaluation was based on the tracheal ciliary movement score.

(26) FIG. 8-4 shows the result of measurement of the amount of viral gene in organs of chickens subjected to administration of test vaccines and viral challenge according to the test group setting and the schedule shown in Table 8-1 and Table 8-2.

(27) FIG. 9-1 shows the result of evaluation of the effect of vaccine administration in chickens subjected to administration of a test vaccine and viral challenge according to the test group setting and the schedule shown in Table 9-1 and Table 9-2, which evaluation was based on the tracheal ciliary movement score.

(28) FIG. 9-2 shows the result of measurement of the amount of viral gene in organs of chickens subjected to administration of a test vaccine and viral challenge according to the test group setting and the schedule shown in Table 9-1 and Table 9-2.

(29) FIG. 10-1 shows the result of evaluation of the effect of vaccine administration in chickens subjected to administration of test vaccines and viral challenge according to the test group setting and the schedule shown in Table 10-1 and Table 10-2, which evaluation was based on the tracheal ciliary movement score.

(30) FIG. 10-2 shows the result of measurement of the amount of viral gene in organs of chickens subjected to administration of test vaccines and viral challenge according to the test group setting and the schedule shown in Table 10-1 and Table 10-2.

(31) FIG. 11-1 shows the result of evaluation of the effect of vaccine administration in chickens subjected to administration of a test vaccine and viral challenge according to the test group setting and the schedule shown in Table 11-1 and Table 11-2, which evaluation was based on the tracheal ciliary movement score.

(32) FIG. 11-2 shows the result of measurement of the amount of viral gene in organs of chickens subjected to administration of a test vaccine and viral challenge according to the test group setting and the schedule shown in Table 11-1 and Table 11-2.

(33) FIG. 12-1 shows the result of evaluation of the effect of vaccine administration in chickens subjected to administration of a test vaccine and viral challenge according to the test group setting and the schedule shown in Table 12-1 and Table 12-2, which evaluation was based on the tracheal ciliary movement score.

(34) FIG. 12-2 shows the result of measurement of the amount of viral gene in organs of chickens subjected to administration of a test vaccine and viral challenge according to the test group setting and the schedule shown in Table 12-1 and Table 12-2.

(35) FIG. 13-1 shows changes in the egg-laying rate in each test group of chickens subjected to administration of a test vaccine and viral challenge according to the test group setting and the schedule shown in Table 13-1 and Table 13-2.

(36) FIG. 13-2 shows changes in the egg-laying rate through different periods in chickens subjected to administration of a test vaccine and viral challenge according to the test group setting and the schedule shown in Table 13-1 and Table 13-2.

(37) FIG. 13-3 shows the result of measurement of the amount of viral gene in buccal/cloacal swabs of chickens subjected to administration of a test vaccine and viral challenge according to the test group setting and the schedule shown in Table 13-1 and Table 13-2.

(38) FIG. 13-4 shows the result of measurement of the amount of viral gene in organs of chickens subjected to administration of a test vaccine and viral challenge according to the test group setting and the schedule shown in Table 13-1 and Table 13-2.

(39) FIG. 13-5 shows the result of evaluation of the effect of vaccine administration in chickens subjected to administration of test vaccines and viral challenge according to the test group setting and the schedule shown in Table 13-1 and Table 13-2, which evaluation was based on the tracheal ciliary movement score.

(40) FIG. 13-6 shows the result of measurement of the serum ELISA antibody titer in chickens subjected to administration of test vaccines and viral challenge according to the test group setting and the schedule shown in Table 13-1 and Table 13-2.

(41) FIG. 14-1 shows the result of evaluation of the effect of vaccine administration in chickens subjected to administration of a test vaccine and challenge by various viral strains according to the test group setting and the schedule shown in Table 14-1 and Table 14-2, which evaluation was based on the tracheal ciliary movement score.

(42) FIG. 14-2 shows the result of measurement of the amount of viral gene in organs of chickens subjected to administration of a test vaccine and challenge by various viral strains according to the test group setting and the schedule shown in Table 14-1 and Table 14-2.

(43) FIG. 15-1 shows the result of SDS-PAGE for confirmation of induction of expression, and purification, of a recombinant PRRSV N protein (PRRSV-rNp).

(44) FIG. 16-1 shows the test schedule for the animal test in 16. Evaluation of Immunogenicity of PRRS Liposome Vaccine Using Mice.

(45) FIG. 16-2 shows the result of measurement of the antigen-specific IFN- production-inducing ability in mice to which each immunizing material was administered, which measurement was carried out by collecting lymphocytes from the spleen and then performing ELISPOT for detection of mouse IFN-.

(46) FIG. 16-3 shows the result of measurement of the blood IgG antibody titer in mice to which each immunizing material was inoculated, which measurement was carried out by ELISA using PRRSV-rNp as an antigen.

(47) FIG. 16-4 shows the result of measurement of the blood IgG1 antibody titer in mice to which each immunizing material was inoculated, which measurement was carried out by ELISA using PRRSV-rNp as an antigen.

(48) FIG. 16-5 shows the result of measurement of the blood IgG2a antibody titer in mice to which each immunizing material was inoculated, which measurement was carried out by ELISA using PRRSV-rNp as an antigen.

(49) FIG. 17-1 shows the test schedule for the animal test in 17. Evaluation of Effectiveness of PRRS Liposome Vaccine Using Pigs.

(50) FIG. 17-2 shows changes in the body temperature scores of pigs in the immunization group to which a test vaccine (PRRSV-rNp-DSS) was administered, and pigs in the control group without the vaccine administration.

(51) FIG. 17-3 shows the result of measurement of the amount of viral gene in blood of pigs in the immunization group to which a test vaccine (PRRSV-rNp-DSS) was administered, and pigs in the control group without the vaccine administration.

(52) FIG. 17-4 shows the result obtained by preparing peripheral blood mononuclear cells (PBMCs) from blood of pigs in the immunization group to which a test vaccine (PRRSV-rNp-DSS) was administered, and pigs in the control group without the vaccine administration, and then subjecting the cells to antigen stimulation, followed by measuring the antigen-specific IFN- production-inducing ability by ELISPOT for detection of porcine IFN-.

(53) FIG. 17-5 shows the result obtained by preparing PBMCs from blood of pigs in the immunization group to which a test vaccine (PRRSV-rNp-DSS) was administered, and pigs in the control group without the vaccine administration, and then subjecting the cells to antigen stimulation, followed by detecting porcine IFN- by ELISA using a monoclonal antibody against porcine IFN-.

(54) FIG. 17-6 shows the lung lesion score of pigs in the immunization group to which a test vaccine (PRRSV-rNp-DSS) was administered, and pigs in the control group without the vaccine administration. Lung collected at 20 dPC was subjected to histopathological examination for scoring of the severity of the lesion.

(55) FIG. 17-7 shows the result obtained by collecting serum from pigs in the immunization group to which a test vaccine (PRRSV-rNp-DSS) was administered, and pigs in the control group without the vaccine administration, and measuring the blood antibody titer by ELISA using PRRSV-rNp as an antigen.

MODE FOR CARRYING OUT THE INVENTION

(56) In the present invention, the non-human animals include animals other than human, such as livestock (cows, pigs, horses, sheep, goats, camels, rabbits, and the like), poultry (chickens, ducks, quails, turkeys, ostriches, pheasants, guinea fowls, and the like), and pet animals (dogs, cats, hamsters, guinea pigs, rabbits, ferrets, parakeets, parrots, and the like). The term birds includes not only poultry, but also birds not legally included in the group of poultry (wild ducks; penguins; pigeons; cormorants; and raptors such as hawks, eagles, falcons, and owls). The terms poultry and birds include living bodies after hatching, and embryonated eggs. Since livestock and poultry are reared in groups, they are prone to suffer from spreading of infections after occurrence of the infections. Therefore, livestock and poultry can be regarded as non-human animals for which prevention of infections is especially important.

(57) The pathogen is not limited, and includes various pathogens such as fungi, bacteria, viruses, and mycoplasmas.

(58) Specific examples of pathogens that infect livestock or poultry include the following. For all of these examples, information on the genome sequence and the like is known, or isolated strains are available. Thus, antigen molecules such as a recombinant antigen protein that binds to the liposome surface can be appropriately prepared by a conventional method.

(59) <Viruses Infectious to Chickens>

(60) Infectious bronchitis virus (IBV) Avian influenza virus (AIV) Newcastle disease virus (NDV) Infectious laryngotracheitis virus (ILTV) Marek's disease virus (MDV) Avian leukemia virus (ALV) Infectious bursal disease virus (IBDV) Fowlpox virus (FPV) Avian encephalomyelitis virus (AEV) Chicken adenovirus (FAV) Egg drop syndrome1976 virus (EDS) Avian reovirus (ARV) Chicken anemia virus (CAV) Avian nephritis virus (ANV) Reticuloendotheliosis virus (REV) Avian metapneumovirus (AMPV)
<Bacteria and Mycoplasmas Infectious to Chickens> Mycoplasma gallisepticum (MG) Mycoplasma synoviae (MS) Salmonella pullorum (SP) Salmonella gallinarum (SG) Salmonella enleritidis (SE) Salmonella typhimurium (ST) Salmonella infantis (SI) Escherichia coli (E. coli) Avibacterium paragallinarum (H. pg) Eimeria protozoa Leucocytozoon caulleryi
<Viruses Infectious to Pigs> Aujeszky's disease virus (ADV) Transmissible gastroenteritis virus (TGEV) Porcine reproductive and respiratory syndrome virus (PRRSV) Porcine epidemic diarrhea virus (PEDV) Swine influenza virus (SIV) Porcine circovirus type 2 (PCV2) Porcine parvovirus (PPV) Japanese encephalitis virus (JEV) Porcine rotavirus (PRV)
<Bacteria and Mycoplasmas Infectious to Pigs> Mycoplasma hyopneumoniae (Mhp) Mycoplasma hyopneumoniae (Mhr) Salmonella choleraesuis (SC) Actinobacillus pleuropneumoniae (App) Swine crysipelas (Ery) Bordetella bronchiseptica (Bb) Pasteurella multocida (Pm) Brachyspira hyodysenteriae (Bra-hyo) Haemophilus parasuis (Hps) Lawsonia intracellularis (Li)
<Viruses Infectious to Cows> Akabane disease virus (AKAV) Chuzan disease virus (KASV) Aino virus (AINOV) Ibaraki disease virus (IBAV) Bovine viral diarrhea-mucosal disease virus (BVDV) Infectious bovine rhinotracheitis virus (IBRV) Bovine ephemeral fever virus (BEFV) Bovine leukemia virus (BLV) Bovine RS virus (BRSV) Bovine parainfluenza virus type 3 (BPIV3) Bovine adenovirus type 7 (BAV7)
<Bacteria and Mycoplasmas Infectious to Cows> Mycoplasma bovis (M. bovis) Mycoplasma bovirhinis (M. bovirhinis) Mycoplasma bovigenitalium (M. bovigenitalium) Mycoplasma disper (M. disper) Mycobacterium avium subsp. paraluberculosis (MAP) Histophilus somni (Hs) Mannheimia haemolytica (Mh)

(61) Typical examples of the antigen molecule derived from a pathogen include proteins encoded by the pathogen genome, and fragments thereof. The antigen molecule in the present invention is preferably a polypeptide. The term polypeptide includes proteins encoded by the pathogen genome, and protein fragments composed of partial regions of the proteins. For production of a vaccine effective against pathogens having various antigenicities or genotypes, it is important to employ, as the antigen molecule, a structural protein whose variation is small (whose sequence is highly conserved) among the pathogen strains, or a partial region thereof. Whether such a highly conserved region has immunogenicity or not can be easily confirmed by carrying out an immunity test using an animal such as a mouse. Examples of the method of the immunity test include a method in which an assay such as an ELISPOT assay is carried out to investigate the IFN- production-inducing ability of lymphocytes (evaluation of the ability to induce cell-mediated immunity) and a method in which an assay such as ELISA is carried out to investigate the antibody-inducing ability (evaluation of the ability to induce humoral immunity).

(62) In cases where the pathogen is a virus, there are viruses having or not having an envelope. In cases of a virus having an envelope, the envelope is present on the outermost part of the virus particle. Therefore, the frequency at which the nucleocapsid protein undergoes a selection pressure, such as an attack by the immune function in the host body, is extremely low. Thus, in cases of a virus having an envelope, the sequence of the nucleocapsid protein is more conserved among viral strains compared to the sequences of other structural proteins. Thus, for preparation of a vaccine of the present invention against a virus having an envelope, the nucleocapsid protein may be preferably employed as the antigen molecule. Among the pathogens exemplified above, IBV, PRRSV, AIV, NDV, ILTV, MDV, ALV, FPV, REV, AMPV, ADV, TGEV, PEDV, SIV, JEV, AKAV, AINOV, BVDV, IBRV, BEFV, BLV, BRSV, and BPIV3 correspond to viruses having an envelope.

(63) The polypeptide may be a recombinant peptide prepared by a genetic recombination technique, or may be a polypeptide prepared by chemical synthesis. In cases where the polypeptide is a short polypeptide having not more than about several ten residues, the chemical synthesis can also be easily carried out. Both the genetic recombination technique and the chemical synthesis of polypeptide are well-known conventional methods.

(64) In the preparation of a recombinant polypeptide by the genetic recombination technique, a polynucleotide encoding a desired antigen polypeptide may be prepared, and the polynucleotide may be cloned into an appropriate vector, followed by introducing the vector into an appropriate host cell, allowing expression of the polypeptide in the host cell, and then recovering and purifying the polypeptide. In cases where the pathogen is a bacterium or Mycoplasma, RT-PCR may be carried out using total RNA extracted from pathogen cells as a template, and using appropriate primers, to prepare a cDNA encoding a desired antigen polypeptide region. In cases where the pathogen is a virus, total RNA may be extracted from cells infected with the virus, and RT-PCR may be carried out using the total RNA as a template. Various cloning vectors and host cells are known, and there are also commercially available products thereof. An appropriate vector and host cells may be selected therefrom in accordance with, for example, properties of the antigen polypeptide to be prepared. For convenience in the recovery and purification of the polypeptide expressed in the host cells, the antigen polypeptide may be expressed with an appropriate tag such as a His tag attached thereto.

(65) Specific examples of the chemical synthesis method include the Fmoc method (fluorenylmethyloxycarbonyl method) and the tBoc method (t-butyloxycarbonyl method). The synthesis may also be carried out by an ordinary method using a commercially available peptide synthesizer. In cases of the chemical synthesis, a desired polypeptide may be synthesized based on the amino acid sequence alone.

(66) As examples of a most preferred vaccine according to the present invention, the later-mentioned Examples describe specific examples of liposome vaccines having an antigen bound to the surface thereof to be used for poultry against IBV. For the IBV liposome vaccines according to the present invention, nucleocapsid protein (N protein) may be preferably used as the antigen molecule. As the N protein of IBV, full-length N protein is preferably used rather than a fragment thereof. N protein is a region having fewer mutations among isolated IBV strains. In particular, N protein having the amino acid sequence of SEQ ID NO:2 may be most preferably used as the antigen molecule for the IBV liposome vaccines. Polypeptides having the same amino acid sequence as SEQ ID NO:2 except that a very small number of amino acids, such as about one or several amino acids, for example, one to five, one to four, one to three, one or two, or one amino acid(s) is/are substituted, deleted, inserted, and/or added (in terms of the sequence identity, polypeptides having an amino acid sequence having an identity of not less than 98% to the amino acid sequence of SEQ ID NO:2) can also be expected to have high immunogenicities similarly to N protein having the amino acid sequence of SEQ ID NO:2, and may therefore be similarly preferably used. One preferred mode of the substitution may be a conservative substitution. Substitution to an amino acid having similar chemical properties is called conservative substitution. It is a substitution which does not deteriorate the properties of the protein. Amino acids having similar side chains have similar chemical properties. Based on the similarities among the side chains, amino acids can be grouped into, for example, a group of amino acids having an aliphatic side chain (glycine, alanine, valine, leucine, isoleucine, and proline), a group of amino acids having an aliphatic hydroxyl side chain (serine and threonine), a group of amino acids having an amide-containing side chain (asparagine and glutamine), a group of amino acids having an aromatic side chain (phenylalanine, tyrosine, and tryptophan), a group of amino acids having a basic side chain (arginine, lysine, and histidine), a group of amino acids having an acidic side chain (aspartic acid and glutamic acid), and a group of amino acids having a sulfur-containing side chain (cysteine and methionine). Examples of the conservative substitution include substitutions within each of these groups.

(67) As other examples of a most preferred vaccine according to the present invention, the later-mentioned Examples also describe specific examples of liposome vaccines having an antigen bound to the surface thereof, to be used for pigs against PRRSV. Also for the PRRSV liposome vaccines, nucleocapsid protein (N protein) may be preferably used as the antigen molecule. Full-length N protein may be preferably used also as the N protein of PRRSV. Alternatively, a fragment(s) of one or more partial regions having high immunogenicities may be used as the antigen molecule. The amino acid sequence of N protein of PRRSV, and the base sequence of the ORF7 region encoding this amino acid sequence, can be obtained from databases such as GenBank in NCBI. The amino acid sequence of SEQ ID NO:28 is one example of the amino acid sequence of N protein of PRRSV. In addition to the protein having this amino acid sequence, polypeptides having the same amino acid sequence as SEQ ID NO: 28 except that a very small number of amino acids, such as about one or several amino acids, for example, one to five, one to four, one to three, one or two, or one amino acid(s) is/are substituted (by, for example, the conservative substitution described above), deleted, inserted, and/or added (in terms of the sequence identity, polypeptides having an amino acid sequence having an identity of not less than 93%, for example, not less than 95%, or not less than 98% to the amino acid sequence of SEQ ID NO:28) can also be expected to have high immunogenicities similarly to the N protein having the amino acid sequence of SEQ ID NO:28, and may therefore be similarly preferably used.

(68) The sequence identity means the value calculated by aligning two amino acid sequences to be compared such that the number of matched amino acid residues becomes largest between the amino acid sequences, and dividing the number of matched amino acid residues by the total number of amino acid residues, which value is expressed as a percentage. In the alignment, a gap(s) is/are inserted, when necessary, into one or both of the two sequences to be compared. Such alignment of sequences may be carried out using a well-known program such as BLAST, FASTA, or CLUSTAL W. When a gap(s) is/are inserted, the above-described total number of amino acid residues is the number of residues calculated by counting one gap as one amino acid residue. When the thus counted total number of amino acid residues is different between the two sequences to be compared, the sequence identity (%) is calculated by dividing the number of matched amino acid residues by the total number of amino acid residues in the longer sequence.

(69) The constitution and the preparation method of the liposome vaccine of the present invention are concretely described below using, as an example, an IBV liposome vaccine, which is one most preferred example of the vaccine according to the present invention. However, the following constitution and method are not limited to those for vaccines against IBV. For example, liposome vaccines against the pathogens of livestock or poultry exemplified above may also be prepared as appropriate according to the following. In the Examples described below, preparation of PRRSV liposome vaccines by the same method as the method for IBV liposome vaccines is described.

(70) The phospholipid membrane constituting the liposome portion of the vaccine according to the present invention contains the following components (A) and (B). In the present description, mol % of each component of the phospholipid membrane means mol % with respect to the total constituents of the phospholipid membrane constituting the liposome portion. (A) A phospholipid containing: a C.sub.14-C.sub.24 acyl group having one unsaturated bond; or a C.sub.14-C.sub.24 hydrocarbon group having one unsaturated bond (hereinafter, the acyl group may be referred to as unsaturated acyl group, and the hydrocarbon group may be referred to as unsaturated hydrocarbon group). (B) A stabilizer for a liposome.

(71) The content of the component (A) is 1 to 99.8 mol %. From the viewpoint of stability of the liposome, the content is preferably 10 to 90 mol %, more preferably 30 to 80 mol %, still more preferably 50 to 70 mol %. The number of carbon atoms of the acyl group or the hydrocarbon group is preferably 16 to 22, more preferably 18 to 22 or 16 to 20, most preferably 18.

(72) The phospholipid may be a glycerophospholipid having a glycerin backbone, or may be a sphingophospholipid having a sphingosine backbone. In the present invention, a glycerophospholipid may be more preferably used.

(73) In cases where the phospholipid is a glycerophospholipid, the unsaturated acyl group(s) and/or unsaturated hydrocarbon group(s) bound to the 1-position and the 2-position of the glycerin backbone may be either the same or different. From the viewpoint of industrial productivity, the 1-position and the 2-position preferably have the same group.

(74) Specific examples of the unsaturated acyl group include palmitoleoyl, oleoyl, and erucoyl. Specific examples of the unsaturated hydrocarbon group include tetradecenyl, hexadecenyl, octadecenyl, C.sub.20 monoene, C.sub.22 monoene, and C.sub.24 monoene.

(75) The phospholipid of the component (A) preferably contains an unsaturated acyl group. An especially preferred phospholipid of the component (A) is a phospholipid containing a C.sub.18 acyl group having one unsaturated bond, that is, an oleoyl group.

(76) The component (A) may include a plurality of different phospholipids which are in accordance with the definition of the phospholipid of (A) described above. Specific examples of the phospholipids include acidic phospholipids and neutral phospholipids; and reactive phospholipids containing a functional group to which an antigen molecule can be bound. The component (A) may include two or more, or three or more of these. In cases where the component (A) includes a plurality of different phospholipids, the unsaturated acyl group(s) and/or unsaturated hydrocarbon group(s) contained in these phospholipids may be totally the same, or may be different among the phospholipids. Usually, the plurality of different phospholipids preferably have the same unsaturated acyl group or unsaturated hydrocarbon group.

(77) The liposome portion of the liposome vaccine of the present invention may contain, in addition to the phospholipid defined in (A), another phospholipid not included in this definition, or a lipid other than a phospholipid. The phospholipid of (A) may be contained at not less than 50%, preferably not less than 60%, more preferably not less than 75%, still more preferably not less than 90%, most preferably not less than 95%, for example, not less than 97%, in the phospholipid membrane component of the liposome portion. The content of the other lipid(s) not included in the definition of (A) is usually not more than 40 mol %, preferably not more than 20 mol %, more preferably not more than 10 mol %, still more preferably not more than 5 mol %.

(78) The type and the ratio of each phospholipid used as the component (A) may be appropriately selected in accordance with various requirements and purposes. The phospholipid is generally used at the following content.

(79) The content of the neutral phospholipid(s) is usually 0.01 to 80 mol %, preferably 0.1 to 70 mol %, more preferably 0.1 to 60 mol %, still more preferably 0.1 to 50 mol %.

(80) The content of the acidic phospholipid(s) is usually 1 to 85 mol %, preferably 2 to 80 mol %, more preferably 4 to 60 mol %, still more preferably 5 to 40 mol %.

(81) The content of the reactive phospholipid(s) is usually 0.2 to 80 mol %, preferably 0.3 to 60 mol %, more preferably 0.4 to 50 mol %, still more preferably 0.5 to 25 mol %.

(82) As the acidic phospholipid(s), diacylphosphatidylserine, diacylphosphatidylglycerol, diacylphosphatidic acid, diacylphosphatidylinositol, and/or the like containing the acyl group defined in (A) may be preferably used. Since an acidic phospholipid gives anionic ionized groups to the surface of the liposome, it imparts a negative zeta potential to the surface of the liposome. By this, the liposome acquires a charge-based repulsive force, and can be present as a stable preparation in an aqueous solvent. Thus, an acidic phospholipid is a component that plays an important role in securing stability of the antigen-bound liposome in an aqueous solvent.

(83) As the neutral phospholipid(s), phosphatidylcholine and/or the like containing the acyl group defined in (A) may be preferably used. A neutral phospholipid has a higher liposome-stabilizing function than an acidic phospholipid, or a reactive phospholipid to which an antigen molecule is bound. A neutral phospholipid is therefore capable of improving the stability of the membrane. From such a point of view, the phospholipid membrane constituting the liposome portion of the liposome vaccine of the present invention preferably contains a neutral phospholipid.

(84) As described above, the reactive phospholipid is a phospholipid containing a functional group to which an antigen molecule can be bound. Representative examples of the functional group include an amino group. The reactive phospholipid may have a terminal structure to which an antigen molecule can be bound (reactive terminal structure), which terminal structure was introduced by binding a cross-linking agent or the like to the phospholipid. The term functional group herein includes such a terminal structure introduced to the phospholipid molecule. For example, the functional group includes the aldehyde group, succinimide group, maleimide group, and the like contained in the divalent reactive compounds exemplified below.

(85) Specific examples of a reactive phospholipid which may be preferably used include phosphatidylethanolamines, and modified phosphatidylethanolamines prepared by introducing a reactive terminal structure to a phosphatidylethanolamine, which phosphatidylethanolamines contain the acyl group defined in (A).

(86) Examples of the modified phosphatidylethanolamines include modified diacylphosphatidylethanolamines prepared by binding one end of a divalent reactive compound to the amino group of a diacylphosphatidylethanolamine. As the divalent reactive compound, compounds known as cross-linking agents may be used. For example, for a diacylphosphatidylethanolamine, a compound containing at least one end an aldehyde group or succinimide group reactive with an amino group may be used.

(87) Examples of the divalent reactive compound containing an aldehyde group include glyoxal, glutaraldehyde, succinaldehyde, and terephthalaldehyde. Glutaraldehyde may be especially preferably used. As described later, the introduction of an aldehyde group with glutaraldehyde or the like to the functional group (amino group) of the reactive phospholipid is usually carried out after the preparation of the liposome.

(88) Examples of the divalent reactive compound containing a succinimide group include dithiobis(succinimidyl propionate), ethylene glycol-bis(succinimidyl succinate), disuccinimidyl succinate, disuccinimidyl suberate, and disuccinimidyl glutarate. Disuccinimidyl suberate may be especially preferably used.

(89) Examples of a divalent reactive compound having a succinimide group at one end, and a maleimide group at the other end, include N-succinimidyl-4-(p-maleimidophenyl)butyrate, sulfosuccinimidyl-4-(p-maleimidophenyl)butyrate. N-succinimidyl-4-(p-maleimidophenyl)acetate, N-succinimidyl-4-(p-maleimidophenyl)propionate, succinimidyl-4-(N-maleimidoethyl)-cyclohexane-1-carboxylate, sulfosuccinimidyl-4-(N-maleimidoethyl)-cyclohexane-1-carboxylate, N-(-maleimidobutyryloxy)succinimide, and N-(-maleimidocaprovloxy)succinimide. By use of such a divalent reactive compound, a modified diacylphosphatidylethanolamine containing a maleimide group as a functional group can be obtained.

(90) Specific examples of the modified diacylphosphatidylethanolamine having a divalent reactive compound bound thereto include succinimidyl-diacylphosphatidylethanolamine and maleimide-diacylphosphatidylethanolamine.

(91) The content of the component (B) is 0.2 to 75 mol %. From the viewpoint of stability of the liposome, the content is preferably 5 to 70 mol %, more preferably 10 to 60 mol %, still more preferably 20 to 50 mol %. In cases where the content of the stabilizer exceeds 75 mol %, stability of the liposome is deteriorated, which is not preferred.

(92) As the stabilizer for the liposome, a sterol or tocopherol may be used. The sterol is not limited as long as it is generally known as a sterol, and examples of the sterol include cholesterol, sitosterol, campesterol, stigmasterol, and brassicasterol. From the viewpoint of availability and the like, cholesterol may be especially preferably used. The tocopherol is not limited as long as it is generally known as a tocopherol. For example, from the viewpoint of availability and the like, a commercially available -tocopherol may be preferably used.

(93) The IBV-derived polypeptide such as N protein to be used as the antigen polypeptide molecule may be bound by using the functional group of the reactive phospholipid in the liposome. By covalently binding the antigen polypeptide molecule to the functional group of the reactive phospholipid which is one component of the phospholipid membrane, the antigen polypeptide molecule can be stably bound to the liposome surface. Such a technique per se is known, and described in, for example, Non-Patent Document 1 and Patent Documents 1 to 3. Although the antigen polypeptide molecule can also be bound to the liposome surface by ionic bonding or hydrophobic bonding as described in Patent Documents 2 and 3, in the IBV liposome vaccine according to the present invention the IBV-derived polypeptide is more preferably bound to the liposome surface by covalent bonding, from the viewpoint of the binding stability during storage and in the living body.

(94) In the preparation of the IBV liposome vaccine, the binding reaction between the liposomes and the IBV-derived polypeptide may be carried out after the preparation of the liposomes containing the reactive phospholipid.

(95) The preparation per se of the liposomes may be carried out according to a conventional method. Examples of the production method include the extrusion method, vortex mixer method, ultrasonic method, surfactant removal method, reverse-phase evaporation method, ethanol injection method, pre-vesicle method, French press method, W/O/W emulsion method, annealing method, and freeze-thaw method. The shape of the liposome is not limited. By appropriately selecting a known liposome production method described above, liposomes having various sizes and shapes, such as a multilamellar liposome, small unilamellar liposome, or large unilamellar liposome can be produced.

(96) The particle size of the liposomes is not limited. From the viewpoint of storage stability and the like, the average particle size of the liposomes is preferably 20 to 600 nm, more preferably, for example, 30 to 500 nm, 40 to 400 nm, 50 to 300 nm, or 70 to 230 nm. The average particle size of the liposomes can be measured by the well-known dynamic light scattering method.

(97) In the present invention, during or alter the preparation of the liposomes, a saccharide or polyol may be added to at least one of the internal aqueous phase and external aqueous phase of the liposomes. By this, the physicochemical stability of the liposomes can be further increased. For example, a liposome suspension containing the reactive phospholipid and the liposome stabilizer may be prepared in a buffer containing a saccharide or polyol, or a liposome suspension containing the reactive phospholipid and the liposome stabilizer may be prepared followed by adding and dissolving a saccharide such as saccharose, or a polyol, in the external aqueous phase of the liposome suspension. Subsequently, the liposome suspension containing the saccharide or polyol may be transferred to a 10-mL glass vial, and then freeze-dried to obtain a freeze-dried product of liposomes each containing a functional group(s) for binding the antigen polypeptide molecule to the surface. By providing the liposomes as the freeze-dried product, it can be stably stored for a long period as an intermediate material for preparation of the liposome vaccine of the present invention.

(98) Examples of the saccharide include monosaccharides such as glucose, galactose, mannose, fructose, inositol, ribose, and xylose; disaccharides such as saccharose, lactose, cellobiose, trehalose, and maltose; trisaccharides such as raffinose and melezitose; oligosaccharides such as cyclodextrin; polysaccharides such as dextrin; and sugar alcohols such as xylitol, sorbitol, mannitol, and maltitol. Among these saccharides, monosaccharides and disaccharides are preferred. In particular, from the viewpoint of availability and the like, glucose or saccharose may be especially preferably used.

(99) Examples of the polyol include glycerin compounds such as glycerin, diglycerin, triglycerin, tetraglycerin, pentaglycerin, hexaglycerin, heptaglycerin, octaglycerin, nonaglycerin, decaglycerin, and polyglycerin; sugar alcohol compounds such as sorbitol and mannitol; ethylene glycol; diethylene glycol; triethylene glycol; tetraethylene glycol; pentaethylene glycol; hexaethylene glycol; heptaethylene glycol; octaethylenc glycol; and nonaethylene glycol. Among these, from the viewpoint of availability, glycerin, diglycerin, triglycerin, sorbitol, or mannitol; or a polyethylene glycol having a molecular weight of 400 to 10,000; may be especially preferably used.

(100) The concentration of the saccharide or polyol contained in at least one of the internal aqueous phase and external aqueous phase of the liposomes may be about 1 to 20% by weight, for example, about 2 to 10% by weight, in terms of the weight concentration with respect to the liposome liquid.

(101) Examples of the functional group of the antigen polypeptide molecule that can be used for the covalent bonding to the liposome surface include an amino group, thiol group, carboxy group, hydroxyl group, and disulfide group. Examples of the combination of functional groups preferred for the covalent bonding include: an amino group and an aldehyde group or carboxy group; an amino group and an amino group; an amino group and a succinimide group; and a thiol group and a maleimide group. Specific examples of the covalent bond between the functional group of the reactive phospholipid and the antigen polypeptide molecule include a Schiff base bond, an amide bond, a thioether bond, and an ester bond.

(102) In cases where the functional group is imparted to the reactive phospholipid by binding of a divalent reactive compound thereto, one of the following methods may be selected depending on the type of the divalent reactive compound: (Method 1) an amino group or the like of the reactive phospholipid is bound to the divalent reactive compound before the preparation of liposomes, and then the reactive phospholipid in which the divalent reactive compound is introduced is used to prepare the liposomes; or (Method 2) liposomes containing the reactive phospholipid are prepared, and then the divalent reactive compound is introduced to an amino group or the like of the reactive phospholipid in the phospholipid membrane. Representative examples of a divalent reactive compound for which Method 1 is employed include disuccinimidyl suberate. Representative examples of a divalent reactive compound for which Method 2 is employed include glutaraldehyde. Both methods per se are known, and described in, for example, Patent Documents 2 and 3, and Non-Patent Documents 2 and 3.

(103) The process of each method is described for the cases of disuccinimidyl suberate (DDS) and glutaraldehyde.

(104) In Method 1, first, disuccinimidyl suberate is bound to the functional group of the reactive phospholipid. As the reactive phospholipid, among the phospholipids defined in (A), a phospholipid containing an amino group as the functional group, such as diacylphosphatidylethanolamine may be preferably used. The binding between the amino group and the disuccinimidyl suberate may be carried out by a known method described in Patent Document 2 or 3, Non-Patent Document 2, or the like, or may be carried out as concretely described below in Examples. By such a method, a reactive phospholipid containing a suberic acid succinimide group (CO(CH.sub.2).sub.6COOC.sub.4H.sub.4NO.sub.2) introduced to the amino group can be obtained. The reactive phospholipid containing a succinimide group as the functional group includes such a reactive phospholipid containing a suberic acid succinimide group introduced therein. As used in the present description, the term disuccinimidyl suberate (DDS)-bound diacylphosphatidylethanolamine means diacylphosphatidylethanolamine containing a suberic acid succinimide group introduced to the amino group.

(105) Subsequently, the reactive phospholipid containing the suberic acid succinimide group introduced therein is mixed with other liposome constituents (that is, other phospholipids corresponding to the component (A), such as an acidic phospholipid and a neutral phospholipid; the liposome stabilizer of the component (B); and, when necessary, other lipids and the like) by a known method, to prepare liposomes. By preparation according to a conventional method, liposomes each containing a succinimide group(s) on its surface, which succinimide group is the functional group introduced to the reactive phospholipid, can be obtained.

(106) To the suspension of the liposomes prepared, an IBV-derived polypeptide is added, and the amino group in the polypeptide is reacted with the succinimide group on the liposome surface.

(107) Unreacted IBV-derived polypeptide, reaction by-products, and the like are removed by a known method such as gel filtration, dialysis, ultrafiltration, or centrifugation. By this, liposomes each comprising the IBV-derived polypeptide molecule(s) covalently bound to its surface through a suberic acid cross-link can be obtained.

(108) In Method 2, liposomes each having on its surface an amino group(s) to be bound to the aldehyde group of glutaraldehyde are prepared. As the reactive phospholipid, a phospholipid containing an amino group as the functional group, such as diacylphosphatidylethanolamine may be used. The reactive phospholipid containing an amino group is mixed with other liposome constituents (that is, other phospholipids corresponding to the component (A), such as an acidic phospholipid and a neutral phospholipid; the liposome stabilizer of the component (B); and, when necessary, other lipids and the like) by a known method, to prepare liposomes. By preparation according to a conventional method, liposomes each having the amino group(s) contained in the reactive phospholipid molecule(s) is/are present on its surface can be obtained.

(109) Subsequently, the liposome suspension is mixed with an IBV-derived polypeptide, and glutaraldehyde is then added to the resulting mixture, followed by allowing the reaction to proceed for a predetermined length of time to form a Schiff base bond between the liposomes and the polypeptide.

(110) Subsequently, a water-soluble compound containing an amino acid group such as glycine is added to the liposome suspension, to deactivate the reactivity of the excess glutaraldehyde.

(111) Unnecessary components such as unreacted IBV-derived polypeptide, reaction product between glutaraldehyde and glycine, and excessive glycine are removed by a known method such as gel filtration, dialysis, ultrafiltration, or centrifugation. By this, liposomes each comprising the IBV-derived polypeptide molecule(s) covalently bound to its surface through a glutaraldehyde cross-link can be obtained.

(112) In the IBV liposome vaccine according to the present invention, the covalent bond between the IBV-derived polypeptide and the liposome is not limited. It has been found that a liposome vaccine obtained by binding through a suberic acid cross-link tends to have a higher vaccine effect than a liposome vaccine obtained by binding through a glutaraldehyde cross-link (see the later-described Examples).

(113) In cases where an IBV liposome vaccine is prepared by Method 1 (a method in which a divalent reactive compound is preliminarily introduced to a reactive phospholipid, and then the resulting product is mixed with other lipids, to prepare liposomes), the components of the liposome portion especially preferably have the following composition (molar ratios): neutral phospholipid, about 2 to 12, preferably about 4 to 8; acidic phospholipid, about 0.5 to 4, preferably about 1 to 3; stabilizer, about 2 to 14, preferably about 5 to 10; with respect to the reactive phospholipid whose ratio is regarded as 1. The reactive phospholipid herein means the total reactive phospholipid, including reactive phospholipids to which the antigen molecule is bound and reactive phospholipids to which no antigen molecule is bound.

(114) In cases where an IBV liposome vaccine is prepared by Method 2 (a method in which liposomes are prepared, and then a divalent reactive compound is introduced thereto), the components of the liposome portion especially preferably have the following composition (molar ratios): neutral phospholipid, about 0.5 to 3, preferably about 1 to 2; acidic phospholipid, about 0.1 to 2, preferably about 0.3 to 1; stabilizer, about 1 to 4, preferably about 1.5 to 3; with respect to the reactive phospholipid whose ratio is regarded as 1. The reactive phospholipid herein also means the total reactive phospholipid, including reactive phospholipids to which the antigen molecule is bound and reactive phospholipids to which no antigen molecule is bound.

(115) Especially preferred examples of the composition of the liposome portion of the IBV liposome vaccine include those containing the following reactive phospholipid, neutral phospholipid, acidic phospholipid, and liposome stabilizer at any molar ratios described above. Reactive phospholipid: dioleoylphosphatidylethanolamine (DOPE) Neutral phospholipid: dioleoylphosphatidylcholine (DOPC) Acidic phospholipid: dioleoylphosphatidylglycerol (DOPG) Liposome stabilizer: cholesterol

(116) The liposomes each comprising an IBV-derived antigen molecule(s) bound to the surface thereof may be formulated as a vaccine by mixing, as appropriate, with a pharmaceutically acceptable additive such as a carrier, diluent, or excipient suitable for the administration route employed. For example, the liposomes may be provided as a liquid formulation containing the liposomes suspended therein, and the liquid formulation may be orally or parenterally administered to a non-human animal whose symptoms caused by infection with a pathogen are to be reduced, for example, a bird (especially chicken) whose symptoms of IB caused by infection with IBV are to be reduced, or livestock (more specifically, a pig) whose symptoms of PRRS caused by infection with PRRSV are to be reduced. As long as the immunity-inducing ability of the antigen molecule is not deteriorated, the antigen-bound liposomes may be subjected to freeze-drying or vacuum drying for preparation of a liposome powder formulation.

(117) Specific examples of the administration route for the parenteral administration include intravenous administration, subcutaneous administration, intradermal administration, intramuscular administration, transnasal administration, transdermal administration, rectal administration, intratracheal administration, and ocular instillation administration, and, in cases of administration to a bird, in ovo administration. Specific examples of the dosage form include orally administered agents such as solutions and capsules; and parenteral administration agents such as injection solutions (for example, intramuscular injection agents and in ovo administration agents), fine spray agents, coarse spray agents, nasal drops, eye drops, and suppositories. Preferred examples of the administration method or dosage form of the liposome vaccine according to the present invention include fine spray administration (agents), coarse spray administration (agents), nasal instillation administration (agents), ocular instillation administration (agents), intramuscular administration (agents), subcutaneous administration (agents), intradermal administration (agents), and inhalation administration (agents). Other preferred examples of the administration method or dosage form include in ovo administration (agents) in cases of administration to a bird. The IBV liposome vaccine of the present invention has been found to be effective also for 0-day-old newborn chicks, whose development of the immune system is immature. Thus, the vaccine is thought to be capable of sufficiently inducing immunity against IBV also by in ovo administration. In the present invention, the fine spray administration agent is an agent administered by spraying at a droplet particle size of not more than 150 m, and the coarse spray administration agent is an agent administered by spraying at a droplet particle size of not less than 200 m. The inhalation administration agent is an agent generally administered by inhalation at a droplet particle size of about 100 m to about several ten micrometers or less (however, the droplet particle size is not limited thereto, and may be appropriately set). In the present invention, the spray administration is mainly a method in which a plurality of animal individuals are treated with an agent at once. In this administration method, an agent liquid in the form of a mist is sprayed to the heads or whole bodies of the plurality of individuals, to make the individuals inhale the agent. The inhalation administration is an administration method in which an agent liquid in the form of a mist is sprayed to a respiratory organ (the nose or mouth) of one individual in a focused manner, to make the individual inhale the agent. The spray administration is an administration method suitable for relatively small animals such as poultry or poultry chicks, including chickens. The inhalation administration is an administration method suitable for relatively large animals such as pigs and cows.

(118) In particular, the dosage form or administration method of the IBV liposome vaccine according to the present invention is especially preferably a fine spray agent (fine spray administration), and the administration route is especially preferably transnasal administration or intratracheal administration. As described below in the Examples, the IBV liposome vaccine may be administered by spray administration (fine spray administration) at a reduced droplet particle size, to enhance the effect of the vaccine. Thus, the administration method for the IBV liposome vaccine of the present invention is especially preferably fine spray administration, and the fine spray administration is carried out with a droplet particle size of preferably not more than 120 m, more preferably not more than 100 m, for example, 50 m to 100 m. The droplet particle size can be easily controlled using a known fine spray administration apparatus. The dosage form and administration route of the PRRSV liposome vaccine according to the present invention are especially preferably an intramuscular administration agent and intramuscular administration.

(119) The dose of the IBV liposome vaccine of the present invention is not limited as long as it is an amount effective for prevention of IBV infection or for reduction of symptoms of IB caused by IBV infection. The effective amount is appropriately selected depending on the body weight, age, and the like of the non-human animal (more specifically, poultry, especially chicken) to which the vaccine is to be administered. The vaccine may be, but does not necessarily need to be, administered at a dose of about 0.03125 to 2 g, for example, about 0.25 to 1 g, per administration in terms of the amount of the IBV-derived polypeptide. The term symptoms of IB includes not only respiratory symptoms as the cardinal symptoms, but also various symptoms known as symptoms of IB, such as nephritis, egg-laying disorders (for example, a decreased egg-laying rate, and production of malformed eggs), and diarrhea.

(120) The same applies to the doses of vaccines against pathogens other than IBV. For example, the dose of the PRRSV liposome vaccine is not limited as long as it is an amount effective for prevention of PRRSV infection or for reduction of symptoms of PRRS caused by PRRSV infection. The effective amount is appropriately selected depending on the body weight, age, and the like of the pig to which the vaccine is to be administered. The vaccine may be, but does not necessarily need to be, administered at a dose of about 0.1 to 500 g, for example, about 10 to 200 g, per administration in terms of the amount of the PRRSV-derived polypeptide. The term symptoms of PRRS includes various symptoms known as symptoms of PRRS, such as respiratory symptoms including cough and dyspnea; reproductive disorders including abortion or stillbirth in mother pigs; weakness; anorexia; eyelid edema; and a decreased rate of weight gain.

(121) The amount of antigen polypeptide molecules bound to the liposome surface may be measured by an ordinary method utilizing the BCA method. More specifically, the amount of the antigen polypeptide on the liposome surface may be measured using a Pierce (trade name) BCA Protein Assay KitReducing Agent Compatible (Thermo Fisher Scientific Inc.), and using the prepared antigen polypeptide-bound liposomes as a measurement sample, according to the manufacturer's instructions for the kit.

(122) The frequency of administration of the IBV liposome vaccine is not limited. Although a certain degree of effect can be obtained even by single administration, the administration is preferably carried out two or more times in order to obtain a high effect to reduce the symptom onset against IBV. The administration may be carried out, for example, two to live times, two to four times, or two or three times. However, there is no upper limit of the number of doses, and, when necessary, six or more times of administration may be carried out for a single individual. For efficient immune induction, the dosing interval of the vaccine is preferably at least 1 week. For example, the vaccine is preferably administered a plurality of times at dosing intervals of not less than 10 days, preferably not less than 2 weeks.

(123) The number of doses of the PRRSV liposome vaccine is also not limited. The vaccine may be administered one or more times, but, for obtaining a high effect against PRRSV, the vaccine is preferably administered two or more times. The administration may be carried out, for example, two to five times, two to four times, or two or three times. However, there is no upper limit of the number of doses, and, when necessary, six or more times of administration may be carried out for a single individual. For efficient immune induction, the dosing interval of the vaccine is preferably at least 1 week. For example, the vaccine is preferably administered a plurality of times at dosing intervals of not less than 10 days, preferably not less than 2 weeks.

(124) The timing of administration of the IBV liposome vaccine is not limited, and the vaccine may be administered at any age in days. For example, from the viewpoint of effectively preventing spreading of IB in a population, the IBV liposome vaccine of the present invention is preferably administered at least once during a period in an early stage after hatching (about 0 day old to about 21 days old). For example, the vaccine may be administered once during the period from 0 day old to 14 days old (especially at 0 day old), and then, after the appropriate dosing interval described above, the second administration may be carried out. Further, when necessary, the third and/or later administrations may be carried out. In cases of in ovo inoculation, the vaccine may be inoculated at least once during the period from about 17 to 20 days old, for example, from 18 to 19 days old, in terms of the incubation age in days, although the timing is not limited. It is usually preferred to carry out in ovo inoculation once, and then to carry out one or more times of inoculation after hatching. Further, for example, for the purpose of suppressing egg-laying disorders due to IB caused by IBV infection, the vaccine may be administered to a mature female bird (in cases of a chicken, an egg-laying chicken at not less than 120 days old) at least once, preferably two or more times at the appropriate dosing intervals described above.

(125) The timing of administration of the PRRSV liposome vaccine is also not limited, and the vaccine may be administered at any age in days or weeks. For example, the vaccine may be administered at least once during the period from 2 weeks old to 10 weeks old. In addition to the administration to a young pig, at least one time of administration may be carried out for a female pig several weeks (for example, 3 to 4 weeks) before mating, for reduction of reproductive disorders and improvement of the reproductive performance of the female pig.

(126) The number of doses and the timing of administration of a liposome vaccine against a pathogen other than IBV and PRRSV are also not limited, and may be appropriately set depending on the type of the pathogen, the type and age of the subject animal, and the like.

Examples

(127) The present invention is described below more concretely by way of Examples. However, the present invention is not limited to the following Examples.

(128) 1. Preparation of Recombinant Antigens

(129) <Object>

(130) For preparation of liposome vaccines against infectious bronchitis virus (hereinafter referred to as IBV), full-length nucleocapsid protein (N protein) and full-length membrane (M) protein, which are relatively highly conserved among IBV strains, were prepared as antigens for the vaccines, using recombinant E. coli.

(131) <Materials and Methods>

(132) (1) Search for Antigen Regions

(133) Since N protein and M protein of IBV have been reported to be relatively highly conserved, these proteins were used as antigen candidate regions. For 11 IBV strains that were recently isolated in Japan, homologies were evaluated by sequence analysis, to select the IBV to be used as the antigen template.

(134) The search for the antigen regions was carried out using the following primers.

(135) TABLE-US-00001 NproteinFw: (SEQIDNO:15) GCGTGTACCTCTCTAGTAT NproteinRv: (SEQIDNO:16) GCTACATGCCTATCTBCCTTA(B=G/T/C) MproteinFw: (SEQIDNO:17) GGTAGAAAACTTAACAATCC MproteinRv: (SEQIDNO:18) AAGACTACTTCCTCCTGTTG
(2) Preparation of Recombinant Proteins by E. coli Expression System

(136) Each full-length antigen region determined in (1) was amplified by the RT-PCR method, and then inserted into a vector (N-terminal His-tag labeling plasmid). The resulting plasmid was introduced into E. coli for cloning, to transform the E. coli. Subsequently, plasmid was extracted from E. coli in which the insertion of the target gene could be confirmed by PCR, and the extracted plasmid was introduced into E. coli for protein expression, to transform the E. coli. Subsequently, the E. coli for expression was cultured, and IPTG was added thereto for induction of expression, to allow expression of a recombinant protein. The bacterial cells were disrupted by sonication, and affinity purification using a His tag was carried out. For the solution after the purification, the total protein concentration was measured. SDS-PAGE was carried out to confirm that the expressed protein is found at the position corresponding to the assumed molecular weight.

(137) The RT-PCR, and the PCR for confirmation of the insertion of the target gene were carried out using the following primers.

(138) TABLE-US-00002 [RT-PCR] NproteinFw: AAGGCCTCTGTCGACATGGCAAGCGGTAAGG(SEQIDNO:19; theunderlineindicatesaSalIrecognitionsite) NproteinRv: AGAATTCGCAAGCTTTCAAAGTTCATTTTCACCAA(SEQIDNO:20; theunderlineindicatesaHindIIIrecognitionsite) MproteinFw: AAGGCCTCTGTCGACATGGAAAATTGCACACTTAAC(SEQIDNO: 21;theunderlineindicatesaSalIrecognitionsite) MproteinRv: AGAATTCGCAAGCTTTTATGTGTAAAGACTACCCCC(SEQIDNO: 22;theunderlineindicatesaHindIIIrecognition site)
[Confirmation of the Insertion of the Target Gene]

(139) TABLE-US-00003 NproteinFw: (SEQIDNO:23) TAATACGACTCACTATAGGG NproteinRv: (SEQIDNO:24) ATGCTAGTTATTGCTCAGCGG MproteinFw: (SEQIDNO:25) CCCGAAAAGTGCCACCTG MproteinRv: (SEQIDNO:26) GTTCTGAGGTCATTACTGG

(140) The following reagents and apparatuses were used.

(141) Nucleic acid extraction: QIAamp Viral RNA Mini Kit (QIAGEN)

(142) PCR apparatus: PCR Thermal Cycler Dice (registered trademark) Gradient (TP600) (TaKaRa)

(143) Gel purification of DNA: QIAquick Gel Extraction Kit (QIAGEN)

(144) Vector plasmids: pET-6HN-N(Clontech) was used for N protein, and pQE-31 (Qiagen) was used for M protein.

(145) Competent cells: The BL21(DE3) pLySs strain (Invitrogen) was used for N protein, and the XL1-Blue strain (Nippon Gene) was used for M protein.

(146) Ligation: An In-Fusion (registered trademark) HD Cloning Kit (Clontech) was used for N protein, and a DNA Ligation Kit (TaKaRa) was used for M protein.

(147) Induction of protein expression: IPTG (TaKaRa)

(148) Sequence analysis: Outsourcing to FASMAC Co., Ltd. or Bio Matrix Research, Inc.

(149) Affinity purification using the His tag: Profinia Protein Purification System (BioRad)

(150) <Results>

(151) (1) Search for Antigen Regions

(152) As a result of comparison of the amino acid homology of the full-length N or M protein region among the 11 strains (10 strains in the case of M protein) that were recently isolated in Japan. N protein exhibited a matching rate of 93 to 99%, and M protein exhibited a matching rate of 90 to 99% indicating that both proteins are highly conserved among the strains (Table 1-1, Table 1-2). Based on this result, it could be expected that either N or M protein derived from any of the IBV may be effective as the antigen for the liposome vaccine. Since an infection test system had already been established for IBV Chiba (2004) in the inventors' lab, IBV Chiba (2004) was selected as the template. The base sequences of the expressed regions are as shown in SEQ ID NO:1 (N protein) and SEQ ID NO:3 (M protein), and the amino acid sequences of the N protein and M protein encoded thereby are as shown in SEQ ID NO:2 and SEQ ID NO:4, respectively.

(153) TABLE-US-00004 TABLE 1 Degrees of conservation of the N protein region (about 410 aa) among recent widespread strains in Japan; 11 strains in total Amino acid Chiba Iwate-2 Iwate-3 Fukuoka-3 Hiroshima Niigata-A 1 Hyogo-8 Kagawa-1 Kagawa-1 Kagawa-1 matching rate (%) (2004) (2004) (2004) (2010) (2010) (2010) (2011) (2011) (2010) (2011) (2012) Chiba(2004) 100 96 98 97 98 96 95 96 96 96 95 Iwate-2(2004) 100 96 94 96 95 94 94 95 94 94 Iwate-3(2004) 100 97 99 96 95 96 97 96 95 Fukuoka-3(2010) 100 96 96 93 94 94 98 96 Hiroshima(2010) 100 96 95 96 97 96 95 Niigata-A(2010) 100 94 95 95 95 96 Hyogo-1(2011) 100 97 96 93 94 Hyogo-8(2011) 100 96 93 94 Kagawa-1(2010) 100 94 96 Kagawa-1(2011) 100 96 Kagawa-1(2012) 100 The year when each strain was solated is shown in parentheses.

(154) TABLE-US-00005 TABLE 2 Degrees of conservation of the M protein region (about 227 aa) among recent widespread strains in Japan; 10 strains in total Amino acid Chiba Iwate-2 Iwate-3 Fukuoka-3 Hiroshima Niigata-A 1 Hyogo-8 Kagawa-1 Kagawa-1 matching rate (%) (2004) (2004) (2004) (2010) (2010) (2011) (2011) (2011) (2002) (2011) Chiba(2004) 100 92 96 93 97 96 93 94 95 95 Iwate-2(2004) 100 91 92 93 91 93 90 91 94 Iwate-3(2004) 100 95 95 99 94 94 98 96 Fukuoka-3(2010) 100 93 95 95 92 94 96 Hiroshima(2010) 100 95 95 95 95 95 Niigata-D(2011) 100 94 94 98 96 Hyogo-1(2011) 100 93 94 96 Hyogo-8(2011) 100 94 95 Kagawa-1(2002) 100 96 Kagawa-1(2011) 100 The year when each strain was solated is shown in parentheses.
(2) Preparation of Recombinant Proteins by E. coli Expression System
A. Preparation of Recombinant E. coli

(155) RT-PCR was carried out using total RNA extracted from IBV Chiba (2004) as a template, and amplification of the target gene fragment was confirmed. Regarding the recombinant N protein (IBV-rNp), the amplicon and the plasmid vector (pET6HN-N) were ligated to each other utilizing the same two kinds of restriction enzyme regions (SalI and HindIII) in each of them, and then sequence analysis was carried out to confirm that the insertion occurred in a normal manner. E. coli for cloning (DH5) was transformed with the plasmid vector, and then cultured, followed by recovering the amplified plasmid. E. coli for expression, the BL21(DE3) pLySs strain, was transformed with the plasmid recovered, to prepare recombinant E. coli for expression of IBV-rNp. Concerning the recombinant M protein (IBV-rMp), its expression did not occur with the above combination of the plasmid vector and E. coli for expression. By using the combination of pQE-31 as the plasmid vector and XL1-BLUE as the E. coli for expression, expression of rMp could be found.

(156) B. Induction of Expression and Purification of Recombinant Proteins

(157) A bacterial liquid obtained by preculture in liquid LB medium supplemented with ampicillin was added to TB medium at 1/100 volume, and shake culture was carried out at 37 C. for 3 hours. The culture scale was 3 L in the case of BV-rNp, and 300 mL in the case of IBV-rMp. After the start of the culture, when O.D.600 reached 0.5. IPTG was added thereto to a final concentration of 1 mM (final 1 mM) to induce expression, and then shake culture was further carried out for 3 hours. After centrifugation at 3000 rpm for 30 min at 4 C., the bacterial pellet was collected, and a sonication buffer was added thereto. Sonication was then carried out to disrupt the bacterial cells, and the resulting crude protein solution, containing a recombinant protein, was subjected to affinity purification, to recover the recombinant protein of interest. As a result of measurement of the protein concentration, the total amount of the recombinant protein prepared was assumed to be at least 300 mg in the case of IBV-rNp, and at least 40 mg in the case of IBV-rMp. The assumed molecular weights of IBV-rNp and IBV-rMp are about 49 kDa and about 29 kDa, respectively. SDS-PAGE is known to show apparent molecular weights which are larger by several kilodaltons due to the effect of tag modification (His-tag) to antigens, and, in both cases, clear bands could be observed at positions close to the assumed molecular weights as a result of the SDS-PAGE (FIG. 1, FIG. 2).

(158) <Conclusion>

(159) With recombinant E. coli, IBV-rNp and IBV-rMp were prepared using IBV Chiba (2004) as a template. The immunogenicities of these recombinant proteins against IBV were evaluated in the following animal test.

(160) 2. Preparation of Liposome Vaccines

(161) <Object>

(162) The two kinds of IBV-derived recombinant antigens (IBV-rNp and IBV-rMp) prepared in 1, were subjected to liposome modification treatment to prepare liposome vaccines.

(163) <Materials and Methods>

(164) (1) Liposome Modification of Recombinant Antigens

(165) Each antigen was bound to liposomes by the disuccinimidyl suberate (DDS) method or the glutaraldehyde (GA) method. According to the following protocols, test vaccines (IBV-rNp-GA and IBV-rMp-GA) were prepared.

(166) (1-1) Liposome Modification of Antigen by DSS Method

(167) A. Materials

(168) (a) Antigens: IBV-rNp and IBV-rMp, which were used at 5 mg (10 mg/mL0.5 mL) per coupling reaction. (b) Liposome: DDS-bound oleic acid liposome, which was used at 90 mg lipid per coupling reaction. (c) Sepharose CL-4B (4% cross-linked agarose) (d) Liposome buffer: PBS supplemented with 8% sucrose, pH 7.2
B. Method (one coupling reaction); three coupling reactions were carried out for each antigen. (a) Freeze-dried DSS-bound oleic acid liposomes were dissolved in 2 mL of the liposome buffer. (b) Two milliliters of the liposome suspension was mixed with 0.5 mL of the antigen solution. (c) The resulting mixture was continuously stirred using a stirrer at room temperature for 48 hours. (d) The mixture was then passed through a CL-4B column to recover antigen-bound liposomes by the molecular sieve effect. (e) The total volume was adjusted to 9 mL with the liposome buffer. (f) Filtration was carried out through a 0.45-m filter. (g) The filtered product was stored under refrigeration until use.

(169) The DSS-bound oleic acid liposomes were prepared as described in Patent Documents 2 and 3. More specifically, the procedure was as follows.

(170) With 50 mL of chloroform, 2 g of dioleoylphosphatidylethanolamine (DOPE) and 180 L of triethylamine were mixed, and the resulting mixture was placed in a 300-mL four-necked flask. While the resulting mixture was stirred at room temperature using a stirrer, a solution prepared by dissolving 3 g of DDS in 80 mL of chloroform was added dropwise thereto for 4 hours, to react the amino group of DOPE with one end of DDS. The resulting crude reaction solution was transferred into an eggplant-type flask, and the solvent was removed by distillation using an evaporator. Subsequently, the minimum amount of chloroform with which the crude reaction product can be dissolved was added to the flask, to obtain a highly concentrated crude reaction product solution. The solution was then subjected to column chromatography according to a conventional method using a silica gel equilibrated with chloroform/methanol/water (65/25/1, volume ratio), and only the fraction of interest, in which the amino group of DOPE is bound to one end of DDS, was collected, followed by removing the solvent by distillation, to obtain DDS (suberic acid succinimide group)-bound DOPE, which is the reactive phospholipid of interest.

(171) In an eggplant-type flask, 0.2886 g (0.2831 mmol) of the above-obtained DDS-bound DOPE, 1.3354 g (1.6987 mmol) of dioleoylphosphatidylcholine (DOPC), 0.7663 g (1.9818 mmol) of cholesterol, and 0.4513 g (0.5662 mmol) of dioleoylphosphatidylglycerol (DOPG) Na salt were placed, and 50 mL of a mixed solvent of chloroform/methanol/water (65/25/4, volume ratio) was added thereto, followed by allowing dissolution at 40 C. Subsequently, the solvent was removed by distillation under reduced pressure using a rotary evaporator, to prepare a lipid film. Thereafter, 30 mL of distilled water for injection was added thereto, and the resulting mixture was stirred to obtain a homogeneous slurry. The slurry was then frozen, and dried in a freeze dryer for 24 hours, to obtain a mixed lipid powder.

(172) Subsequently, 60 mL of a separately prepared buffer (1.0 mM Na.sub.2HPO.sub.4/KH.sub.2PO.sub.4, 0.25 M saccharose; pH7.4) was added to the eggplant-type flask containing the mixed lipid powder, and then the resulting mixture was stirred at 40 C. to allow hydration of the lipids, to obtain liposomes. Subsequently, the particle size of the liposomes was adjusted using an extruder. First, the liposomes were passed through an 8-m polycarbonate filter, and then through 5-m, 3-m, 1-m, 0.65-m, 0.4-m, and 0.2-m filters in this order. By this, liposome particles having an average particle size of 206 nm (as measured by the dynamic light scattering method) (DOPE:DOPC:cholesterol:DOPG=1:6:7:2 (molar ratio)) were obtained. The liposome particle suspension was freeze-dried to provide DDS-bound oleic acid liposomes, which were used for the above-described liposome modification of the antigen by the DSS method.

(173) (1-2) Liposome Modification of Antigen by GA Method

(174) A. Materials

(175) (a) Antigens: IBV-rNp and IBV-rMp, which were used at 5 mg (2 mg/ml2.5 ml) per coupling reaction. (b) Liposome: Oleic acid liposome, which was used at 90 mg lipid per coupling reaction. (c) 2.5% Glutaraldehyde solution (d) Saturated glycine-NaOH solution (pH 7.2) (e) Sepharose CL-4B (4% cross-linked agarose) (f) Liposome buffer: PBS supplemented with 8% sucrose, pH 7.2
B. Method (One Coupling Reaction); Each Antigen was Subjected to Three Coupling Reactions. (a) Two milliliters of the liposome suspension was mixed with 2.5 mL of the antigen solution. (b) To the resulting mixture, 0.5 mL of 2.5% glutaraldehyde solution was added. (c) The resulting mixture was gently stirred in a water bath at 37 C. for 1 hour. (d) The excessive GA was deactivated by addition of 0.5 mL of saturated glycine-NaOH solution. (e) The mixture was then left to stand at 4 C. overnight. (f) The mixture was then passed through a CL-4B column to recover antigen-bound liposomes. (g) The total volume was adjusted to 9 mL with the liposome buffer. (h) Filtration was carried out through a 0.45-m filter. (i) The filtered product was stored under refrigeration.

(176) The oleic acid liposomes used in the GA method were prepared according to the preparation method for the DSS-bound oleic acid liposomes described above, with a molar ratio of DOPE:DOPC:cholesterol:DOPG=3:4:7:2. Sizing of the liposomes was carried out using a polycarbonate filter, and then the liposome suspension was freeze-dried. The liposomes were then dissolved in a buffer (1.0 mM Na.sub.2HPO.sub.4/KH.sub.2PO.sub.4, 0.25 M saccharose; pH 7.4) to a concentration of 90 mg/2 mL, to provide an oleic acid liposome suspension, which was used for the above-described liposome modification of the antigen by the GA method.

(177) (2) Quantification of Antigen Protein

(178) Using a commercially available kit utilizing the BCA method (Pierce (trade name) BCA Protein Assay KitReducing Agent Compatible (Thermo Fisher Scientific Inc.)), the antigen protein bound to the liposome surface was quantified.

(179) <Results>

(180) (1) Liposome Modification of Antigen by DSS Method

(181) The freeze-dried DSS-bound oleic acid liposome powder (90 mg lipid/vial) was rehydrated with distilled water to a total volume of 2 mL per coupling reaction. To the resulting liquid, 0.5 mL of the antigen, whose concentration was adjusted to 10 mg/mL, was added, and the resulting mixture was stirred using a stirrer at room temperature for 48 hours. Three coupling reactions were carried out for each antigen. A column packed with CL-4B (4% cross-linked agarose gel) was equilibrated with PBS, and then the antigen-liposome mixture was applied thereto, to recover a fraction of antigen-bound liposomes by the molecular sieve effect (9 mL/coupling). The fraction was then filtered (0.45 m) to provide a test vaccine (IBV-rNp-DSS or IBV-rMp-DSS). The liquid volume of each test vaccine finally collected was about 25 mL.

(182) (2) Liposome Modification of Antigen by GA Method

(183) For each coupling reaction, 2.5 mL of the antigen, whose concentration was adjusted to 2 mg/mL, was added to the oleic acid liposome suspension (90 mg lipid/vial/2 mL). Subsequently, 0.5 mL of 2.5% glutaraldehyde solution was added to the resulting mixture, and, immediately thereafter, the mixture was shaken in a water bath at 37 C. for 1 hour. After neutralizing the residual aldehyde groups by addition of 0.5 mL of saturated glycine-NaOH solution (pH 7.0), the mixture was left to stand at 4 C. overnight. The purification and the filtration were carried out by the same process as in the DSS method. The liquid volume of each test vaccine (IBV-rNp-GA or IBV-rMp-GA) finally collected was about 25 mL.

(184) (3) Quantification of Antigen Protein

(185) The quantification results are shown below in Table 2-1.

(186) TABLE-US-00006 TABLE 2-1 Quantification of antigen protein Protein Binding Binding concentration efficiency Test vaccine Antigen method (g/ml) (%) 1 IBV-rNp-DSS IBV-rNp DSS 227.8 40.7 2 IBV-rNp-GA GA 217.7 38.9 3 IBV-rMp-DSS IBV-rMp DSS 180.8 32.3 4 IBV-rMp-GA GA 209 37.3
<Conclusion>

(187) By using IBV-rNp or IBV-rMp as an antigen, and by carrying out liposome modification of the antigen by the DSS method or GA method, a total of four kinds of test vaccines were prepared. The performances of these test vaccines were evaluated in the following animal test.

(188) 3. Evaluation of Immunogenicities of Test Vaccines

(189) <Object>

(190) SPF chickens were immunized with each of the four kinds of test vaccines prepared in 2, and subjected to evaluation of the antigen-specific IFN- production-inducing ability and antibody production-inducing ability, to select the test vaccines to be used for the later challenge study.

(191) <Materials and Methods>

(192) (1) Animal Test

(193) The test group setting and the animal test schedule were as shown in Table 3-1 and Table 3-2.

(194) TABLE-US-00007 TABLE 3-1 Test group setting Number of Administration Dose Amount of antigen Test group chickens Test vaccine route (mL/dose/body) (g/dose/body) Group 1 2 Group 2 2 IBV-rNp-DSS Intra-leg 1 227.8 Group 3 2 IBV-rNp-GA muscle 217.7 Group 4 2 IBV-rMp-DSS 180.8 Group 5 2 IBV-rMp-GA 209

(195) TABLE-US-00008 TABLE 3-2 Animal test schedule Age in weeks Test group 6 8 10 11 Unimmunized Autopsy group (Group 1) Immunization First Booster Booster groups immunization immunization immunization (Groups 2, 3, 4, 5)
(2) Evaluation of IFN- Production-Inducing Ability

(196) Using lymphocytes collected from the spleen of each test chicken, the antigen-specific IFN- production-inducing ability was measured by ELISPOT for detection of chicken IFN-.

(197) (3) Evaluation of Antibody-Inducing Ability

(198) Using serum of each test chicken, the antigen-specific blood antibody titer was measured by ELISA.

(199) <Results>

(200) (1) Animal Test

(201) Six-week-old SPF chickens were immunized by a total of three times of injection of a test vaccine into the leg muscle (1 mL per injection) at 2-week intervals. After the immunization, no side reaction such as swelling or induration was found at the injection site. One week after the final immunization, each chicken was dissected to collect spleen. In addition, at the start of the test and during the dissection, sera for ELISA were collected.

(202) (2) Evaluation of IFN- Production-Inducing Ability

(203) To a single-cell suspension prepared from the spleen of the test chicken, a test vaccine antigen (IBV-rNp or IBV-rMp) was added at 5 to 40 g/mL as a stimulating antigen, and the cells were then cultured in a 5% CO.sub.2 incubator at 41 C. for 20 hours. The lymphocytes activated in response to the stimulating antigen produced IFN-, and the sites of the production appeared as spots on the well. The number of the spots was counted to evaluate the antigen-specific IFN- production-inducing ability. As a result, for all test vaccines, significant activities of lymphocytes against antigen stimulation at not less than 5 g/mL could be found, and there was a positive correlation between the number of spots and the concentration of the stimulating antigen (FIG. 3-1, FIG. 3-2). For each antigen, no large difference in the number of spots was found between the binding methods. Based on comparison at each stimulating antigen concentration, IBV-rNp tended to show a larger number of spots than IBV-rMp. There was no large difference in the result among the test chickens within each test group.

(204) (3) Evaluation of Antibody-Inducing Ability

(205) Using 3 g/well of IBV-rNp or IBV-rMp as an antigen, ELISA was carried out to measure the blood antibody titers before and after the immunization. As a result, induction of specific antibody due to the immunization with the test vaccine was found (FIG. 3-3, FIG. 3-4).

(206) <Conclusion>

(207) In the immunization method in which the vaccine was injected a plurality of times into the leg muscle of 6-week-old SPF chickens, any of the test vaccines showed activation of IFN--producing lymphocytes and antibody induction. Since no large difference in the activation of IFN--producing lymphocytes was found between the antigen types or between the methods of binding to the liposome, all four kinds of test vaccines were compared with each other in terms of the protection effect in the following challenge test using a highly virulent homologous strain.

(208) 4. Evaluation of Effectiveness of Test Vaccines (1)

(209) <Object>

(210) SPF chickens were immunized with each of the four kinds of test vaccines prepared in 2, and thereafter, the chickens were challenged with the IBV Chiba (2002) strain (highly virulent homologous strain), from which the antigen protein was derived. By this, the effectiveness of each test vaccine was evaluated.

(211) <Materials and Methods>

(212) (1) Animal Test

(213) The test group setting and the animal test schedule were as shown in Table 4-1 and Table 4-2. For the evaluation of the effectiveness (protection effect) of each test vaccine, a test group using the IBV Chiba strain MSV, which was prepared by attenuation of the IBV Chiba (2002) strain, as a live vaccine was set up, and this test group was used as a positive control group (test group showing an evident protection effect). In addition, a test group in which only the challenge is carried out was set up to provide a challenge control group.

(214) TABLE-US-00009 TABLE 4-1 Test group setting Amount of Dose Test Number of Immunization Administration antigen/virus (mL/dose .Math. group chickens material route titer body) Challenge Group 1 5 IBV-rNp-DSS Intra-leg 227.8 g/mL 0.5 Chiba(2002) Group 2 5 IBV-rNp-GA muscle 217.7 g/mL Group 3 5 IBV-rMp-DSS 180.8 g/mL Group 4 5 IBV-rMp-GA 209 g/mL Group 5 5 Live vaccine Ocular 5.0 logEID.sub.50/mL 0.03 instillation Group 6 5

(215) TABLE-US-00010 TABLE 4-2 Animal test schedule Test Schedule (Day) group Content 0 14 21 28 35 42 Groups Test First Booster Booster Challenge Autopsy 1 to 4 vaccine immunization immunization immunization Group 5 Live First vaccine immunization Group 6 Challenge control
(2) Evaluation Items
A. Evaluation Based on Tracheal Ciliary Movement Score

(216) As is commonly carried out for evaluation of the respiratory symptoms after IBV infection, the tracheal ciliary movement activity was scored. More specifically, for the trachea collected from each test chicken by the autopsy, tracheal rings were prepared at five sites per individual in the lab. For each of these, activity of the tracheal ciliary movement was observed under the microscope, and scoring was carried out according to the following criteria:

(217) 0=active movement; 1=rather weak; 2=very weak/partial movement; 3=arrest.

(218) After calculating the average score for each individual, the score for each test group was calculated.

(219) *A higher score indicates that the respiratory damage caused by IBV is severer (the protection effect of the vaccine is lower).

(220) B. Quantification of Viral Gene in Organs

(221) From trachea and kidney collected by the autopsy, 10% (w/v) organ emulsions were prepared, and centrifugation was carried out at 3000 rpm at 4 C. for 20 min, followed by collecting the supernatant.

(222) C. Isolation of Virus from Organs

(223) From trachea and kidney collected by the autopsy, 10% (w/v) organ emulsions were prepared, and centrifugation was carried out at 3000 rpm at 4 C. for 20 min, followed by collecting the supernatant. The emulsion supernatant, after 10-fold serial dilution with PBS, was inoculated to primary renal cells derived from SPF chickens (hereinafter referred to as CK cells), and, on Day 4 after the inoculation, the cells were observed for the presence or absence of the cytopathic effect characteristic to IBV. By this, virus isolation was confirmed, and the virus titer was measured.

(224) D. Measurement of Neutralizing Antibody Titer

(225) Sera of each individual collected at the times of the challenge and autopsy were subjected to measurement of the neutralizing antibody titer against the IBV Chiba (2002) strain using CK cells derived from SPF chickens.

(226) <Results>

(227) (1) Animal Test

(228) A total of six test groups were set up, and five chickens were tested for each test group. In the four test vaccine groups, 0.5 mL of a test vaccine was injected into the leg muscle at 5 weeks old, 7 weeks old, and 9 weeks old. In the live vaccine group, 30 L each of 1 dose (3.5 log EID.sub.50/body) of the IBV Chiba strain MSV was inoculated by ocular instillation at 8 weeks old. In all test groups including the challenge control group, each chicken was challenged by intratracheal inoculation of 50 L of 3.5 log EID.sub.50/body of the Chiba (2002) strain at 10 weeks old. The chickens were kept under observation of clinical symptoms, and subjected to autopsy at Week 1 after the challenge. For the organs and sera collected upon the challenge and autopsy, observation of the tracheal ciliary movement, isolation of the virus, quantification of the viral gene, and measurement of the neutralizing antibody titer were carried out.

(229) (2) Evaluation Based on Tracheal Ciliary Movement Score

(230) Compared to the challenge control group, the IBV-rNp-DSS group and the IBV-rNp-GA group showed lower suppression of the tracheal ciliary movement (FIG. 4-1). On the other hand, the IBV-rMp-DSS group and the IBV-rMp-GA group showed results equivalent to the result in the challenge control group.

(231) (3) Quantification of Viral Gene in Organs

(232) In all test groups, viral gene was detected from trachea and kidney collected by the autopsy (FIG. 4-2). Compared to the challenge control group, the IBV-rNp-DSS group and the IBV-rNp-GA group tended to show decreased amounts of viral gene in the organs.

(233) (4) Virus Isolation and Measurement of Virus Titer

(234) Compared to the challenge control group, the IBV-rNp-DSS group and the IBV-rNp-GA group showed decreased virus isolation rates from the organs and decreased average virus titers in the isolation-positive samples (FIG. 4-3). On the other hand, the IBV-rMp-DSS group and the IBV-rMp-GA group showed results equivalent to those in the challenge control group.

(235) (5) Measurement of Neutralizing Antibody Titer

(236) Regarding the neutralizing antibody titer upon the challenge, the live vaccine group showed a 23-fold titer, while all test vaccine groups showed less than 4-fold titers. At Week 1 after the challenge, all test vaccine groups showed increased titers of about 16-fold. However, these titers were equivalent to the titer in the challenge control group (FIG. 4-4).

(237) <Conclusion>

(238) As a result of evaluation of the effectiveness of the four kinds of test vaccines against the IBV Chiba (2002) strain, which corresponds to the antigen homologous strain, the two kinds of test vaccines using IBV-rNp as the antigen were found to have an effect to reduce the symptom onset. On the other hand, an effect to reduce the symptom onset was not found with the test vaccines using IBV-rMp as the antigen.

(239) 5. Evaluation of Effectiveness of Test Vaccines (2)

(240) <Object>

(241) SPF chickens immunized using IBV-rNp-DSS or IBV-rNp-GA, for which a certain level of effectiveness (symptom onset-reducing effect) was found in 4, among the four kinds of test vaccines prepared in 2, were challenged with highly virulent heterologous strains having genotypes which are the same as or different from the genotype of the IBV Chiba (2002) strain, from which the antigen protein was derived, to evaluate the effectiveness of IBV-rNp-DSS and IBV-rNp-GA.

(242) <Materials and Methods>

(243) (1) Animal Test

(244) The test group setting and the test schedule were as shown in Table 5-1 and Table 5-2. For evaluation of the effectiveness (protection effect) of each test vaccine, chickens were challenged with three kinds of highly virulent heterologous field strains. In addition, a test group in which only the challenge is carried out was set up to provide a challenge control group.

(245) TABLE-US-00011 TABLE 5-1 Test group setting Antigen Number of concentration Immunization Dose Challenge strain Test group chickens Test vaccine (g/mL) route (mL/body) (genotype) Group 1 5 IBV-rNp-DSS 200 Injection into 0.5 Niigata/2010 Group 2 5 IBV-rNp-GA leg muscle strain Group 3 5 IBV-rNp-DSS Ocular 0.1 (JP-II) instillation Group 4 5 None Group 5 5 IBV-rNp-DSS 200 Injection into 0.5 Ehime/2011 Group 6 5 IBV-rNp-GA leg muscle strain Group 7 5 IBV-rNp-DSS Ocular 0.1 (JP-III) instillation Group 8 5 None Group 9 5 IBV-rNp-DSS 200 Injection into 0.5 Kagawa/2012/1 Group 10 5 IBV-rNp-GA leg muscle strain Group 11 5 IBV-rNp-DSS Ocular 0.1 (JP-IV) instillation Group 12 5 None

(246) TABLE-US-00012 TABLE 5-1 Animal test schedule Age in weeks Test group 5 7 9 10 11 Immunization groups First Booster Booster Challenge Autopsy (1, 2, 3, 5, 6, 7, 9, 10, 11) immunization immunization immunization Observation Challenge control groups (4, 8, 12)
(2) Evaluation Items

(247) The following items were evaluated in the same manner as in 4. A. Evaluation based on the tracheal ciliary movement score B. Quantification of viral gene in organs C. Isolation of virus from organs
<Results>
(1) Animal Test

(248) A total of 12 test groups were set up, and five chickens were tested for each test group. In the intramuscular injection immunization group, 0.5 mL each of the test vaccine was injected into the leg muscle at 5 weeks old, 7 weeks old, and 9 weeks old. In the ocular instillation immunization group, 0.1 mL each of the test vaccine was administered by ocular instillation at 5 weeks old, 7 weeks old, and 9 weeks old. In all test groups including the challenge control group, each chicken was challenged by intratracheal inoculation of 3.5 log EID.sub.50/body (50 L/body) of the challenge virus at 10 weeks old. The chickens were kept under observation of clinical symptoms, and then subjected to autopsy at Week 1 after the challenge, for collecting trachea and kidney. Further, blood was collected at the times of the challenge and autopsy.

(249) (2) Evaluation Based on Tracheal Ciliary Movement Score

(250) Compared to the challenge control group, all immunization groups showed certain levels of reduction of the suppression of the tracheal ciliary movement. No evident difference in the effectiveness was found among the challenge strains (FIG. 5-1). Regarding comparison between the administration routes, intramuscular injection tended to show higher suppression-reducing effects than ocular instillation. However, variation of the suppression-reducing effect was found also within each test group (Table 5-3).

(251) TABLE-US-00013 TABLE 5-3 Distribution of the tracheal ciliary movement score Number of chickens with each score Test group 0 to less than 1 1 to less than 2 2 to 3 Group 1 2 2 1 Group 2 1 2 2 Group 3 1 2 2 Group 4 0 0 5 Group 5 1 3 1 Group 6 2 2 1 Group 7 0 4 1 Group 8 0 0 5 Group 9 2 2 1 Group 10 0 3 2 Group 11 1 3 1 Group 12 0 0 5
(3) Quantification of Viral Gene in Organs

(252) In all test groups, viral gene was detected from trachea and kidney collected by the autopsy (Table 5-4). Compared to the challenge control group, the immunization groups showed significantly smaller amounts of viral gene in the organs (FIG. 5-2).

(253) TABLE-US-00014 TABLE 5-4 Positive ratio in each test group as measured by real-time PCR (%) Test group Trachea Kidney Group 1 100 100 Group 2 100 100 Group 3 100 100 Group 4 100 100 Group 5 100 100 Group 6 100 100 Group 7 100 100 Group 8 100 100 Group 9 100 100 Group 10 100 100 Group 11 100 100 Group 12 100 100
(4) Virus Isolation and Measurement of Virus Titer

(254) Compared to the challenge control group, all immunization groups tended to show decreased virus isolation rates from trachea and kidney collected by the autopsy, and decreased average virus titers (FIG. 5-3, FIG. 5-4). All challenge strains and administration routes showed similar virus isolation rates and virus titers. Chickens showing high tracheal ciliary movement scores (2.0 or higher on average) tended to correspond to virus isolation-positive chickens.

(255) <Conclusion>

(256) The test liposome vaccines using IBV-rNp as the antigen showed certain levels of symptom onset-reducing effect against the three highly virulent heterologous strains. In the ocular instillation groups, the amount of antigen used was one-fifth the amount in the intramuscular injection groups. However, the symptom onset-reducing effect in the ocular instillation groups was only slightly lower than that in the groups employing the intramuscular injection route. When IBV-rNp-DSS and IBV-rNp-GA were used under the same conditions, IBV-rNp-DSS tended to show relatively higher effectiveness. Therefore, IBV-rNp-DSS was used in the following studies.

(257) 6. Evaluation of Effectiveness of Test Vaccines (3)

(258) <Object>

(259) Since IBV is widespread in the environment, vaccination is commonly carried out at birth (0-day-old). Since the above animal tests in the present study were carried out using 5-week-old chicks, the effectiveness for newborn chicks, whose development of the immune system is more immature, has been unclear. In view of this, using IBV-rNp-DSS as a test vaccine, the effectiveness of the vaccine for newborn chicks was evaluated by setting conditions regarding the administration route, antigen concentration, and number of doses.

(260) <Materials and Methods>

(261) (1) Animal Test

(262) The test group setting and the test schedule were as shown in Table 6-1 and Table 6-2. For evaluation of the effectiveness (protection effect) of IBV-rNp-DSS, conditions regarding the antigen concentration and the number of times of immunization were set for each of three kinds of administration routes, and immunization was carried out. Thereafter, a challenge with a highly virulent heterologous strain was carried out. In addition, a test group in which only the challenge is carried out was set up to provide a challenge control group.

(263) TABLE-US-00015 TABLE 6-1 Test group setting Antigen concentration in vaccine stock Number of Test Number of Administration solution Fold- Dose times of Challenge group chickens Test vaccine route (g/mL) concentration (L/body) immunization strain 1 4 IBV-rNp-DSS Ocular 200 4 50 1 Kagawa/ 2 4 instillation 4 3 2012/1 3 4 None 1 strain 4 4 None 3 5 4 IBV-rNp-DSS Nasal 200 4 50 1 6 4 instillation 4 3 7 4 None 1 8 4 None 3 9 4 IBV-rNp-DSS Intra-leg 200 4 50 1 10 4 muscle 4 3 11 4 None 1 12 4 None 4 13 4 None

(264) TABLE-US-00016 TABLE 6-2 Test schedule Age in days Test group 0 7 14 21 28 Single- Immuni- Challenge Autopsy immunization zation groups Three- Immuni- Immuni- Immuni- immunization zation zation zation groups Challenge control group
(2) Evaluation Items

(265) The following items were evaluated in the same manner as in 4. A. Evaluation based on the tracheal ciliary movement score B. Quantification of viral gene in organs C. Isolation of virus from organs
<Results>
(1) Animal Test

(266) A total of 13 test groups were set up, and four chicks were tested for each test group. As the administration routes, ocular instillation, nasal instillation, and intramuscular injection were set up. As an immunizing material, the stock solution of IBV-rNp-DSS, or a 4-fold concentrated solution prepared by freeze-drying the stock solution and rehydrating the freeze-dried product with 1/4 volume of PBS, was used. Administration of 50 L each of the test vaccine was carried out only at birth in the single-immunization group; and at birth, 7 days old, and 14 days old in the three-immunization group. In all test groups including the challenge control group, each chick was challenged by nasal instillation inoculation of 3.5 log EID.sub.50/body (50 L/body) of the challenge strain at 21 days old. The chicks were kept under observation of clinical symptoms, and then subjected to autopsy at Week 1 after the challenge, for collecting trachea and kidney.

(267) (2) Evaluation Based on Tracheal Ciliary Movement Score

(268) In the test groups in which the immunization was carried out three times with the 4-fold concentrate or stock solution of IBV-rNp-DSS by the nasal instillation route (Group 6 and Group 8), and the test group in which the immunization was carried out three times with the 4-fold concentrate of IBV-rNp-DSS by the intramuscular route (Group 10), the suppression of the tracheal ciliary movement tended to be reduced (FIG. 6-1). However, variation of the score among individuals was found also within each test group (Table 6-3).

(269) TABLE-US-00017 TABLE 6-3 Distribution of the tracheal ciliary movement score Number of chickens with each score Test group 0 to less than 1 1 to less than 2 2 to less than 3 Group 1 0 1 3 Group 2 0 2 2 Group 3 0 1 3 Group 4 0 2 2 Group 5 0 1 3 Group 6 3 1 0 Group 7 2 0 2 Group 8 3 1 0 Group 9 0 3 1 Group 10 1 3 0 Group 11 0 0 4 Group 12 1 2 1 Group 13 0 0 4
(3) Quantification of Viral Gene in Organs

(270) Viral gene was detected from the trachea and kidney in all immunization groups. However, for any of the administration routes, the test groups in which the immunization was carried out three times showed significant decreases in the amount of viral gene in the trachea or kidney (FIG. 6-2, Table 6-4).

(271) TABLE-US-00018 TABLE 6-4 Positive ratio as measured by real-time PCR (%) Test group Trachea Kidney Group 1 100 100 Group 2 100 100 Group 3 100 100 Group 4 100 100 Group 5 100 100 Group 6 100 100 Group 7 100 100 Group 8 100 100 Group 9 100 100 Group 10 100 100 Group 11 100 100 Group 12 100 100 Group 13 100 100
(4) Virus Isolation and Measurement of Virus Titer

(272) In the test groups in which the immunization was carried out three times by the nasal instillation route (Group 6 and Group 8), the virus isolation rates from the organs decreased (FIG. 6-3). In the cases of the nasal instillation route, the virus titers in the organs significantly decreased even by the single immunization, but the virus titers further decreased by the three times of immunization (FIG. 6-4).

(273) <Conclusion>

(274) IBV-rNp-DSS was found to have a certain level of symptom onset-reducing effect also for newborn chicks. Among the immunization methods in the present study, the three times of administration by the nasal instillation route was most effective. In the cases of the nasal instillation route, no large difference in the effectiveness was found between the different antigen concentrations.

(275) 7. Study of Test Vaccine Administration Method (1)

(276) <Object>

(277) Since IBV-rNp-DSS showed high effectiveness by the nasal instillation route in 6, the effectiveness of spray administration (coarse spray or fine spray) was studied assuming its on-site application.

(278) <Materials and Methods>

(279) (1) Animal Test

(280) The test group setting and the test schedule were as shown in Table 7-1 and Table 7-2. Conditions regarding the antigen concentration and the number of times of immunization were set for each of three kinds of administration routes, and immunization was carried out. Thereafter, a challenge with a highly virulent heterologous strain was carried out. In addition, a test group in which only the challenge is carried out was set up to provide a challenge control group. The droplet particle size was adjusted using a live-vaccine power sprayer (Nyukon 607, Kimura Nosan) to 250 to 300 m for the coarse spray administration, and to 50 to 100 m for the fine spray administration.

(281) TABLE-US-00019 TABLE 7-1 Test group setting Antigen concentration in Number vaccine stock Dose Number of Test of Administration solution Fold- (L/body .Math. times of Challenge group chickens Test vaccine route (g/mL) dilution dose) immunization strain 1 4 IBV-rNp-DSS Nasal 200 None 50 2 Kagawa/ 2 4 instillation 10 2 2012/1 3 4 100 2 strain 4 4 None 1 5 4 IBV-rNp-DSS Coarse 200 10 100 2 6 4 spray 100 2 7 4 1000 2 8 4 10 1 9 4 IBV-rNp-DSS Fine 200 10 100 2 10 4 spray 100 2 11 4 1000 2 12 4 10 1 13 4 None

(282) TABLE-US-00020 TABLE 7-2 Animal test schedule Age in days Test group 7 14 35 42 Single-immunization Immunization Challenge Autopsy groups Two-immunization Immunization Immunization groups Challenge control group
(2) Evaluation Items

(283) The following items were evaluated in the same manner as in 4. A. Evaluation based on the tracheal ciliary movement score B. Quantification of viral gene in organs C. Isolation of virus from organs
<Results>
(1) Animal Test

(284) A total of 13 test groups were set up, and four birds were tested for each test group. The test vaccine was administered after up to 100-fold dilution with PBS for the nasal instillation route, or after up to 1000-fold dilution with PBS for the coarse spray or fine spray route. Administration of the test vaccine was carried out only at 7 days old in the single-immunization group; and at 7 days old and 14 days old in the two-immunization group. In the cases of the nasal instillation route, 50 L/dose of the vaccine was administered for each bird. In the cases of the coarse spray or fine spray route, taking the amount of loss into account, 100 L/dose of the vaccine was administered for each bird. When the administration was carried out by the coarse spray or fine spray route, each test chicken was placed in a large plastic bag, and a predetermined amount of the test vaccine was administered from about 50 cm above the test chicken toward its face. Thereafter, the mouth of the plastic bag was tied, and the plastic bag was left to stand for about 1 minute to provide an environment which allows the test chicken to efficiently inhale test vaccine particles floating in the air. In all test groups including the challenge control group, each chicken was challenged by intratracheal inoculation of 3.5 log EID.sub.50/body (50 L/body) of the challenge strain at 21 days old. The chickens were kept under observation of clinical symptoms, and then subjected to autopsy at Week 1 after the challenge, for collecting trachea and kidney.

(285) (2) Evaluation Based on Tracheal Ciliary Movement Score

(286) In the cases of the nasal instillation route, the two-immunization groups showed reduction of the suppression in an antigen concentration-dependent manner. However, in the single-immunization group, suppression-reducing effect was found (FIG. 7-1). In the cases of the coarse spray route, the two-immunization groups showed certain levels of reduction of the suppression at up to 100-fold dilution. However, the result obtained at 1000-fold dilution was equivalent to that in the challenge control group. In the cases of the fine spray route, the two-immunization groups showed similar average scores at up to 1000-fold dilution. Even at 1000-fold dilution, two out of the four chickens showed average scores of less than 1 (Table 7-3). Variation of the score among individuals was found also within each test group.

(287) TABLE-US-00021 TABLE 7-3 Distribution of the tracheal ciliary movement score Number of chickens with each score Test group 0 to less than 1 1 to less than 2 2 to less than 3 Group 1 1 2 1 Group 2 0 3 1 Group 3 1 0 3 Group 4 0 1 3 Group 5 1 0 3 Group 6 0 2 2 Group 7 0 0 4 Group 8 0 0 4 Group 9 1 1 2 Group 10 2 1 1 Group 11 2 0 2 Group 12 0 1 3 Group 13 0 0 4
(3) Quantification of Viral Gene in Organs

(288) Viral gene was detected from the organs in all immunization groups (Table 7-4). In the two-immunization groups, significant decreases in the amount of viral gene were found for the trachea and/or kidney at up to 10-fold dilution in the cases of the nasal instillation route, up to 100-fold dilution in the cases of the coarse spray route, and up to 1000-fold dilution in the cases of the fine spray route (FIG. 7-2).

(289) TABLE-US-00022 TABLE 7-4 Positive ratio as measured by real-time PCR (%) Test group Trachea Kidney Group 1 100 100 Group 2 100 100 Group 3 100 100 Group 4 100 100 Group 5 100 100 Group 6 100 100 Group 7 100 100 Group 8 100 100 Group 9 100 100 Group 10 100 100 Group 11 100 100 Group 12 100 100 Group 13 100 100
(4) Virus Isolation and Measurement of Virus Titer

(290) In the cases of the fine spray route, the two-immunization groups showed decreased virus-isolation-positive rates from the organs even at 1000-fold dilution (FIG. 7-3). The maximum dilution factor at which a significant difference was found in the virus titer for the trachea was 10 in the cases of the nasal instillation route, and 1000 in the cases of the fine spray route. However, a large variation was found among individuals within each test group (FIG. 7-4).

(291) <Conclusion>

(292) It could be confirmed that spray administration also shows a certain level of effectiveness, and that fine spray administration, which is carried out with smaller particle sizes, exhibits better maintenance of the effectiveness even at higher dilution factors. However, since spray administration tended to show large variation among individuals, improvement of the immunization method was attempted.

(293) 8. Study of Antigen Region of Test Vaccine

(294) <Object>

(295) Surface-bound liposome vaccines are characterized in that they strongly induce cytotoxic T lymphocyte (CTL) response. However, the CTL epitope region of IBV has not yet been clarified. IBV-rNp-DSS, which is the subject of the present study, uses full-length IBV nucleocapsid (N) protein as the antigen region. However, under the assumption that an epitope may be localized in a partial region of N protein, identification of such an epitope-localized region may lead to improvement of the effectiveness of the liposome vaccine. In view of this, liposome vaccines containing, as the antigen, a fragmented N protein, or a chimeric protein prepared by binding N protein and membrane (M) protein to each other, were prepared, and their effectiveness was compared by animal tests.

(296) <Materials and Methods>

(297) (1) Preparation of Fragmented/Chimeric Proteins and Liposome Modification Thereof

(298) The N protein gene (1230 bp, SEQ ID NO:1) of the IBV Chiba (2002) strain was divided into four parts partially overlapping with each other in both ends, and recombinant proteins were prepared therefrom using recombinant E. coli (FIG. 8-1). The amino acid sequences encoded by the base sequences N1 to N4 are shown in SEQ ID NOs:5 to 12.

(299) In addition, regions of IBV N and M proteins, which regions are especially highly conserved among IBV strains, were bound together to prepare a chimeric protein: Ch(N+M) (FIG. 8-2). The base sequence and amino acid sequence of Ch(N+M) are shown in SEQ ID NOs:13 and 14. In the base sequence of SEQ ID NO: 3, positions 1 to 450 correspond to the N protein region: 241-690 (450 bp), and positions 451 to 657 correspond to the M protein region: 454-660 (207 bp).

(300) These were bound to the liposome surface by the DSS method, to prepare a liposome vaccine.

(301) (2) Animal Test

(302) The test group setting and the test schedule were as shown in Table 8-1 and Table 8-2. At 7 days old and 14 days old, the test vaccine, 10-fold diluted with PBS, was administered to chickens by spraying (fine spray), and then the birds were challenged with a highly virulent heterologous strain. In addition, a test group in which only the challenge is carried out was set up to provide a challenge control group. The droplet particle size was adjusted using a live-vaccine power sprayer (Nyukon 607, Kimura Nosan) to 50 to 100 m for the fine spray administration. Further, in order to reduce variation among the individuals, the administration time in each test group was increased from 4 seconds to 6 seconds while the dose of the test vaccine was the same as in the method carried out in 7.

(303) TABLE-US-00023 TABLE 8-1 Test group setting Antigen concentration in vaccine stock Dose Number of Test Number Vaccine Administration solution Fold- (L/body/ times of Challenge group of birds antigen route (g/mL) dilution dose) immunization strain 1 8 N1 Fine spray 200 10-fold 100 2 IBV 2 8 N2 Kagawa/ 3 8 N3 2012/1 4 8 N4 strain 5 8 N + M 6 8 IBV-rNp (full length) 7 6

(304) TABLE-US-00024 TABLE 8-2 Test schedule Age in days Test group 7 21 28 35 Immunization Immunization Immunization Challenge Autopsy groups Challenge control group
(3) Evaluation Items

(305) The following items were evaluated in the same manner as in 4. A. Evaluation based on the tracheal ciliary movement score B. Quantification of viral gene in organs
<Results>
(1) Preparation of Fragmented/Chimeric Proteins and Liposome Modification Thereof

(306) The N protein gene (1230 bp) derived from the IBV Chiba (2002) strain was divided into four parts partially overlapping with each other in both ends, and recombinant proteins were prepared therefrom using recombinant E. coli. The recombinant proteins were designated N1, N2, N3, and N4 in the order from the 5-end side. In addition, regions in IBV N and M proteins, which regions are especially highly conserved among viral strains, were bound together to prepare a chimeric protein (N+M). These were bound to the liposome surface by the DSS method, to prepare a total of five kinds of liposome vaccines.

(307) (2) Animal Test

(308) A total of seven test groups were set up. Eight birds were tested in each of Groups 1 to 6, in which immunization with a liposome vaccine is carried out, and six birds were tested in Group 7, which is a challenge control group. In Groups 1 to 6, a liposome vaccine prepared in (1) was 10-fold diluted with PBS, and 100 L per body of the diluted vaccine was administered by fine spraying (droplet particle size, 50 to 100 m) at 7 days old and 21 days old using a live-vaccine power sprayer. In all test groups including the challenge control group, each bird was challenged by intratracheal inoculation of 3.5 log EID.sub.50/body (50 L/body) of a highly virulent heterologous strain at 28 days old. The birds were kept under observation of clinical symptoms, and then subjected to autopsy at Week 1 after the challenge, for collecting trachea and kidney.

(309) (3) Evaluation Based on Tracheal Ciliary Movement Score

(310) Compared to the challenge control group, all test groups tended to show reduced suppression of the tracheal ciliary movement (FIG. 8-3). In Group 6, (IBV-rNp), in which the highest suppression-reducing effect was found, showed less variation among individuals, and all birds had scores of not more than 1 (Table 8-3). In other test groups, some birds had scores higher than 1, and variation of the score was found among individuals within each test group. Among Groups 1 to 4, in which fragmented N proteins were used, Group 2 and Group 3 tended to show low scores.

(311) TABLE-US-00025 TABLE 8-3 Distribution of the tracheal ciliary movement score Number of birds with each score Test group 0 to less than 1 1 to less than 2 2 to less than 3 Group 1 2 4 2 Group 2 5 1 2 Group 3 4 3 1 Group 4 2 2 4 Group 5 5 2 1 Group 6 7 1 0 Group 7 0 0 8
(4) Quantification of Viral Gene in Organs

(312) Compared to the challenge control group, all test groups showed significantly smaller amounts of viral gene in the trachea and kidney (FIG. 8-4). The highest gene-amount-reducing effect was found in Group 6 (BV-rNp), and the next highest effect was found in Group 5 (N+M). Among Groups 1 to 4, in which the fragmented IBV N proteins were used, Group 2 and Group 3 tended to show smaller amounts of gene.

(313) <Conclusion>

(314) The fragmented or chimeric liposome vaccines showed certain levels of symptom onset-reducing effect against the challenges with the highly virulent heterologous strain. The effectiveness tended to be high in the N2 and N3 regions, but evident localization of the epitope region could not be identified. The test group using the full length (IBV-rNp) as the antigen, which has been studied above, showed a higher symptom onset-reducing effect.

(315) Due to the partial modification of the fine spray administration method, the variation among individuals was reduced, and the symptom onset-reducing effect was improved.

(316) 9. Study of Test Vaccine Administration Method (2)

(317) <Object>

(318) The minimum effective amount of antigen in fine spray administration was studied for IBV-rNp.

(319) <Materials and Methods>

(320) (1) Animal Test

(321) The test group setting and the test schedule were as shown in Table 9-1 and Table 9-2. From 2 g/dose/body in terms of the amount of IBV-rNp antigen, IBV-rNp-DSS was 2-fold serially diluted with PBS, and administered at 7 days old and 21 days old by fine spraying to perform immunization. A challenge was carried out at 28 days old, and autopsy was carried out at 35 days old. In addition, a test group in which only the challenge is carried out was set up to provide a challenge control group.

(322) TABLE-US-00026 TABLE 9-1 Test group setting Amount of rNp Number of Test Number Vaccine Administra- antigen Dose times of Challenge group of birds antigen tion route (g/dose/body) (L/body/dose) immunization strain 1 5 IBV-rNp-DSS Fine 2 100 2 Kagawa/ 2 5 spray 1 2012/1 3 5 0.5 strain 4 5 0.25 5 5 0.125 6 5 0.0625 7 5 0.03125 8 5 None

(323) TABLE-US-00027 TABLE 9-2 Animal test schedule Age in days Test group 7 21 28 35 Immunization Immunization Immunization Challenge Autopsy groups (Groups 1 to 7) Challenge control group (Group 8)
(2) Evaluation Items

(324) The following items were evaluated in the same manner as in 4. A. Evaluation based on the tracheal ciliary movement score B. Quantification of viral gene in organs
<Results>
(1) Animal Test

(325) A total of seven test groups were set up. Eight birds were tested in each of Groups 1 to 6, in which immunization with a liposome vaccine is carried out, and six birds were tested in Group 7, which is a challenge control group. In Groups 1 to 6, a liposome vaccine prepared in (1) was 10-fold diluted with PBS, and 100 L per body of the diluted vaccine was administered by fine spraying (droplet particle size, 50 to 100 m) at 7 days old and 21 days old using a live-vaccine power sprayer. In all test groups including the challenge control group, each bird was challenged by intratracheal inoculation of 3.5 log EID.sub.50/body (50 L/body) of a highly virulent heterologous strain at 28 days old. The birds were kept under observation of clinical symptoms, and then subjected to autopsy at Week 1 after the challenge, for collecting trachea and kidney.

(326) (2) Evaluation Based on Tracheal Ciliary Movement Score

(327) Compared to the challenge control group, all test groups tended to show reduced suppression of the tracheal ciliary movement (FIG. 9-1). The differences in the score among the test groups were small, and there were no birds showing a score of 2 or more in any of the test groups (Table 9-3). Also in the test group with the smallest amount of antigen (Group 7), variation among the individuals was small.

(328) TABLE-US-00028 TABLE 9-3 Distribution of the tracheal ciliary movement score Number of birds with each score Test group 0 to less than 1 1 to less than 2 2 to less than 3 Group 1 4 1 0 Group 2 4 1 0 Group 3 4 1 0 Group 4 3 2 0 Group 5 4 1 0 Group 6 3 2 0 Group 7 3 2 0 Group 8 0 0 5
(3) Quantification of Viral Gene in Organs

(329) Compared to the challenge control group, all test groups showed significantly smaller amounts of viral gene in the trachea and kidney (FIG. 9-2).

(330) <Conclusion>

(331) Since a high symptom onset-reducing effect was found even after the maximum, 640-fold, dilution of the IBV-rNp-DSS stock solution (20 g/mL), it was suggested that the minimum effective amount of antigen in two-time administration of IBV-rNp-DSS by fine spraying corresponds to 640- or higher-fold dilution of the stock solution.

(332) 10. Study on Effectiveness of Liposome Vaccine in Relation to Presence or Absence of Binding between Antigen and Liposome

(333) <Object>

(334) According to a past literature using mice (Taneichi et al., J Immunol. 2006, 177(4):2324-2330), it has been suggested that surface-bound liposome vaccines are required to be in a state where an antigen is bound to the liposome surface, in order to realize their effectiveness. However, no study has yet been carried out on whether this applies to chickens. In view of this, comparison with cases where the antigen or liposome is used alone, or where the antigen and liposome are not bound to each other, was carried out to clarify that binding of the antigen to the liposome is indispensable for realization of the effectiveness.

(335) <Materials and Methods>

(336) (1) Animal Test

(337) The test group setting and the test schedule were as shown in Table 10-1 and Table 10-2. Using IBV-rNp-DSS as a positive control, the antigen/liposome alone, or a liposome-antigen mixture in an unbound state prepared by mixing the antigen and liposome together immediately before the administration, was administered by fine spraying.

(338) TABLE-US-00029 TABLE 10-1 Test group setting Number Amount of IBV- Dose Number of Test of Immunization Administra- rNp antigen (L/body/ times of Challenge group chickens material tion route (g/dose/body) dose) immunization strain Group 1 5 IBV-rNp-DSS Fine spray 2 100 2 Kagawa/ Group 2 5 IBV-rNp only 2 2012/1 Group 3 5 IBV-rNp + liposome 2 strain (unbound) Group 4 5 Liposome only 0 Group 5 5 None

(339) TABLE-US-00030 TABLE 10-2 Animal test schedule Age in days Test group 7 21 28 35 Immunization Immunization Immunization Challenge Autopsy groups (Groups 1 to 4) Challenge control group (Group 5)
(2) Evaluation Items

(340) The following items were evaluated in the same manner as in 4. A. Evaluation based on the tracheal ciliary movement score B. Quantification of viral gene in organs
<Results>
(1) Animal Test

(341) A total of four test groups were set up, and five chickens were tested for each test group. In groups 1, 2, and 3, the amount of rNp antigen was adjusted to 2 g/dose/body with PBS. In Group 4, the amount of liposome was set to the same amount as in Group 1. Using a live-vaccine power sprayer, 100 L per body of the vaccine was administered by fine spraying (droplet particle size, 50 to 100 m) at 7 days old and 21 days old. In all test groups including the challenge control group, each chicken was challenged by intratracheal inoculation of 50 L of 3.5 log EID.sub.50/body of the Kagawa/2012/1 strain (highly virulent heterologous strain) at 28 days old. The chickens were kept under observation of clinical symptoms, and then subjected to autopsy at Week 1 after the challenge, for collecting trachea and kidney.

(342) (2) Evaluation Based on Tracheal Ciliary Movement Score

(343) Compared to the challenge control group. Group 1 tended to show reduced suppression of the tracheal ciliary movement. However, in Groups 2, 3, and 4, the tracheal ciliary movement score was similar to that in the challenge control group, showing no symptom onset-reducing effect (FIG. 10-1. Table 10-3).

(344) TABLE-US-00031 TABLE 10-3 Distribution of the tracheal ciliary movement score Number of chickens with each score Test group 0 to less than 1 1 to less than 2 2 to less than 3 Group 1 4 1 0 Group 2 0 0 5 Group 3 0 1 4 Group 4 0 0 5 Group 5 0 0 5
(3) Quantification of Viral Gene in Organs

(345) Compared to the challenge control group, Group 1 showed significantly smaller amounts of viral gene in the trachea and kidney. However, in Groups 2, 3, and 4, the amounts were similar to those in the challenge control group (FIG. 10-2).

(346) <Conclusion>

(347) It was confirmed that, for realization of the effectiveness of a surface-bound liposome vaccine, binding of the antigen to the liposome is indispensable also in chickens.

(348) 11. Study of Test Vaccine Administration Method (3)

(349) <Object>

(350) Assuming use in outdoor farms, conditions for the fine spray administration were studied.

(351) <Materials and Methods>

(352) (1) Animal Test

(353) The test group setting and the test schedule were as shown in Table 11-1 and Table 11-2. In Group 1 (closed space), 10 SPF chicks were placed in a thick plastic bag (W 900H 1000; capacity, 90 L), and rNp-DSS was administered by fine spraying from about 50 cm above the chicks toward their heads. In Groups 2 to 6 (open space), 10 SPF chicks were placed in a chicken transportation basket (internal dimension, W 750D 500H 280) (placement density, 0.038 m.sup.2/individual), and IBV-rNp-DSS was administered by fine spraying from about 50 cm above the chicks toward their heads. For the fine spray administration, a live-vaccine power sprayer (Nyukon 607) was used. After the fine spray administration, the chicks were transferred into chicken isolators, and reared. In addition, a test group in which only the challenge is carried out was set up to provide a challenge control group (Group 7).

(354) TABLE-US-00032 TABLE 11-1 Test group setting Condition of chickens Number of IBV-rNp Administra- during fine times of antigen Dose tion time spray Challenge Test Number of Administra- immuniza- concentra- (L/body/ (seconds/ administra- strain group chicks Test vaccine tion route tion tion (g/mL) dose) group) tion (genotype) 1 10 IBV-rNp-DSS Fine 2 5 100 6 Closed space Kagawa/ 2 10 spray 5 100 6 Open space 2012/1 3 10 20 100 6 Open space strain 4 10 5 400 6 Open space (JP-IV) 5 10 5 100 30 Open space 6 10 20 400 30 Open space 7 5 None

(355) TABLE-US-00033 TABLE 11-2 Animal test schedule Age in days Test group 7 21 28 35 Immunization Immunization Immunization Challenge Autopsy groups (Groups 1 to 6) Challenge control group (Group 7)

(356) At 7 days old and 21 days old, immunization was carried out by the above method, and each chicken was challenged by intratracheal inoculation of 3.5 log EID.sub.50 (50 L/body) of a highly virulent heterologous strain at 28 days old. The chickens were kept under observation of clinical symptoms, and then subjected to autopsy on Day 35 for collecting trachea and kidney.

(357) (2) Evaluation Items

(358) A. Evaluation Based on Tracheal Ciliary Movement Score

(359) See 4. A significance test was carried out by the Dunnett's multiple comparison test method.
B. Quantification of Viral Gene in Organs See 4. A significance test was carried out by the Student-t test method.
<Results>
(1) Evaluation Based on Tracheal Ciliary Movement Score

(360) Compared to the challenge control group (Group 7), all test groups showed significantly lower tracheal ciliary movement scores (P<0.01) (FIG. 11-1). Comparison between the closed environment (Group 1) and the open environment (Group 2) was carried out under the same conditions of antigen concentration, dose, and administration time. As a result, these groups showed similar average scores, but Group 2 showed a larger variation within the test group. Compared to Group 2, the dose was increased in Group 4, and the administration time was increased in Group 5. Although Groups 4 and 5 showed average scores similar to that in Group 2, they showed a smaller variation within each test group. In all immunization groups (Groups 1 to 6), each of 7 to 9 chickens out of the 10 chickens showed a score of less than 1, and there were no chickens with a score of 2 or more (Table 11-3).

(361) TABLE-US-00034 TABLE 11-3 Score distribution of the tracheal ciliary movement score Number of chickens with each score Test group 0 to less than 1 1 to less than 2 2 or more Group 1 8 2 0 Group 2 8 2 0 Group 3 7 3 0 Group 4 9 1 0 Group 5 8 2 0 Group 6 8 2 0 Group 7 0 0 5
(2) Quantification of Viral Gene in Organs

(362) Compared to the challenge control group (Group 7), all immunization groups (Groups 1 to 6) showed significantly smaller amounts of viral gene in the trachea and kidney (P<0.01). The immunization groups (Groups 1 to 6) showed similar amounts of viral gene therebetween (FIG. 11-2).

(363) <Conclusion>

(364) Fine spray administration of IBV-rNp-DSS was found to be effective to the same extent between the closed environment and the open environment. It was also suggested that variation among individuals can be effectively reduced by increasing the dose of IBV-rNp-DSS per body or by increasing the administration time.

(365) 12. Study of Test Vaccine Administration Method (4)

(366) <Object>

(367) Conditions of fine spray administration of BV-rNp-DSS were studied in terms of the timing of administration, administration interval, and dose.

(368) <Materials and Methods>

(369) (1) Animal Test

(370) The test group setting and the test schedule were as shown in Table 12-1 and Table 12-2. In the immunization groups, five SPF chicks were placed in a chicken transportation basket (internal dimension, W 750D 500H 280) (placement density, 0.076 m.sup.2/individual), and IBV-rNp-DSS was administered by fine spraying from about 50 cm above the chicks toward their heads. For the fine spray administration, a live-vaccine power sprayer (Nyukon 607) was used. After the fine spray administration, the chicks were transferred into chicken isolators, and reared. In addition, test groups in which only the challenge is carried out were set up to provide challenge control groups (Groups 4, 8, and 12). In the immunization groups, immunization was carried out twice at the ages in days shown in Table 1, and, 7 days after the second immunization, each chicken was challenged by intratracheal inoculation of 3.5 log EID.sub.50 (50 L/body) of a highly virulent heterologous strain. The chickens were kept under observation of clinical symptoms, and then subjected to autopsy on Day 7 after the challenge, for collecting trachea and kidney.

(371) TABLE-US-00035 TABLE 12-1 Test group setting Age in days Number of upon Administra- times of administra- Age in days Amount of Antigen tion time Test Number Administra- immuniza- tion upon antigen concentra- Dose (seconds/ group of chicks tion method tion (interval) challenge (ng/dose) tion (ng/L) (L/dose) group) 1 5 Fine spray 2 0.7 14 400 1 400 5 2 5 (particle (7) 100 100 3 5 size: 50 to 25 25 4 5 100 m) 5 5 2 0.14 21 400 1 400 6 5 (14) 100 100 7 5 25 25 8 5 9 5 2 7.21 28 400 1 400 10 5 (14) 100 100 11 5 25 25 12 5

(372) TABLE-US-00036 TABLE 12-2 Animal test schedule Age in days Test group 0 7 14 21 28 35 Groups 1 to 3 Immunization Immunization Challenge Autopsy Group 4 Groups 5 to 7 Immunization Immunization Challenge Autopsy Group 8 Groups 9 to 11 Immunization Immunization Challenge Autopsy Group 12
(2) Evaluation Items
A. Evaluation Based on the Tracheal Ciliary Movement Score See 4. A significance test was carried out by the Dunnett's multiple comparison test method.
B. Quantification of Viral Gene in Organs See 4. A significance test was carried out by the Student-t test method.
<Results>
(1) Evaluation Based on Tracheal Ciliary Movement Score

(373) Compared to the challenge control group, significant decreases in the tracheal ciliary movement score (P<0.01 or P<0.05) were found in the 0- to 7-day-old immunization groups (Groups 1 and 2), the 0- to 14-day-old immunization groups (Groups 5 and 6), and the 7- to 21-day-old immunization groups (Groups 9 and 10), which were the groups in which the amount of antigen was not less than 100 ng/dose (FIG. 12-1). On the other hand, when the amount of antigen was 25 ng/dose (Groups 3, 7, and 11), significant decreases in the tracheal ciliary movement score were found only in Group 7 and Group 11, which were the groups in which the administration interval was 14 days (P<0.05). The variation of the tracheal ciliary movement score within each test group tended to be slightly large in the 0- to 7-day-old immunization groups (Groups 1 to 3), and, irrespective of the timing of administration, in the immunization groups in which the amount of antigen was 25 ng/dose (Groups 3, 7, and 11) (Table 12-3).

(374) TABLE-US-00037 TABLE 12-3 Score distribution of the tracheal ciliary movement score Number of chickens with each score Test group 0 to less than 1 1 to less than 2 2 or more Group 1 1 3 1 Group 2 4 1 0 Group 3 1 2 2 Group 4 1 0 4 Group 5 4 0 1 Group 6 3 2 0 Group 7 2 2 1 Group 8 0 1 4 Group 9 3 2 0 Group 10 2 3 0 Group 11 2 2 1 Group 12 0 1 4
(2) Quantification of Viral Gene in Organs

(375) The results are shown in FIG. 12-2. Compared to the challenge control group, significant decreases in the amount of viral gene in the trachea were found in the immunization groups in which the amount of antigen was not less than 100 ng/dose (Groups 1 and 2, 5 and 6, and 9 and 10) (P<0.01 or P<0.05). On the other hand, significant decreases in the amount of viral gene in the kidney were found in the immunization groups in which the amount of antigen was not less than 100 ng/dose except for Group 1 (Groups 2, 5 and 6, and 9 and 10) (P<0.01 or P<0.05).

(376) <Conclusion>

(377) Concerning the optimum conditions of fine spray administration of IBV-rNp-DSS, high symptom onset-reducing effects were found when the timing of the first administration was 0 day old or 7 days old; the administration interval was 14 days; and the amount of antigen was not less than 100 ng/dose. Since IBV is widespread in the environment, it is important to give immunity against this disease to chicks at an early stage. It was thus thought that the condition two-time administration by administration at 0 day old and 14 days old at 100 ng/dose in terms of the amount of antigen is suitable as an IBV-rNp-DSS administration model.

(378) 13. Evaluation of Effectiveness of Test Vaccines (4)

(379) <Object>

(380) Effectiveness of IBV-rNp-DSS against abnormalities in egg laying due to IBV infection was evaluated.

(381) <Materials and Methods>

(382) (1) Animal Test

(383) The test group setting and the test schedule were as shown in Table 13-1 and Table 13-2. Twelve 25-week-old SPF egg-laying chickens in each group were tested. The chickens were reared in separate cages (H 965W 393D 193 mm) for about 11 weeks. In the vaccine test group, IBV-rNp-DSS was administered by fine spraying (0.5 g/100 L/individual) at 25 weeks old and 27 weeks old. At 28 weeks old, that is, 1 week after the booster immunization, the vaccine test group and the challenge control group were challenged by intratracheal inoculation of 3.5 log EID.sub.50 (50 L/body) of a highly virulent heterologous strain. The chickens were kept under observation of clinical symptoms and the egg-laying performance while buccal swabs, cloacal swabs, and sera were collected over time. Two chickens in each group on Day 7 after the challenge, and 10 chickens in each group on Day 57 after the challenge, were subjected to autopsy, to collect organs (trachea, kidney, and oviduct).

(384) TABLE-US-00038 TABLE 13-1 Test group setting Number of Test group chickens Immunization Challenge Group 1 Uninfected 12 Not done Not done control group Group 2 Vaccine test 12 Done Done group Group 3 Challenge 12 Not done Done control group

(385) TABLE-US-00039 TABLE 13-2 Test schedule 0 14 21 28 57 (dPI) Group 1 Autopsy Autopsy Group 2 Immuni- Immuni- Challenge (2 (10 zation zation chickens/ chickens/ Group 3 group) group)
(2) Evaluation Items
A. Evaluation of Egg-Laying Performance

(386) The egg-laying performance of each chicken was recorded every day (7 to 57 dPI). In cases where an abnormal egg was found, the presence or absence of abnormality of the external egg quality and internal egg quality was investigated.

(387) B. Quantification of Viral Gene

(388) For each individual, quantification of IBV gene was carried out by real-time PCR for the buccal and cloacal swabs at 7, 14, 35, and 57 dPI, and for the trachea, kidney, and oviduct (ampulla) collected by the autopsies at 7 and 57 dPI. A significance test was carried out by the Student-t test.

(389) C. Tracheal Ciliary Movement Score

(390) In the autopsies at 7 dPI and 57 dPI, tracheal ciliary movement was observed for tracheal rings at five sites per individual under the microscope, and scoring was carried out according to the following index (0=active movement; 1=rather weak; 2=very weak/partial movement; 3=arrest).

(391) D. Antibody Test (ELISA)

(392) Using a commercially available IB ELISA kit (IDEXX), the ELISA antibody titer (S/P ratio) was measured for the sera at 0, 7, and 57 dPI from each chicken, and the average value was calculated for each test group. A significance test was carried out by the Student-t test.

(393) <Results>

(394) (1) Evaluation of Egg-Laying Performance

(395) Changes in the egg-laying rate in each test group are shown in FIG. 13-1. Based on the egg-laying rate in each period of about 1 week, the rate decreased immediately after the challenge by not less than 15% in Group 2, and by not less than 30% in Group 3. Thereafter, the egg-laying rate gradually recovered in both groups (FIG. 13-2). The length of time required for recovery of the egg-laying rate to 90% or higher was 4 weeks in Group 2, and 6 weeks in Group 3. The number of chickens whose egg laying stopped continuously for 3 days or more after the challenge was 3 out of the 12 chickens in Group 2, and 6 out of the 12 chickens in Group 3. All chickens produced abnormal eggs (small and/or poor-quality eggs) after they began to lay eggs, and thereafter, they produced normal eggs (Table 13-3).

(396) TABLE-US-00040 TABLE 13-3 Details of chickens that showed abnormal egg laying Number of chickens whose Presence or absence of egg laying stopped Number of abnormal egg continuously for days of Abnormality Abnormality Test 3 or more days after continuous of external of internal group challenge (%) stop egg quality egg quality Group 1 0 chicken (0%) None None Group 2 3 chickens (25%) 7 days Small eggs Slightly watery 4 days Small eggs None 4 days Small eggs None Group 3 6 chickens (50%) 9 days Small eggs Slightly watery 8 days Small eggs Slightly watery 4 days Small eggs Slightly watery 4 days Small eggs None 3 days Small eggs Slightly watery 3 days Small eggs None
(2) Quantification of Viral Gene
A. Quantification of Viral Gene in Swabs

(397) Viral gene was detected from the buccal/cloacal swabs for the period from 7 to 14 dPI in Group 2, and for the period from 7 to 35 dPI in Group 3 (FIG. 13-3). In the period from 7 to 35 dPI, Group 2 showed significantly smaller amounts of gene relative to Group 3 (P<0.05 or P<0.01). At 57 dPI, virus gene was not detected in any test group.

(398) B. Quantification of Viral Gene in Organs

(399) At 7 dPI, viral gene was detected from the trachea, kidney, and oviduct in Group 2 and Group 3 (FIG. 3-4). The amount of viral gene in Group 2 tended to be smaller than in Group 3. At 57 dPI, virus gene was not detected in any test group.

(400) (3) Tracheal Ciliary Movement Score

(401) At 7 dPI, two chickens in Group 3 showed severe suppression of tracheal ciliary movement. In contrast, in Group 2, one chicken showed no suppression, and another chicken showed mild suppression (FIG. 13-5).

(402) (4) Antibody Test (ELISA)

(403) At 7 dPI and 57 dPI, the ELSA antibody titer in Group 2 was significantly higher than in Group 3 (P<0.05) (FIG. 13-6).

(404) <Conclusion>

(405) From the frequency of occurrence and the period of occurrence of the egg-laying disorder after the challenge, and from the test results indicating systemic viral infection, it was suggested that the egg-laying disorder was less severe in the vaccine test group than in the challenge control group, and hence that the IB liposome vaccine is effective against the egg-laying disorder.

(406) 14. Evaluation of Effectiveness of Test Vaccines (5)

(407) <Object>

(408) Based on the immunization method established in 12, the effectiveness of IBV-rNp-DSS against IBV heterologous field strains (5 strains) having various genotypes, which strains were recently isolated in Japan, was evaluated.

(409) <Materials and Methods>

(410) (1) Animal Test

(411) The test group setting, the test schedule, and the heterologous field strains tested were as shown in Table 14-1, Table 14-2, and Table 14-3, respectively. Ten birds were tested in each immunization group, and three birds were tested in each challenge control group. Based on the immunization method established in 12, IBV-rNp-DSS was administered by fine spraying (100 ng/dose) at 0 day old and 14 days old in the immunization groups. At 21 days old, the immunization groups and the challenge control groups were challenged by intratracheal inoculation of 3.0 log EID.sub.50 (50 L/body) of the various heterologous field strains. The birds were kept under observation of clinical symptoms and the egg-laying performance, and then subjected to autopsy on Day 7 after the challenge, for collecting organs (trachea and kidney).

(412) TABLE-US-00041 TABLE 14-1 Test group setting Test Number of group birds Test vaccine Challenge strain 1 10 IBV-rNp-DSS JP-I type field strain 2 10 JP-II type field strain 3 10 JP-III type field strain 4 10 4/91 type field strain 5 10 Mass type field strain 6 3 None JP-I type field strain 7 3 JP-II type field strain 8 3 JP-III type field strain 9 3 4/91 type field strain 10 3 Mass type field strain

(413) TABLE-US-00042 TABLE 14-2 Test schedule Age in days Test group 0 14 21 28 Immunization Immunization Immunization Challenge Autopsy groups (Groups 1 to 5) Challenge control groups (Groups 6 to 10)

(414) TABLE-US-00043 TABLE 14-3 Heterologous field strains used for the challenge Prefecture in which the Year in which Strain name S1 strain was the strain No. (abbreviation) genotype isolated was isolated 1 JP-I type field strain JP-I Kagawa 2009 2 JP-II type field strain JP-II Niigata 2010 3 JP-III type field strain JP-III Ehime 2011 4 4/91 type field strain 4/91 Iwate 2004 5 Mass type field strain Mass Hyogo 2011
(2) Evaluation Items
A. Evaluation Based on the Tracheal Ciliary Movement Score See 4. A significance test was carried out by the Dunnett's multiple comparison test method.
B. Quantification of Viral Gene in Organs See 4. A significance test was carried out by the Student-t test method.
<Results>
(1) Tracheal Ciliary Movement Score

(415) While all challenge control groups showed severe suppression of tracheal ciliary movement, the immunization groups showed no suppression or only mild suppression in a large number of birds, resulting in significantly lower average scores compared to the challenge control groups (P<0.05) (FIG. 14-1, Table 14-4).

(416) TABLE-US-00044 TABLE 14-4 Score distribution of the tracheal ciliary movement score Number of birds with each score Test group 0 to less than 1 1 to less than 2 2 or more Group 1 4 5 1 Group 2 5 3 2 Group 3 6 3 1 Group 4 5 3 2 Group 5 6 4 0 Group 6 0 0 3 Group 7 0 0 3 Group 8 0 0 3 Group 9 0 0 3 Group 10 0 0 3
(2) Quantification of Viral Gene

(417) Compared to the challenge control groups, the immunization groups using any challenge strain showed significantly smaller amounts of viral gene in the trachea and kidney 7 days after the challenge (P<0.05 or P<0.01) (FIG. 14-2).

(418) <Conclusion>

(419) As a result of the use of IBV-rNp-DSS based on the immunization method established in 12, a high symptom onset-reducing effect was found against any of the heterologous field strains (5 strains) having various genotypes.

(420) 15. Preparation of PRRSV Liposome Vaccine

(421) <Object>

(422) For preparation of a liposome vaccine against porcine reproductive and respiratory syndrome virus (hereinafter referred to as PRRSV), full-length nucleocapsid (N) protein, which is relatively highly conserved among PRRSV strains, was prepared as an antigen for the vaccine, using recombinant E. coli. A PRRS liposome vaccine was prepared using this antigen.

(423) <Materials and Methods>

(424) (1) Determination of Antigen Region

(425) N protein (ORF7 gene region), which has been reported to be relatively highly conserved among PRRSV strains, was used as the antigen region.

(426) (2) Preparation of Recombinant N Protein by E. coli Expression System

(427) From the PRRSV wt-7 strain, which was isolated in ZEN-NOH Institute of Animal Health, genome extraction was carried out, and the full-length ORF7 region (SEQ ID NO:27) encoding N protein (SEQ ID NO:28) was amplified by PCR, followed by inserting the amplified product into a vector plasmid containing a His-tag. The resulting plasmid was introduced into E. coli for cloning, to transform the E. coli. Subsequently, plasmid was extracted from E. coli in which the insertion of the target gene could be confirmed by PCR, and the extracted plasmid was introduced into E. coli for protein expression, to transform the E. coli. The recombinant E. coli was subjected to induction of expression using LB medium supplemented with ampicillin, and IPTG or to induction of expression using TB medium supplemented with 10 mM lactose, to allow expression of recombinant N protein (hereinafter referred to as PRRSV-rNp). The bacterial cells were disrupted by sonication, and affinity purification using the His tag was carried out. SDS-PAGE was carried out to confirm that the expressed protein is found at the position corresponding to the assumed molecular weight.

(428) The RT-PCR, and the PCR for confirmation of the insertion of the target gene were carried out using the following primers.

(429) TABLE-US-00045 Fw: CCCCATATGGCCATGCCAAATAACAACGGCAA(SEQIDNO:29; theunderlineindicatesanNdeIrecognitionsite) Rv: TTTGGATCCTCATGCTGAGGGTGATGATA(SEQIDNO:30; theunderlineindicatesaBamHIrecognitionsite)

(430) The following reagents and the like were used. Nucleic acid extraction: QIAamp Viral RNA Mini Kit (QIAGEN) PCR apparatus: PCR Thermal Cycler Dice (registered trademark) Gradient (TP600) (TaKaRa) Gel purification of DNA: QiAquick Gel Extraction Kit (QIAGEN) Restriction enzymes: NdeI and BamHI (Takara) Vector plasmid: pET-15b (Novagen) Competent cells: The E. coli JM109 strain (TaKaRa) was used for the cloning, and the E. coli BL21 (DE3) strain (BioDynamics Laboratory, Inc.) was used for the protein expression. Ligation: Ligation high (TOYOBO) Sequence analysis: Outsourcing to FASMAC Co., Ltd. Affinity purification using the His tag: Profinia Protein Purification System (BioRad)
(3) Liposome Modification

(431) By the same method as 2. (1-1) (Liposome Modification of Antigen by DSS Method), PRRSV-rNp was bound to the liposome surface to prepare a PRRS liposome vaccine (hereinafter referred to as PRRSV-rNp-DSS).

(432) <Results>

(433) (1) Search for Antigen Region

(434) The base sequence of the full-length ORF7 region of the PRRSV wt-7 strain is shown in SEQ ID NO:27.

(435) (2) Preparation of Recombinant Protein by E. coli Expression System

(436) A. Preparation of Recombinant E. coli

(437) RT-PCR was carried out using total RNA extracted from the PRRSV wt-7 strain as a template, and amplification of the target gene fragment was confirmed. Regarding the recombinant N protein (rNp), the amplicon and the plasmid vector (pET-15b) were ligated to each other utilizing the same two kinds of restriction enzyme regions (NdeI and BamHI) in each of them, and then sequence analysis was carried out to confirm that the insertion occurred in a normal manner. E. coli for cloning (JM109) was transformed with the plasmid vector, and then cultured, followed by recovering the amplified plasmid. E. coli for expression, the BL21(DE3) strain, was transformed with the plasmid recovered, to prepare recombinant E. coli for expression of PRRSV-rNp.

(438) B. Induction of Expression and Purification of Recombinant Protein

(439) The recombinant E. coli for expression of PRRSV-rNp, after preculture in liquid LB medium supplemented with ampicillin, was added at 1/100 volume to LB medium supplemented with ampicillin, and shake culture was carried out at 37 C. for 3 hours. After the start of the culture, when O.D.600 reached 0.5. IPTG (final concentration, 1 mM) was added thereto to induce expression, and then shake culture was further carried out for 3 hours. Alternatively, the recombinant E. coli for expression of PRRSV-rNp, after overnight culture in liquid LB medium supplemented with ampicillin, was added at about 1/100 volume to TB medium supplemented with 10 mM lactose, and shake culture was carried out at 25 C. for 3 days. Each of these cultured bacterial liquids was centrifuged at 3000 rpm for 40 min at 4 C. to collect the bacterial cell pellet. After resuspension of the pellet using a binding buffer (20 mM Tris, 500 mM NaCl, 20 mM imidazole; pH 7.4), the bacterial cells were disrupted by sonication. Subsequently, centrifugation was carried out at 6000 rpm for 30 minutes to collect the soluble fraction (supernatant), and affinity purification was carried out to recover the fraction of interest, that is, the PRRSV-rNp fraction. SDS-PAGE is known to show apparent molecular weights which are larger by several kilodaltons due to the effect of tag modification (His-tag) to antigens. As a result of SDS-PAGE, and also Western blotting using a mouse anti-PRRSV-rNp antibody, a clear band was found near the assumed molecular weight (about 14 kDa), and the expression level of PRRSV-rNp was higher in the case where TB medium supplemented with 10 mM lactose was used (FIG. 15-1).

(440) C. Preparation of Liposome Vaccine (Same as 2.)

(441) The freeze-dried DSS-bound oleic acid liposome powder (90 mg lipid/vial) was rehydrated with distilled water to a total volume of 2 mL per coupling reaction. To the resulting liquid, 0.5 mL of the antigen, whose concentration was adjusted to 10 mg/mL, was added, and the resulting mixture was stirred using a stirrer at room temperature for 48 hours. Three coupling reactions were carried out. A column packed with CL-4B (4% cross-linked agarose gel) was equilibrated with PBS, and then the antigen-liposome mixture was applied thereto, to recover a fraction of antigen-bound liposomes by the molecular sieve effect (9 mL/coupling). The fraction was then filtered (0.45 m) to provide a test vaccine (PRRSV-rNp-DSS). The liquid volume of the test vaccine finally collected was about 25 mL.

(442) <Conclusion>

(443) PRRSV-rNp, which uses the PRRSV wt-7 strain as a template, was prepared using recombinant E. coli. PRRSV-rNp-DSS was prepared using the PRRSV-rNp as an antigen. The immunogenicity of PRRSV-rNp-DSS was evaluated in the animal test described below.

(444) 16. Evaluation of Immunogenicity of PRRS Liposome Vaccine Using Mice

(445) <Object>

(446) Using mice, the immunogenicity of the PRRS liposome vaccine PRRSV-rNp-DSS prepared in 15, was evaluated.

(447) <Materials and Methods

(448) 1) Animal Test

(449) The test group setting and the test schedule were as shown in Table 15-1 and FIG. 16-1. Three-week-old mice of two different lineages, BALB/cCrSlc mice (hereinafter referred to as BALB/c mice) and C57BL/6NCrSlc mice (hereinafter referred to as B6 mice), were introduced, and their immunization was begun at 4 weeks old. The immunizing material was administered into footpads of each mouse three times in total at 2-week intervals. Blood collection and autopsy were carried out over time.

(450) TABLE-US-00046 TABLE 15-1 Test group setting Amount of Number PRRSV-rNp Test of mice Immunization antigen Administration Dose group Test mice tested material (g/mL) route (L/dose .Math. body) Group 1 BALB/cCrSlc 8 PBS Footpads 100 Group 2 Liposome alone (50 L for each Group 3 PRRSV-rNp 200 foot) Group 4 PRRSV-rNp-DSS 200 Group 5 C57BL/6NCrSlc PBS Group 6 Liposome alone Group 7 PRRSV-rNp 200 Group 8 PRRSV-rNp-DSS 200
(2) Evaluation Items
A. Evaluation of Antigen-Specific Lymphocyte Activity by ELISPOT

(451) Mouse IFN- ELISPOT BASIC (MABTECH) was used. One week after the third immunization (35 dPI), three mice were subjected to autopsy to collect the spleen. To a suspension of the spleen cells (510.sup.5 cells/mL), 2 g/well of PRRSV-rNp was added as a stimulating antigen, and the cells were then cultured in a 5% CO.sub.2 incubator at 37 C. for 24 hours. The lymphocytes activated in response to the stimulating antigen produced IFN-, and the sites of the production appeared as spots on the well. The number of the spots was counted to evaluate the antigen-specific mouse IFN- production-inducing ability.

(452) B. Evaluation of Antibody-Inducing Ability by ELISA

(453) Using mouse sera collected over time, and HRP-labeled goat anti-chicken IgG, IgG1, and IgG2a (BETHYL), ELISA using PRRSV-rNp as an antigen was carried out to measure IgG, IgG1, and IgG2.

(454) C. Evaluation of Neutralizing Antibody-Inducing Ability

(455) The sera in Groups 3, 4, 7, and 8, in which increases in the antibody titer against PRRSV-rNp were found in the ELISA, were subjected to measurement of the neutralizing antibody titer by a neutralization test using MARC145 cells and the PRRSV wt-7 strain.

(456) 3. Results

(457) (1) Evaluation of IFN- Production-Inducing Ability

(458) As a result of the evaluation of the IFN- production-inducing ability in the lymphocytes in the spleen by the ELISPOT assay, increases in the number of spots in response to the stimulating antigen (PRRSV-rNp) were found in Group 4 and Group 8, in which PRRSV-rNp-DSS was administered (FIG. 16-2).

(459) (2) Evaluation of Antibody-Inducing Ability

(460) As a result of the ELISA for IgG, IgG1, and IgG2a using PRRSV-rNp as an antigen, increases in the antibody against PRRSV-rNp were found in the PRRSV-rNp administration groups (Groups 3 and 7) and the PRRSV-rNp-DSS administration groups (Groups 4 and 8) (FIG. 16-3, FIG. 16-4, FIG. 16-5). The BALB/c mice and the B6 mice showed differences in the degree of increase in the antibody titer. This was thought to be due to the fact that the major component of IgG is IgG1 in BALB/c, and IgG2a in B6.

(461) (3) Evaluation of Neutralizing Antibody-Inducing Ability

(462) The serum samples in the groups of 3, 4, 7, and 8, in which increases in the antibody titer against PRRSV-rNp were found in the ELISA, were subjected to measurement of the neutralizing antibody titer. However, none of the samples showed an increase in the neutralizing antibody titer (Table 15-2). This was thought to be due to the fact that N protein of PRRSV is not a neutralization activity region.

(463) TABLE-US-00047 TABLE 15-2 Neutralizing antibody titer in serum Neutralizing antibody titer After first After second After third Test group immunization immunization immunization Group 3 <2 <2 <2 Group 4 <2 <2 <2 Group 7 <2 <2 <2 Group 8 <2 <2 <2
<Conclusion>

(464) In the mice to which PRRSV-rNp-DSS was administered, activation of IFN--producing lymphocytes and antibody induction were found. It was thus confirmed that PRRSV-rNp-DSS has a certain level of immunogenicity.

(465) 17. Evaluation of Effectiveness of PRRS Liposome Vaccine Using Pigs

(466) <Object>

(467) Using pigs, the effectiveness of the PRRS liposome vaccine PRRSV-rNp-DSS prepared in 15, was evaluated.

(468) 2. Materials and Methods

(469) (1) Animal Test

(470) The test group setting and the test schedule were as shown in Table 16-1 and FIG. 17-1. Three-week-old SPF pigs were introduced, and their immunization was begun at 4 weeks old. In the immunization group, PRRSV-rNp-DSS was injected into the cervical muscle three times in total at 2-week intervals. Blood was collected over time from after the start of the immunization until the end of the test. One week after the third immunization, that is, at 9 weeks old (35 dPI), each pig was challenged by transnasal administration of 2 mL (1 mL to each side of nose) of 10.sup.5.0 TCID.sub.50/mL of the PRRSV wt-7 strain. Twenty days after the challenge, that is, at 12 weeks old (55 dPI), autopsy was carried out to collect lung.

(471) TABLE-US-00048 TABLE 16-1 Test group setting Amount of Number PRRSV-rNp Number of Dose of pigs Immunization antigen Administration times of (mL/dose .Math. Test group tested material (g/mL) route immunization body) Group 1 5 PBS Intra-cervical 3 times 2 (control group) muscle Group 2 PRRSV-rNp-DSS 200 (immunization group)
(2) Evaluation Items
A. Body Temperature Measurement

(472) The body temperature was measured every day from 0 dPC to 20 dPC.

(473) B. Amount of Viral Gene in Blood

(474) Blood collected over time from 1 dPC to 12 dPC was subjected to measurement of the amount of viral gene by real-time PCR.

(475) C. Evaluation of Antigen-Specific Lymphocyte Activity by ELISPOT

(476) Porcine IFN- ELISpot BASIC (HRP) (MABTECH) was used. From blood collected over time from 0 dPC to 20 dPC, PBMCs were prepared, and 2 g/well of PRRSV-rNp as a stimulating antigen was added to a PBMC suspension (3.010.sup.5 cells/well), followed by performing culture in a 5% CO.sub.2 incubator at 37 C. for 24 hours. The lymphocytes activated in response to the stimulating antigen produced IFN-, and the sites of the production appeared as spots on the well. The number of the spots was counted to evaluate the antigen-specific porcine IFN- production-inducing ability.

(477) D. Evaluation of Antigen-Specific Lymphocyte Activity by ELISA

(478) Porcine IFN- was detected by sandwich ELISA using Porcine IFN Mab, clone P2F6 (Thermo Scientific) and Biotin Mouse Anti-Pig IFN Clone P2C11 (BD Biosciences). From blood collected over time from 0 dPC to 20 dPC, PBMCs were prepared, and 20 g/well of PRRSV-rNp as a stimulating antigen was added to a PBMC suspension (2.010.sup.6 cells/well), followed by performing culture in a 5% CO.sub.2 incubator at 37 C. for 72 hours. Thereafter, the supernatant was collected, and detection of porcine IFN- was carried out by the sandwich ELISA.

(479) E. Histopathological Examination

(480) The lung collected at 20 dPC was subjected to histopathological examination for scoring of the severity of the lesion. The scoring was carried out according to P. G. HALBUR, et al. Comparison of the Pathogenicity of Two US Porcine Reproductive and Respiratory Syndrome Virus Isolates with that of the Lelystad Virus. Veterinary Pathology 32:648-660 (1995).

(481) F. Evaluation of Antibody-Inducing Ability by ELISA

(482) The sera collected over time were subjected to measurement of antibody against PRRSV-rNp by ELISA. As a secondary antibody, HRP-labeled rabbit anti-pig IgG (MP Biomedicals) was used.

(483) <Results>

(484) A. Body Temperature Measurement

(485) Although there was a variation among the individuals, the body temperature after the challenge tended to be lower in the immunization group, and was significantly lower at 11 dPC and 12 dPC (FIG. 17-2).

(486) B. Amount of Viral Gene in Blood

(487) In the immunization group, the amount of viral gene in blood was significantly lower at 1 dPC, but was almost the same at 6 dPC and later compared to that in the control group (FIG. 17-3).

(488) C. Evaluation of Antigen-Specific Lymphocyte Activity by ELISPOT

(489) The immunization group showed activity of lymphocytes in specific response to PRRSV-rNp from 0 dPC to 20 dPC. The degree of the activity tended to be high in the immunization group (FIG. 17-4).

(490) D. Evaluation of Antigen-Specific Lymphocyte Activity by ELISA

(491) The immunization group showed activity of lymphocytes in specific response to PRRSV-rNp from 0 dCP 0 dPC to 20 dPC. The degree of the activity tended to be high in the immunization group (FIG. 17-5).

(492) E. Histopathological Examination

(493) The immunization group tended to show low lung lesion scores (FIG. 17-6).

(494) F. Evaluation of Antibody-inducing Ability by ELISA

(495) After the second immunization (28 dPI), the immunization group showed induction of specific antibody (FIG. 17-7). After the challenge, the immunization group showed a remarkable increase in the antibody titer.

(496) <Conclusion>

(497) The pigs immunized with PRRSV-rNp-DSS showed a PRRSV-rNp-specific immune response, and tended to show reduction of the fever, amount of viral gene in blood, and lung lesion after the challenge.