Metal nanoshell-coated barcodes
11473152 · 2022-10-18
Assignee
Inventors
Cpc classification
C12Q1/6888
CHEMISTRY; METALLURGY
B82Y20/00
PERFORMING OPERATIONS; TRANSPORTING
B82Y30/00
PERFORMING OPERATIONS; TRANSPORTING
B82Y40/00
PERFORMING OPERATIONS; TRANSPORTING
B82Y15/00
PERFORMING OPERATIONS; TRANSPORTING
C09K11/025
CHEMISTRY; METALLURGY
International classification
C12Q1/6888
CHEMISTRY; METALLURGY
C09K11/02
CHEMISTRY; METALLURGY
B82Y30/00
PERFORMING OPERATIONS; TRANSPORTING
Abstract
The present invention relates to barcodes coated with metal nanoshells and to methods of making the metal nanoshell-coated barcodes. The metal nanoshell-coated barcodes of the present invention have applications in detection systems, including multiplex detection systems.
Claims
1. A barcode, the barcode comprising a metal nanoshell-coated microbead containing multiple populations of fluorophores and a target-specific capture probe conjugated directly to an external surface of the metal nanoshell, each population of fluorophores in the microbead sharing a common wavelength such that the microbead has a unique optical signature that identifies the target-specific probe conjugated to the metal nanoshell, the metal nanoshell-coated microbead comprising: a) a mixed polymer having one or more carboxylic acid functional groups for seeding metal nanoparticles and growing the metal nanoshell on the surface of the microbead in a porous distribution to permit fluorescence emission; and b) wherein the metal nanoshell comprises a porous roughened external surface, wherein the mixed polymer comprises polystyrene and poly(styrene-co-maleic anhydride), or analogues or derivatives thereof, in a ratio of 2:1 to 1:1 in mass.
2. The barcode of claim 1, wherein the fluorophores include organic fluorophores, inorganic fluorophores, or a mixture of organic and inorganic fluorophores.
3. The barcode of claim 1, wherein the mixed polymer comprises polystyrene and poly(styrene-co-maleic anhydride), or analogues or derivatives thereof, in a ratio of 1:1 in mass.
4. The barcode of claim 1, wherein the fluorophores are quantum dots (QDs).
5. The barcode of claim 1, wherein the metal is selected from silver or gold.
6. The barcode of claim 1, wherein the target includes inorganic and organic materials.
7. The barcode of claim 6, wherein the organic materials include unicellular and multicellular organisms and any components thereof, peptides, proteins, oligosaccharides, lipids, genes, nucleic acids, amino acids, and wherein the inorganic materials include inorganic molecules having metal atoms.
8. The barcode of claim 1, wherein the metal nanoshell operates to enhance shelf-life of the barcode relative to the barcode without the metal nanoshell.
9. The barcode of claim 1, wherein the metal nanoshell operates to enhance fluorescence stability of the barcode relative to the barcode without the metal nanoshell.
10. The barcode of claim 1, wherein the nanoshell is selected from a silver nanoshell having a thickness of 20-30 nm and a gold nanoshell having a thickness of about 50 nm.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) Embodiments will now be described, by way of example only, with reference to the drawings, in which:
(2)
(3)
(4) right column (graphs c, f, i): silver nanoshell-coated poly(styrene-co-maleic anhydride)-polystyrene mixed polymers.
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
DETAILED DESCRIPTION OF THE INVENTION
(20) Definitions
(21) In this specification and in the claims that follow, reference will be made to a number of terms that shall be defined to have the meanings below. All numerical designations, e.g., dimensions and weight, including ranges, are approximations that typically may be varied (+) or (−) by increments of 0.1, 1.0, or 10.0, as appropriate. All numerical designations may be understood as preceded by the term “about”. The singular form “a”, “an”, and “the” includes plural references unless the context clearly dictates otherwise. All publications cited herein, as well as the priority document, are incorporated by reference in their entirety.
(22) “Capture probe” refers to a compound that binds a target molecule in a sample such that their relative expression levels can be detected. Capture probes may include nucleic acid sequences, proteins, phages, antibodies, enzymes and so forth. Targets may include organic molecules including nucleic acids, proteins, lipids, sugars, toxins, unicellular and multi-cellular organisms, viruses and components thereof and inorganic molecules, which may include metal atoms, and any other target of interest that can may be bound to a capture probe.
(23) The term “secondary probe” refers to a molecule, which is capable of recognizing the target of a capture probe and of producing a detectable signal in response to the interaction between the capture probe, the target of said capture probe and the secondary probe. Secondary probes may include nucleic acid sequences, proteins, phages, antibodies, enzymes and so forth. The secondary probe may include a fluorescent molecule.
(24) The term “comprising” means any recited elements are necessarily included and other elements may optionally be included. “Consisting essentially of” means any recited elements are necessarily included, elements that would materially affect the basic and novel characteristics of the listed elements are excluded, and other elements may optionally be included. “Consisting of” means that all elements other than those listed are excluded. Embodiments defined by each of these terms are within the scope of this invention.
(25) As used herein, a “quantum dot” (QD) is a semiconducting photoluminescent material, as is known in the art (for example, see Alivasatos, Science 271:933-937 (1996)). Non-limiting examples of QDs include: CdS quantum dots, CdSe quantum dots, CdSe/CdS core/shell quantum dots, CdSe/ZnS core/shell quantum dots, CdTe quantum dots, PbS quantum dots, and/or PbSe quantum dots. As is known to those of skill in the art, CdSe/ZnS means that a ZnS shell is coated on a CdSe core surface (i.e.: “core-shell” quantum dots). The shell materials of core-shell QDs have a higher band gap and passivate the core QDs surfaces, resulting in higher quantum yield and higher stability and wider applications than core QDs.
(26) As used herein, the term “population” with regard to fluorophores, including QDs, refers to a plurality of fluorophores sharing a common wavelength of maximum emission and intensity.
(27) As used herein, “barcode” refers to a bead or microbead containing one, two, three or more populations of fluorophores. It may be possible to have a single population of fluorophores emitting a single color, if the intensity of the fluorophore is varied to achieve multiple sub-populations. Each bead contains a unique optical signature that identifies a surface conjugated molecule. The suitable fluorophores may include organic fluorophores, QDs, multi-metal rods or any other fluorophore capable of forming an optical signature. Approximately 10,000 to 40,000 different barcodes can be engineered using 5-6 different color quantum dots and six intensity levels (9). This enables significant multiplexing and these barcodes can detect targets in a flow cytometer (10-13) or microfluidic channel (14, 15).
(28) The term “sample” includes both solid and fluid samples. Solid type samples may be solubilized in a suitable fluid. The samples may be biological and/or environmental (i.e. non-biological). Biological samples (fluid or solid) may include samples taken from an organism (unicellular or multicellular) of the animal or plant kingdoms, including prokaryote and eucaryote organisms. Non-fluid samples may be solubilized in a suitable solution. Environmental samples (fluid or solid) may include water samples, soil samples, mineral samples and so forth.
(29) As used herein, “seeding” refers to the addition of metal particles or ions to the bead surface that serve as a nucleating site for the formation of the metal shell around the bead.
(30) In this document, the term “shelf-life” refers to the ability of beads, and barcodes to remain intact in various environmental conditions such as buffer types, solution pH ranges, and temperature ranges and maintain their fluorescence signals in response to these variable environmental cues.
(31) Metal Nanoshell-Coated Barcodes
(32) Described herein is a novel and non-obvious nanoshell-coated barcode with improved stability and improved analytical sensitivity, and methods of preparing the metal nanoshell-coated barcodes.
(33) In one embodiment, the barcode of the present invention includes a metal nanoshell-coated microbead having one or more populations of fluorophores.
(34) The microbead may be a polymeric bead made of a single polymer system or a mixed polymer system. The polymer may be any suitable polymer, including polystyrenes of different molecular weights and other polystyrene (random- or block-) copolymers, including analogues or derivatives. The single polymer bead may be any suitable polymer. In one embodiment, the single polymer bead may be made of poly(styrene-co-maleic anhydride), an analogue or derivative. The mixed polymer system may include a mixture of polymers. In one embodiment, the mixture of polymers may be polystyrene and poly(styrene-co-maleic anhydride) or a mixture of their analogues or derivatives. The ratio between polystyrene and poly(styrene-co-maleic anhydride) (or their analogues or derivatives) may be varied from 4:1 to 1:1 in mass.
(35) The nanoshell may be made of a metal. Metals that may be used include silver and gold. Any other suitable metal capable of forming a shell on the surface of the barcode microbead that provides substantial shelf life and substantial analytical sensitivity may also be used.
(36) The metal nanoshell-coated barcodes of the present invention may be functionalized with target specific capture probes as described herein below.
(37) Method of Preparing Metal Nano-Shell Coated Barcodes
(38) In one embodiment, the present invention provides for a method of preparing a metal nanoshell on barcodes. In one embodiment, the method may include: (a) contacting or seeding one or more populations of barcodes with metal nanoparticles, and (b) mixing the barcodes seeded with the metal nanoparticles with a salt of the metal.
(39) In one embodiment of the method of the present invention, the method may also include conjugating a target-specific capture probe to the metal nanoshell.
(40) In one embodiment of the method, the fluorophores may be polystyrene-coated QDs. In another embodiment, the QDs may be modified with a range of hydrophobic poly-aromatic polymers that are similar in structure to the matrix polymer making up the internal regions of the microbead.
(41) Preparation of Barcodes
(42) An embodiment for preparing the metal nano-shell coated barcodes of the present invention is illustrated in
(43) With reference to
(44) Fluorophores used to prepare the barcodes may be coated with amino terminated polystyrene polymers. Polystyrene-coated QDs may be prepared by any of the known methods in the art [1]. In one embodiment, QDs may be provided as tri-n-octylphosphine oxide (TOPO) QDs. Using TOPO QDs as an example, the TOPO ligands on the QD surface may be replaced with amino-terminated polystyrene polymers, thereby obtaining the polystyrene-coated QDs. A ligand exchange process may be used to replace the TOPO ligands with amino-terminated polystyrene polymers. Other methods for modifying the surface chemistry of quantum dots include ligand exchange with monodentate or multidentate thiol-, phosphine-, or aminated ligands; polymer encapsulation; silanization. Any of these methods could be used to produce surface-modified quantum dots.
(45)
(46) Growth of a Metal Nanoshell on the Surface of Microbeads
(47) With reference to
(48) To grow a metal nanoshell, the microbead surface of the barcodes may be enriched with groups having enhanced affinity to metal nanoparticles used for the seeding process. In one embodiment, this enrichment step may be achieved by enriching the surface of the microbeads with thiol or sulphydryl groups. The microbead surface of the barcode may be provided with carboxylic groups for surface functionalization. For example, carboxylic groups may be formed by the maleic anhydride. In one embodiment, carboxylic acid functional groups of the microbeads' surface may be modified with cystamine for example via a carbodiimide-mediated reaction. The thiolated microbeads may then be incubated with metal nanoparticles as a seeding process (See
(49) The diameter of the metal nanoparticles may range between 6 to 12 nm. In one embodiment, the metal nanoparticles, may have an average diameter of 6 nm, in another embodiment of 7 nm, in another embodiment of 8 nm, in another embodiment of 9 nm, in another embodiment of 10 nm, in another embodiment of 11 nm, in another embodiment of 12 nm. The metal nanoshell may be grown on the surface of the microbeads of the barcodes by the addition of a reducing agent and a salt of the metal being used. In the case of silver, the metal salt may be silver nitrate, in the case of gold, the metal salt may be gold chloride. The metal shell thickness and surface coverage on the microbead surface may be tuned or controlled with prolonged or reduced growth time, and with continuous addition of reducing agent and silver nitrate/gold chloride. The growing time may range from 0 minutes (see
(50) Detection and Multiplex-Detection Systems
(51) The nanoshell-coated barcodes of the present invention may be suitable in systems and methods for detecting organic or inorganic targets in samples. The metal nanoshell-coated barcodes of the present invention may also be used in methods and multiplex detection systems for the simultaneous detection of multiple organic targets including biological targets, such as pathogens, peptides, proteomic and genomic targets, amino acid sequences, nucleic acid sequences, lipids, polysaccharides and so forth, or inorganic targets such as those containing metal atoms, in a single sample.
(52) As such, in one embodiment, the present invention provides for a method of detecting a target of interest in a sample. The method, in one embodiment, may include: contacting the sample with: (a) a plurality of barcodes, each barcode comprising a metal nanoshell-coated microbead having one or more populations of fluorophores, and a capture probe conjugated to the metal nanoshell, the capture probe being capable of interacting with the target of interest, each barcode being capable of emitting a target-specific signal, and (b) a secondary probe, the secondary probe being capable interacting with the target of interest and of emitting a secondary probe signal; wherein the presence of the barcode signal and the secondary probe signal indicates detection of the target in the sample.
(53) In another embodiment, the present invention provides for a detection system for detecting a target in a sample. The detection system, in one embodiment, may include a plurality of barcodes, each barcode comprising a metal nanoshell-coated microbead having one or more populations of fluorophores and a capture probe conjugated to the metal nanoshell, the capture probe being capable of interacting with the target and the system being capable of producing a detectable signal that indicates detection of the target in the sample, the detectable signal being comprised of a first signal from the barcode having the capture probe bound to the target and a second signal from a secondary probe bound to the target.
(54) In another embodiment, the present invention provides for a multiplex detection system for simultaneously detecting multiple targets of interest in a single sample. The multiplex detection system of the present invention, in one embodiment, may include: a plurality of barcodes, each barcode comprising: (i) a metal nanoshell-coated microbead having one or more populations of fluorophores and (ii) one capture probe conjugated to the surface of the barcode capable of interacting with one of the multiple targets of interest such that the plurality of barcodes include at least one barcode for each of the multiple targets of interest, the plurality of metal nanoshell-barcodes being capable of producing different target-specific signals for each of the multiple targets of interest, each target-specific signal being comprised of a first signal from the barcode having the capture probe interacting with a particular target of interest, and a second signal from a secondary probe bound to the particular target of interest.
(55) In one embodiment, the detection system or the multiplex detection system may combine the metal nanoshell-coated barcodes of the present invention with wireless communication devices, such as computers, cellular phones, tablets, and watches to enable the simultaneous detection of multiple organic or inorganic targets in a sample. The wireless, multiplex detection systems of the present invention may allow for the detection and quantitative analysis of multiple targets using a wireless communication device having a camera to image the detectable signal from the multiplex detection system. The wireless capabilities of systems and methods of the present invention may allow them to be used in remote settings, enable wireless transmission of data for interpretation, and may allow the mapping and surveillance of target spread.
(56) The wireless communication device may include means for colleting the signals from the barcodes, means to transmit the collected signals, or both.
(57) Advantages
(58) Nanoshell-coated barcodes of the present invention were also shown, as further exemplified herein bellow, to have: substantial fluorescence stability and consistency in different biological environments (see
(59) Other advantages of the nanoshell-coated barcodes of the present invention include: (a) The diameter of microbeads, the fluorescence of QDs, and the thickness of the metal nanoshell are tunable. (b) The fluorescence of the barcodes of the present invention may have substantially greater consistency in a wide range of pH ranges, buffers and temperature conditions. Control over these parameters may lead to improvements in the barcode signal consistency (c) About a 2-order increase in analytical sensitivity for detecting genetic targets using metal nanoshell-coated microbeads has been observed in comparison to uncoated microbeads. The assay process is simple, reliable and relatively fast, and the detection sensitivity is comparable to other bead-based detection platforms with signal amplification mechanisms [29,30]. (d) Microbeads are capable of multiplexed detection with excellent barcoding performance. The inventors show that the barcodes may be used to differentiate the potentially deadly Plasmodium falciparum malaria pathogen from less deadly malaria species, such as Plasmodium vivax. These advantages make this platform an ideal candidate for ultrasensitive and high-throughput multiplexed sensing applications in a wide variety of fields.
(60) In order that this invention may be better understood, the following examples are set forth. These examples are for purposes of illustration only and are not to be construed as limiting the scope of the invention in any manner.
EXAMPLES
(61) Experimental Procedures
(62) QD synthesis: tri-n-octylphosphine oxide(TOPO)ZnS-capped CdSe QDs were synthesized and characterized based on published procedures [31] and stored in chloroform. The quantum yields of QDs were between 0.2 to 0.4 depending on the batch. Ligand exchange on QD surface: the chloroform of TOPO-coated QDs solution was evaporated by a gentle air stream. Amino-terminated polystyrene polymer (Mn=5000, from Polymer Source) and QDs (molar ratio =1000:1) were dissolved in toluene and incubated at 60° C. overnight. Polystyrene-coated QDs were precipitated by adding methanol and re-suspended in chloroform for bead synthesis. Synthesis of QD barcodes: QD barcodes were synthesized by the concentration-controlled flow focusing (CCFF) technique modified from a pervious report [32]. Polystyrene-coated QDs were mixed with poly(styrene-co-maleic anhydride) polymer alone (4%, w/v) or poly(styrene-co-maleic anhydride)(2%)-polystyrene (2%) mixed polymers in chloroform. The solution was filtered through a 0.2-μm PTFE filter and then injected into a customized nozzle system (Ingeniatrics) at a rate of 1.2 mL/hour by a syringe pump (World Precision Instruments) along with the focusing fluid (water) at a rate of 180 mL/hour by a digital gear pump (Cole Parmer Instruments). The bottom of the nozzle was immersed in water. After synthesis, the QD barcodes were hardened by overnight stirring and collected by centrifugation. The size and concentration of barcodes were determined by a Vi-Cell analyzer (Beckman Coulter).
(63) Growth of a metal nanoshell on barcode surface: 1 million QD barcodes were incubated with 100 μL of EDC (20 mg/mL in MES buffer of pH 6.5, 50 mM) and 30 μL of cystamine (50 mM in MES buffer) at room temperature for 4 hours. Excess cystamine was washed off in water by repeated centrifugation at 5,000 g for 5 minutes. Thiolated beads were incubated with silver or gold nanoparticles (average diameter=10 nm, 100 μL of 100 nM in 1 mM citrate from Nanocomposix) overnight at room temperature. The metal nanoparticles acted as a nucleation site for growth of metal. Barcodes were then washed in water (containing 0.05% TWEEN-20) by repeated centrifugation at 500 g for 5 minutes. Silver or gold-seeded barcodes were re-suspended in 50 μL of silver nitrate or gold chloride (1 mM) respectively, and hydroquinone (1 mM) for up to 2 hours, and washed in water (0.05% TWEEN-20) by repeated centrifugation at 100 g for 5 minutes. Metal nanoshell-coated beads were stored in water at 4° C. Scanning electron microscopy (SEM) imaging: metal nanoshell-coated barcodes were dropped on a carbon-film coated grid (300 mesh from Ted Pella) and imaged by a Hitachi S-5200 SEM at 2.0 kV. Functionalization of barcode surface with DNA capture probes: The procedure for functionalization of the barcode surface with DNA probes was modified from a published report [33]. 1 million beads were incubated with 50 μL of thiolated capture probe (30 μM in PBST containing 0.9 M of sodium chloride) at room temperature for 2 hours. Barcodes were washed in water (0.05% TWEEN-20) by repeated centrifugation at 100 g for 5 minutes. For uncoated beads, the conjugation condition was previously optimized [34]. 1 million uncoated beads were incubated with aminated capture probe (same amount as the thiolated capture probe used for silver nanoshell-coated barcodes) and EDC (10 mg in 100 μL of MES buffer pH 5.0, 100 mM) over-night at room temperature. Barcodes were then washed in water by repeated centrifugation at 5000 g for 5 minutes. The amount of capture probe on beads were calculated by measuring the remaining DNA amount in the supernatant after conjugation and centrifugation, and subtracting from the total amount of capture probes. The same amount of capture probes was used for uncoated and silver-nanoshell coated beads during the conjugation process. The amount of capture probe per bead is shown in Table 2. DNA assay: for each sample, about 5,000 microbeads were incubated with different concentrations of target DNA strand and Alexa647-labeled secondary probe in hybridization buffer (5×SSC buffer from Sigma) with a final volume of 20 μL. The amount of reporter probe was in 100 times molar excess of the highest target amount in the assay. The reaction was carried out at 40° C. for 20 minutes in a HL-2000 HybriLinker hybridization oven (UVP), followed by washing through a 96-well 0.45-μm filter plate (Millipore). Microbeads were then resuspended in PBST and analyzed by a flow cytometer (BD Biosciences). Sequences of DNA strands: DNA strands were synthesized by IDT or Bio Basic.
(64) TABLE-US-00001 TABLE 1 Secondary Capture probe (5′- probe Target AF647) 5′-end to 5′-end to 5′-end to 3′-end 3′-end 3′-end direction direction direction Negative SEQ ID NO: 1 SEQ ID NO: 2 SEQ ID NO: 9 control aaaaaaaaag cggcgatgaatac Taagtgtgctagg acaatgctca ctagcacacttac tattcatcgccg ctgaggatagt taactatcctcag tgagcattgtc Positive SEQ ID NO: 3 SEQ ID NO: 4 control aaaaaaaaac cggcgatgaata caatatcggc cctagcacactt ggcc actaggccgc cgatattgg P. SEQ ID NO: 5 SEQ ID NO: 6 falciparum aaaaaaaaaaa cggcgatgaata tatatttggtt cctagcacactt ttcccaaac actattaaactg cagtttaa gtttgggaaaac caaatatatt P.vivax SEQ ID NO: 7 SEQ ID NO: 8 aaaaaaaaagt cggcgatgaatac atcagttatg ctagcacacttac tggattaag tacgcttctagct ctagaagcg taatccacataac tgatac
Results
(65) Fluorescence Intensity of the Metal Nanoshell-Coated Barcodes
(66) The fluorescence intensity of metal-coated QD barcodes of the present invention was shown to remain distinct under a wide field microscope. It has also been shown that a metal nanoshell with controlled thickness may not substantially affect the barcoding capacity of QDs. The fluorescence intensities of QD microbeads of the present invention decreased with increased shell thickness (see
(67) As shown in
(68)
(69)
(70) As shown in
(71) Different shell thicknesses may also be used to increase the number of QD barcodes since the thickness would influence the fluorescence intensities.
(72)
(73) Fluorescence Stability of the Metal Nanoshell-Coated Barcodes
(74)
(75) Uncoated single polymer QD barcodes were compared with silver nanoshell-coated single and mixed polymer barcodes. Uncoated mixed polymer barcodes were not compared because, as previously shown, the polymer composition did not significantly affect their shelf-life (see
(76) Shelf-Life of Metal Nanoshell-coated Barcodes
(77) Microbeads were incubated in pH 4 to 11 for 24 hours (
(78) The forward scattering and side scattering plots suggest that uncoated beads degraded easily under alkaline, high ionic strength, and high heat conditions (see
(79) As shown in
(80) Applications of the Metal Nanoshell-Coated Barcodes
(81) The metal nanoshell-coated barcodes of the present invention may be functionalized by conjugating a capture probe to the surface of the metal nanoshell.
(82) The inventors compared the analytical performance of uncoated and silver nanoshell-coated microbeads in detection assays. The positive control DNA strand (cggcgatgaatacctagcacacttactaggccgccgatattgg) (SEQ ID NO: 4) used in the multiplexed experiments was chosen as the model target. Uncoated QD555 beads were conjugated with an aminated capture probe of the target strand (aaaaaaaaaccaatatcggcggcc) (SEQ ID NO: 3) by a carbodiimide coupling agent. The conjugation conditions were optimized in previous studies [16,17] Briefly, 1 million of uncoated beads were incubated in 100 pL of MES buffer (pH 6.5, 50 mM) containing 10 mg of EDC and 28 picomole of capture probe over night. Silver nanoshell-coated beads were functionalized with thiolated capture probe. The amount of capture probes for conjugation was kept constant between the uncoated and silver nanoshell-coated QD barcodes. The target strand was then measured by a sandwich assay using both types of beads performed in parallel (
(83) Silver nanoshell-coated beads exhibited a detection limit of 3 attomoles, which was a 2-order improvement over uncoated beads (see
(84) Multiplex Detection System
(85) The inventors further demonstrated the practical application of the metal nanoshell-coated QD barcodes of the present invention in multiplexed detection by conducting a 4-plex DNA assay for differentiation of Plasmodium falciparum, a potentially deadly species of malaria, from other nonlethal malaria species.
(86) Over 1 million people die from malaria infections annually [22,23]. There are four different parasites that cause malaria in humans: P. falciparum, P. vivax, P. ovale, and P. malariae. The ability to differentially identify the potentially deadly P. falciparum from the other species is important for proper clinical treatment of patients and to reduce drug resistance.
(87) In order to detect P. falciparum from other malarial species, capture probes were designed based on genetically conserved regions of the 18S rRNA gene of P. falciparum and P. vivax [24,25], and an Alexa647-labeled sequence was used as a secondary probe. Negative and positive control strands were also designed (the DNA sequences are available in Table 1). Silver nanoshell-coated QD barcodes of four different fluorescent signatures were functionalized with thiolated capture probes for each target [26].
(88) The dose-response curves of P. falciparum and P. vivax are shown in
(89) The inventors also studied if metal nanoshells in general can enhance the assay performance. As shown in
(90) QD540 and QD580 were used to make the 4-plex barcodes and their emission spectra were shown in
(91) TABLE-US-00002 TABLE 2 Amount of Capture Probe on Beads Silver nanoshell- Uncoated beads coated beads Amount of capture probe 54 181 per bead (attomole)
(92) Presented herein are nanoshell-coated QD barcodes and methods to synthesize metal nanoshell-coated QD barcodes. The diameter of microbeads, the fluorescence of QDs, and the thickness of metal nanoshell may be highly tunable. The fluorescence of the QD barcodes of the present invention has greater consistency in a wide range of pH, buffer and temperature conditions compared with uncoated beads. This should lead to improvements in the barcode signal consistency. The inventors demonstrate at least a 2-order increase in analytical sensitivity for detecting genetic targets using metal nanoshell-coated microbeads in comparison to uncoated microbeads. The assay process is very simple, reliable and fast, and the detection sensitivity is comparable to other bead-based detection platforms with signal amplification mechanisms [29,30]. Finally, it has been shown herein that such composite microbeads are capable of multiplexed detection with excellent barcoding performance. The barcodes of the present invention were capable of differentiating the potentially deadly P. falciparum malaria pathogen from other malaria species. These advantages make this platform an ideal candidate for ultrasensitive and high-throughput multiplexed sensing applications in a wide variety of fields.
REFERENCES
(93) [1] R. Wilson, A. R. Cossins, D. G. Spiller, Encoded microcarriers for high-throughput multiplexed detection, Angew Chem Int Ed Engl 45 (2006) 6104-6117.
(94) [2] M. Han, X. Gao, J. Z. Su, S. Nie, Quantum-dot-tagged microbeads for multiplexed optical coding of biomolecules, Nat Biotechnol 19 (2001) 631-635.
(95) [3] S. Fournier-Bidoz, T. L. Jennings, J. M. Klostranec, W. Fung, A. Rhee, D. Li, W.C. Chan, Facile and rapid one-step mass preparation of quantum-dot barcodes, Angew Chem Int Ed Engl 47 (2008) 5577-5581.
(96) [4] X. Gao, S. Nie, Doping Mesoporous Materials with Multicolor Quantum Dots, J. Phys. Chem. B 107 (2003) 11575-11578.
(97) [5] D. Wang, A. L. Rogach, F. Caruso, Semiconductor Quantum Dot-Labeled Microsphere Bioconjugates Prepared by Stepwise Self-Assembly, Nano Lett. 2 (2002) 857-861.
(98) [6] X. Gao, W. C. Chan, S. Nie, Quantum-dot nanocrystals for ultrasensitive biological labeling and multicolor optical encoding, J Biomed Opt 7 (2002) 532-537.
(99) [7] J. A. Lee, A. Hung, S. Mardyani, A. Rhee, J. Klostranec, Y. Mu, D. Li, W. C. W. Chan, Toward the Accurate Read-out of Quantum Dot Barcodes: Design of Deconvolution Algorithms and Assessment of Fluorescence Signals in Buffer, Adv. Mater. 19 (2007) 3113-3118.
(100) [8] L. Y. Chou, W. C. Chan, A strategy to assemble nanoparticles with polymers for mitigating cytotoxicity and enabling size tuning, Nanomedicine (Lond) 6 (2011) 767-775.
(101) [9] M. Brust, D. J. Schiffrin, D. Bethell, C. J. Kiely, Novel gold-dithiol nano-networks with non-metallic electronic properties, Advanced Materials 7 (1995) 795-797.
(102) [10] Y. C. Cao, X. F. Hua, X. X. Zhu, Z. Wang, Z. L. Huang, Y. D. Zhao, H. Chen, M. X. Liu, Preparation of Au coated polystyrene beads and their application in an immunoassay, Journal of immunological methods 317 (2006) 163-170.
(103) [11] T. Ji, V. G. Lirtsman, Y. Avny, D. Davidov, Preparation, Characterization, and Application of Au-Shell/Polystyrene Beads and Au-Shell/Magnetic Beads, Advanced Materials 13 (2001) 1253-1256.
(104) [12] J. H. Lee, M. A. Mahmoud, V. Sitterle, J. Sitterle, J. C. Meredith, Facile preparation of highly-scattering metal nanoparticle-coated polymer microbeads and their surface plasmon resonance, J Am Chem Soc 131 (2009) 5048-5049.
(105) [13] K. E. Peceros, X. Xu, S. R. Bulcock, M. B. Cortie, Dipole-dipole plasmon interactions in gold-on-polystyrene composites, J Phys Chem B 109 (2005) 21516-21520.
(106) [14] A. D. Quach, G. Crivat, M. A. Tarr, Z. Rosenzweig, Gold nanoparticle-quantum dot-polystyrene microspheres as fluorescence resonance energy transfer probes for bioassays, J Am Chem Soc 133 (2011) 2028-2030.
(107) [15] W. Shi, Y. Sahoo, M. T. Swihart, P. N. Prasad, Gold nanoshells on polystyrene cores for control of surface plasmon resonance, Langmuir 21 (2005) 1610-1617.
(108) [16] Y. Gao, W. L. Stanford, W. C. Chan, Quantum-dot-encoded microbeads for multiplexed genetic detection of non-amplified DNA samples, Small 7 (2011) 137-146.
(109) [17] S. Giri, E. A. Sykes, T. L. Jennings, W. C. Chan, Rapid screening of genetic biomarkers of infectious agents using quantum dot barcodes, ACS Nano 5 (2011) 1580-1587.
(110) [18] A. I. Dragan, E. S. Bishop, J. R. Casas-Finet, R. J. Strouse, M. A. Schenerman, C. D. Geddes, Metal-enhanced PicoGreen fluorescence: application for double-stranded DNA quantification, Anal Biochem 396 (2010) 8-12.
(111) [19] C. R. Sabanayagam, J. R. Lakowicz, Increasing the sensitivity of DNA microarrays by metal-enhanced fluorescence using surface-bound silver nanoparticles, Nucleic Acids Res 35 (2007) e13.
(112) [20] E. G. Matveeva, I. Gryczynski, A. Barnett, Z. Leonenko, J. R. Lakowicz, Z. Gryczynski, Metal particle-enhanced fluorescent immunoassays on metal mirrors, Anal Biochem 363 (2007) 239-245.
(113) [21] J. Zhang, E. Matveeva, I. Gryczynski, Z. Leonenko, J. R. Lakowicz, Metal-enhanced fluoroimmunoassay on a silver film by vapor deposition, J Phys Chem B 109 (2005) 7969-7975.
(114) [22] Y. Kockaerts, S. Vanhees, D. C. Knockaert, J. Verhaegen, M. Lontie, W.E. Peetermans, Imported malaria in the 1990s: a review of 101 patients, European Journal of Emergency Medicine 8 (2001) 287.
(115) [23] P. Martens, L. Hall, Malaria on the move: human population movement and malaria transmission, Emerging Infectious Diseases 6 (2000) 103.
(116) [24] M. Ndao, E. Bandyayera, E. Kokoskin, T. W. Gyorkos, J. D. MacLean, B. J. Ward, Comparison of blood smear, antigen detection, and nested-PCR methods for screening refugees from regions where malaria is endemic after a malaria outbreak in Quebec, Canada, Journal of clinical microbiology 42 (2004) 2694-2700.
(117) [25] G. Snounou, S. Viriyakosol, X. P. Zhu, W. Jarra, L. Pinheiro, V. E. do Rosario, S. Thaithong, K. N. Brown, High sensitivity of detection of human malaria parasites by the use of nested polymerase chain reaction, Molecular and biochemical parasitology 61 (1993) 315.
(118) [26] H. D. Hill, J. E. Millstone, M. J. Banholzer, C. A. Mirkin, The role radius of curvature plays in thiolated oligonucleotide loading on gold nanoparticles, ACS Nano 3 (2009) 418-424.
(119) [27] M. L. Wilson, Malaria rapid diagnostic tests, Clin Infect Dis 54 (2012) 1637-1641.
(120) [28] M. L. McMorrow, M. Aidoo, S. P. Kachur, Malaria rapid diagnostic tests in elimination settings—can they find the last parasite?, Clin Microbiol Infect 17 (2011) 1624-1631.
(121) [29] S. C. Chapin, P. S. Doyle, Ultrasensitive multiplexed microRNA quantification on encoded gel microparticles using rolling circle amplification, Anal Chem 83 (2011) 7179-7185.
(122) [30] E. Schopf, Y. Chen, Attomole DNA detection assay via rolling circle amplification and single molecule detection, Anal Biochem 397 (2010) 115-117.
(123) [31] Peng, X.; Schlamp, M. C.; Kadavanich, A. V.; Alivisatos, A. P. Journal of the American Chemical Societyl997, 119, 7019-7029.
(124) [32] Lee, J. H.; Mahmoud, M. A.; Sitterle, V.; Sitterle, J.; Meredith, J. C. J Am Chem Soc2009, 131, 5048-5049.
(125) [33] Hill, H. D.; Millstone, J. E.; Banholzer, M. J.; Mirkin, C. A. ACS Nano2009, 3, 418-424.
(126) [34] Gao, Y.; Stanford, W. L.; Chan, W. C. Small2011, 7, 137-146.
(127) The priority document and all publications and patent applications cited in this specification are herein incorporated by reference as if each individual publication or patent application were specifically and individually indicated to be incorporated by reference. Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be readily apparent to those of ordinary skill in the art in light of the teachings of this invention that certain changes and modifications may be made thereto without departing from the spirit or scope of the appended claims.