Improved lipid accumulation in Yarrowia lipolytica strains by overexpression of hexokinase and new strains thereof
20170145449 ยท 2017-05-25
Inventors
- Jean-Marc Nicaud (Trappes, FR)
- Zbigniew Lazar (Wroclaw, PL)
- Thierry Dulermo (Saint Germain en Laye, FR)
- Anne-Marie Crutz-Le Coq (Velizy, FR)
Cpc classification
C12N9/1205
CHEMISTRY; METALLURGY
C12Y101/01008
CHEMISTRY; METALLURGY
C12P7/6427
CHEMISTRY; METALLURGY
C12N9/2431
CHEMISTRY; METALLURGY
C12N9/1029
CHEMISTRY; METALLURGY
C12Y203/0102
CHEMISTRY; METALLURGY
International classification
C12P7/64
CHEMISTRY; METALLURGY
Abstract
The present invention relates to oleaginous yeast strains overexpressing a hexokinase gene, wherein said strains are capable of accumulating lipids. Methods for obtaining said strains as well as methods for producing lipids are also disclosed.
Claims
1. A Yarrowia lipolytica strain overexpressing a hexokinase gene, wherein said strain is of a background selected in the list consisting of A-101, H222 and W29, and said strain is capable of accumulating lipids.
2. The strain of claim 1, wherein the said hexokinase gene is ylHXK1.
3. The strain of claim 1, said strain further overexpressing a hexose transporter gene.
4. The strain of claim 1, wherein the said transporter is YHT1, YHT3 or YHT3-1181V.
5. The strain of claim 1, said strain further overexpressing the SUC2 gene of Saccharomyces cerevisiae.
6. The strain of claim 1, said strain further overexpressing the GPD1 gene and said strain being deficient for beta-oxidation of fatty acids.
7. The strain of claim 1, said strain further comprising at least one loss-of-function mutation in at least one gene selected from the PEX genes, the POX genes, the MFE1 gene, and the POT1 gene.
8. The strain of claim 1, said strain further comprising at least one loss-of-function mutation in each of the genes POX1, POX2, POX3, POX3, POX4, POX5, and POX6.
9. The strain of claim 1, said strain further comprising at least one additional mutation in at least one gene encoding an enzyme involved in the metabolism of fatty acids.
10. The strain of claim 9, wherein said mutation further increases the capacity of the strain to accumulate lipids.
11. The strain of claim 9, wherein said mutation is a mutation in GUT2, TLG3 or TLG4.
12. The strain of claim 9, wherein said mutation is a mutation in the YALI0B10153g.
13. The strain of claim 1, said strain further overexpressing the ylDGA2 gene.
14. A method for constructing the strain of claim 1 comprising a step of transforming an oleaginous yeast with a polynucleotide allowing the overexpression of said hexokinase gene.
15. The method of claim 14, further comprising at least one step of introducing at least one additional polynucleotide enabling the overexpression of another gene selected in the list comprising YHT1, YHT3, YHT3-I181V, SUC2, GPD1, and ylDGA2.
16. The method of claim 14, further comprising a step of introducing at least one additional mutation affecting lipid synthesis, wherein said mutation affects at least one of the PEX genes, one of the POX genes, the MFE1 gene, the POT1 gene, the TLG3 and TLG4 genes, GUT2, or YALI0B10153g.
17. A method for producing lipids, comprising the steps of: a. growing the strain of oleaginous yeast of claim 1 in an appropriate culture medium; and b. harvesting the lipids produced by the culture of step a.
18. The method of claim 17, wherein the culture medium of step a) comprises a carbon source which is glucose, fructose or sucrose.
Description
FIGURE LEGENDS
[0140]
[0141] The JMY3501 strain was derived from JMY1233 (Beopoulos et al., 2008). (i) TGL4 was inactivated by introducing the disruption cassette tgl4::URA3ex from JMP1364 (Dulermo et al., 2013), which generated JMY2179. (ii) An excisable auxotrophic marker, URA3ex, was then excised from JMY2179 using JMP547 (Fickers et al., 2003), which generated JMY3122. (iii) JMY3501 was then obtained by successively introducing pTEF-DGA2-LEU2ex, from JMP1822, and pTEF-GPD1-URA3ex, from JMP1128 (Dulermo and Nicaud, 2011), into JMY3122. JMP1822 was obtained by replacing the URA3ex marker from JMP1132 (Beopoulos et al., 2008) with LEU2ex.
[0142] The JMY4086 strain was generated by successively introducing pTEF-YlHXK1-URA3ex, from JMP2103, and pTEF-SUC2-LEU2ex, from JMP2347, into JMY3820. JMY3820 corresponds to JMY3501, but is different in that the URA3ex and LEU2ex markers in the former have been rescued, as previously described (Fickers et al., 2003).
[0143]
[0144]
[0145]
[0146]
[0147]
[0148] )YGL253W) hexokinases. Yeast were grown in YNB medium with 6% fructose as carbon source with C/N ratio=60. In red: the improvement in FA production (% of CDW; ratio of HXK to WT).
[0149]
[0150]
[0151]
[0152]
[0153]
[0154]
[0155]
[0156]
EXAMPLES
[0157] Characterization of the Y. Lipolytica Hexokinase Gene
1. MATERIALS AND METHODS
[0158] 1.1. Yeast Strains and Plasmids
[0159] The plasmids and strains used in this study are listed in Table 4. Three Y. lipolytica wild-type (WT) strains were used (country of origin in parentheses): W29 (France), A-101 (Poland), and H222 (Germany) (Wojtatowicz and Rymowicz, 1991; Barth and Gaillardin, 1996). The following auxotrophic strains had previously been derived from these WT strains and were also used in this study: PO1d (Ura.sup.Leu.sup.) from W29 (Barth and Gaillardin 1996), A-101-A18 (Ura.sup.) from A-101 (Walczak and Robak, 2009), and Y322 (Ura.sup.) from H222 (Mauersberger et al., 2001). The other strains used in this study were strains Y3573, Y3812, and Y3850, which contained an expression cassette that included the Y. lipolytica HXK1 gene from W29 (ylHXK1, YALI0B22308g) under the control of the constitutive TEF promoter (Muller et al., 1998), and strain Y3572, which contained an expression cassette carrying the S. cerevisiae hexokinase gene HXK2 (scHXK2, YGL253W). Transformation of Y. lipolytica was performed with the lithium acetate procedure (Xuan et al., 1990), using NotI digested fragments for random chromosomal integration (Mauersberger et al., 2001).
TABLE-US-00004 TABLE 4 Strains used in this study. For simplification purposes, the transformants of three different origin of Y. lipolytica overexpressing hexokinase are named: W29- HXK1, A-101-HXK1 and H222-HXK1, respectively. Additionally, strains named in the table e.g. JMY3501are named Y3501. Name Relevant genotype Reference E. coli strains JME547 pUB4-CRE 1 Fickers et al. (2003) JME1128 JMP62 pTEF-GPD1-URA3ex Dutermo and Nicaud (2011) JME1364 pKS P-LEU2ex-T TGL4 Dutermo et al. (2013) JME1822 JMP62 pTEF-DGA2-LEU2ex JME2103 JMP62 pTEF-YlHXK1-URA3ex This work JME2347 JMP62 pTEF-SUC2-LEU2ex Lazar et al. (2013) JME2441 JMP62 pTEF-ScHXK2-Ura3ex This work Y. lipolytica strains A-101 MATa WT Wojtatowicz and Rymowicz (1991) H222 MATa WT Barth and Gaillardin (1996) W29 MATa WT Barth and Gaillardin (1996) PO1d MATa ura3-302 leu2-270 xpr2-322 + pXPR2-SUC2 Barth and Gaillardin (1996) A-101- MATa ura3-302 + pXPR2-SUC2 Walczak and A18 Robak (2009) Y322 MATa ura3-302 + pXPR2-SUC2(H222) Mauersberger et al. (2001) JMY1233 MATa ura3-302 leu2-270 xpr2-322 pox1-6 + pXPR2-SUC2 Beopoulos et al. (2008) JMY2179 MATa ura3-302 leu2-270 xpr2-322 pox1-6 tgl4::URA3ex + This work pXPR2-SUC2 JMY2900 MATa ura3-302 xpr2-322 + URA3ex + pXPR2-SUC2 Brunel and Nicaud (unpublished data) JMY3122 MATa ura3-302 leu2-270 xpr2-322 pox1-6tgl4 + pXPR2-SUC2 This work JMY3373 MATa ura3-302 leu2-270 xpr2-322 pox1-6tgl4 + pXPR2- This work SUC2 + pTEF-DGA2-LEU2ex JMY3501 MATa ura3-302 leu2-270 xpr2-322 pox1-6 tgl4 + pXPR2- This work SUC2 + pTEF-DGA2-LEU2ex + pTEF-GPD1-URA3ex JMY3572 MATa ura3-302 leu2-270 xpr2-322 + pXPR2-SUC2 + pTEF-ScHXK2- This work URA3ex + LEU2ex JMY3573 MATa ura3-302 leu2-270 xpr2-322 + pXPR2-SUC2 + pTEF-YlHXK1- This work URA3ex + LEU2ex JMY3812 MATa ura3-302 + pXPR2-SUC2 + pTEF-YlHXK1-URA3ex (A-101) This work JMY3820 MATa ura3-302 leu2-270 xpr2-322 pox1-6 tgl4 + pXPR2- This work SUC2 + pTEF-DGA2 + pTEF-GPD1 JMY3850 MATa ura3-302 + pXPR2-SUC2 + pTEF-YlHXK1-URA3ex (H222) This work JMY4059 MATa ura3-302 leu2-270 xpr2-322 pox1-6 tgl4 + pXPR2- This work SUC2 + pTEF-DGA2 + pTEF-GPD1 + pTEF-YlHXK1-URA3ex JMY4086 MATa ura3-302 leu2-270 xpr2-322 pox1-6 tgl4 + pXPR2- This work SUC2 + pTEF-DGA2 + pTEF-GPD1 + pTEF-YlHXK1-URA3ex + pTEF-SUC2- LEU2ex
[0160] To recover prototrophy, strains Y3572 and Y3573 were transformed with a purified Sail fragment of the plasmid pINA62 that contained the LEU2 gene (Gaillardin and Ribet, 1987). Construction of the Y4086 strain, which was modified for lipid production, is depicted in detail in
[0161] 1.2. Growth Media
[0162] Media and growth conditions for Escherichia coli were identical to those in previous studies (Sambrook and Russell, 2001), as were those of Y. lipolytica (Barth and Gaillardin, 1996). Rich (YPD) medium was prepared using 20 g.Math.L.sup.1 Bacto Peptone (Difco, Paris, France), 10 g.Math.L.sup.1 yeast extract (Difco), and 20 g.Math.L.sup.1 glucose (Merck, Fontenay-sous-Bois, France). Minimal (YNB) medium was prepared using 1.7 g.Math.L.sup.1 yeast nitrogen base (without amino acids and ammonium sulphate, Difco), 10 g.Math.L.sup.1 glucose (Merck), 5 g.Math.L.sup.1 NH.sub.4Cl, and 50 mM phosphate buffer (pH 6.8). To complement auxotrophic processes, 0.1 g.Math.L.sup.1 uracil or leucine (Difco, Paris, France) were added as necessary.
[0163] 1.3. Growth in Microtiter Plates
[0164] Precultures were obtained from frozen stocks, inoculated into tubes containing 5 mL YPD medium, and cultured overnight (170 rpm, 28 C.). Precultures were then centrifuged and washed with sterile distilled water; cell suspensions were standardized to an OD.sub.600 of 0.1. Yeast strains were grown in 96-well plates in 200 l of minimal YNB medium (see above) containing 10 g.Math.L.sup.1 of either glucose or fructose.
[0165] The culture was performed three times, with 2-3 replicates for each condition. Cultures were maintained at 28 C. under constant agitation with a Biotek Synergy MX microtiter plate reader (Biotek Instruments, Colmar, France); each culture's optical density at 600 nm was measured every 20 min for 72 h.
[0166] 1.4. Media and Growth for Lipid Biosynthesis Experiments
[0167] For lipid biosynthesis in minimal media, cultures were prepared as follows: an initial preculture was established by inoculating 50 mL of YPD medium in 250-mL Erlenmeyer flasks; this was followed by an overnight shaking step at 28 C. and 170 rpm. The resulting cell suspension was washed three times with sterile distilled water and used to inoculate 50 mL of YNB medium containing 15, 30, 60, 90, or 120 g.Math.L.sup.1 of fructose (corresponding to a carbon/nitrogen (C/N) ratio of 15, 30, 60, 90, and 120, respectively). Each culture was incubated, with shaking, in non-baffled 250-mL Erlenmeyer flasks, at 28 C. and 170 rpm for 168 h, or until all available sugar had been consumed. We also evaluated lipid biosynthesis in several other types of media, including a glucose-only (60 g.Math.L.sup.1, C/N=60) control medium, a sucrose-containing (60 g.Math.L.sup.1, C/N=60) medium, and a rich fructose (YPF) medium. The latter was prepared using 20 g.Math.L.sup.1 peptone; 10 g.Math.L.sup.1 yeast extract; and 10, 50, 100, 200, or 250 g.Math.L.sup.1 of fructose. The preculture and growth conditions for each experiment were as described above.
[0168] 1.5. Bioreactor Studies
[0169] Lipid biosynthesis was also evaluated in batch cultures (BC) that were maintained for 96 h in 5-L stirred-tank BIO-STAT B-PLUS reactors (Sartorius, Frankfurt, Germany) under the following conditions: 2-L working volume, 28 C., 800 rpm, and 4-L.Math.min.sup.1 aeration rate. The production media contained 150 g sucrose, 1.7 g YNB, 3.75 g NH.sub.4Cl, 0.7 g KH.sub.2PO.sub.4, and 1.0 g MgSO.sub.47H.sub.2O, all in 1 L of tap water. Culture acidity was automatically maintained at pH 6.8 using a 40% (w/v) NaOH solution. Culture inocula were grown in 0.1 L of YNB medium with 30 g.Math.L.sup.1 glucose in 0.5-L flasks on a rotary shaker kept at 170 rpm and 28 C. for 48 h; inocula were added to the bioreactor cultures in a volume equal to 10% of the total working volume.
[0170] To analyze lipid production in the bioreactor cultures, a 15-mL sample was taken from each culture 10 min after inoculation (Time=0); subsequent sampling was conducted every 12 hours. Each sample was centrifuged for 10 min at 5000 rpm; supernatants and cell pellets were collected and used for further analyses.
[0171] 1.6. General Genetic Techniques and Plasmid Construction
[0172] Standard molecular genetics techniques were used throughout this study following Sambrook et al. (1989). Restriction enzymes were obtained from New England Biolabs (Ipswich, England). Genomic DNA from yeast transformants was prepared as described by Querol et al. (1992). PCR amplification was performed using an Eppendorf 2720 thermal cycler and employing both Taq (Promega, Madison, Wis.) and Pfu (Stratagene, La Jolla, Calif.) DNA polymerases. PCR fragments were then purified with a QIAgen Purification Kit (Qiagen, Hilden, Germany), and DNA fragments were recovered from agarose gels using a QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany). The Staden software package was used for gene sequence analysis (Dear and Staden, 1991).To quantify hexokinase gene expression, genes were amplified with the primer pairs ylHXK1-fwd and ylHXK1-rev (GAGAAGATCTATGGTTCATCTTGGTCCCCGAAAACCC, SEQ ID NO: 38 and GCGCCCTAGGCTAAATATCGTACTTGACACCGGGCTTG, SEQ ID NO: 39, respectively), and scHXK2-fwd and scHXK2-rev (SEQ ID NO: 4 0: GCGCGGATCCATGGTTCATTTAGGTCCAAAAAAACC and SEQ ID NO: 41: GCGCCCTAGGTTAAGCACCGATGATACCAACG, respectively), all of which contained BamHI(BglII)-AvrII restriction sites. These restriction sites enabled the genes to be cloned into JME1128 plasmids that had been digested with BamHI-AvrII, as previously described (Beopoulos et al. 2008; Dulermo et al., 2011). To delete the genes of interest, the disruption cassettes were produced in accordance with the protocol of Fickers and colleagues (2003). Auxotrophies were restored via excision using the Cre-lox recombinase system following transformation with the replicative plasmid pUB4-Cre1 (JME547) (Fickers et al., 2003).
[0173] 1.7. Fluorescence Microscopy
[0174] Images were obtained using a Zeiss Axio Imager M2 microscope (Zeiss, Le Pecq, France) with a 100 objective lens and Zeiss filter sets 45 and 46 for fluorescence microscopy. Axiovision 4.8 software (Zeiss, Le Pecq, France) was used for image acquisition. To make the lipid bodies (LBs) visible, BodiPy Lipid Probe (2.5 mg.Math.mL.sup.1 in ethanol; Invitrogen) was added to the cell suspension (OD.sub.600=5) and the samples were incubated for 10 min at room temperature.
[0175] 1.8. Lipid Determination
[0176] Fatty acids (FAs) in 15-mg aliquots of freeze-dried cells were converted into methyl esters using the method described in Browse et al. (1986) and were analyzed using a gas chromatograph (GC). GC analysis of FA methyl esters was performed using a Varian 3900 instrument equipped with a flame ionization detector and a Varian FactorFour vf-23ms column, for which the bleed specification at 260 C. was 3 pA (30 m, 0.25 mm, 0.25 m). FAs were identified by comparing their GC patterns to those of commercial FA methyl ester standards (FAME32; Supelco) and quantified using the internal standard method, which involved the addition of 50 g of commercial C17:0 (Sigma).
[0177] Total lipid extractions were obtained from 100-mg samples (cell dry weight (CDW)) in accordance with the method described by Folch et al. (1957). Briefly, Y. lipolytica cells were spun down, washed with water, freeze dried, and then resuspended in a 2:1 chloroform/methanol solution and vortexed with glass beads for 20 min. The organic solution was extracted and washed with 0.4 mL of 0.9% NaCl solution before being dried at 60 C. overnight and weighed to quantify lipid production.
[0178] 1.9. Sugar and Citric Acid Measurement
[0179] Citric acid (CA), glucose, fructose, and sucrose were identified and quantified by HPLC (UltiMate 3000, Dionex-Thermo Fisher Scientific, UK) using an Aminex HPX87H column coupled to UV (210 nm) and RI detectors. The column was eluted with 0.01 N H.sub.2SO.sub.4 at room temperature and a flow rate of 0.6 mL.Math.min.sup.1. Identification and quantification were achieved via comparisons to standards. Before being subject to HPLC analysis, samples were filtered on 0.45-m pore-size membranes.
[0180] 1.10. Dry Biomass Determination
[0181] To determine dry biomass, the cell pellets from 15-mL culture samples were washed twice with distilled water, filtered on 0.45-m pore-size membranes, and dried at 105 C. using a WPS 1105 weight dryer (Radwag, Pozna, Poland) until a constant mass was reached.
[0182] 1.11. Measurement of Hexokinase Activity
[0183] Total hexokinase activity was determined using whole cell extracts and a Hexokinase Colorimetric Assay Kit (Sigma-Aldrich, Saint Louis, Mo., USA) in accordance with the manufacturer's instructions. The reaction was performed at 24 C. in 96-well plates using a Biotek Synergy MX microtiter plate reader and was monitored by measuring absorbance at 450 nm. One unit of hexokinase was defined as the amount of enzyme that generated 1.0 mole of NADH per minute at pH 8.0 at room temperature.
[0184] 1.12. Reverse Transcription and qRT-PCR
[0185] RNA extraction was performed using TRIzol reagent (Invitrogen, Carlsbad, Calif., USA) in accordance with the manufacturer's instructions. Nucleic acids amounts were measured using a Biochrom WPA Biowave II spectrophotometer (Biochrom Ltd., Cambridge, UK) equipped with a TrayCell (HelmaAnalytics, Mllheim, Germany). Following the manufacturer's instructions, cDNA was prepared using Maxima First Strand cDNA Synthesis Kits for RT-qPCR (ThermoScientific, Waltham, Mass., USA).
[0186] Real-time PCR was performed using the DyNAmo Flash SYBR Green qPCR Kit (ThermoScientific, Waltham, Mass., USA) with 0.5 M forward and reverse primers and 1 g of cDNA template in a final reaction volume of 10 L. Thermocycling was performed in the Eco Real-Time PCR System (Illumina, San Diego, Calif., USA) with the following cycling parameters: 5 min incubation at 95 C., followed by 40 cycles of 10 s at 95 C., 10 s at 60 C., and 8 s at 72 C. Fluorescence data were acquired during each elongation step, and at the end of each run, specificity was controlled by melting curve analysis. Hexokinase expression was detected using the primers ylHXK1-qPCR-fwd (SEQ ID NO: 42: TCTCCCAGCTTGAAACCATC) and ylHXK1-qPCR-rev (SEQ ID NO: 43: CTTGACAACTCGCAGGTTGG). The results were normalized to actin gene expression (Lazaret al., 2011) and then analyzed using the ddCT method (Schmittgen and Livak, 2008).
[0187] All experiments in this paper were performed at least three times.
2. RESULTS AND DISCUSSION
[0188] Y. lipolytica is a strictly aerobic microorganism that is known to grow on hydrophobic substrates like n-alkanes, fatty acids, and oils (Fickers et al., 2005b). This yeast has been reported to metabolize a few types of different sugars, namely glucose, fructose, and mannose (Coelho et al., 2010; Michely et al., 2013), and its preferential consumption of glucose over fructose has been well-described (Wojtatowicz et al., 1997; Lazar et al., 2011).
[0189] 2.1. Variability of Fructose Utilization Among Y. Lipolytica Strains of Different Origin
[0190] The ability of three wild-type strains of different origins, i.e., W29 (France), H222 (Germany), and A-101 (Poland), to grow in media containing either glucose or fructose was compared. The three wild-type strains presented similar growth kinetics in YNB containing 10 g.Math.L.sup.1 glucose (=0.355 h.sup.1;
[0191] 2.2. Overexpression of the ylHXK1 Gene Enhances Hexokinase Activity, Growth, and Fructose Uptake in Y. Lipolytica
[0192] As Hxk1p is crucial for fructose assimilation in Y. lipolytica, we reasoned that interstrain variation in its activity could potentially be responsible for the diversity of growth patterns that we observed among the strains grown on fructose. We thus obtained the genome sequences of the different Y. lipolytica strains (Neuvglise, unpublished data) and compared the hexokinase gene and its promoter region among the three strains (data not shown). No polymorphisms were found in the putative hexokinase sequence, and only a few changes were identified in the different strains' promoter regions.
[0193] In an attempt to increase hexokinase activity among the different strains, we decided to introduce an additional copy of ylHXK1 under the strong, constitutive TEF promoter (Muller et al., 1998) into each strain. First, we examined the impact of this addition on the overall abundance of HXK1 transcripts and kinase activity by comparing these ylHXK1 transformants to their WT parental strains after they had been grown in glucose versus fructose media (Table 5). The presence of an additional copy of ylHXK1 increased both HXK1 transcript abundance (at least 23 fold) and hexokinase activity (at least 6 fold) in both carbon sources, which confirmed that constitutive overexpression had been successful. Transformants with the H222 background differed the least from their WT parent, both in terms of their HXK1 transcription levels and their kinase activity, while the largest difference was seen in the W29 transformantsof the three original strains, W29 showed the slowest growth on fructose. After they had been grown in fructose-containing medium, all three ylHXK1-overexpressing strains exhibited similar levels of hexokinase activity, around 1700 U.Math.g.sub.CDW.sup.1, an observation that suggests that this value could be the maximum level of hexokinase activity.
TABLE-US-00005 TABLE 5 Activity and mRNA fold change of hexokinase extracted from Y. lipolytica WT and ylHXK1 mutants growing in YNB medium with 100 g .Math. L.sup.1 glucose or 100 g .Math. L.sup.1 fructose analyzed at 24 h of the culture. Glucose Fructose Fold Fold change in change in Activity Fold transcript Activity Fold transcript Strain (U .Math. g.sub.CDW.sup.1) change level (U .Math. g.sub.CDW.sup.1) change level W29 193.5 23 7.70 28.22 1.7 145.3 12 12.15 96.11 4.8 W29-HXK1 1490.4 186 1766.2 118 A-101 42.4 3 27.10 40.21 3.0 155.6 10 10.73 55.39 2.8 A-101- 1148.6 87 1670.2 151 HXK1 H222 33.1 4 33.92 55.84 3.6 256.5 21 6.45 23.61 1.2 H222-HXK1 1122.6 100 1653.6 181
[0194] Next, we examined the growth capacity of the different transformants as compared to the WT strains. Although we observed a clear increase in hexokinase activity in both glucose- and fructose-based media, the growth profiles of the ylHXK1-overexpressing strains in YNB glucose were similar to those of the WT strains (=0.367 h.sup.1;
[0195] Finally, to investigate the indirect effects of hexokinase overexpression on glucose and fructose assimilation, we analyzed the uptake of these sugars by following changes in their concentration in the medium during yeast culture; their initial concentration was 100 g.Math.L.sup.1 (
[0196] 2.3. Overexpression of Hexokinase Inhibits Filamentation of Y. Lipolytica
[0197] The cultivation of Y. lipolytica in YNB glucose favored the growth of cells in the yeast form; however, when fructose was the carbon source, filamentation was clearly observed in the three WT strains (
[0198] In Y. lipolytica and other well-studied yeasts like S. cerevisiae, filamentation is known to be triggered by non-glucose C sources: N acetyl glucosamine in Y. lipolytica (Herrero et al., 1999; Hurtado and Rachubinski, 1999); and mannose, maltose, maltotriose, or sucrose in S. cerevisiae (da Silva et al., 2007; Van de Velde and Thevelein, 2008). Interestingly, both the use of fructose as a carbon source (da Silva et al., 2007) and the absence of hexokinase are also involved in filamentation in S. cerevisiae. In this species, deletion of the gene encoding hexokinase II resulted in the induction of filamentation in a glucose-containing medium (Van de Velde and Thevelein, 2008).
[0199] 2.4. Hexokinase Overexpression Increases Biomass and Lipid Biosynthesis
[0200] In addition to investigating growth, we also compared the lipid production of Y. lipolytica WT strains with that of their corresponding ylHXK1-overexpression transformants; all strains were grown in YNB medium with either 100 g.Math.L.sup.1 glucose or 100 g.Math.L.sup.1 fructose as the carbon source. The C/N molar ratio was fixed at 100 for this experiment. The dry biomass and fatty acids extracted from the cells as well as sugar consumption and citric acid production in the medium were quantified over the 120 h of culture. All the results obtained in this experiment are summarized in Table 6.
TABLE-US-00006 TABLE 6 Parameters of fatty acids, biomass and citric acid production by different origin WT and ylHXK1 transformants of Y. lipolytica growing 120 h in YNB medium with glucose or fructose (carbon source 100 g .Math. L.sup.1, C/N 100) Glucose Fructose W29 A-101 H222 W29 A-101 H222 Parameters WT ylHXK1 WT ylHXK1 WT ylHXK1 WT ylHXK1 WT ylHXK1 WT ylHXK1 X g .Math. L.sup.1 21.4 21.9 16.8 17.3 15.4 16.2 17.4 21.6 16.9 17.8 15.7 15.8 Y.sub.X/S g .Math. g.sup.1 0.27 0.28 0.25 0.26 0.23 0.26 0.25 0.28 0.27 0.27 0.23 0.25 FA g .Math. L.sup.1 2.57 3.28 3.03 3.12 1.69 1.95 1.56 3.02 2.19 2.85 1.26 1.90 Y.sub.FA/X g .Math. g.sup.1 0.12 0.15 0.18 0.18 0.11 0.12 0.09 0.14 0.13 0.16 0.08 0.12 Y.sub.FA/S g .Math. g.sup.1 0.032 0.044 0.045 0.046 0.025 0.032 0.022 0.039 0.035 0.043 0.019 0.029 CA g .Math. L.sup.1 0.54 2.21 4.89 8.76 1.04 0.51 0.33 1.16 2.47 3.65 0.26 0.00 Symbols: Xdry biomass, FAfatty acids, CAcitric acid, Y.sub.X/Syield of biomass from consumed substrate, Y.sub.FA/Syield of fatty acids from consumed substrate, Y.sub.FA/Xyield of fatty acids from dry biomass; SD of all analyzed parameters did not exceed 7%.
[0201] The greatest amount of dry biomass, 21.5 g.Math.L.sup.1, was obtained from W29 and its ylHXK1 transformant when they were grown on glucose. Lower values were obtained from A-101 and H222 (17 g.Math.L.sup.1 and 16 g.Math.L.sup.1, respectively). The differences in final biomass observed among these strains in flask culture compared to Biotek culture may possibly result from the higher concentration of the carbon source in the flasks and differences in oxygenation between the two systems, which again confirms that physiological differences existed among the strains examined. Overexpression of ylHXK1 did not lead to a significant increase in biomass in YNB glucose medium for any of the strains. In contrast, ylHXK1 overexpression in strain W29 had a large impact on biomass production when the yeast was grown in fructose relative to what was seen for its WT parent, which had been the slowest-growing WT strain in that medium. WT W29 produced around 4 g.Math.L.sup.1 less biomass in fructose than in glucose, while the W29 ylHXK1 transformant yielded similar amounts of dry biomass regardless of the medium's carbon source. Strains A-101 and H222 generated similar amounts of biomass when grown in fructose versus glucose, regardless of whether the hexokinase gene was overexpressed or not.
[0202] Slightly less dramatic differences were observed among the different Y. lipolytica strains when biomass yield per unit of substrate consumed was examined (Table 6). The highest value, Y.sub.X/S=0.28, was produced by the ylHXK1 transformant of W29 in both substrates. However, a small increase was also observed for the ylHXK1 transformant of H222 relative to its WT parent in both glucose- and fructose-based media. No difference was observed between the A-101 strain and its ylHXK1 transformant in both sugars.
[0203] Among the WT strains, A-101 grown in the glucose-based medium yielded the highest amount of total fatty acids (3.03 g.Math.L.sup.1, Table 6) out of all the strain/media combinations that were tested. Although the amount of FAs produced by WT A-101 was lower when the strain was grown in the fructose medium (38% less than in the glucose medium), it was still 74% and 40% higher than the amount obtained in the same medium for the H222 and W29 strains, respectively. Overexpression of hexokinase improved FA production in both substrates for all three Y. lipolytica transformant strains. Although the strain/medium combination that yielded the greatest amount of FAs was the W29 ylHXK1 transformant grown in YNB glucose medium (3.28 g.Math.L.sup.1), the largest increase compared to WT was observed in the same strain in YNB fructose medium (3.02 g.Math.L.sup.1); ylHXK1 overexpression almost doubled the amount of FAs produced as compared to the W29 WT. For the other strains, the effect of hexokinase overexpression on FA production was also more visible when the strains were grown in YNB fructose versus glucose medium; FA production increased by 51% and 30% for H222 and A-101, respectively.
[0204] However, when we adjusted these values to account for yeast biomass, we found that the best FA producer, in terms of FA yield obtained per unit biomass, was A-101 grown in YNB glucose medium (0.18 g.Math.g.sup.1, Table 6). This strain produced 63% and 50% more FA per g of biomass than did H222 and W29, respectively. For all the strains, a lower amount of total FAs was produced and the yield of FAs per unit biomass was also lower in YNB fructose than in YNB glucose. Similarly, A-101 was also the best FA producer in the fructose medium, with a yield of 0.13 g of FA per g of biomass compared to yields of 0.09 g.Math.g.sup.1 and 0.08 g.Math.g.sup.1 for W29 and H222, respectively. In terms of production in fructose, the overexpression of hexokinase improved FA yield as compared to the WT for all the transformant strains, but we did not observe large differences in FAs per unit biomass between the WT and ylHXK1 mutants grown in the YNB glucose medium. Hexokinase overexpression resulted in an increase in FA production per g biomass in YNB fructose of 55%, 50%, and 23% for W29, H222, and A-101, respectively. A similar pattern was also observed for measurements of the conversion of consumed substrate into FAs (Y.sub.FA/S; Table 6).
[0205] In addition to triggering lipid production, nitrogen limitation in Y. lipolytica also results in the production of citric acid (CA). Under the conditions present in this study, low amounts of CA, which is an undesirable by-product of lipid accumulation, were produced. The highest amount of CA was produced by A-101 and its ylHXK1 transformant (Table 6). These two strains produced more than 0.05 g of CA per g of cells, with the A-101 ylHXK1 transformant generating up to 0.13 g per g of YNB glucose substrate (data not shown). In batch culture and under conditions optimized for CA production, WT A-101 was able to produce 0.45 g of CA per gram of glucose (Rywiska et al., 2010). In the W29 and A-101 transformants, the overexpression of ylHXK1 significantly increased CA production in both glucose and fructose media. In contrast, ylHXK1 overexpression in H222 had the opposite effectCA production was reduced in the glucose medium and absent in the fructose medium.
[0206] The three Y. lipolytica WT strains also differed in the composition of the FAs they produced (Table 7). Each strain generated high amounts of C18:1 and C16:0 in both YNB glucose and fructose media, with strain A-101 showing the highest quantity of C18:1 and the lowest quantity of C18:0 and C16:0 compared to the other strains. This result suggests that FA elongation and desaturation in Y. lipolytica A-101 were more efficient than in the other two strains, due to either an increase in activity of the 9-desaturase and elongase enzymes or increased stimulation by their respective promoters. A difference was also observed between strains W29 and H222. Although both strains generated similar amounts of C16:0, strain W29 produced more C18:1 than did strain H222; conversely, H222 contained more C18:0 than did W29. This pattern held regardless of whether the carbon source was glucose or fructose. However, both strains contained a higher percentage of C18:2 when grown in YNB fructose than when grown in YNB glucose. Overexpression of ylHXK1 had the clearest impact on fatty acid composition in strain W29 in both the glucose- and fructose-based media. Compared to the composition found in the WT strain, the percentage of C18:1 decreased for C18:0 and slightly for C16:0 in YNB glucose and even more in YNB fructose. It is possible that faster FA synthesis might have resulted in the saturation of 9-desaturase and thus reduced the conversion of C18:0 into C18:1. In the other two strains, hexokinase overexpression did not result in any visible changes in relative FA composition.
TABLE-US-00007 TABLE 7 Composition of FA produced by Y. lipolytica WT and ylHXK1 transformants growing 120 h in YNB glucose or fructose medium (carbon source 100 g .Math. L.sup.1, C/N 100) Glucose Fructose Fatty W29 A-101 H222 W29 A-101 H222 acid WT ylHXK1 WT ylHXK1 WT ylHXK1 WT ylHXK1 WT ylHXK1 WT ylHXK1 C16:0 17.4 18.4 11.9 11.3 18.8 17.2 15.5 18.7 12.2 12.0 17.3 16.8 C16:1 7.1 6.2 7.6 8.7 5.7 6.1 7.0 6.7 7.9 8.6 7.2 7.5 (n-7) C18:0 11.9 13.7 8.2 7.5 15.8 14.0 9.5 13.5 7.6 7.6 12.1 11.5 C18:1 52.5 47.1 61.1 62.9 47.9 50.2 54.2 47.4 60.3 61.6 48.9 49.0 (n-9) C18:2 7.3 8.7 7.6 6.4 7.3 7.6 9.6 8.7 8.3 6.8 10.2 10.3 (n-6) Others 4.0 5.9 3.6 3.3 4.5 4.8 4.2 5.0 3.7 3.4 4.3 4.9
[0207] 2.5. Impact of Different Hexokinase Genes and Varying C/N Ratios on Fatty Acid and Citric Acid Production
[0208] Taking into account all of these results, the French strain W29 was chosen for further analysis, as overexpression of hexokinase in this background resulted in the highest degree of improvement in the parameters examined. Furthermore, many studies on lipid biosynthesis in Y. lipolytica have been performed using W29-derived strains, which made it easier to compare our results on sugar utilization improvement with those from the literature.
[0209] Data from the literature regarding the regulation of glycolysis and the characterization of hexokinase reveal differences in the enzyme's kinetics among different organisms. For example, hexokinase in Y. lipolytica is unique in that it is highly sensitive to trehalose-6-phosphate inhibition, much more so than Hxk2p in S. cerevisiae (Petit and Gancedo, 1999). Because of this, we wanted to compare the improvement in FA production resulting from the expression of HXK2 in a Y. lipolytica background (strain PO1d) with that resulting from overexpression of the native Y. lipolytica hexokinase (again in strain PO1d); each inserted gene was regulated by the constitutive TEF promoter (
[0210] As a second test, the effect of varying C/N molar ratios in the YNB fructose medium on lipid production was investigated (
TABLE-US-00008 TABLE 8 Parameters of biomass and citric acid production by Y. lipolytica Y3573 in YNB medium with fructose with different C/N ratio and in rich medium YP with different fructose concentration. C/N ratio Fructose concentration (g .Math. L.sup.1) Parameter 15 30 60 90 120 10 50 100 200 250 X g .Math. L.sup.1 W29 4.9 12.7 14.3 14.8 14.8 7.8 31.5 46.3 61.0 62.3 ylHXK1 7.3 12.0 21.0 21.6 21.5 9.8 35.1 49.7 56.7 58.7 Y.sub.X/S g .Math. g.sup.1 W29 0.36 0.47 0.33 0.30 0.29 0.78 0.63 0.46 0.32 0.29 ylHXK1 0.49 0.44 0.42 0.32 0.33 0.98 0.70 0.50 0.31 0.27 CA g .Math. L.sup.1 W29 0.62 0.70 13.97 24.52 27.75 0 0 0 0 0 ylHXK1 0 0.15 2.89 5.11 3.99 0.18 0.07 1.25 3.71 5.50 Y.sub.CA/X g .Math. g.sup.1 W29 0.127 0.055 0.976 1.656 1.875 0 0 0 0 0 ylHXK1 0 0.013 0.138 0.237 0.186 0.018 0.002 0.025 0.065 0.094 Y.sub.CA/S g .Math. g.sup.1 W29 0.046 0.026 0.321 0.492 0.531 0 0 0 0 0 ylHXK1 0 0.005 0.058 0.076 0.061 0.018 0.001 0.013 0.020 0.026 Symbols: Xdry biomass, CAcitric acid, Y.sub.X/Syield of biomass from consumed substrate, Y.sub.CA/Syield of CA from consumed substrate, Y.sub.CA/Xyield of CA from dry biomass
[0211] Further analysis of FA production was performed using different fructose concentrations in the presence of 10 g.Math.L.sup.1 of peptones, which are routinely added to Y. lipolytica media to improve growth (
[0212] After the yeast had spent 120 h in 200 and 250 g.Math.L.sup.1 fructose, 26 and 48 g.Math.L.sup.1 of fructose remained in the medium, respectively, and after an additional 2 days of culture, the remaining sugar concentration was 19 and 36 g.Math.L.sup.1, respectively. Very little CA production was observed in this experiment (Table 8); even at the highest initial fructose concentrations, the yield of CA per unit substrate consumed only reached 2% and 2.6% (for 200 and 250 g.Math.L.sup.1 of initial fructose, respectively). The results obtained for FA production and sugar utilization, taken together with the length of culture in each experiment, suggest that a carbon source concentration of between 100 and 200 g.Math.L.sup.1 is the most promising for the optimization of lipid biosynthesis. This value was subsequently used for experiments involving bioreactor cultures.
[0213] 2.6. Effects of ylHXK1 Overexpression in a Strain Optimized for Fatty Acid Accumulation
[0214] Finally, we investigated the impact of ylHXK1 overexpression in a highly modified strain of Y. lipolytica W29 that was engineered to optimize its oil-production potential; these experiments were conducted in YNB medium containing 60 g.Math.L.sup.1 of carbon source, with a C/N ratio of 60 in order to maximize FA yield (as shown in the previous subsection; for details, see Materials a Methods). As a first step, the genes that encode acyl-coenzyme A oxidases (P0X1-6 genes) were deleted (Beopoulos et al., 2008); the resulting strain had an impaired ability to mobilize accumulated lipids through peroxisomal -oxidation. In Y. lipolytica, accumulated lipids are stored in specialized organelles called lipid bodies, mainly in the form of triacylglycerols (TAGs) (Daum et al., 1998; Mlickova et al., 2004; Athenstaedt et al., 2006). Fatty acids stored as TAGs can later be efficiently used by the cell through the activity of a lipase attached to the lipid bodies, which is encoded by ylTGL4 (Dulermo et al., 2013). A deletion of this gene was introduced in the pox1-6 background to inhibit TAG degradation. Additionally, to increase TAG biosynthesis, the major acyl-CoA: diacylglycerol acyltransferase-en coding gene (ylDGA2) was overexpressed (Beopoulos et al., 2012). Finally, ylGPD1 was overexpressed in order to increase production of glycerol-3-phosphate (Dulermo and Nicaud, 2011); the resulting strain was designated Y3501. All these modifications were then combined with hexokinase overexpression in order to optimize fructose utilization for lipid production. As one of the cheapest fructose-containing substrates is sucrose, we further modified this strain in order to enable utilization of this compound through extracellular hydrolysis, by introducing into the genome a modified cassette for the efficient expression of the S. cerevisiae invertase gene (Lazar et al., 2013). The strain resulting from all of these modifications was called strain Y4086 (Table 4).
[0215] To test lipid biosynthesis, batch cultures were grown in non-baffled Erlenmeyer flasks in YNB media that contained 60 g.Math.L.sup.1 of glucose, fructose, or sucrose as a carbon source at a C/N ratio of 60. Strain Y4086 produced around 15 g.Math.L.sup.1 of dry biomass in the sucrose-based medium, which was the highest concentration of biomass generated in this experiment (Table 9). The same strain produced almost 4 g.Math.L.sup.1 less biomass following cultivation in glucose or fructose. This result is probably due to the lower osmotic pressure in sucrose-based media, which allows cells to better adapt to culture conditions (Lazar et al., 2011). Strain Y4086 grown in the sucrose-based medium also generated the highest yield of biomass per unit substrate consumed; it was at least 50% higher than the yield obtained from the same strain grown in YNB medium containing either of the monosaccharides (Table 9).
TABLE-US-00009 TABLE 9 Parameters of FA, biomass and CA production of 96 h flask culture using Y. lipolytica Y3501 and Y4086 strains growing in YNB medium with glucose, fructose or sucrose (carbon source 60 g .Math. L.sup.1, C/N 60) Glucose Fructose Sucrose Parameters Y3501 Y4086 Y3501 Y4086 Y4086 X g .Math. L.sup.1 11.4 11.0 10.7 11.3 15.1 Y.sub.X/S g .Math. g.sup.1 0.19 0.18 0.19 0.20 0.30 FA g .Math. L.sup.1 3.20 2.76 2.26 2.58 4.43 Y.sub.FA/X g .Math. g.sup.1 0.281 0.250 0.212 0.228 0.294 Y.sub.FA/S g .Math. g.sup.1 0.053 0.046 0.041 0.045 0.087 CA g .Math. L.sup.1 0.25 0.18 0.18 0.27 1.00 Symbols: Xdry biomass, FAfatty acids, CAcitric acid, Y.sub.X/Syield of biomass from consumed substrate, Y.sub.FA/Syield of fatty acids from consumed substrate, Y.sub.FA/Xyield of fatty acids from dry biomass. SD of all analyzis did not exceed 5%.
[0216] Strain Y4086 grown in sucrose also produced the largest overall amount of FAs, as well as the best yield per unit biomass (4.43 g.Math.L.sup.1 and 0.294 g.Math.g.sup.1, respectively; Table 9). The same strain grown in YNB medium with either glucose or fructose produced significantly lower concentrations of lipids and lower yields. Additionally, in YNB fructose, only a very small improvement was observed in FA yield from biomass for strain Y4086 as compared to strain Y3501, whereas in YNB glucose, Y4086 actually performed worse in terms of Y.sub.FA/X than did Y3501 (Table 9). Thus, the significant improvement in lipid accumulation that we observed in the fructose-based medium between WT W29 and its ylHXK1 transformant (Y3573)the overexpression transformant contained 74% more FAswas not repeated by the highly modified Y4086 strain (which only produced 14% more FAs than did Y3501). In this case, it seems that lipid metabolism was limited by another factor that remains to be identified.
[0217] The sucrose-based medium also proved itself superior in terms of FA yield per unit substrate consumed (Table 9). The value for Y. lipolytica Y4086 grown in this medium, 0.087 g.Math.g.sup.1, was almost twice as high as that for cultures for which glucose or fructose was the sole carbon source (0.046 and 0.045, respectively). No significant differences were observed in FA yield for strain Y4086 grown in glucose versus fructose media; however, it is worth mentioning that the parental strain Y3501 produced 30% more FAs per unit substrate consumed in glucose-based medium than in fructose-based medium.
[0218] No significant concentrations of citric acid were observed at the end of the culture period for either of the Y. lipolytica strains (Table 9).
[0219] No significant differences were observed between the FA profiles of Y4086 and Y3501, but slight differences were observed between cultures of the same strain grown in YNB glucose versus fructose (Table 10). However, a comparison of Y4086 and Y3501 with W29 and the W29 ylHXK1 transformant revealed significant differences in the identities of the accumulated FAs (Table 7 and 10). The blocking of -oxidation and TAG hydrolysis, combined with the increased amount of G3P and TAG synthesis, reduced fatty acid elongation thus increasing C16:0 level in both glucose- and fructose-based media. Therefore meaning amount of C16:0 synthesized in the cytosol could be directly esterified into TAG and would not follow further elongation and desaturation in the endoplasmic reticulum.
TABLE-US-00010 TABLE 10 Fatty acid composition in Y. lipolytica strains growing 96 h in YNB medium with glucose, fructose or sucrose (carbon source 60 g .Math. L.sup.1, C/N 60) Glucose Fructose Sucrose Fatty acid Y3501 Y4086 Y3501 Y4086 Y4086 C16:0 23.75 22.90 25.06 23.54 24.10 C16:1(n-7) 7.32 7.16 8.38 7.23 6.71 C18:0 9.86 9.98 8.23 9.49 10.00 C18:1(n-9) 46.79 46.87 44.72 45.67 47.82 C18:2(n-6) 8.23 9.07 10.10 10.21 7.60 Others 4.05 4.03 3.52 3.86 3.76
[0220] 2.7. Bioreactor Studies
[0221] To investigate strain Y4086 (which had been optimized to produce lipids from sucrose) on a larger scale, bioreactor cultures were grown in YNB sucrose medium (
[0222] Strain Y3501 also demonstrated a slower rate of hydrolysis than did JMY2529, as the rate of the latter reached 2.50 g.Math.L.sup..Math.h.sup.1. Similar trends were observed for strain Y4086, in which sucrose hydrolysis was also delayed for 12 h compared to the invertase-overexpressing strain JMY2531, and its hydrolysis rate was likewise slower (in JMY2531 it has been reported to reach 7.63 g.Math.L.sup..Math.h.sup.1; Lazar et al., 2013). This discrepancy could be explained by the high level of genetic modification of Y3501 and Y4086, which may have resulted in these strains having slower metabolisms.
[0223] Both of these strains began to grow as soon as bioreactor culturing was initiated (
[0224] Conversely, strain Y3501 grew at a rate of 0.18 h.sup.1 and continued to grow until the end of the experiment. The final biomass of both strains was similar, around 34 g.Math.L.sup.1.
[0225] As the medium used for the bioreactor studies contained only low levels of nitrogen and nitrogen limitation plays an important role in both lipid accumulation and CA production, the concentration of both metabolites was analyzed. Strain Y4086 began to secrete CA into the medium at a rate of 1.06 g.Math.L.sup..Math.h.sup.1 after 36 h of culture (
[0226] As was mentioned above, the final biomass of both Y. lipolytica strains did not differ at the end of the experiment (it was around 34 g.Math.L.sup.1 for each; Table S3). However, a comparison of the yield of dry biomass per unit substrate consumed showed that Y. lipolytica Y3501 converted 50% more carbon into biomass than did strain Y4086. The final biomass production of Y. lipolytica Y4086 was 124% higher in the bioreactor culture as compared to the flask culture, likely as a consequence of the controlled bioreactor conditions; however, at the same time, the yield from substrate decreased by 25%. A search of the available literature regarding strains optimized for lipid production revealed that, in a strain of Y. lipolytica that overexpresses ACC1 and DGA1, 28.5 g.Math.L.sup.1 of biomass can be produced using 90 g.Math.L.sup.1 of glucose as a carbon source, with a yield from substrate of around 0.32 g.Math.g.sup.1 (Tai and Stephanopoulos, 2013). Another strain of Y. lipolytica that was highly modified for lipid biosynthesis produced around 20 g.Math.L.sup.1 of biomass using 80 g.Math.L.sup.1 of glucose as a carbon source, with a yield from substrate of 0.25 g.Math.g.sup.1 (Blazeck et al., 2014). These results suggest that, under conditions optimized for Y. lipolytica strain Y4086, a comparable concentration and yield of biomass could be obtained.
[0227] Additionally, as noted earlier, cell morphology played an important role in lipid accumulation (
[0228] Strain Y4086 produced significantly higher amounts of lipids than did strain Y3501 (Table 11). This improvement was seen in the increase of around 60% in the total lipids, FAs, and FA yield per unit biomass. Although the FA yield from biomass generated in the bioreactor cultures was lower than that generated in the flasks (26.2% and 29.4% respectively), the higher amount of biomass present in the bioreactors allowed for the production of almost 4.5 g.Math.L.sup.1 more total lipids. As described by Tai and Setphanopoulos (2013), a Push and Pull strategy involving the overexpression of ACC1 and DGA1 generated 0.617 g lipids per g biomass from cultures grown in 90 g.Math.L.sup.1 of glucose. This result is higher than that obtained in the current study for Y. lipolytica Y4086 grown in the sucrose-based medium (0.262 g.Math.g.sup.1; Table 11). However, the results of Blazeck et al. (2014) indicated that sucrose could be a potentially attractive substrate for lipid production. Through Nile red fluorescence measurements, the authors showed that their highly modified PO1f strain had optimal lipid production on glucose- and mannose-containing substrates, and they found similar results to those obtained here for Y. lipolytica W29. The use of fructose as a carbon source decreased lipid production by 35% (Blazeck et al., 2014), and as demonstrated here, W29 was characterized as the weakest of the Y. lipolytica WT strains examined here in terms of fructose utilization. Taken in the context of our results, it is possible that the reduction in lipid production in the fructose medium observed by Blazeck and colleagues derived from problems with hexokinase limitation, as PO1f is a derivative of W29 (Blazeck et al., 2014). Additionally, the strain created by Blazeck et al. (2014), which expresses the invertase gene under the XPR2 promoter, was limited in its ability to utilize sucrose. These two observations indicate that, in order to efficiently produce lipids from sucrose, rapid sucrose hydrolysis is important (and can be obtained by the overexpression of invertase under a TEF promoter), as is fast sugar phosphorylation (obtained via hexokinase overexpression).
TABLE-US-00011 TABLE 11 Parameters of Y. lipolytica Y3501 and Y4086 growing in YNB medium with sucrose during 96 h of the bioreactor process (sucrose concentration 150 g .Math. L.sup.1, C/N 60) Parameters Y3501 Y4086 X g .Math. L.sup.1 33.88 33.89 Y.sub.X/S g .Math. g.sup.1 0.36 0.24 Lipids g .Math. L.sup.1 5.76 9.15 FA g .Math. L.sup.1 5.45 8.89 Y.sub.FA/X g .Math. g.sup.1 0.161 0.262 Y.sub.FA/S g .Math. g.sup.1 0.057 0.063 CA g .Math. L.sup.1 42.39 64.15 Y.sub.CA/X g .Math. g.sup.1 1.13 1.78 Y.sub.CA/S g .Math. g.sup.1 0.44 0.46 Symbols: Xdry biomass, FAfatty acids, CAcitric acid, Y.sub.X/Syield of biomass from consumed substrate, Y.sub.FA/Syield of fatty acids from consumed substrate, Y.sub.FA/Xyield of fatty acids from dry biomass. SD of all analyzis did not exceed 5%.
[0229] In contrast to the results from the flask cultures, significantly higher amounts of CA were produced by Y. lipolytica strain Y4086 when it was grown in the bioreactors (Table 11). Up to 64 g.Math.L.sup.1 of CA was generated by this strain when it was grown in a bioreactor with 150 g.Math.L.sup.1 of sucrose, while it only produced 1 g.Math.L.sup.1 during the flask experiment in medium containing 100 g.Math.L.sup.1 of the same substrate (Table 9). The concentration of CA produced by strain Y4086 was 50% higher than that produced by strain Y3501, as was the yield from biomass; however, both strains converted similar amounts of sugar into CA (Y.sub.CA/S=0.44-0.46; Table 11). The conversion of sucrose into CA by Y4086 was only slightly lower than that by Y. lipolytica invertase-overexpressing strains JMY2529 and JMY2531, in which 0.50 g.Math.g.sup.1 and 0.58 g.Math.g.sup.1 were generated, respectively (Lazar et al., 2013). These results suggest that the parameters for lipid accumulation in bioreactor cultures for Y. lipolytica strain Y4086 remain to be optimized in order to reduce CA production.
3. CONCLUSIONS
[0230] As a step towards understanding alternative methods of biofuel production, the complex lipid metabolism of Y. lipolytica has become the target of many studies in recent years. In particular, much of this research seeks to decipher the de novo biosynthesis and accumulation of lipids within the cells of Y. lipolytica. In optimizing biolipid production by this yeast, it has become clear that the selection of substrates is of great importance. From an economic point of view, these substrates must be cheap and widely available, and such raw materials are often sought among industrial byproducts. One of these substrates is sucrose (table sugar), which is a major component of molasses. Although WT strains of Y. lipolytica are not able to utilize this saccharide, it has already been shown that genetically engineered strains that express S. cerevisiae invertase are able to use it by breaking it down into its constituent glucose and fructose molecules. In the present study, we investigated another problem connected to proper sucrose utilization, which is that Y. lipolytica strains differ significantly in terms of their ability to utilize fructose. We determined that impaired fructose assimilation in some strains can be successfully eliminated through the overexpression of the native hexokinase gene. This genetic modification improves not only growth and fructose uptake in Y. lipolytica, but also lipid production from fructose. As a result of the increased hexokinase activity, cells remain in yeast form throughout the culture period; transformant strains are thus able to produce bigger lipid bodies and accumulate more lipids than WT strains. In Y. lipolytica, combining hexokinase overexpression with other genetic modifications of the lipid metabolism process enabled the accumulation of 23% of FA from fructose by 1 g of dry biomass. However, the improvement in lipid production in this strain that resulted from hexokinase overexpression was not as dramatic as that observed between the ylHXK1 transformant (modified only in hexokinase expression) and its WT parental strains. This observation indicates that lipid metabolism in the highly engineered strain Y4086 encountered another limiting factor besides hexokinase activity, and this factor remains to be identified. Additionally, higher lipid accumulation was achieved when sucrose was used as a carbon source instead of its constituents (glucose and fructose); bioreactor cultures in the sucrose-based medium generated 9 g.Math.L.sup.1 of lipids. However, the preferential consumption of glucose over fructose remains a limiting factor that must be addressed in order to increase lipid productivity.
EXAMPLE 2
1. MATERIALS AND METHODS
[0231] 1.1. Strains, Media
[0232] Saccharomyces cerevisiae strain deleted for the hexose transporter EBY.VW4000 was used as recipient strain (hxt.sup.0; CEN.PK2-1 C hxt1-17 gal2::loxP stl1::loxP agt1::loxP mph2:loxP mph3::loxP) [Wieczorke et al., 1999]. Transformants containing Y. lipolytica putative transporters and control strains with empty vectors used in this study are listed in Table 12. Strains were grown at 28 C. on minimal media YNB maltose 2% supplemented with Histidine, Leucine, Tryptophan and Uracil when required. YNB medium for S. cerevisiae contained 6.5 g.Math.L-1 yeast nitrogen base (without amino acids and ammonium sulphate, Difco) and 10 g/L of (NH.sub.4).sub.2SO.sub.4. Tested carbon sources were added as indicated.
[0233] 1.2. Cloning of Transporter Genes
[0234] Potential Yarrowia lipolytica sugar transporters were identified from literature and BLAST search (Altschul et al., 1990). Among them, 24 genes named according to their systematic name in Gnolevures database (http://gryc.inra.fr/; formerly www.genolevures.org) were amplified using primers listed in Table 13 and genomic DNA from W29 or, H222 and A 101 when indicated (Table 12). PCR fragments were cloned in the centromeric plasmid pRS416 containing the ADH1 promoter (Mumberg et al., 1995), the 2 plasmid pRS426 containing the ADH1 promoter or pRS426 containing the strong TEF promoter (Mumberg et al., 1995) as indicated in Table 12. Plasmids were introduced into S. cerevisiae strain EBY.VW4000) (hxt.sup.0 using the LiAc transformation protocol and selected on minimal media YNB maltose 2% supplemented with Tryptophan, Histidine and Leucine. Presence of the corresponding gene in the transformants was verified by PCR.
TABLE-US-00012 TABLE13 Primersusedinthisstudy. Gene Gene systematic usual Primer SEQID name name type* Primersequence** RE** 44 A01958 Fwd GCGCACTAGTATGTTCTGGAAGAACATGAAAAATG SpeI 45 Rev GCGCAAGCTTTTAACAATTCTCCACATGAATAACAC HindIII 46 A08998 Fwd GCGCACTAGTATGAAGCTGTTTAAACGAGAAGC SpeI 47 Rev GCGCAAGCTTCTATCCACGAATAGTGGCACCTC HindIII 48 A14212 Fwd GCGCACTAGTATGTCAATCAAGTCGCTCTCAAAGG SpeI 49 Rev GCGCAAGCTTCTAGACACCATCTTTAGCAACCTTC HindIII 50 B00396 Fwd GAGAACTAGTATGTCGCACCGGCCCTGG SpeI 51 Rev GCGCAAGCTTTCACCTATCAGCATTTTCACCCATTTCC HindIII 52 B01342 YHT5 Fwd GCGCACTAGTATGTACAAGGTCCATAACCCCTACCTC SpeI 53 Rev GCGCAAGCTTTTAGACATGCTCAGTTCCAGGATAC HindIII 54 B06391 YHT6 Fwd GCGCACTAGTATGATTGGAAACGCTCAAATTAACC SpeI 55 Rev GCGCAAGCTTTTACAATTGAGAGGGAGGGGCGTCG HindIII 56 B17138 Fwd GCGCACTAGTATGAAAGACTTCCTCGCCTTCAC SpeI 57 Rev GCGCAAGCTTCTACGCTGTCTCGATTCGAAC HindIII 58 B21230 Fwd GCGCACTAGTATGTCGTCTATATCTTCGTCCCAGCAG SpeI 59 Rev GCGCAAGCTTCTACATGGTCCAAACCTCGGTAAAATTT HindIII CG 60 C04686 Fwd GCGCACTAGTATGTCGCTGGCTATCACCAAC SpeI 61 Rev GCGCAAGCTTTTAAGCTGGCTGAGTAGTGTTATTGG HindIII 62 C04730 Fwd GCGCACTAGTATGGGCTTCAGAGGCCAAAGAC SpeI 63 Rev GCGCAAGCTTTTAAACATGTCTGGTTTCCTCTTGATCA HindIII GAAG 64 C06424 YHT1 Fwd GCGCACTAGTATGGGACTCGCTAACATCATC SpeI 65 Rev GCGCAAGCTTCTAGACAGACTCAATGTAGACTGTCTGT HindIII CC 66 C08943 YHT2 Fwd GCGCGGATCCATGGCCATTATTGTGGCTGTATTTG BamHI 67 Rev GCGCATCGATCTAATCCGAATCAAATCCAGAATCG ClaI 68 C16522 Fwd GCGCACTAGTATGAAGCTACAAGTACCCGCGTTTG SpeI 69 Rev GAGAGTCGACTCACTGAAACTCGGCCGAATC SalI 70 D00132 Fwd GCGCACTAGTATGGTTTTTGGACGAGAAAAAGAC SpeI 71 Rev GCGCAAGCTTTTAAACGAACTCGGCAGTG HindIII 72 D00363 Fwd GCGCACTAGTATGTTCTGGAAAAACATGAAGAATGAG SpeI 73 Rev GAGAGTCGACCTAACAGGTCTCCACGTGAAC SalI 74 D01111 Fwd GCGCACTAGTATGGGACGAAACTGGCTAG SpeI 75 Rev GCGCCCCGGGTTAAGCTTGAGAAACGTTCTCAAAAG XmaI 76 D18876 Fwd GCGCACTAGTATGTTCTGGAAAAATATGAAGAATG SpeI 77 Rev GCGCAAGCTTCTAACACGACTCCACCATC HindIII 78 E20427 Fwd GCGCACTAGTATGTCCGGGCAGACATATATAG SpeI 79 Rev GAGAGTCGACCTAGCAGTTCTCCACATGG SalI 80 E23287 YHT4 Fwd GCGCACTAGTATGGCGAGGCTTTGTCTTTC SpeI 81 Rev GCGCAAGCTTTTAAACAGTCTCGGTGTACTGAGG HindIII 82 F06776 Fwd GCGCACTAGTATGTTTTCGTTAACGGGCAAACC SpeI 83 Rev GCGCAAGCTTTTATACCGGAGGTTGAGGGAAGTC HindIII 84 F18084 Fwd GCGCACTAGTATGTCTTCCTATCCATCCGAGAAG SpeI 85 Rev GAGTAAGCTTTTAAGCAAGCTCCGCCGTGTG HindIII 86 F19184 YHT3 Fwd GCGCGGATCCATGTCCACTAGTGCTATGAC BannHI 87 Rev GCGCAAGCTTCTAAGAGGACTCGGAGAAGTC HindIII 88 F23903 Fwd GCGCGGATCCATGTCGCTGGACAAAAACC BamHI 89 Rev GCGCAAGCTTCTACTTCTTGTAGCCTCTCTTGG HindIII 90 F25553 Fwd GCGCACTAGTATGATACTTTTTTGGTTACACAGAGGCG SpeI TCTTC 91 Rev GCGCAAGCTTTTATTGATGAGTGGTGGTGTCGGGGTA HindIII C 92 C06424- YHT1.sub.H- Fwd CAGTTTGCCGTCACCATTGGTCTTCTGC I162V 93 I162V 162V Rev GCAGAAGACCAATGGTGACGGCAAACTG 94 F19184- YHT3.sub.H- Fwd CCAGCTGTTTGTTACTCTCGGCATCTTC I181V 95 I181V 181V Rev GAAGATGCCGAGAGTAACAAACAGCTGG * Abreviations: Fwd: forward; Rev: revese. ** Restriction site introduced for cloning are undelined and base changes to introduce the mutation for the amino acid exchange are boled. To simplify in the table the systematic name for the putative transporter were names according to Gnolevures nomenclature (Durrens, P., Sherman, D. J. (2005)) without YALI0, e.g. YALI0A01958 are named A01958. YHT genes were amplified from the Y. lipolytica wild-type W29 or from the wild-type H222 for the variants of the isoleucine 162/181 altered to valine for YHT1.sub.H-162V and YHT3.sub.H-181V, respectively.
[0235] 1.3. Site-Directed Mutagenesis.
[0236] Mutations were inserted into H222 C06424 (YHT1.sub.H) and F19184 transporter (YHT3.sub.H) by site-directed PCR mutagenesis. First, 5 and 3 fragments (Yhtx-a and Yhtx-b, respectively) were amplified with primer pairs Fwd/Mut-rev and Mut-fwd/Rev, respectively, using the Pyrobest polymerase (TaKaRa). The two mutagenesis primers covered the target codon and the neighboring 15-20 nucleotides and were directed in opposing directions (forward and reverse). The two fragments were then used as templates in PCR fusion with flanking primers pairs fwd/rev to produce the full-length YHT variant (Table 13).
[0237] YHT1.sub.H-161V allele encoding the mutated C06424 gene from H222 for the Isoleucine 161 was constructed as follows. First, YHT1-a and YHT1-b fragments were amplified with primer pairs (C06424-fwd/C064241161Vmut-rev) and (C06424-rev/C064241161Vmut-fwd). The second PCR fusion contained the two fragments with primer pair C06424-fwd/C06424-rev to produce the full-length YHT1.sub.H-161V allele. YHT3.sub.H-181V allele encoding the mutated F19184 gene for the Isoleucine 181 was amplifies similarly with specific primers (Table 13) giving rise to the YHT3.sub.H-181V allele.
[0238] 1.4. Sugar Utilisation Test.
[0239] The S. cerevisiae transformants were grown at 30 C. for 24 h in the minimal media YNB maltose 2% three time successively in order to increase and standardize the plasmid copy number. For drop test, exponentially growing cells were centrifuged, washed twice with water and re-suspended to an optical density OD.sub.600 of 1. Successive 10-fold dilutions were performer (10.sup.0-10.sup.5) and 5 l of each dilution were spotted onto YNB plate containing various sugar (glucose, fructose, mannose and galactose) and at different concentration (0.1 to 2% as indicated in the text or in figure legend).
[0240] 1.5. Growth in Microtiter Plates
[0241] Yeast strains were grown in 96-well plates in 200 l of minimal YNB medium containing either 1% glucose, 1% fructose or mixture of glucose and fructose (0,5% each). Precultures were obtained from frozen stocks, inoculated into tubes containing 5 mL YNB maltose 2% medium, and cultured for 24 h (170 rpm, 28 C.). Precultures were then centrifuged washed with sterile distilled water and their concentrations were standardized to an OD.sub.600 of 0.1. This analysis was conducted three times, with 2-3 replicates per plate for each condition. Cultures were maintained at 28 C. under constant agitation with a Biotek Synergy MX microtiter plate reader (Biotek Instruments, Colmar, France); each culture's optical density at 600 nm was measured every 20 min for 72 h.
[0242] 1.6. Media and Growth for Sugar Utilization Experiment in Flask
[0243] For sugar utilization in minimal media, cultures were prepared as follows: an initial preculture was established by inoculating 50 mL of YNB maltose 2% medium in 250-mL Erlenmeyer flasks; this was followed by an overnight shaking step at 28 C. and 170 rpm. The resulting cell suspension was washed three times with sterile distilled water and used to inoculate 50 mL of the main culture containing 1% of glucose, fructose or mixture of those sugars. Each culture was incubated, with shaking in 250-mL Erlenmeyer flasks, at 28 C. and 170 rpm during 72 h, or until all available sugar had been consumed. Samples for analysis were taken every 12 h.
[0244] 1.7. Sugar Concentration Measurement
[0245] Glucose and fructose were identified and quantified by HPLC (UltiMate 3000, Dionex-Thermo Fisher Scientific, UK) using an Aminex HPX87H column coupled to UV (210 nm) and RI detectors. The column was eluted with 0.01 N H.sub.2SO.sub.4 at room temperature and a flow rate of 0.6 mL.Math.min.sup.1. Identification and quantification were achieved via comparisons to standards. Before being subject to HPLC analysis, samples were filtered on 0.45-m pore-size membranes.
2. RESULTS
[0246] 2.1. Identification of putative Y. lipolytica hexose transporters.
[0247] Yarrowia lipolytica genome of strain E150 was determined 10 years ago by the Gnolevures consortium (Dujon et al, 2004). Genome analysis shows that the GL3C0002 family coding for putatif sugar transporters contained 23 members from Yarrowia. This family contains the well known S. cerevisiae Hxt7 hexose transporter.
[0248] Little information has been reported for Y. lipolytica transporters (Young et al., 2011; Yong et al., 2014). The only report during this study was from Alper and coworkers which, during a survey on yeast sugar transporter preference, analysed the sugar preference of 6 members of this family, namely B01342, B06391, C06424, C08943, D00132 and F06776. These transporters were expressed in ARS plasmid (p414-TEF, CEN6/ARS4 origin; see Mumberg et al., 1995) under the control of the constitutif TEF promoter and transformed into S. cerevisiae strain EX12. Limited growth was observed only for C06424 with a growth rate depending on sugar tested of about 0.05-0.06 compared to 0.03-0.05 for the empty vector and 0.191, 0.254 and 0.278 for EX12 expressing S. cerevisiae Hxt7 on glucose, fructose and mannose, respectively (Young et al. 2014). Thus suggesting that only the Y. lipolytica C06424 transporter could transport glucose, galactose and manose but not fructose.
[0249] 2.2. Functional Characterisation of Putative Y. Lipolytica Hexose Transporters in the S. Cerevisiae Heterologous Host by Drop Tests.
[0250] For the characterization and screening of putative sugar transporters, the hexose deficient Saccharomyces cerevisiae hxt.sup.0 strain EBY.VW4000 developed by Boles E. and coworker (Wieczorke et al., 1999) is wildly used. This strain lacks all 20 transporter genes (HXT1-17, GAL2, AGT1, MPHs) required for hexose uptake which prevents growth of glucose, fructose, mannose and galactose, thus allowing assessment of the function of heterologous transporters.
[0251] First, among the Y. lipolytica putative transporters, the three closest genes to S. cerevisiae HXT7 transporters, C06424 (YHT1), C08943 (YHT2) and F19184 (YHT3) were amplified from strain W29 and cloned into the replicative ARS plasmid pRS416 under the ADH1 promoter. Only the transformants carrying YHT1 present very slow growth on glucose plate while no growth could be observed for the transformants carrying YHT2 or YHT3 (data not shown) being slightly lower than that observed by the Alper group (Young et al, 2014). In addition no growth was observed for the three genes on fructose. This lack of efficient growth may result from low expression of the Y. lipolytica genes in S. cerevisiae or due to polymorphism in the corresponding gene in strain W29 used for the amplification. Therefore, the genes were amplified also using H222 and A-101 genomic DNA and cloned into 2 based plasmids pRS426 either under the ADH1 and the TEF promoter. For strain harboring YHT1, the TEF promoter enables better growth than the ADH1 promoter which remain limited (
[0252] Similar promoter-dependent growth was observed on fructose plates. This confirmed that both strong transporter expression and the use of 2 based plasmid were required to observe growth complementation of S. cerevisiae strain EBY.VW4000.
[0253] Since that growth on fructose differed depending on strain origin, we hypothesized that this may also be due to differences of the fructose transport in addition to hexokinase defect. Therefore, the YHT1 and YHT2 genes were also amplified using H222 genomic DNA and YHT3 was amplified from both H222 and A-101 genomic DNA and will be named YHTX.sub.W, YHX.sub.H and YHTX.sub.A, respectively. Growth complementation with the different alleles shown in
[0254] Second, we extended the functional analysis by amplification and cloning 20 additional putative transporters from Y. lipolytica W29 and 11 from H222 into the 2 plasmid pRS426 under the TEF promoter as described in Table 13. The corresponding strains are described in Table 12. Growth of transformants on 2% maltose was tested to verify the absence of growth defect induced by overexpression of hexose transporters (
[0255] Growth of transformants was tested on four sugars; glucose, fructose, mannose and galactose at four different concentrations, 0.1 to 2% (
[0256] Four of them allowed growth on glucose; B01342, C06424, E23287 and F19184 and were designated YHT5, YHT1, YHT4 and YHT3 respectively (Table 1). However, while YHT1.sub.H and YHT1.sub.W are functional, YHT5 did not allowed efficient growth on glucose and YHT3.sub.W requires high glucose concentration for complementation.
[0257] The Yht2 transporter allowed growth on fructose, better at low concentration, independently to the allele used. While for the YHT3 transporter, complementation is clearly depending on the allele used, YHT3.sub.W confers reduced growth on fructose compared to the YHT3.sub.H and YHT3.sub.A.
[0258] At least one other protein of the putative transporter could sustain hexose transport in the host S. cerevisiae. D01111 was found to complement the HXT-deficient EBY.VW4000 strain only for glucose uptake and resulted in a weak growth compared to that provided by YHT genes.
[0259] 2.3. Functional Characterisation of Putative Y. Lipolytica Hexose Transporters in the S. Cerevisiae Heterologous Host in Liquid Media.
[0260] To further characterize putative Y. lipolytica transporters, growth of transformants was analysed in liquid media in 96 well microplate on glucose, fructose and glucose-fructose mixture. Representative curves for five YHT of Y. lipolytica H222 strain are presented in
[0261] 2.4. Growth and Sugar Consumption by the S. Cerevisiae Heterologous Host.
[0262] Previous report of invertase overexpression in Y. lipolytica shows the preferred consumption of glucose over fructose, suggesting an inhibition of fructose utilisation by glucose (Lazar et al, 2013). Thus growth and sugar consumption was monitored during growth in fructose media depending on glucose concentration in flasks (
[0263] As for Biotek experiments, no growth was observed for C04730 and A08998. In the case of YHT4 (E23287), the low growth on fructose could be improved by addition of small amounts of glucose, confirming its substrate preference for glucose. By contrast, growth of EBY.VW4000 overexpressing YHT1 (C06424) on fructose is inhibited by increasing amounts of glucose. Additionally, the highest OD.sub.600 was reached by EBY.VW4000 overexpressing YHT3 (F19184). In all conditions growth profiles are similar.
[0264] Several of categories of transporter could be identified by analyzing sugar consumption. In this experiment, A08998 and C04730 showed no capacity to transport glucose or fructose. Yht1 (C06424), Yht4 (E23287), and Yht3 (F19184) are able to uptake glucose and fructose. For the former two, presence of glucose highly delays fructose utilization, whereas YHT3 (F19184) shows only slightly delayed fructose consumption if not concomitant with glucose (
[0265] The time course of residual sugars in the medium was examined. This reflects the consumption of fructose and glucose for S. cerevisiae cells expressing each of the identified fructose transporters (Yht1 to 4; the most efficient Yht3.sub.H222 was chosen), grown in the presence of fructose (10 g.Math.L.sup.1) and varying concentrations of glucose.
[0266] First, fructose utilization appeared to be impeded by glucose in presence of equal amount of both sugars, whatever the transporter being expressed, including Yht2 which is not able to promote glucose uptake and Yht1 which seems to transport glucose alone less efficiently than fructose. Conversely the presence of fructose did not preclude the uptake of glucose for none of the Yht1, Yht3H222 or Yht4 transporters (Yht2 is not able to internalize glucose).
[0267] Second, lowering glucose concentration in the medium (5 g.Math.L.sup.1 or 1 g.Math.L.sup.1 at start of the culture, or in the course of cultivation through glucose consumption) relieved the inhibition exerted on fructose consumption. When Yht4 was expressed, this relief occurred for a remaining glucose concentration under about 0.8 g.Math.L.sup.1. For Yht1, slopes of residual fructose in the medium actually suggest that glucose may be competing with fructose uptake in a rate positively proportional to its concentration in the medium rather than inhibitory in a threshold manner. Consumption of fructose by Yht3-expressing cells is unique since it is merely slightly delayed in the presence of external glucose over 4-5 g.Math.L-land no competition with glucose was evidenced below this concentration.
3 FUNCTIONAL ANALYSIS IN Y. LIPOLYTICA
[0268] 3.1 Deletion Analysis of YHT Genes
[0269] To identify the main transporters involved in growth of Y. lipolytica on fructose, derivatives of W29 carrying individual disruptions of the YHT genes promoting fructose transport (YHT1 to 4) or combination thereof, were constructed. Growth tests were performed in a microplate reader or as drop-test assays on plates in YNB minimal medium supplemented with individual sugars (fructose, glucose and mannose; galactose was not tested due to the inability of WT Y. lipolytica to grow on this sugar).
[0270] The single yht1 mutant displayed a significant phenotype in fructose. At 1 g.Math.L.sup.1 of fructose, the sole YHT1 disruption was sufficient to prevent growth of Y. lipolytica, showing the essential role of this single gene in the uptake of fructose at low concentration. At 10 g.Math.L.sup.1, an unexpected phenotype was observed, as the yht1 mutant grew more robustly than the WT strain. No particular phenotype was observed in glucose or mannose. Transformation of yht1 by YHT1 restored WT growth on fructose.
[0271] Deletion of YHT2 or YHT3 alone had no detectable effect on growth, neither in fructose nor in glucose. Moreover, strains carrying double mutations of YHT2 and YHT1 or of YHT3 and YHT1 showed the same phenotypes as the single yht1 mutant.
[0272] Likewise, the single yht4 mutant exhibited no significant growth alteration compared to the WT strain. However the combination of this deletion with the yht1 mutation led to a growth defect in fructose, glucose and mannose. The double deletion of YHT1 and YHT4 was sufficient to abolish growth on fructose at all tested concentrations from 1 to 10 g.Math.L.sup.1. Growth on glucose was also severely affected in the double yht1 yht4 mutant. However, residual growth could sporadically outcome as filamentous-type colonies on YNB glucose plates after incubation for several days as well as very delayed growth in microplates. Moreover growth on mannose was also abolished in the double yht1 yht4 mutant showing that the two encoded transporters are necessary and sufficient for hexose transport in laboratory conditions for Y. lipolytica.
[0273] 3.2 Transcription of YHT Genes
[0274] The transcription profiles of the YHT genes and D01111 in WT genetic backgrounds were investigated.
[0275] A first RT-PCR analysis was carried out during growth of W29 and H222 in minimal medium supplemented with the sole fructose at 1 g.Math.L.sup.1 or 10 g.Math.L.sup.1. Transcription profiles were very similar for both natural isolates (
[0276] In a second analysis, we investigated the transcription of YHT and D01111 genes in the complex environment of a bioreactor in which cells were grown in sucrose medium. The W29 and H222 derivatives used here were equipped with an efficient invertase expression cassette (Lazar et al., 2013). The continuous hydrolysis of sucrose by the secreted enzyme and uptake of the monosaccharides by the cells generated changing concentrations of glucose and fructose in the medium that could be followed by HPLC. This provided an interesting environment to study whether the expected delayed uptake of fructose (in the presence of glucose) could be related to transporter gene expression.
[0277] We could observe early raising concentrations of glucose and fructose, due to sucrose hydrolysis faster than uptake of released sugars. The uptake of glucose started from the beginning of cultivation whereas fructose was consumed only after glucose depletion (W29) or shortening (H222).
[0278] The transcription profiles, which are similar for the two strains, could be divided into two classes of transporter genes. The first one includes YHT1, YHT4 and D01111 whose transcripts are detected continuously during cultivation. YHT5 could be a particular case whose transcripts although continuously detected, apparently increased at the beginning of stationary phase. The second one comprises YHT2, YHT3 and YHT6 whose transcripts are detected essentially at stationary phase. Altogether transcripts were detected for all 7 genes (YHT1-6 and D01111) in both strains at entry to stationary phase after glucose depletion, transiently or not. This was also true for other genes of the SP family picked at random.
[0279] In conclusion, the RT analysis confirmed that Yht1 and Yht4 are major hexose transporters involved in fructose uptake in Y. lipolytica. It suggested that Yht5 and/or D01111 might be responsible for the residual fastidious growth sporadically observed on glucose in the yht1-4 mutant strain. In addition, this analysis showed that inhibition of transcription of transporter gene for fructose uptake is not the molecular basis for glucose over fructose preference. Conversely, the better detection of transcripts of D01111 in the complex bioreactor environment suggests a possible induction of the gene by sucrose or glucose.
REFERENCES
[0280] Altschul S F, Gish W, Miller W, Myers E W, Lipman D J: Basic local alignment search tool. J Mol Biol 1990, 215(3):403-410.
[0281] Athenstaedt K, Jolivet P, Boulard C, Zivy M, Negroni L, Nicaud J M, Chardot T. 2006. Lipid particle composition of the yeast Y. lipolytica depends on the carbon source. Proteomics. 6: 1450-1459.
[0282] Barth G, Gaillardin C. 1996. Y. lipolytica. In: Wolf K (ed.). Non conventional yeasts in biotechnology, a handbook. Springer. p. 313-388.
[0283] Beopoulos A, Mrozova Z, Thevenieau F, Dall M T, Hapala I, Papanikolaou S, Chardot T, Nicaud J M. 2008. Control of lipid accumulation in the yeast Y. lipolytica. Applied Environmental Microbiology. 74: 7779-7789.
[0284] Beopoulos A, Cescut J, Haddouche R, Uribelarrea J L, Molina-Jouve C, Nicaud J M. 2009. Y. lipolytica as a model for bio-oil production. Progress in Lipid Research. 48: 375-387.
[0285] Beopoulos A, Haddouche R, Kabran P, Dulermo T, Chardot T, Nicaud J M. 2012. Identification and characterization of DGA2, an acyltransferase of the DGAT1 acyl-CoA:diacylglycerol acyltransferase family in the oleaginous yeast Y. lipolytica. New insights into the storage lipid metabolism of oleaginous yeasts. Applied Microbiology and Biotechnology. 93(4): 1523-1537.
[0286] Blazeck J, Hill A, Liu L, Knight R, Miller J, Pan A, Otoupal P, Alper H S. 2014. Harnessing Y. lipolytica lipogenesis to create a platform for lipid and biofuel production. Nature Communications. DOI: 10.1038/ncomms4131.
[0287] Browse J, McCourt P J, Somerville C R. 1986. Fatty acid composition of leaf lipids determined after combined digestion and fatty acid methyl ester formation from fresh tissue. Analytical Biochemistry. 152: 141-145.
[0288] Coelho M A Z, Amaral P F F, Belo I. 2010. Y. lipolytica: an industrial workhorse. In: Mndez-Villas A (ed). Current Research, Technology and Education Topics in Applied Microbiology and Microbial Biotechnology. Vol. 2. Formatex, Badajoz, p 930.
[0289] Daum G, Lees N D, Bard M, Dickson R. 1998. Biochemistry, cell biology and molecular biology of lipids of S. cerevisiae. Yeast. 14: 1471-1510.
[0290] da Silva P C, Horii J, Santos Miranda V, Gallera Brunetto H, Ceccato-Antonini S R. 2007. Characterization of industrial strains of S. cerevisiae exhibiting filamentous growth induced by alcohols and nutrient deprivation. World Journal of Microbiology and Biotechnology. 23: 697-704.
[0291] Dujon B, Sherman D, Fischer G, Durrens P, Casaregola S, Lafontaine I, De Montigny J, Marck C, Neuveglise C, Talla E, Goffard N, Frangeul L, Aigle M, Anthouard V, Babour A, Barbe V, Barnay S, Blanchin S, Beckerich J M, Beyne E, Bleykasten C, Boisrame A, Boyer J, Cattolico L, Confanioleri F, De Daruvar A, Despons L, Fabre E, Fairhead C, Ferry-Dumazet H, Groppi A, Hantraye F, Hennequin C, Jauniaux N, Joyet P, Kachouri R, Kerrest A, Koszul R, Lemaire M, Lesur I, Ma L, Muller H, Nicaud J M, Nikolski M, Oztas S, Ozier-Kalogeropoulos O, Pellenz S, Potier S, Richard GF, Straub M L, Suleau A, Swennen D, Tekaia F, Wesolowski-Louvel M, Westhof E, Wirth B, Zeniou-Meyer M, Zivanovic I, Bolotin-Fukuhara M, Thierry A, Bouchier C, Caudron B, Scarpelli C, Gaillardin C, Weissenbach J, Wincker P, Souciet J L. 2004. Genome evolution in yeasts. Nature. 430(6995): 35-44.
[0292] Dulermo T, Nicaud J M. 2011. Involvement of the G3P shuttle and -oxidation pathway in the control of TAG synthesis and lipid accumulation in Y. lipolytica. Metabolic engineering. 13(5): 482-491.
[0293] Dulermo T, Trton B, Beopoulos A, Kabran Gnankon A P, Haddouche R, Nicaud J M. 2013. Characterization of the two intracellular lipases of Y. lipolytica encoded by TGL3 and TGL4 genes: new insights into the role of intracellular lipases and lipid body organisation. Biochimica and Biophysica Acta. 1831(9): 1486-1495.
[0294] Durrens, P., Sherman, D. J. 2005. A systematic nomenclature of chromosomal elements for hemiascomycete yeasts. Yeast 22(5), 337-342.
[0295] Dyer J M, Chapital D C, Kuan J W, Mullen R T, Pepperman A B. 2002. Metabolic engineering of S. cerevisiae for production of novel lipid compounds. Applied Microbiology and Biotechnology. 59(2-3): 224-230.
[0296] Ernandes J R, De Meirsman C, Rolland F, Winderickx J, de Winde J, Brandao R L, Thevelein J M. 1998. During the initiation of fermentation overexpression of hexokinase PII in yeast transiently causes a similar deregulation of glycolisys as deletion of Tps1. Yeast. 14(3): 255-269.
[0297] Fickers P, Le Dall M T, Gaillardin C, Thonart P, Nicaud J M. 2003. New disruption cassettes for rapid gene disruption and marker rescue in the yeast Y. lipolytica. Journal of Microbiological Methods. 55: 727-737.
[0298] Fickers P, Nicaud J M, Destain J, Thonart P. 2005a. Involvement of hexokinase Hxk1 in glucose catabolite repression of LIP2 encoding extracellular lipase in the yeast Y. lipolytica. Current Microbiology. 50(3): 133-7.
[0299] Fickers P, Benetti P H, Wach Y, Marty A, Mauersberger S, Smit M S, Nicaud J M. 2005b. Hydrophobic substrate utilisation by the yeast Y. lipolytica, and its potential applications. FEMS Yeast Research. 5:527-543.
[0300] Folch J, Lees M, Sloane-Stanley G H. 1957. A simple method for the isolation and purification of total lipides from animal tissues. Journal of Biological Chemistry. 226: 497-509.
[0301] Gaillardin C, Ribet A M. 1987. LEU2 directed expression of -galactosidase activity and phleomycin resistance in Y. lipolytica. Current Genetics. 11: 369-375.
[0302] Groenewald M, Boekhout T, Neuvglise C, Gaillardin C, van Dijck P W M, Wyss M. 2014. Y. lipolytica: Safety assessment of an oleaginous yeast with a great industrial potential. Critical Reviews in Microbiology. 40(3): 187-206.
[0303] Guillaume C, Delobel P, Sablayrolles J M, Blondin B. 2007. Molecular Basis of Fructose Utilization by the Wine Yeast S. cerevisiae: a Mutated HXT3 Allele Enhances Fructose Fermentation. Applied and Environmental Microbiology, 73(8): 2432-2439.
[0304] Gysler C, Kneuss P, Niederberger P. 1990. Transformation of commercial baker's yeast strains by electroporation. Biotechnol Tech 4: 285-290.
[0305] Herrero A B, Lpez M C, Fernandez-Lago L, Dominguez A. 1999. Candida albicans and Y. lipolytica as alternative models for analysing budding patterns and germ tube formation in dimorphic fungi. Microbiology. 145: 2727-2737.
[0306] Hoess R H, Abremski K. 1985. Mechanism of strand cleavage and exchange in the Cre-lox site-specific recombination system. J Mol Biol. 181(3): 351-362.
[0307] Hurtado C A, Rachubinski R A. 1999. MHY1 encodes a C2H2-type zinc finger protein that promotes dimorphic transition in the yeast Y. lipolytica. Journal of Bacteriology. 181: 3051-3057.
[0308] Ito H, Fukuda Y, Murata K, Kimura A. 1983. Transformation of intact yeast cells treated with alkali cations. Journal of Bacteriololy. 153: 163-168.
[0309] Klebe R J, Harriss J V, Sharp Z D, Douglas M G. 1983. A general method for polyethylene-glycol-induced genetic transformation of bacteria and yeast. Gene. 25(2-3): 333-341.
[0310] Kurat et al. 2006. Obese yeast: triglyceride lipolysis is functionally conserved from mammals to yeast. Journal of Biological Chemistry 281: 491-500.
[0311] Lazar Z, Walczak E, Robak M. 2011. Simultaneous production of citric acid and invertase by Y. lipolytica SUC.sup.+ transformants. Bioresource Technology. 102(13): 6982-6989.
[0312] Lazar Z, Rossignol T, Verbeke J, Crutz-Le Coq A M, Nicaud J M, Robak M. 2013. Optimized invertase expression and secretion cassette for improving Y. lipolytica growth on sucrose for industrial applications. Journal of Industrial Microbiology and Biotechnology. 40(11): 1273-1283.
[0313] Leandro, M. J., Fonseca, C. and Goncalves, P. 2009. Hexose and pentose transport in ascomycetous yeasts: an overview. FEMS Yeast Research, 9: 511-525.
[0314] Le Dall M T1, Nicaud J M, Gaillardin C. 1994. Multiple-copy integration in the yeast Yarrowia lipolytica. Curr Genet. 26(1): 38-44.
[0315] Liccioli T, Chambers P J, Jiranek V. 2011. A novel methodology independent of fermentation rate for assessment of the fructophilic character of wine yeast strains. Journal of Industrial Microbiology and Biotechnology. 38(7): 833-43.
[0316] Mauersberger S, Wang H J, Gaillardin C, Barth G, Nicaud J M. 2001. Insertional mutagenesis in the n-alkane-assimilating yeast Y. lipolytica: generation of tagged mutations in genes involved in hydrophobic substrate utilization. Journal of Bacteriology. 183: 5102-5109.
[0317] Madzak C, Trton B, Blanchin-Roland S. 2000 Strong hybrid promoters and integrative expression/secretion vectors for quasi-constitutive expression of heterologous proteins in the yeast Yarrowia lipolytica. J. Mol. Microbiol. Biotechnol., 2(2): 207-216.
[0318] Madzak C, Gaillardin C, Beckerich J M. Heterologous protein expression and secretion in the non-conventional yeast Yarrowia lipolytica: a review. 2004 Journalof Biotechnology, 109(1-2): 63-81.
[0319] Maftahi M, Gaillardin C, Nicaud J M. 1996 Sticky-end polymerase chain reaction method for systematic gene disruption in Saccharomyces cerevisiae. Yeast. 12(9): 859-868.
[0320] Michely S, Gaillardin C, Nicaud J M, Neuvglise C. 2013. Comparative physiology of oleaginous species from the Yarrowia clade. PLOS one. 8(5): e63356 (1-10).
[0321] Miroczuk A M, Furgata J, Rakicka M, Rymowicz W. 2014. Enhanced production of erythritol by Y. lipolytica on glycerol in repeated batch cultures. Journal of Industrial Microbiology and Biotechnology. 41 (1): 57-64.
[0322] Mlickova K, Roux E, Athenstaedt K, d'Andrea S, Daum G, Chardot T, Nicaud J M. 2004. Lipid accumulation, lipid body formation, and acyl coenzyme a oxidases of the yeast Y. lipolytica. Applied and Environmental Microbiology. 70: 3918-3924.
[0323] Moeller L, Zehnsdorf A, Aurich A, Barth G, Bley T, Strehlitz B. 2012. Citric acid production from sucrose by recombinant Y. lipolytica using semicontinuous fermentation. Engineering in Life Sciences. 13(2): 163-171.
[0324] Mller S, Sandal T, Kamp-Hansen P, Dalbge H. 1998. Comparison of expression systems in the yeasts S. cerevisiae, Hansenula polymorpha, Kluyveromyces lactis, Schizosaccharomyces pombe and Y. lipolytica. Cloning of two novel promoters from Y. lipolytica. Yeast. 14 (14):1267-1283.
[0325] Mumberg D, Mller R, Funk M. 1995. Yeast vectors for the controlled expression of heterologous proteins in different genetic backgrounds. Gene 156(1): 119-122.
[0326] Nicaud J M, Fabre E, Gaillardin C. 1989. Expression of invertase activity in Y. lipolytica and its use as a selective marker. Current Genetics. 16(4): 253-260.
[0327] Orr-Weaver T L, Szostak J W, Rothstein R J. 1981 Yeast transformation: a model system for the study of recombination. Proc Natl Acad Sci USA. 78(10): 6354-6358.
[0328] Petit T, Gancedo C. 1999. Molecular Cloning and Characterization of the Gene HXK1 Encoding the Hexokinase from Y. lipolytica. Yeast. 15: 1573-1584.
[0329] Querol A, Barrio E, Huerta T, Ramon D. 1992. Molecular monitoring of wine fermentations conducted by active dry yeast strains. Applied and Environmental Microbiology, 58: 2948-2953.
[0330] Reifenberger et al. 1995. Yeast. 11: 5457.
[0331] Rywiska A, Rymowicz W. 2010. High-yield production of citric acid by Y. lipolytica on glycerol in repeated-batch bioreactors. Journal of Industrial Microbiology and Biotechnology. 37 (5): 431-435.
[0332] Rywiska A, Rymowicz W, arowska B, Skrzypiski A. 2010. Comparison of citric acid production from glycerol and glucose by different strains of Y. lipolytica. World Journal of Microbiology and Biotechnology. 26: 1217-1224.
[0333] Sambrook J, Russell D W. 2001. Molecular Cloning: A laboratory manual, 3rd ed, Cold Spring Harbor Laboratory Press, New York.
[0334] Sauer B. 1987. Functional expression of the cre-lox site-specific recombination system in the yeast Saccharomyces cerevisiae. Mol Cell Biol. 7(6): 2087-2096.
[0335] Schmittgen T D, Livak K J. 2008. Analyzing real-time PCR data by the comparative CT method. Nature Protocols. 3(6): 1101-1108.
[0336] Tai M, Stephanopoulos G. 2013. Engineering the push and pull of lipid biosynthesis in oleaginous yeast Y. lipolytica for biofuel production. Metabolic engineering. 15: 1-9.
[0337] Thevenieau F, Le Dall M T, Nthangeni B, Mauersberger S, Marchal R, Nicaud J M. 2007. Characterization of Yarrowia lipolytica mutants affected in hydrophobic substrate utilization. Fungal Genet Biol. 44(6): 531-542.
[0338] Van de Velde S, Thevelein J M. 2008. Cyclic AMP-Protein Kinase A and Snf1 Signaling Mechanisms Underlie the Superior Potency of Sucrose for Induction of Filamentation in S. cerevisiae. Eucaryotic cell. 7(2): 286-293.
[0339] Walczak E, Robak M. 2009. Growth on sucrose of Y. lipolytica yeasts clones with invertase gene from S. cerevisiae [in Polish]. Acta Scientiarum Polonorum, Biotechnologia. 8 (4): 25-36.
[0340] Wang H J, Le Dall M T, Wach Y, Laroche C, Belin J M, Gaillardin C, Nicaud J M. 1999. Evaluation of acyl coenzyme A oxidase (Aox) isozyme function in the n-alkane-assimilating yeast Yarrowia lipolytica. Journal of Bacteriology 181(17): 5140-5148.
[0341] Wieczorke, R., S. Krampe, T. Weierstall, K. Freidel, C. P. Hollenberg and E. Boles 1999. Concurrent knock-out of at least 20 transporter genes is required to block uptake of hexoses in Sacccharomyces cervisiae. FEBS Letters 464(3): 123-128)
[0342] Wojtatowicz M, Rymowicz W. 1991. Effect of inoculum on kinetics and yield of citric acid production on glucose media by Y. lipolytica A-101. Acta Alimentaria Polonica. 41(2): 137-143.
[0343] Wojtatowicz M, Rymowicz W, Robak M, arowska B, Nicaud J M, 1997. Kinetics of cell growth and citric acid production by Y. lipolytica Suck transformants in sucrose media. Polish Journal of Food and Nutricion Sciences. 6/47 (4): 49-54.
[0344] Xuan J W, Fournier P, Declerck N, Chasles M, Gaillardin C. 1990. Overlapping reading frames at the LYS5 locus in the yeast Y. lipolytica. Molecular and Cellular Biology. 10: 4795-4806.
[0345] Yongmanitchai W, Ward O P, Growth of and omega-3 fatty acid production by Phaeodactylum tricornutum under different culture conditions. Appl. Environ. Microbiol. 57: 419-425, 1991
[0346] Young E, Poucher A, Comer A, Bailey A, Alper H S. 2011. Functional survey for heterologous sugar transport proteins, using Saccharomyces cerevisiae as a host. Appl Environ Microbiol 77(10): 3311-3319.
[0347] Young E M, Tong A, Bui H, Spofford C, Alper H S. 2014. Rewiring yeast sugar transporter preference through modifying a conserved protein motif. Proc Natl Acad Sci USA. 111(1): 131-136.