DGAT GENES FOR INCREASED SEED STORAGE LIPID PRODUCTION AND ALTERED FATTY ACID PROFILES IN OILSEED PLANTS
20170145434 ยท 2017-05-25
Inventors
Cpc classification
C12N15/8247
CHEMISTRY; METALLURGY
C12N9/1029
CHEMISTRY; METALLURGY
C12N9/1037
CHEMISTRY; METALLURGY
Y02A40/146
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
International classification
Abstract
Polynucleotide sequences encoding diacylglycerol acyltransferase genes and the use of these acyltransferases for increased seed storage lipid production and altered fatty acid profiles in oilseed plants are disclosed. Transgenic soybean seed having increased total fatty acid content of at least 20% and altered fatty acids when compared to the total fatty acid content of non-transgenic, null segregant soybean seed are described. Methods for increasing the total fatty acid content of a soybean seed by at least 20% include steps of transformation and selection.
Claims
1. A transgenic soybean seed having increased total fatty acid content of at least 20% and an increased protein content when compared to the total fatty acid content of a non-transgenic, null segregant soybean seed, wherein the seed comprises at least one recombinant construct having at least one diacylglycerol acyltransferase (DGAT) sequence and a construct downregulating galactinol synthase (GAS) activity wherein the DGAT sequence and the GAS construct can be in the same recombinant construct or in separate recombinant constructs.
2. The transgenic soybean seed of claim 1 further wherein the DGAT sequence is a Yarrowia DGAT sequence.
3. The transgenic soybean seed of claim 1, wherein the DGAT sequence is a DGAT1.
4. The transgenic soybean seed of claim 1, wherein the DGAT sequence is a DGAT2.
5. The transgenic soybean seed of claim 1, wherein the transgenic soybean seed has reduced soluble carbohydrate content when compared to the soluble carbohydrate content of the non-transgenic, null segregant soybean seed.
6. The transgenic soybean seed of claim 5, wherein the soluble carbohydrate content is at least one selected from the group of stachyose and raffinose.
7. A method for increasing the total fatty acid and protein content of a soybean seed comprising: (a) transforming at least one soybean cell with at least one recombinant construct having at least one diacylglycerol acyltransferase (DGAT) sequence and a construct downregulating galactinol synthase (GAS) activity wherein the DGAT sequence and the GAS construct can be in the same recombinant construct or in separate recombinant constructs; (b) selecting the transformed soybean cell(s) of step (a) such that plants grown from the transformed cells produce transgenic seed having an increased total fatty acid content of at least 20% and an increased protein content when compared to the total fatty acid and protein content of a non-transgenic, null segregant soybean seed.
8. The method of claim 7 wherein the DGAT sequence is selected from the group consisting of DGAT1, DGAT2 and DGAT1 in combination with DGAT2.
9. The method of claim 8, wherein the DGAT sequence is a DGAT1.
10. The method of claim 8, wherein the DGAT sequence is a DGAT2.
11. The method of claim 8, wherein the DGAT sequence is a Yarrowia sequence.
12. The method of claim 7, wherein the DGAT sequence is a Yarrowia sequence.
13. The method of claim 7, wherein the transgenic soybean seed has reduced soluble carbohydrate content when compared to the soluble carbohydrate content of the non-transgenic, null segregant soybean seed.
14. The transgenic soybean seed of claim 5, wherein the soluble carbohydrate content is at least one selected from the group of stachyose and raffinose.
15. A meal obtained from a transgenic soybean seed having increased total fatty acid content of at least 20% when compared to the total fatty acid content of a non-transgenic, null segregant soybean seed, wherein the transgenic soybean seed comprises at least one recombinant construct having at least one diacylglycerol acyltransferase (DGAT) sequence and a construct downregulating galactinol synthase (GAS) activity wherein the DGAT sequence and the GAS construct can be in the same recombinant construct or in separate recombinant constructs, further wherein protein content is increased by at least 1.5% points in the meal obtained from the transgenic soybean seed compared to the protein content of a meal obtained from the non-transgenic null segregant soybean seed.
16. The meal of claim 15, wherein the DGAT sequence is a Yarrowia DGAT sequence.
17. The meal of claim 15, wherein soluble carbohydrate content is reduced when compared to the soluble carbohydrate content of a meal obtained from a non-transgenic, null segregant soybean seed.
18. The meal of claim 17, wherein the soluble carbohydrate content is at least one selected from the group of stachyose and raffinose.
19. The meal of claim 17, wherein the soluble carbohydrate content is reduced by at least 17% when compared to the soluble carbohydrate content of a meal obtained from a non-transgenic, null segregant soybean seed.
20. The meal of claim 17, wherein the soluble carbohydrate content is at least one selected from the group of stachyose and raffinose.
Description
BRIEF DESCRIPTION OF THE DRAWINGS AND SEQUENCE LISTINGS
[0020] The invention can be more fully understood from the following detailed description and the accompanying drawings and Sequence Listing, which form a part of this application.
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030] The sequence descriptions summarize the Sequences Listing attached hereto. The Sequence Listing contains one letter codes for nucleotide sequence characters and the single and three letter codes for amino acids as defined in the IUPAC-IUB standards described in Nucleic Acids Research 13:3021-3030 (1985) and in the Biochemical Journal 219(2):345-373 (1984).
Summary of Nucleic Acid and Protein SEQ ID Numbers
[0031]
TABLE-US-00001 Nucleic acid Protein Description and Abbreviation SEQ ID NO. SEQ ID NO. Yarrowia lipolytica DGAT1 gene 1 (1581bp) Plasmid pYDA1 2 (8325bp) Plasmid py75 3 (7518bp) Plasmid pY75 YLDGAT1: YLDGAT1 4 (9109) inserted into pY75 Plasmid pRS425 5 (6849bp) Plasmid pGDP425 6 (7494bp) Yarrowia lipolytica DGAT2 gene 9 (1545bp) 10 (514aa) Plasmid pY75 YLDGAT2, pY75 with YL 11 (9070bp) DGAT2 inserted Yarrowia lipolytica DGAT1 gene variant 16 (1603bp) with NcoI and NotI sites added Yarrowia lipolytica DGAT2 gene variant 17 (1567bp) with NcoI and NotI sites added Plasmid pFBAIN-MOD-1 18 (6991bp) Plasmid pFBAIN-YLDGAT, pFBAIN with YL 19 (8568bp) DGAT1 inserted Plasmid pFBAIN-YLDGAT2 20 (8532bp) Plasmid pKS123 21 (7049bp) cal a24-4 22 (1098bp) Plasmid pKR53B 25 (8138bp) Plasmid pKR72 26 (7085bp) Plasmid pKR85 27 (7085bp) Plasmid pPCR85 30 (4827bp) Plasmid pKR91 31 (15114bp) Plasmid pKR92 32 (13268bp) Plasmid pKR92 YL DGAT2, pKR92 with the 33 (19604bp) YL DGAT2 gene inserted Plasmid pKR92 YL DGAT1 YL DGAT2 34 (20082bp) Soybean glycinin 1 (GY1) gene (Genbank 35 (3527bp) X15121) Soybean GY1 promoter 36 (690bp) Plasmid pZBL114 39 (6660bp) Soybean GM GY1 (glycinin 1) gene 40 (1437bp) Synthetic BHL8 (barley high lysine) gene 41 (204bp) GY1-BHL8 fusion product 42 (1701bp) Plasmid pZBL133 43 (6493bp) Plasmid pKS238 44 (6472bp) Plasmid pKS240 45 (6259bp) Plasmid pKS120 46 (5267bp) Plasmid pKS242 47 (8643bp) Plasmid pKS349 48 (8720bp) Plasmid pKS121/BS 49 (5280bp) Plasmid pDs-Red in pKS121/BS 50 (5968bp) Plasmid pKS332 51 (10058bp) Plasmid pKS362 comprisingwild-type 52 (11611bp) Yarrowia lipolytica DGAT2 driven by a beta-conglycinin promoter Soybean promoter GM P34 53 (1422bp) Plasmid pZBL115 56 (7466bp) Plasmid pJS89 57 (7841bp) Morteriella alpina delta-6 desaturase gene 58 (1390bp) coding sequence Plasmid pJS93 59 (9223bp) Plasmid pKS127 60 (7472bp) Plasmid pKS343 61 (7847bp) Plasmid pKS352 62 (10866bp) Plasmid pKS364 63 (12055bp) Yarrowia lipolytica DGAT1 gene codon 64 (1581 bp) 65 (526aa) optimized for soybean Yarrowia lipolytica DGAT2 gene codon 66 (1545bp) 67 (514aa) optimized for soybean Plasmid pKR1234 68 (8638bp) Plasmid ppPSgly32 71 (3673bp) Plasmid pKR264 72 (4171bp) Plasmid pKR1212 73 (6130bp) Plasmid pKR1235 74 (5764bp) Plasmid pKR1236 comprising both 75 (11693bp) Yarrowia lipolytica DGAT1 and DGAT2 Plasmid pKR1254 comprising wild-type 78 (5079bp) Yarrowia lipolytica DGAT2 Plasmid pKR1254_Y326F, pKR1254 81 (5079bp) comprising mutant Y326F Yarrowia lipolytica DGAT2 Yarrowia lipolytica DGAT2 comprising 82 (1545bp) 83 (514aa) codon 326 mutated from Tyr to Phe Plasmid pKR1254_Y326L, pKR1254 86 (5079bp) comprising mutant Y326L Yarrowia lipolytica DGAT2 Yarrowia lipolytica DGAT2 comprising 87 (1545bp) 88 (514aa) codon 326 mutated from Tyr to Leu Plasmid pKR1254_R327K, pKR1254 91 (5079bp) comprising mutant R327K Yarrowia lipolytica DGAT2 Yarrowia lipolytica DGAT2 comprising 92 (1545bp) 93 (514aa) codon 327 mutated from Arg to Lys Plasmid pY191 yeast expression vector 94 (9074bp) comprising wild-type Yarrowia lipolytica DGAT2 Plasmid pY192 yeast expression vector 95 (9074bp) comprising mutant Y326F Yarrowia lipolytica DGAT2 Plasmid pY193 yeast expression vector 96 (9074bp) comprising mutant Y326L Yarrowia lipolytica DGAT2 Plasmid pY194 yeast expression vector 97 (9074bp) comprising mutant R327K Yarrowia lipolytica DGAT2 Plasmid pKR1256 soybean expression 98 (8641bp) vector comprising wild-type Yarrowia lipolytica DGAT2 Plasmid pKR1277 soybean expression 99 (8641bp) vector comprising mutant Y326F Yarrowia lipolytica DGAT2 Plasmid pKR1278 soybean expression 100 (8641bp) vector comprising mutant Y326L Yarrowia lipolytica DGAT2 Plasmid pKS392 comprising Yarrowia 101 (11647bp) lipolytica DGAT1 codon optimized for soybean driven by b-conglycinin promoter Plasmid pKS393 comprising Yarrowia 102 (11611bp) lipolytica DGAT2 codon optimized for soybean driven by b-con promoter Plasmid pKS391 comprising wild-type 103 (11649bp) Yarrowia lipolytica DGAT1 driven by b-con promoter Plasmid pFBAIn-YLPAT1 104 (7674bp) Plasmid pKR1239 105 (4391bp) Plasmid pKR457 106 (5252bp) Plasm id pKR1242 107 (5952bp) Plasmid pFBAIn-YLPAAT2 108 (7836bp) Plasmid pKR1240 109 (4553bp) Plasmid pKR1243 110 (6114bp) Plasmid pFBAIn-YLPAT3 111 (8229bp) Plasmid pKR1241 112 (4946bp) Plasmid pKR1244 113 (6507bp) Plasmid pY27 114 (8928bp) Plasmid pKR1246 115 (7210bp) Plasmid pYAT-ACBP yeast expression 116 (7069bp) vector comprising Yarrowia lipolytica ACBP (acyl-CoA binding protein) Plasmid pKR1245 117 (3965bp) Plasmid pKR1250 soybean expression 118 (5526bp) vector comprising Yarrowia lipolytica ACBP (acyl-CoA binding protein) Plasmid pFBAIn-YCPT1 119 (8172bp) Plasmid pKR1247 120 (4889bp) Plasmid pKR1251 121 (6450bp) Yarrowia lipolytica GPAT 122 (2184bp) 123 (727aa) (glycerolphosphate acyltransferase homolog) Plasmid PCRblunt-YLGPAT 126 (5715bp) Plasmid pKR1257 127 (7447bp) Yarrowia lipolytica PAP1 (phosphatidic acid 128 (837bp) 129 (278aa) phosphatase homolog 1) Plasmid pHD33 132 (3875bp) Plasmid pKR1347 133 (6100bp) Yarrowia lipolytica PAP3 (phosphatidic acid 134 (1602bp) 135 (533aa) phosphatase homolog 3) Plasmid pHD34 138 (4640bp) Plasmid pKR1348-2 139 (6865bp) Yarrowia lipolytica PAP2 (phosphatidic acid 140 (2172bp) 141 (723aa) phosphatase homolog 2) Plasmid pHD35 144 (5210bp) Plasmid pKR1349 145 (7435bp) Yarrowia lipolytica GPD (glycerol 146 (1197bp) 147 (398aa) phosphate dehydrogenase homolog) Plasmid pHD36 152 (4729bp) Plasmid pKR1273 153 (5249bp) Plasmid pKR1369 154 (6457bp) Soybean (Glycine max) LPAAT-like 155 (1122bp) 156 (373aa) (lysophosphatidic acid acyltransferase-like homolog) Plasmid pKR561 soy LPAAT-like 159 (8654bp) Catalpa speciosa LPAAT-like 160 (1116bp) 161 (371aa) (lysophosphatidic acid acyltransferase-like homolog) Plasmid pKR561 catalpa LPAAT-like 164 (8653bp) Plasmid pKR268 165 (4906bp) Plasmid pKR145 166 (7096bp) Plasmid pKR561 167 (7497bp) Plasmid pKS387 168 (13308bp) Plasmid pKS178 169 (6498bp) Plasmid pKR1358 170 (6063bp) Plasmid pKR1364 171 (8936bp) Plasmid pYAT MOD1 180 (7043bp) Yarrowia lipolytica ACBP (acyl-CoA binding 181 (261bp) 182 (86aa) protein) Yarrowia lipolytica LPAAT1 185 (672bp) 186 (223aa) (lysophosphatidic acid acyltransferase-1) Yarrowia lipolytica LPAAT1 187 (849bp) 188 (282aa) (lysophosphatidic acid acyltransferase-2) Yarrowia lipolytica LPAAT1 189 (1230bp) 190 (409aa) (lysophosphatidic acid acyltransferase-3) Yarrowia lipolytica PDAT 191 (1944bp) 192 (648aa) (phospholipid: diacylglyceride acyltransferase) Yarrowia lipolytica CPT (choline 193 (1185bp) 194 (394aa) phosphotransferase) Plasmid pKR278 195 (5303bp) Plasmid pKR1274 196 (8358bp) Soybean (Glycine max) thioesterase 2 197 (1251bp) (TE2) Plasmid pTC4 198 (9592bp) Plasmid pKR1258 203 (4738bp) Soybean (Glycine max) fatty acid 204 (1164bp) desaturase 2-1 (Fad2-1)) Plasmid pBS43 205 (10303bp) Plasmid PCRblunt-Fad2-1 210 (4584bp) Plasmid pKR1259 211 (5797bp) Plasmid pKR1261 212 (7590bp) Plasmid pKR123R 213 (4993bp) Plasmid pKR1266 214 (9036bp) Plasmid pKR1267 215 (11615bp) Plasmid pKR457 216 (5252bp) Plasmid pKR1264 217 (9295bp) Plasmid pKR1277 218 (2577bp) Plasmid pKR1269 219 (9219bp) plasmid SH58 220 (8819) plasmid pJMS33 224 (9396) plasmid PHP25069 (SH74) 225 (11440) plasmid pJMS38 229 (11111) plasmid PHP21155 230 (3231) plasmid PHP29252 (pJMS41) 235 (11879) plasmid PHP19031A 236 (3984)
[0032] SEQ ID NOs:7-8 correspond to PCR primers oYLDGAT2-1 (SEQ IOD NO:7) and oYLDGAT2-2 (SEQ IOD NO:8), used to amplify the Yarrowia lipolytica diacylglycerol acyltransferase 2 (YL DGAT2) gene from a yeast lysate (for details see Example 1.)
[0033] SEQ ID NOs:12-15 correspond to oligonucleotide primers used to amplify the coding regions of YL DGAT1 (YDGAT1-F and YDGAT1-R; SEQ ID NOs:12-13, respectively) and YL DGAT2 (YDGAT2-F and YDGAT2-R, SEQ ID NOs:14-15, respectively) from Yarrowia lipolytica genomic DNA.
[0034] SEQ ID NOs:23 (oCal-15) and SEQ ID NO:24 (oCal-6) correspond to oligonucleotide primers used to amplify DNA fragment cal a24-4 (SEQ ID NO:22) from template plasmid CalFad2-2 described in PCT Publication No. WO 02/008269.
[0035] SEQ ID NO:28 (oKR85-1) and SEQ ID NO:29 (oKR85-2) correspond to primers used to amplify the beta-conglycinin promoter-(NotI cloning site)-phaseolin 3 terminator region from plasmid pKR85 (SEQ ID NO:27.)
[0036] SEQ ID NOs:37(oGy1-1) and SEQ ID NO:38 (oGy1-2) correspond to primers used to amplify the soybean glycinin 1 promoter (SEQ ID NO:36) and incorporating BamHI and NcoI sites on the 5 and 3-ends, respectively.
[0037] SEQ ID NO:54 (oP34-1) and SEQ ID NO:55 (oP34-2) correspond to primers used to amplify the soybean P34 promoter (SEQ ID NO:53) and incorporating BamHI and NotI sites into the 5 and 3-ends, respectively.
[0038] SEQ ID NO:69 (oSGly-2) and SEQ ID NO:70 (oSGly-3) correspond to primers used to amplify the glycinin GY1 promoter.
[0039] SEQ ID NOs:76(oYDG2-1) and SEQ ID NO:77 (oYDG2-2) correspond to primers used to amplify Yarrowia DGAT2 (SEQ ID NO:10) which was then incorporated into pKR1254 (SEQ ID NO:78).
[0040] SEQ ID NO:79 (YID2_Y326F-5) and SEQ ID NO:80 (YID2_Y326F-3) correspond to primers used to mutate the amino acid at position 326 of Yarrowia DGAT2 (SEQ ID NO:10) from tyrosine to phenylalanine.
[0041] SEQ ID NO:84 (YID2_Y326L-5) and SEQ ID NO:85 (YID2_Y326L-3) correspond to primers used to mutate the amino acid at position 326 of Yarrowia DGAT2 (SEQ ID NO:10) from tyrosine to leucine.
[0042] SEQ ID NO:89 (YID2_R327K-5) and SEQ ID NO:90 (YID2_R327K-3) correspond to primers used to mutate the amino acid at position 327 of Yarrowia DGAT2 (SEQ ID NO:10) from arginine to lysine.
[0043] SEQ ID NOs:124 (YIGPAT-5) and SEQ ID NO:125 (YIGPAT-3) correspond to primers used to amplify the Yarrowia glycerolphosphate acyltransferase homolog (YL GPAT) which was then incorporated into pKR1257 (SEQ ID NO:127).
[0044] SEQ ID NOs:130 (YIPAP1-5) and SEQ ID NO:131 (YIPAP1-3) correspond to primers used to amplify the Yarrowia phosphatidic acid phosphatase homolog 1 (YL PAP1) which was then incorporated into pKR1347 (SEQ ID NO:133).
[0045] SEQ ID NOs:136 (YIPAP3-5) and SEQ ID NO:137 (YIPAP3-3) correspond to primers used to amplify the Yarrowia phosphatidic acid phosphatase homolog 3 (YL PAP3) which was then incorporated into pKR1348_2 (SEQ ID NO:139).
[0046] SEQ ID NOs:142 (YIPAP2-5) and SEQ ID NO:143 (YIPAP2-3) correspond to primers used to amplify the Yarrowia phosphatidic acid phosphatase homolog 2 (YL PAP2) which was then incorporated into pKR1349 (SEQ ID NO:145).
[0047] SEQ ID NOs:148 (YIGPD-5) and SEQ ID NO:149 (YIGPD-3-2) and SEQ ID NOs:150 (YIGPD-intron-5-2) and SEQ ID NO:151 (YIGPD-3) correspond to primers used to amplify the Yarrowia glycerol phosphate dehydrogenase homolog (YL GPD) which was then incorporated into pKR1273 (SEQ ID NO:153).
[0048] SEQ ID NOs:157 (soy LPAAT-like fwd) and SEQ ID NO:158 (soy LPAAT-like rev) correspond to primers used to amplify the soybean lysophosphatidic acid acyltransferase-like homolog (LPAAT-like; SEQ ID NO:156) which was then incorporated into pKR561-SOY LPAAT-like (SEQ ID NO:159).
[0049] SEQ ID NOs:162 (catalpa LPAAT-like fwd) and SEQ ID NO:163 (catalpa LPAAT-like rev) correspond to primers used to amplify the catalpa lysophosphatidic acid acyltransferase-like homolog (LPAAT-like; SEQ ID NO:161) which was then incorporated into pKR561-CATALPA LPAAT-like (SEQ ID NO:164).
[0050] SEQ ID NOs:172 (YL LPAAT1 fwd) and SEQ ID NO:173 (YL LPAAT1 rev) correspond to primers used to amplify the Yarrowia lysophosphatidic acid acyltransferase-1 homolog (YLPAT1) which was then incorporated into pFBAIn-YLPAT1 (SEQ ID NO:104).
[0051] SEQ ID NOs:174 (YL LPAAT2 fwd) and SEQ ID NO:175 (YL LPAAT2 rev) correspond to primers used to amplify the Yarrowia lysophosphatidic acid acyltransferase-2 homolog (YLPAT2) which was then incorporated into pFBAIn-YLPAAT2 (SEQ ID NO:108).
[0052] SEQ ID NOs:176 (YL LPAAT3 fwd) and SEQ ID NO:177 (YL LPAAT3 rev) correspond to primers used to amplify the Yarrowia lysophosphatidic acid acyltransferase-3 homolog (YLPAT3) which was then incorporated into pFBAIn-YLPAT3 (SEQ ID NO:111).
[0053] SEQ ID NOs:178 (YL ACBP fwd) and SEQ ID NO:179 (YL ACBP rev) correspond to primers used to amplify the Yarrowia acyl-CoA binding protein homolog (YL ACBP) which was then incorporated into pYAT-ACBP (SEQ ID NO: 116).
[0054] SEQ ID NOs:183 (YL CPT fwd) and SEQ ID NO:184 (YL CPT rev) correspond to primers used to amplify the Yarrowia phosphotransferase homolog (YL CPT) which was then incorporated into -YCPT1 (SEQ ID NO:119).
[0055] SEQ ID NOs:199 (GmTE2-1 5-1) and SEQ ID NO:200 (GmTE2-1 3-1) and SEQ ID NOs:201 (GmTE2-1 5-2) and SEQ ID NO:202 (GmTE2-1 3-2) correspond to primers used to amplify the soybean (Glycine max) thioesterase 2 gene (TE2) which was then incorporated into pKR1258 (SEQ ID NO:203).
[0056] SEQ ID NO:206 (GmFad2-1 5-1) and SEQ ID NO:207 (GmFad2-1 3-1) and SEQ ID NOs:208 (GmFad2-1 5-2) and SEQ ID NO:209 (GmFad2-1 3-2) correspond to primers used to amplify the soybean (Glycine max) fatty acid desaturase 2-1 gene (Fad2-1) which was then incorporated into pKR1259 (SEQ ID NO:211).
[0057] SEQ ID NO:221 (G1HPFW04) and SEQ ID NO:222 (G3HPRV02) are primers used to PCR amplify fragment H-NotI-Sal1-GAS1sGAS2GAS3-AvrII-B-H (SEQ ID NO:223, 1621 bp) which was digested and cloned into plasmid pJMS33 (SEQ ID NO:224).
[0058] SEQ ID NO:226 (GMPGMFW02) and SEQ ID NO:227 (GMPGMRV02) are primers used to PCR amplify fragment PGMPCRAA (SEQ ID NO:228, 596 bp) which was digested and cloned into plasmid pJMS38 (SEQ ID NO:229).
[0059] SEQ ID NO:231 (PHP21155FW01) and SEQ ID NO:232 (PHP21155RV01) are primers used to PCR amplify fragment STLS1(BsiWI-SbfI) (SEQ ID NO:233, 220 bp) which was digested along with fragment PGMPCRAS (SEQ ID NO:234, 592 bp) and cloned into plasmid pJMS41 (SEQ ID NO:235).
DETAILED DESCRIPTION OF THE INVENTION
[0060] The disclosure of each reference set forth herein is hereby incorporated by reference in its entirety.
[0061] As used herein and in the appended claims, the singular forms a, an, and the include plural reference unless the context clearly dictates otherwise. Thus, for example, reference to a plant includes a plurality of such plants, reference to a cell includes one or more cells and equivalents thereof known to those skilled in the art, and so forth.
[0062] In the context of this disclosure, a number of terms and abbreviations are used. The following definitions are provided.
[0063] Open reading frame is abbreviated ORF.
[0064] Polymerase chain reaction is abbreviated PCR.
[0065] American Type Culture Collection is abbreviated ATCC.
[0066] Acyl-CoA:sterol-acyltransferase is abbreviated ARE2.
[0067] Phospholipid:diacylglycerol acyltransferase is abbreviated PDAT.
[0068] Diacylglycerol acyltransferase is abbreviated DAG AT or DGAT.
[0069] Diacylglycerol is abbreviated DAG.
[0070] Triacylglycerols are abbreviated TAGs.
[0071] Co-enzyme A is abbreviated CoA.
[0072] The term fatty acids refers to long chain aliphatic acids (alkanoic acids) of varying chain length, from about C.sub.12 to C.sub.22 (although both longer and shorter chain-length acids are known). The predominant chain lengths are between C.sub.16 and C.sub.22. The structure of a fatty acid is represented by a simple notation system of X:Y, where X is the total number of carbon (C) atoms in the particular fatty acid and Y is the number of double bonds.
[0073] Generally, fatty acids are classified as saturated or unsaturated. The term saturated fatty acids refers to those fatty acids that have no double bonds between their carbon backbone. In contrast, unsaturated fatty acids have double bonds along their carbon backbones (which are most commonly in the cis-configuration). Monounsaturated fatty acids have only one double bond along the carbon backbone (e.g., usually between the 9.sup.th and 10.sup.th carbon atom as for palmitoleic acid (16:1) and oleic acid (18:1)), while polyunsaturated fatty acids (or PUFAs) have at least two double bonds along the carbon backbone (e.g., between the 9.sup.th and 10.sup.th, and 12.sup.th and 13.sup.th carbon atoms for linoleic acid (18:2); and between the 9.sup.th and 10.sup.th, 12.sup.th and 13.sup.th, and 15.sup.th and 16.sup.th for -linolenic acid (18:3)).
[0074] Microbial oils or single cell oils are those oils naturally produced by microorganisms (e.g., algae, oleaginous yeasts and filamentous fungi) during their lifespan. The term oil refers to a lipid substance that is liquid at 25 C. and usually polyunsaturated. In contrast, the term fat refers to a lipid substance that is solid at 25 C. and usually saturated.
[0075] Lipid bodies refer to lipid droplets that usually are bounded by specific proteins and a monolayer of phospholipid. These organelles are sites where most organisms transport/store neutral lipids. Lipid bodies are thought to arise from microdomains of the endoplasmic reticulum that contain TAG-biosynthesis enzymes; and, their synthesis and size appear to be controlled by specific protein components.
[0076] Neutral lipids refer to those lipids commonly found in cells in lipid bodies as storage fats and oils and are so called because at cellular pH, the lipids bear no charged groups. Generally, they are completely non-polar with no affinity for water. Neutral lipids generally refer to mono-, di-, and/or triesters of glycerol with fatty acids, also called monoacylglycerol, diacylglycerol or TAG, respectively (or collectively, acylglycerols). A hydolysis reaction must occur to release free fatty acids from acylglycerols.
[0077] The terms triacylglycerol, oil and TAGs refer to neutral lipids composed of three fatty acyl residues esterified to a glycerol molecule (and such terms will be used interchangeably throughout the present disclosure herein). Such oils can contain long chain PUFAs, as well as shorter saturated and unsaturated fatty acids and longer chain saturated fatty acids. Thus, oil biosynthesis generically refers to the synthesis of TAGs in the cell.
[0078] The term DAG AT or DGAT refers to a diacylglycerol acyltransferase (also known as an acyl-CoA-diacylglycerol acyltransferase or a diacylglycerol O-acyltransferase) (EC 2.3.1.20). This enzyme is responsible for the conversion of acyl-CoA and 1,2-diacylglycerol to TAG and CoA (thereby involved in the terminal step of TAG biosynthesis). Two families of DAG AT enzymes exist: DGAT1 and DGAT2. The former family shares homology with the acyl-CoA: cholesterol acyltransferase (ACAT) gene family, while the latter family is unrelated (Lardizabal et al., J. Biol. Chem. 276(42):38862-28869 (2001)).
[0079] The term PDAT refers to a phospholipid:diacylglycerol acyltransferase enzyme (EC 2.3.1.158). This enzyme is responsible for the transfer of an acyl group from the sn-2 position of a phospholipid to the sn-3 position of 1,2-diacylglycerol, thus resulting in lysophospholipid and TAG (thereby involved in the terminal step of TAG biosynthesis). This enzyme differs from DGAT (EC 2.3.1.20) by synthesizing TAG via an acyl-CoA-independent mechanism.
[0080] The term ARE2 refers to an acyl-CoA:sterol-acyltransferase enzyme (EC 2.3.1.26; also known as a sterol-ester synthase 2 enzyme), catalyzing the following reaction: acyl-CoA+cholesterol=CoA+cholesterol ester.
[0081] The term Kennedy pathway enzyme genes are defined as genes encoding enzymes that are involved in providing the immediate precursors for membrane lipid or storage lipid biosynthesis at the endoplasmic reticulum. Kennedy pathway enzymes also include enzymes that catalyze transfer of acyl groups between intermediates of membrane lipid or seed storage lipid biosynthesis at the endoplasmic reticulum (ER). Kennedy pathway enzyme can be soluble, cytosolic enzymes. They can associated with the ER membrane system or they can be integral membrane proteins of the ER membrane system. A Kennedy Pathway gene is further defined as any gene directly involved biosynthesis or degradation of triacylglycerol (TAG) or TAG intermediates. Some examples of genes include glycerol-phosphate dehydrogenase (GPD), glycerol-phosphate acyltransferase (GPAT), glycerol acyltransferase, lyso-phospholipid acyltransferase (LPAT), lyso-phosphatidic acid acyltransferase (LPAAT), lyso-phosphatidylcholine acyltransferase (LPCAT), monoacylglyceride acyltransferase, phosphatidic acid phosphatase (PAP), lyso-phospholipid phospholipase, lyso-phosphatidic acid phospholipase, lyso-phosphatidylcholine phospholipase, phospholipase A1 (PLA1), phospholipase A2 (PLA2), phospholipase B (PLB), phospholipase C (PLC), phospholipase D (PLD), choline phosphotransferase (CPT), plastidic phosphoglucomutase (PGM), phospholipid:diacylglyceride acyltransferase (PDAT), lyso-phospholipid:diglyceride acyltransferase (LPDAT), triacylglyceride lipase, diacylglyceride lipase, monoacylglyceride lipase, and acylCoA binding protein (ACBP).
[0082] As used herein, nucleic acid means a polynucleotide and includes single or double-stranded polymer of deoxyribonucleotide or ribonucleotide bases. Nucleic acids may also include fragments and modified nucleotides. Thus, the terms polynucleotide, nucleic acid sequence, nucleotide sequence or nucleic acid fragment are used interchangeably and is a polymer of RNA or DNA that is single- or double-stranded, optionally containing synthetic, non-natural or altered nucleotide bases. Nucleotides (usually found in their 5-monophosphate form) are referred to by their single letter designation as follows: A for adenylate or deoxyadenylate (for RNA or DNA, respectively), C for cytidylate or deosycytidylate, G for guanylate or deoxyguanylate, U for uridlate, T for deosythymidylate, R for purines (A or G), Y for pyrimidiens (C or T), K for G or T, H for A or C or T, I for inosine, and N for any nucleotide.
[0083] The terms subfragment that is functionally equivalent and functionally equivalent subfragment are used interchangeably herein. These terms refer to a portion or subsequence of an isolated nucleic acid fragment in which the ability to alter gene expression or produce a certain phenotype is retained whether or not the fragment or subfragment encodes an active enzyme. For example, the fragment or subfragment can be used in the design of chimeric genes to produce the desired phenotype in a transformed plant. Chimeric genes can be designed for use in suppression by linking a nucleic acid fragment or subfragment thereof, whether or not it encodes an active enzyme, in the sense or antisense orientation relative to a plant promoter sequence.
[0084] The term conserved domain or motif means a set of amino acids conserved at specific positions along an aligned sequence of evolutionarily related proteins. While amino acids at other positions can vary between homologous proteins, amino acids that are highly conserved at specific positions indicate amino acids that are essential in the structure, the stability, or the activity of a protein. Because they are identified by their high degree of conservation in aligned sequences of a family of protein homologues, they can be used as identifiers, or signatures, to determine if a protein with a newly determined sequence belongs to a previously identified protein family.
[0085] The terms homology, homologous, substantially similar and corresponding substantially are used interchangeably herein. They refer to nucleic acid fragments wherein changes in one or more nucleotide bases do not affect the ability of the nucleic acid fragment to mediate gene expression or produce a certain phenotype. These terms also refer to modifications of the nucleic acid fragments of the instant invention such as deletion or insertion of one or more nucleotides that do not substantially alter the functional properties of the resulting nucleic acid fragment relative to the initial, unmodified fragment. It is therefore understood, as those skilled in the art will appreciate, that the invention encompasses more than the specific exemplary sequences.
[0086] Moreover, the skilled artisan recognizes that substantially similar nucleic acid sequences encompassed by this invention are also defined by their ability to hybridize (under moderately stringent conditions, e.g., 0.5SSC, 0.1% SDS, 60 C.) with the sequences exemplified herein, or to any portion of the nucleotide sequences disclosed herein and which are functionally equivalent to any of the nucleic acid sequences disclosed herein. Stringency conditions can be adjusted to screen for moderately similar fragments, such as homologous sequences from distantly related organisms, to highly similar fragments, such as genes that duplicate functional enzymes from closely related organisms. Post-hybridization washes determine stringency conditions.
[0087] The term selectively hybridizes includes reference to hybridization, under stringent hybridization conditions, of a nucleic acid sequence to a specified nucleic acid target sequence to a detectably greater degree (e.g., at least 2-fold over background) than its hybridization to non-target nucleic acid sequences and to the substantial exclusion of non-target nucleic acids. Selectively hybridizing sequences typically have about at least 80% sequence identity, or 90% sequence identity, up to and including 100% sequence identity (i.e., fully complementary) with each other.
[0088] The term stringent conditions or stringent hybridization conditions includes reference to conditions under which a probe will selectively hybridize to its target sequence. Stringent conditions are sequence-dependent and will be different in different circumstances. By controlling the stringency of the hybridization and/or washing conditions, target sequences can be identified which are 100% complementary to the probe (homologous probing). Alternatively, stringency conditions can be adjusted to allow some mismatching in sequences so that lower degrees of similarity are detected (heterologous probing). Generally, a probe is less than about 1000 nucleotides in length, optionally less than 500 nucleotides in length.
[0089] Typically, stringent conditions will be those in which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30 C. for short probes (e.g., 10 to 50 nucleotides) and at least about 60 C. for long probes (e.g., greater than 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. Exemplary low stringency conditions include hybridization with a buffer solution of 30 to 35% formamide, 1 M NaCl, 1% SDS (sodium dodecyl sulphate) at 37 C., and a wash in 1 to 2SSC (20SSC=3.0 M NaCl/0.3 M trisodium citrate) at 50 to 55 C. Exemplary moderate stringency conditions include hybridization in 40 to 45% formamide, 1 M NaCl, 1% SDS at 37 C., and a wash in 0.5 to 1SSC at 55 to 60 C. Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37 C., and a wash in 0.1SSC at 60 to 65 C.
[0090] Specificity is typically the function of post-hybridization washes, the critical factors being the ionic strength and temperature of the final wash solution. For DNA-DNA hybrids, the T.sub.m can be approximated from the equation of Meinkoth et al., Anal. Biochem. 138:267-284 (1984): T.sub.m=81.5 C.+16.6 (log M)+0.41 (% GC)0.61 (% form)500/L; where M is the molarity of monovalent cations, % GC is the percentage of guanosine and cytosine nucleotides in the DNA, % form is the percentage of formamide in the hybridization solution, and L is the length of the hybrid in base pairs. The T.sub.m is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridizes to a perfectly matched probe. T.sub.m is reduced by about 1 C. for each 1% of mismatching; thus, T.sub.m, hybridization and/or wash conditions can be adjusted to hybridize to sequences of the desired identity. For example, if sequences with 90% identity are sought, the T.sub.m can be decreased 10 C. Generally, stringent conditions are selected to be about 5 C. lower than the thermal melting point (T.sub.m) for the specific sequence and its complement at a defined ionic strength and pH. However, severely stringent conditions can utilize a hybridization and/or wash at 1, 2, 3, or 4 C. lower than the thermal melting point (T.sub.m); moderately stringent conditions can utilize a hybridization and/or wash at 6, 7, 8, 9, or 10 C. lower than the thermal melting point (T.sub.m); low stringency conditions can utilize a hybridization and/or wash at 11, 12, 13, 14, 15, or 20 C. lower than the thermal melting point (T.sub.m). Using the equation, hybridization and wash compositions, and desired T.sub.m, those of ordinary skill will understand that variations in the stringency of hybridization and/or wash solutions are inherently described. If the desired degree of mismatching results in a T.sub.m of less than 45 C. (aqueous solution) or 32 C. (formamide solution) it is preferred to increase the SSC concentration so that a higher temperature can be used. An extensive guide to the hybridization of nucleic acids is found in Tijssen, Laboratory Techniques in Biochemistry and Molecular BiologyHybridization with Nucleic Acid Probes, Part I, Chapter 2 Overview of principles of hybridization and the strategy of nucleic acid probe assays, Elsevier, New York (1993); and Current Protocols in Molecular Biology, Chapter 2, Ausubel et al., Eds., Greene Publishing and Wiley-Interscience, New York (1995). Hybridization and/or wash conditions can be applied for at least 10, 30, 60, 90, 120, or 240 minutes.
[0091] Sequence identity or identity in the context of nucleic acid or polypeptide sequences refers to the nucleic acid bases or amino acid residues in two sequences that are the same when aligned for maximum correspondence over a specified comparison window.
[0092] Thus, percentage of sequence identity refers to the value determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide or polypeptide sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the results by 100 to yield the percentage of sequence identity. Useful examples of percent sequence identities include, but are not limited to, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%, or any integer percentage from 50% to 100%. These identities can be determined using any of the programs described herein.
[0093] Sequence alignments and percent identity or similarity calculations may be determined using a variety of comparison methods designed to detect homologous sequences including, but not limited to, the MegAlign program of the LASERGENE bioinformatics computing suite (DNASTAR Inc., Madison, Wis.). Within the context of this application it will be understood that where sequence analysis software is used for analysis, that the results of the analysis will be based on the default values of the program referenced, unless otherwise specified. As used herein default values will mean any set of values or parameters that originally load with the software when first initialized.
[0094] The Clustal V method of alignment corresponds to the alignment method labeled Clustal V (described by Higgins and Sharp, CABIOS. 5:151-153 (1989); Higgins, D. G. et al. (1992) Comput. Appl. Biosci. 8:189-191) and found in the MegAlign program of the LASERGENE bioinformatics computing suite (DNASTAR Inc., Madison, Wis.). For multiple alignments, the default values correspond to GAP PENALTY=10 and GAP LENGTH PENALTY=10. Default parameters for pairwise alignments and calculation of percent identity of protein sequences using the Clustal method are KTUPLE=1, GAP PENALTY=3, WINDOW=5 and DIAGONALS SAVED=5. For nucleic acids these parameters are KTUPLE=2, GAP PENALTY=5, WINDOW=4 and DIAGONALS SAVED=4. After alignment of the sequences using the Clustal V program, it is possible to obtain a percent identity by viewing the sequence distances table in the same program.
[0095] BLASTN method of alignment is an algorithm provided by the National Center for Biotechnology Information (NCBI) to compare nucleotide sequences using default parameters.
[0096] It is well understood by one skilled in the art that many levels of sequence identity are useful in identifying polypeptides, from other species, wherein such polypeptides have the same or similar function or activity. Useful examples of percent identities include, but are not limited to, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%, or any integer percentage from 50% to 100%. Indeed, any integer amino acid identity from 50% to 100% may be useful in describing the present invention, such as 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%. Also, of interest is any full-length or partial complement of this isolated nucleotide fragment.
[0097] Gene refers to a nucleic acid fragment that expresses a specific protein, including regulatory sequences preceding (5 non-coding sequences) and following (3 non-coding sequences) the coding sequence. Native gene refers to a gene as found in nature with its own regulatory sequences. Chimeric gene refers to any gene that is not a native gene, comprising regulatory and coding sequences that are not found together in nature. Accordingly, a chimeric gene may comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a manner different than that found in nature. A foreign gene refers to a gene not normally found in the host organism, but that is introduced into the host organism by gene transfer. Foreign genes can comprise native genes inserted into a non-native organism, or chimeric genes. A transgene is a gene that has been introduced into the genome by a transformation procedure.
[0098] The term genome as it applies to a plant cells encompasses not only chromosomal DNA found within the nucleus, but organelle DNA found within subcellular components (e.g., mitochondrial, plastid) of the cell.
[0099] A codon-optimized gene is a gene having its frequency of codon usage designed to mimic the frequency of preferred codon usage of the host cell.
[0100] An allele is one of several alternative forms of a gene occupying a given locus on a chromosome. When all the alleles present at a given locus on a chromosome are the same that plant is homozygous at that locus. If the alleles present at a given locus on a chromosome differ that plant is heterozygous at that locus.
[0101] Coding sequence refers to a DNA sequence that codes for a specific amino acid sequence. Regulatory sequences refer to nucleotide sequences located upstream (5 non-coding sequences), within, or downstream (3 non-coding sequences) of a coding sequence, and which influence the transcription, RNA processing or stability, or translation of the associated coding sequence. Regulatory sequences may include, but are not limited to: promoters, translation leader sequences, introns, polyadenylation recognition sequences, RNA processing sites, effector binding sites and stem-loop structures.
[0102] Promoter refers to a DNA sequence capable of controlling the expression of a coding sequence or functional RNA. The promoter sequence consists of proximal and more distal upstream elements, the latter elements often referred to as enhancers. Accordingly, an enhancer is a DNA sequence that can stimulate promoter activity, and may be an innate element of the promoter or a heterologous element inserted to enhance the level or tissue-specificity of a promoter. Promoters may be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even comprise synthetic DNA segments. It is understood by those skilled in the art that different promoters may direct the expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental conditions. It is further recognized that since in most cases the exact boundaries of regulatory sequences have not been completely defined, DNA fragments of some variation may have identical promoter activity. Promoters that cause a gene to be expressed in most cell types at most times are commonly referred to as constitutive promoters. New promoters of various types useful in plant cells are constantly being discovered; numerous examples may be found in the compilation by Okamuro, J. K., and Goldberg, R. B. Biochemistry of Plants 15:1-82 (1989).
[0103] Translation leader sequence refers to a polynucleotide sequence located between the promoter sequence of a gene and the coding sequence. The translation leader sequence is present in the fully processed mRNA upstream of the translation start sequence. The translation leader sequence may affect processing of the primary transcript to mRNA, mRNA stability or translation efficiency. Examples of translation leader sequences have been described (Turner, R. and Foster, G. D., Mol. Biotechnol. 3:225-236 (1995)).
[0104] 3 non-coding sequences, transcription terminator or termination sequences refer to DNA sequences located downstream of a coding sequence and include polyadenylation recognition sequences and other sequences encoding regulatory signals capable of affecting mRNA processing or gene expression. The polyadenylation signal is usually characterized by affecting the addition of polyadenylic acid tracts to the 3 end of the mRNA precursor. The use of different 3 non-coding sequences is exemplified by Ingelbrecht, I. L., et al. Plant Cell 1:671-680 (1989).
[0105] RNA transcript refers to the product resulting from RNA polymerase-catalyzed transcription of a DNA sequence. When the RNA transcript is a perfect complementary copy of the DNA sequence, it is referred to as the primary transcript. A RNA transcript is referred to as the mature RNA when it is a RNA sequence derived from post-transcriptional processing of the primary transcript. Messenger RNA or mRNA refers to the RNA that is without introns and that can be translated into protein by the cell. cDNA refers to a DNA that is complementary to, and synthesized from, a mRNA template using the enzyme reverse transcriptase. The cDNA can be single-stranded or converted into double-stranded form using the Klenow fragment of DNA polymerase I. Sense RNA refers to RNA transcript that includes the mRNA and can be translated into protein within a cell or in vitro. Antisense RNA refers to an RNA transcript that is complementary to all or part of a target primary transcript or mRNA, and that blocks the expression of a target gene (U.S. Pat. No. 5,107,065). The complementarity of an antisense RNA may be with any part of the specific gene transcript, i.e., at the 5 non-coding sequence, 3 non-coding sequence, introns, or the coding sequence. Functional RNA refers to antisense RNA, ribozyme RNA, or other RNA that may not be translated but yet has an effect on cellular processes. The terms complement and reverse complement are used interchangeably herein with respect to mRNA transcripts, and are meant to define the antisense RNA of the message.
[0106] The term operably linked refers to the association of nucleic acid sequences on a single nucleic acid fragment so that the function of one is regulated by the other. For example, a promoter is operably linked with a coding sequence when it is capable of regulating the expression of that coding sequence (i.e., the coding sequence is under the transcriptional control of the promoter). Coding sequences can be operably linked to regulatory sequences in a sense or antisense orientation. In another example, the complementary RNA regions of the invention can be operably linked, either directly or indirectly, 5 to the target mRNA, or 3 to the target mRNA, or within the target mRNA, or a first complementary region is 5 and its complement is 3 to the target mRNA.
[0107] Standard recombinant DNA and molecular cloning techniques used herein are well known in the art and are described more fully in Sambrook, J., Fritsch, E. F. and Maniatis, T. Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory: Cold Spring Harbor, N.Y. (1989). Transformation methods are well known to those skilled in the art and are described infra.
[0108] PCR or polymerase chain reaction is a technique for the synthesis of large quantities of specific DNA segments and consists of a series of repetitive cycles (Perkin Elmer Cetus Instruments, Norwalk, Conn.). Typically, the double-stranded DNA is heat denatured, the two primers complementary to the 3 boundaries of the target segment are annealed at low temperature and then extended at an intermediate temperature. One set of these three consecutive steps is referred to as a cycle.
[0109] The term recombinant refers to an artificial combination of two otherwise separated segments of sequence, e.g., by chemical synthesis or by the manipulation of isolated segments of nucleic acids by genetic engineering techniques.
[0110] The terms plasmid, vector and cassette refer to an extra chromosomal element often carrying genes that are not part of the central metabolism of the cell, and usually in the form of circular double-stranded DNA fragments. Such elements may be autonomously replicating sequences, genome integrating sequences, phage or nucleotide sequences, linear or circular, of a single- or double-stranded DNA or RNA, derived from any source, in which a number of nucleotide sequences have been joined or recombined into a unique construction which is capable of introducing a promoter fragment and DNA sequence for a selected gene product along with appropriate 3 untranslated sequence into a cell. Transformation cassette refers to a specific vector containing a foreign gene and having elements in addition to the foreign gene that facilitates transformation of a particular host cell. Expression cassette refers to a specific vector containing a foreign gene and having elements in addition to the foreign gene that allow for enhanced expression of that gene in a foreign host (i.e., to a discrete nucleic acid fragment into which a nucleic acid sequence or fragment can be moved.)
[0111] The terms recombinant construct, expression construct, chimeric construct, construct, and recombinant DNA construct are used interchangeably herein. A recombinant construct comprises an artificial combination of nucleic acid fragments, e.g., regulatory and coding sequences that are not found together in nature. For example, a chimeric construct may comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a manner different than that found in nature. Such a construct may be used by itself or may be used in conjunction with a vector. If a vector is used, then the choice of vector is dependent upon the method that will be used to transform host cells as is well known to those skilled in the art. For example, a plasmid vector can be used. The skilled artisan is well aware of the genetic elements that must be present on the vector in order to successfully transform, select and propagate host cells comprising any of the isolated nucleic acid fragments of the invention. The skilled artisan will also recognize that different independent transformation events will result in different levels and patterns of expression (Jones et al., EMBO J. 4:2411-2418 (1985); De Almeida et al., Mol. Gen. Genetics 218:78-86 (1989)), and thus that multiple events must be screened in order to obtain lines displaying the desired expression level and pattern. Such screening may be accomplished by Southern analysis of DNA, Northern analysis of mRNA expression, immunoblotting analysis of protein expression, or phenotypic analysis, among others.
[0112] The term expression, as used herein, refers to the production of a functional end-product (e.g., a mRNA or a protein [either precursor or mature]).
[0113] The term introduced means providing a nucleic acid (e.g., expression construct) or protein into a cell. Introduced includes reference to the incorporation of a nucleic acid into a eukaryotic or prokaryotic cell where the nucleic acid may be incorporated into the genome of the cell, and includes reference to the transient provision of a nucleic acid or protein to the cell. Introduced includes reference to stable or transient transformation methods, as well as sexually crossing. Thus, introduced in the context of inserting a nucleic acid fragment (e.g., a recombinant DNA construct/expression construct) into a cell, means transfection or transformation or transduction and includes reference to the incorporation of a nucleic acid fragment into a eukaryotic or prokaryotic cell where the nucleic acid fragment may be incorporated into the genome of the cell (e.g., chromosome, plasmid, plastid or mitochondrial DNA), converted into an autonomous replicon, or transiently expressed (e.g., transfected mRNA).
[0114] Mature protein refers to a post-translationally processed polypeptide (i.e., one from which any pre- or propeptides present in the primary translation product have been removed). Precursor protein refers to the primary product of translation of mRNA (i.e., with pre- and propeptides still present). Pre- and propeptides may be but are not limited to intracellular localization signals.
[0115] Stable transformation refers to the transfer of a nucleic acid fragment into a genome of a host organism, including both nuclear and organellar genomes, resulting in genetically stable inheritance. In contrast, transient transformation refers to the transfer of a nucleic acid fragment into the nucleus, or DNA-containing organelle, of a host organism resulting in gene expression without integration or stable inheritance. Host organisms containing the transformed nucleic acid fragments are referred to as transgenic organisms.
[0116] As used herein, transgenic refers to a plant or a cell which comprises within its genome a heterologous polynucleotide. Preferably, the heterologous polynucleotide is stably integrated within the genome such that the polynucleotide is passed on to successive generations. The heterologous polynucleotide may be integrated into the genome alone or as part of an expression construct. Transgenic is used herein to include any cell, cell line, callus, tissue, plant part or plant, the genotype of which has been altered by the presence of heterologous nucleic acid including those transgenics initially so altered as well as those created by sexual crosses or asexual propagation from the initial transgenic. The term transgenic as used herein does not encompass the alteration of the genome (chromosomal or extra-chromosomal) by conventional plant breeding methods or by naturally occurring events such as random cross-fertilization, non-recombinant viral infection, non-recombinant bacterial transformation, non-recombinant transposition, or spontaneous mutation.
[0117] Antisense inhibition refers to the production of antisense RNA transcripts capable of suppressing the expression of the target protein. Co-suppression refers to the production of sense RNA transcripts capable of suppressing the expression of identical or substantially similar foreign or endogenous genes (U.S. Pat. No. 5,231,020). Co-suppression constructs in plants previously have been designed by focusing on overexpression of a nucleic acid sequence having homology to an endogenous mRNA, in the sense orientation, which results in the reduction of all RNA having homology to the overexpressed sequence (Vaucheret et al., Plant J. 16:651-659 (1998); Gura, Nature 404:804-808 (2000)). The overall efficiency of this phenomenon is low, and the extent of the RNA reduction is widely variable. More recent work has described the use of hairpin structures that incorporate all, or part, of an mRNA encoding sequence in a complementary orientation that results in a potential stem-loop structure for the expressed RNA (PCT Publication No. WO 99/53050, published Oct. 21, 1999; PCT Publication No. WO 02/00904, published Jan. 3, 2002). This increases the frequency of co-suppression in the recovered transgenic plants. Another variation describes the use of plant viral sequences to direct the suppression, or silencing, of proximal mRNA encoding sequences (PCT Publication No. WO 98/36083, published Aug. 20, 1998). Both of these co-suppressing phenomena have not been elucidated mechanistically, although genetic evidence has begun to unravel this complex situation (Elmayan et al., Plant Cell 10:1747-1757 (1998)).
[0118] The term oleaginous refers to those organisms that tend to store their energy source in the form of lipid (Weete, In: Fungal Lipid Biochemistry, 2.sup.nd Ed., Plenum, 1980). A class of plants identified as oleaginous are commonly referred to as oilseed plants. Examples of oilseed plants include, but are not limited to: soybean (Glycine and Soja sp.), flax (Linum sp.), rapeseed (Brassica sp.), maize, cotton, safflower (Carthamus sp.) and sunflower (Helianthus sp.).
[0119] Within oleaginous microorganisms the cellular oil or TAG content generally follows a sigmoid curve, wherein the concentration of lipid increases until it reaches a maximum at the late logarithmic or early stationary growth phase and then gradually decreases during the late stationary and death phases (Yongmanitchai and Ward, Appl. Environ. Microbiol. 57:419-25 (1991)).
[0120] The term oleaginous yeast refers to those microorganisms classified as yeasts that make oil. It is not uncommon for oleaginous microorganisms to accumulate in excess of about 25% of their dry cell weight as oil. Examples of oleaginous yeast include, but are no means limited to, the following genera: Yarrowia, Candida, Rhodotorula, Rhodosporidium, Cryptococcus, Trichosporon and Lipomyces.
[0121] The term plant refers to whole plants, plant organs, plant tissues, seeds, plant cells, seeds and progeny of the same. Plant cells include, without limitation, cells from seeds, suspension cultures, embryos, meristematic regions, callus tissue, leaves, roots, shoots, gametophytes, sporophytes, pollen and microspores.
[0122] Progeny comprises any subsequent generation of a plant.
[0123] Non-transgenic, null segregant soybean seed refers to a near isogenic plant or seed that lacks the transgene, and/or a parental plant used in the transformation process to obtain the transgenic event. Null segregants can be plants or seed that do not contain the transgenic trait due to normal genetic segregation during propagation of the heterozygous transgenic plants.
[0124] A kernel is the corn caryopsis, consisting of a mature embryo and endosperm which are products of double fertilization. The term corn or maize represents any variety, cultivar, or population of Zea mays L.
[0125] Grain comprises mature corn kernels produced by commercial growers for on farm use or for sale to customers in both cases for purposes other than growing or reproducing the species. The seed is the mature corn kernel produced for the purpose of propagating the species and for sale to commercial growers. As used herein the terms seeds, kernels, and grains can be used interchangeably. The embryo or also termed germ is a young sporophytic plant, before the start of a period of rapid growth (seed germination). The embryo (germ) of corn contains the vast majority of the oil found in the kernel. The structure of embryo in cereal grain includes the embryonic axis and the scutellum. The scutellum is the single cotyledon of a cereal grain embryo, specialized for absorption of the endosperm. The aleurone is a proteinaceous material, usually in the form of small granules, occurring in the outermost cell layer of the endosperm of corn and other grains.
[0126] The present invention concerns a transgenic soybean seed having increased total fatty acid content of at least 20% when compared to the total fatty acid content of a non-transgenic, null segregant soybean seed. It is understood that any measurable increase in the total fatty acid content of a transgenic versus a non-transgenic, null segregant would be useful. Such increases in the total fatty acid content would include, but are not limited to, at least 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, or 40%.
[0127] A transgenic oilseed of the invention can comprise a recombinant construct having at least one DGAT sequence. This DGAT sequence can be selected from the group consisting of DGAT1, DGAT2 and DGAT1 in combination with DGAT2. Furthermore, at least one DGAT sequence can be from Yarrowia. Examples of suitable DGAT sequences that can be used to practice the invention are discussed in the Examples below. There can be mentioned SEQ ID NOs:1, 9, 64, 66, 82, 87, and 92 in the present invention. Those skilled in the art will appreciate that the instant invention includes, but is not limited to, the DGAT sequences disclosed herein.
[0128] Such a recombinant construct promoter would comprise different components such as a promoter which is a DNA sequence that directs cellular machinery of a plant to produce RNA from the contiguous coding sequence downstream (3) of the promoter. The promoter region influences the rate, developmental stage, and cell type in which the RNA transcript of the gene is made. The RNA transcript is processed to produce mRNA which serves as a template for translation of the RNA sequence into the amino acid sequence of the encoded polypeptide. The 5 non-translated leader sequence is a region of the mRNA upstream of the protein coding region that may play a role in initiation and translation of the mRNA. The 3 transcription termination/polyadenylation signal is a non-translated region downstream of the protein coding region that functions in the plant cell to cause termination of the RNA transcript and the addition of polyadenylate nucleotides to the 3 end of the RNA.
[0129] The origin of the promoter chosen to drive expression of the DGAT coding sequence is not important as long as it has sufficient transcriptional activity to accomplish the invention by expressing translatable mRNA for the desired nucleic acid fragments in the desired host tissue at the right time. Either heterologous or non-heterologous (i.e., endogenous) promoters can be used to practice the invention. For example, suitable promoters include, but are not limited to: the alpha prime subunit of beta conglycinin promoter, the Kunitz trypsin inhibitor 3 promoter, the annexin promoter, the glycinin Gy1 promoter, the beta subunit of beta conglycinin promoter, the P34/Gly Bd m 30K promoter, the albumin promoter, the Leg A1 promoter and the Leg A2 promoter.
[0130] The annexin, or P34, promoter is described in PCT Publication No. WO 2004/071178 (published Aug. 26, 2004). The level of activity of the annexin promoter is comparable to that of many known strong promoters, such as: (1) the CaMV 35S promoter (Atanassova et al., Plant Mol. Biol. 37:275-285 (1998); Battraw and Hall, Plant Mol. Biol. 15:527-538 (1990); Holtorf et al., Plant Mol. Biol. 29:637-646 (1995); Jefferson et al., EMBO J. 6:3901-3907 (1987); Wilmink et al., Plant Mol. Biol. 28:949-955 (1995)); (2) the Arabidopsis oleosin promoters (Plant et al., Plant Mol. Biol. 25:193-205 (1994); Li, Texas A&M University Ph.D. dissertation, pp. 107-128 (1997)); (3) the Arabidopsis ubiquitin extension protein promoters (Callis et al., J Biol. Chem. 265(21):12486-93 (1990)); (4) a tomato ubiquitin gene promoter (Rollfinke et al., Gene. 211(2):267-76 (1998)); (5) a soybean heat shock protein promoter (Schoffl et al., Mol Gen Genet. 217(2-3):246-53 (1989)); and, (6) a maize H3 histone gene promoter (Atanassova et al., Plant Mol Biol. 37(2):275-85 (1989)).
[0131] Another useful feature of the annexin promoter is its expression profile in developing seeds. The annexin promoter is most active in developing seeds at early stages (before 10 days after pollination) and is largely quiescent in later stages. The expression profile of the annexin promoter is different from that of many seed-specific promoters, e.g., seed storage protein promoters, which often provide highest activity in later stages of development (Chen et al., Dev. Genet. 10:112-122 (1989); Ellerstrom et al., Plant Mol. Biol. 32:1019-1027 (1996); Keddie et al., Plant Mol. Biol. 24:327-340 (1994); Plant et al., (supra); Li, (supra)). The annexin promoter has a more conventional expression profile but remains distinct from other known seed specific promoters. Thus, the annexin promoter will be a very attractive candidate when overexpression, or suppression, of a gene in embryos is desired at an early developing stage. For example, it may be desirable to overexpress a gene regulating early embryo development or a gene involved in the metabolism prior to seed maturation.
[0132] Following identification of an appropriate promoter suitable for expression of a specific DGAT-coding sequence, the promoter is then operably linked in a sense orientation using conventional means well known to those skilled in the art.
[0133] Standard recombinant DNA and molecular cloning techniques used herein are well known in the art and are described more fully in Sambrook, J. et al., In Molecular Cloning: A Laboratory Manual; 2.sup.nd ed.; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, N.Y., 1989 (hereinafter Sambrook et al., 1989) or Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A. and Struhl, K., Eds.; In Current Protocols in Molecular Biology; John Wiley and Sons: New York, 1990 (hereinafter Ausubel et al., 1990).
[0134] This invention concerns a method for increasing the total fatty acid content of a soybean seed comprising:
[0135] (a) transforming at least one soybean cell with a recombinant construct having at least one DGAT sequence;
[0136] (b) selecting the transformed soybean cell(s) of step (a) having an increased total fatty acid content of at least 20% when compared to the total fatty acid content of a non-transgenic, null segregant soybean seed.
[0137] In another aspect, this invention concerns combining, either on the same construct, or a separate construct, at least on DGAT sequence with a construct causing the downregulation of plastidic phosphoglucomutase. The downregulation of plastidic phosphoglucomutase activity can occur by, but is not limited to, cosuppression, antisense, microRNA targeting, or translational inhibition.
[0138] Once the recombinant construct has been made, it may then be introduced into a plant cell of choice by methods well known to those of ordinary skill in the art (e.g., transfection, transformation and electroporation). Oilseed plant cells are the preferred plant cells. The transformed plant cell is then cultured and regenerated under suitable conditions permitting selection of those transformed soybean cell(s) having an increased total fatty acid content of at least 20% when compared to the total fatty acid content of a non-transgenic, null segregant soybean seed.
[0139] Such recombinant constructs may be introduced into one plant cell; or, alternatively, each construct may be introduced into separate plant cells.
[0140] Expression in a plant cell may be accomplished in a transient or stable fashion as is described above.
[0141] Also within the scope of this invention are seeds or plant parts obtained from such transformed plants.
[0142] Plant parts include differentiated and undifferentiated tissues including, but not limited to the following: roots, stems, shoots, leaves, pollen, seeds, tumor tissue and various forms of cells and culture (e.g., single cells, protoplasts, embryos and callus tissue). The plant tissue may be in plant or in a plant organ, tissue or cell culture.
[0143] The term plant organ refers to plant tissue or a group of tissues that constitute a morphologically and functionally distinct part of a plant. The term genome refers to the following: (1) the entire complement of genetic material (genes and non-coding sequences) that is present in each cell of an organism, or virus or organelle; and/or (2) a complete set of chromosomes inherited as a (haploid) unit from one parent.
[0144] Methods for transforming dicots (primarily by use of Agrobacterium tumefaciens) and obtaining transgenic plants have been published, among others, for: cotton (U.S. Pat. No. 5,004,863; U.S. Pat. No. 5,159,135); soybean (U.S. Pat. No. 5,569,834; U.S. Pat. No. 5,416,011); Brassica (U.S. Pat. No. 5,463,174); peanut (Cheng et al. Plant Cell Rep. 15:653-657 (1996); McKently et al. Plant Cell Rep. 14:699-703 (1995)); papaya (Ling, K. et al. Bio/technology 9:752-758 (1991)); and pea (Grant et al. Plant Cell Rep. 15:254-258 (1995)). For a review of other commonly used methods of plant transformation see Newell, C. A. (Mol. Biotechnol. 16:53-65 (2000)). One of these methods of transformation uses Agrobacterium rhizogenes (Tepfler, M. and Casse-Delbart, F. Microbiol. Sci. 4:24-28 (1987)). Transformation of soybeans using direct delivery of DNA has been published using PEG fusion (PCT Publication No. WO 92/17598), electroporation (Chowrira, G. M. et al., Mol. Biotechnol. 3:17-23 (1995); Christou, P. et al., Proc. Natl. Acad. Sci. U.S.A. 84:3962-3966 (1987)), microinjection and particle bombardement (McCabe, D. E. et. al., Bio/Technology 6:923 (1988); Christou et al., Plant Physiol. 87:671-674 (1988)).
[0145] There are a variety of methods for the regeneration of plants from plant tissue. The particular method of regeneration will depend on the starting plant tissue and the particular plant species to be regenerated. The regeneration, development and cultivation of plants from single plant protoplast transformants or from various transformed explants is well known in the art (Weissbach and Weissbach, In: Methods for Plant Molecular Biology, (Eds.), Academic: San Diego, Calif. (1988)). This regeneration and growth process typically includes the steps of selection of transformed cells and culturing those individualized cells through the usual stages of embryonic development through the rooted plantlet stage. Transgenic embryos and seeds are similarly regenerated. The resulting transgenic rooted shoots are thereafter planted in an appropriate plant growth medium such as soil. Preferably, the regenerated plants are self-pollinated to provide homozygous transgenic plants. Otherwise, pollen obtained from the regenerated plants is crossed to seed-grown plants of agronomically important lines. Conversely, pollen from plants of these important lines is used to pollinate regenerated plants. A transgenic plant of the present invention containing a desired polypeptide is cultivated using methods well known to one skilled in the art.
[0146] In addition to the above discussed procedures, practitioners are familiar with the standard resource materials which describe specific conditions and procedures for: the construction, manipulation and isolation of macromolecules (e.g., DNA molecules, plasmids, etc.); the generation of recombinant DNA fragments and recombinant expression constructs; and, the screening and isolating of clones. See, for example: Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor: NY (1989); Maliga et al., Methods in Plant Molecular Biology, Cold Spring Harbor: NY (1995); Birren et al., Genome Analysis: Detecting Genes, Vol. 1, Cold Spring Harbor: NY (1998); Birren et al., Genome Analysis: Analyzing DNA, Vol. 2, Cold Spring Harbor: NY (1998); Plant Molecular Biology: A Laboratory Manual, eds. Clark, Springer: NY (1997).
[0147] Examples of oilseed plants include, but are not limited to: soybean, Brassica species, sunflower, maize, cotton, flax and safflower.
[0148] As was discussed above, any of the transgenic oilseeds discussed herein can comprise a recombinant construct having at least one DGAT sequence. This DGAT sequence can be selected from the group consisting of DGAT1, DGAT2, or DGAT1 in combination with DGAT2. Furthermore, at least one DGAT sequence is from Yarrowia.
[0149] Transformation of monocotyledons using electroporation, particle bombardment, and Agrobacterium have been reported. Transformation and plant regeneration have been achieved in asparagus (Bytebier et al., Proc. Natl. Acad. Sci. (USA) 84:5354, (1987)); barley (Wan and Lemaux, Plant Physiol 104:37 (1994)); Zea mays (Rhodes et al., Science 240:204 (1988), Gordon-Kamm et al., Plant Cell 2:603-618 (1990), Fromm et al., BiolTechnology 8:833 (1990), Koziel et al., BiolTechnology 11: 194, (1993), Armstrong et al., Crop Science 35:550-557 (1995)); oat (Somers et al., BiolTechnology 10: 15 89 (1992)); orchard grass (Horn et al., Plant Cell Rep. 7:469 (1988)); rice (Toriyama et al., TheorAppl. Genet. 205:34, (1986); Part et al., Plant Mol. Biol. 32:1135-1148, (1996); Abedinia et al., Aust. J. Plant Physiol. 24:133-141 (1997); Zhang and Wu, Theor. Appl. Genet. 76:835 (1988); Zhang et al. Plant Cell Rep. 7:379, (1988); Battraw and Hall, Plant Sci. 86:191-202 (1992); Christou et al., Bio/Technology 9:957 (1991)); rye (De la Pena et al., Nature 325:274 (1987)); sugarcane (Bower and Birch, Plant J. 2:409 (1992)); tall fescue (Wang et al., BiolTechnology 10:691 (1992)), and wheat (Vasil et al., Bio/Technology 10:667 (1992); U.S. Pat. No. 5,631,152).
[0150] Assays for gene expression based on the transient expression of cloned nucleic acid constructs have been developed by introducing the nucleic acid molecules into plant cells by polyethylene glycol treatment, electroporation, or particle bombardment (Marcotte et al., Nature 335:454-457 (1988); Marcotte et al., Plant Cell 1:523-532 (1989); McCarty et al., Cell 66:895-905 (1991); Hattori et al., Genes Dev. 6:609-618 (1992); Goff et al., EMBO J. 9:2517-2522 (1990)).
[0151] Transient expression systems may be used to functionally dissect gene constructs (see generally, Maliga et al., Methods in Plant Molecular Biology, Cold Spring Harbor Press (1995)). It is understood that any of the nucleic acid molecules of the present invention can be introduced into a plant cell in a permanent or transient manner in combination with other genetic elements such as vectors, promoters, enhancers etc.
[0152] In addition to the above discussed procedures, practitioners are familiar with the standard resource materials which describe specific conditions and procedures for the construction, manipulation and isolation of macromolecules (e.g., DNA molecules, plasmids, etc.), generation of recombinant organisms and the screening and isolating of clones, (see for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press (1989); Maliga et al., Methods in Plant Molecular Biology, Cold Spring Harbor Press (1995); Birren et al., Genome Analysis: Detecting Genes, 1, Cold Spring Harbor, N.Y. (1998); Birren et al., Genome Analysis: Analyzing DNA, 2, Cold Spring Harbor, N.Y. (1998); Plant Molecular Biology: A Laboratory Manual, eds. Clark, Springer, New York (1997)).
[0153] The transgenic soybean seeds of the invention can be processed to yield soy oil, soy products and/or soy by-products.
[0154] Soy products can include, but are not limited to, those items listed in Table 1A.
TABLE-US-00002 TABLE 1A Soy Protein Products Derived from Soybean Seeds.sup.a Whole Soybean Products Roasted Soybeans Baked Soybeans Soy Sprouts Soy Milk Specialty Soy Foods/Ingredients Soy Milk Tofu Tempeh Miso Soy Sauce Hydrolyzed Vegetable Protein Whipping Protein Processed Soy Protein Products Full Fat and Defatted Flours Soy Grits Soy Hypocotyls Soybean Meal Soy Milk Soy Protein Isolates Soy Protein Concentrates Textured Soy Proteins Textured Flours and Concentrates Textured Concentrates Textured Isolates .sup.aSee Soy Protein Products: Characteristics, Nutritional Aspects and Utilization (1987). Soy Protein Council.
[0155] Processing refers to any physical and chemical methods used to obtain the products listed in Table 1A and includes, but is not limited to, heat conditioning, flaking and grinding, extrusion, solvent extraction, or aqueous soaking and extraction of whole or partial seeds. Furthermore, processing includes the methods used to concentrate and isolate soy protein from whole or partial seeds, as well as the various traditional Oriental methods in preparing fermented soy food products. Trading Standards and Specifications have been established for many of these products (see National Oilseed Processors Association Yearbook and Trading Rules 1991-1992). Products referred to as being high protein or low protein are those as described by these Standard Specifications. NSI refers to the Nitrogen Solubility Index as defined by the American Oil Chemists' Society Method Ac4 41. KOH Nitrogen Solubility is an indicator of soybean meal quality and refers to the amount of nitrogen soluble in 0.036 M KOH under the conditions as described by Araba and Dale [(1990) Poult. Sci. 69:76-83]. White flakes refer to flaked, dehulled cotyledons that have been defatted and treated with controlled moist heat to have an NSI of about 85 to 90. This term can also refer to a flour with a similar NSI that has been ground to pass through a No. 100 U.S. Standard Screen size. Cooked refers to a soy protein product, typically a flour, with an NSI of about 20 to 60. Toasted refers to a soy protein product, typically a flour, with an NSI below 20. Grits refer to defatted, dehulled cotyledons having a U.S. Standard screen size of between No. 10 and 80. Soy Protein Concentrates refer to those products produced from dehulled, defatted soybeans by three basic processes: acid leaching (at about pH 4.5), extraction with alcohol (about 55-80%), and denaturing the protein with moist heat prior to extraction with water. Conditions typically used to prepare soy protein concentrates have been described by Pass [(1975) U.S. Pat. No. 3,897,574; Campbell et al., (1985) in New Protein Foods, ed. by Altschul and Wilcke, Academic Press, Vol. 5, Chapter 10, Seed Storage Proteins, pp 302-338]. Extrusion refers to processes whereby material (grits, flour or concentrate) is passed through a jacketed auger using high pressures and temperatures as a means of altering the texture of the material. Texturing and structuring refer to extrusion processes used to modify the physical characteristics of the material. The characteristics of these processes, including thermoplastic extrusion, have been described previously [Atkinson (1970) U.S. Pat. No. 3,488,770, Horan (1985) In New Protein Foods, ed. by Altschul and Wilcke, Academic Press, Vol. 1A, Chapter 8, pp 367-414]. Moreover, conditions used during extrusion processing of complex foodstuff mixtures that include soy protein products have been described previously [Rokey (1983) Feed Manufacturing Technology III, 222-237; McCulloch, U.S. Pat. No. 4,454,804].
TABLE-US-00003 TABLE 1B Generalized Steps for Soybean Oil and Byproduct Production Process Impurities Removed and/or Step Process By-Products Obtained # 1 soybean seed # 2 oil extraction meal # 3 Degumming lecithin # 4 alkali or physical gums, free fatty acids, refining pigments # 5 water washing soap # 6 Bleaching color, soap, metal # 7 (hydrogenation) # 8 (winterization) stearine # 9 Deodorization free fatty acids, tocopherols, sterols, volatiles # 10 oil products
[0156] More specifically, soybean seeds are cleaned, tempered, dehulled, and flaked, thereby increasing the efficiency of oil extraction. Oil extraction is usually accomplished by solvent (e.g., hexane) extraction but can also be achieved by a combination of physical pressure and/or solvent extraction. The resulting oil is called crude oil. The crude oil may be degummed by hydrating phospholipids and other polar and neutral lipid complexes that facilitate their separation from the nonhydrating, triglyceride fraction (soybean oil). The resulting lecithin gums may be further processed to make commercially important lecithin products used in a variety of food and industrial products as emulsification and release (i.e., antisticking) agents. Degummed oil may be further refined for the removal of impurities (primarily free fatty acids, pigments and residual gums). Refining is accomplished by the addition of a caustic agent that reacts with free fatty acid to form soap and hydrates phosphatides and proteins in the crude oil. Water is used to wash out traces of soap formed during refining. The soapstock byproduct may be used directly in animal feeds or acidulated to recover the free fatty acids. Color is removed through adsorption with a bleaching earth that removes most of the chlorophyll and carotenoid compounds. The refined oil can be hydrogenated, thereby resulting in fats with various melting properties and textures. Winterization (fractionation) may be used to remove stearine from the hydrogenated oil through crystallization under carefully controlled cooling conditions. Deodorization (principally via steam distillation under vacuum) is the last step and is designed to remove compounds which impart odor or flavor to the oil. Other valuable byproducts such as tocopherols and sterols may be removed during the deodorization process. Deodorized distillate containing these byproducts may be sold for production of natural vitamin E and other high-value pharmaceutical products. Refined, bleached, (hydrogenated, fractionated) and deodorized oils and fats may be packaged and sold directly or further processed into more specialized products. A more detailed reference to soybean seed processing, soybean oil production, and byproduct utilization can be found in Erickson, Practical Handbook of Soybean Processing and Utilization, The American Oil Chemists' Society and United Soybean Board (1995). Soybean oil is liquid at room temperature because it is relatively low in saturated fatty acids when compared with oils such as coconut, palm, palm kernel, and cocoa butter.
[0157] Plant and microbial oils containing PUFAs that have been refined and/or purified can be hydrogenated, thereby resulting in fats with various melting properties and textures. Many processed fats (including spreads, confectionary fats, hard butters, margarines, baking shortenings, etc.) require varying degrees of solidity at room temperature and can only be produced through alteration of the source oil's physical properties. This is most commonly achieved through catalytic hydrogenation.
[0158] Hydrogenation is a chemical reaction in which hydrogen is added to the unsaturated fatty acid double bonds with the aid of a catalyst such as nickel. For example, high oleic soybean oil contains unsaturated oleic, linoleic, and linolenic fatty acids, and each of these can be hydrogenated. Hydrogenation has two primary effects. First, the oxidative stability of the oil is increased as a result of the reduction of the unsaturated fatty acid content. Second, the physical properties of the oil are changed because the fatty acid modifications increase the melting point resulting in a semi-liquid or solid fat at room temperature.
[0159] There are many variables which affect the hydrogenation reaction, which in turn alter the composition of the final product. Operating conditions including pressure, temperature, catalyst type and concentration, agitation, and reactor design are among the more important parameters that can be controlled. Selective hydrogenation conditions can be used to hydrogenate the more unsaturated fatty acids in preference to the less unsaturated ones. Very light or brush hydrogenation is often employed to increase stability of liquid oils. Further hydrogenation converts a liquid oil to a physically solid fat. The degree of hydrogenation depends on the desired performance and melting characteristics designed for the particular end product. Liquid shortenings (used in the manufacture of baking products, solid fats and shortenings used for commercial frying and roasting operations) and base stocks for margarine manufacture are among the myriad of possible oil and fat products achieved through hydrogenation. A more detailed description of hydrogenation and hydrogenated products can be found in Patterson, H. B. W., Hydrogenation of Fats and Oils: Theory and Practice. The American Oil Chemists' Society (1994).
[0160] Hydrogenated oils have become somewhat controversial due to the presence of trans-fatty acid isomers that result from the hydrogenation process. Ingestion of large amounts of trans-isomers has been linked with detrimental health effects including increased ratios of low density to high density lipoproteins in the blood plasma and increased risk of coronary heart disease.
EXAMPLES
[0161] The present invention is further defined in the following Examples, in which parts and percentages are by weight and degrees are Celsius, unless otherwise stated. It should be understood that these Examples, while indicating preferred embodiments of the invention, are given by way of illustration only. From the above discussion and these Examples, one skilled in the art can ascertain the essential characteristics of this invention, and without departing from the spirit and scope thereof, can make various changes and modifications of the invention to adapt it to various usages and conditions. Thus, various modifications of the invention in addition to those shown and described herein will be apparent to those skilled in the art from the foregoing description. Such modifications are also intended to fall within the scope of the appended claims.
[0162] The meaning of abbreviations is as follows: sec means second(s), min means minute(s), h means hour(s), d means day(s), L means microliter(s), mL means milliliter(s), L means liter(s), M means micromolar, mM means millimolar, M means molar, mmol means millimole(s), mole mean micromole(s), g means gram(s), g means microgram(s), ng means nanogram(s), U means unit(s), bp means base pair(s) and kB means kilobase(s).
Example 1
Expression of Yarrowia lipolytica DGAT Genes in Saccharomyces cerevisiae
[0163] The DGAT1 gene (SEQ ID NO:1) of Yarrowia lipolytica was excised from plasmid vector pYDA1 (SEQ ID NO:2) by restriction digestion with NcoI and NotI. The ends of DNA fragment were completely filled in using T4 DNA polymerase (Promega, Madison, Wis., USA) and ligated into the unique Not I site of pY75 (SEQ ID NO:3). Prior to its use for cloning the pY75 vector had been linearized with NotI, filled in with T4 DNA polymerase and dephosphorylated with shrimp alkaline phosphatase (NEB, Beverly, Mass., USA). Plasmid DNA was isolated using standard techniques and restriction digests with EcoRI were conducted to identify plasmid clones in which the start codon was in proximity to the 3 end of the GPD promoter in pY75 (sense orientation of the DGAT1 gene). This plasmid is henceforth referred to as pY75 YL DGAT1 (SEQ ID NO:4). The construction of pYDA1 is described in PCT Publication No. WO 2006/052914, which is hereby incorporated as reference.
[0164] The yeast episomal plasmid (YEp)-type vector pRS425 (SEQ ID NO:5) (Christianson et al., Gene 110:119-122 (1992)) contains sequences from the Saccharomyces cerevisiae 2 micron endogenous plasmid, a LEU2 selectable marker and sequences based on the backbone of a multifunctional phagemid, pBluescript II SK(+). The Saccharomyces cerevisiae strong, constitutive glyceraldehyde-3-phosphate dehydrogenase (GPD) promoter was cloned between the SacII and SpeI sites of pRS425 in the same way as described by Jia et al. (Physiol. Genomics 3:83-92 (2000)) to produce pGPD-425 (SEQ ID NO:6). A NotI site was introduced into the BamHI site of pGPD-425, thus giving a NotI site flanked by BamHI sites, and this plasmid was called pY75 (SEQ ID NO:3)
[0165] The DGAT2 gene was PCR amplified from the genome of Yarrowia lipolytica (ATCC Accession No. 20362) as follows. Yeast cells were grown on solid YPD medium for 72 h. Cells were resuspended in 200 L of DNA extraction buffer (100 mM Tris pH 7.5, 10 mM EDTA, 100 mM NaCl, 0.1% Triton X-100) and supplemented with 2-5 glass beads (3 mm diameter) and approximately 0.1 g of glass beads (0.5 mm diameter). The yeast cell suspension was mixed vigorously using a vortex mixer and incubated at 75 C. for 25 min. The lysate was cooled to room temperature and cleared by centrifugation.
[0166] The following two oligonucleotide primers were used to generate a PCR fragment of approximately 1600 bp:
TABLE-US-00004 oYLDGAT2-1: (SEQIDNO:7) GCGGCCGCATGACTATCGACTCACAATACTACAAGT, and oYLDGAT2-2: (SEQIDNO:8) GCGGCCGCTTACTCAATCATTCGGAACTCTGGGGCT.
Briefly, a PCR reaction mixture (100 L) containing 2.5 mM MgCl.sub.2, 2 mM dNTPs, 10 mM Tris/HCl (pH 8.8), 50 mM KCl, 0.08% Nonidet P40, 1 M of oYLDGAT2-1 (SEQ ID NO:7) and oYLDGAT2-2 (SEQ ID NO:8), 10 U Taq polymerase (Fermentas, Hanover, Md.), and 2 L of yeast lysate was created. The PCR mixture was divided into four 25 L aliquots and amplification was carried out for 35 cycles, each comprising 45 sec at 94 C., 45 sec at the respective annealing temperature, and 1 min at 72 C. PCR products were gel-purified and cloned into pGEM T-easy (Promega) using manufacturer instructions.
[0167] Ten independent plasmid clones were completely sequenced. The consensus sequence of this analysis is set forth as SEQ ID NO:9. This DNA sequence differs from the DGAT2 sequence disclosed in PCT Publication No. WO 2005/003322 at two different nucleotide positions. The difference in DNA sequence affects nt 448 and nt 672 of the DGAT2 open reading frame. The former nt difference changes the predicted amino acid sequence of the DGAT protein. It replaces a serine found in the DGAT sequence disclosed in PCT Publication No. WO 2005/003322 with a threonine residue. The second sequence difference does not change the amino acid sequence from the one disclosed in PCT Publication No. WO 2005/003322. The difference between the Yarrowia lipolytica DGAT2 sequence disclosed herein and that of PCT Publication No. WO 2005/003322 can be attributed to the different Yarrowia lipolytica strains that were used for DGAT2 gene isolation. The predicted amino acid sequence of the DGAT protein of strain ATCC Accession No. 20362 is set forth as SEQ ID NO:10.
[0168] The DGAT gene (SEQ ID NO:9) was excised as a Not I restriction fragment from the pGEM T-easy vector and ligated to NotI linearized, dephosphorylated DNA of pY75 (SEQ ID NO:3). Plasmid DNA was isolated form recombinant clones and restriction digestion with SacI and PacI allowed to identify clones in which the start codon of the DGAT2 gene was in proximity to the 3 end of the GPD promoter in pY75 (sense orientation of the DGAT2 gene). This plasmid is henceforth referred to as pY75 YL DGAT2 (SEQ ID NO:11).
[0169] Plasmid DNA of pY75 YL DGAT1 (SEQ ID NO:4) and the empty pY75 vector were transformed into the Saccharomyces cerevisiae stain INVSC1 (Invitrogen, USA) using standard methods (Gietz, R. Daniel; Woods, Robin A., Meth. Enzymol. 350:87-96 (2002)). Recombinant yeast colonies were selected on DOBA media supplemented with CSM-leu (Qbiogene, Carlsbad, Calif.). Five 50 mL cultures of DOBA media supplemented with CSM-leu were inoculated with five independently generated colonies and grown and 30 C. for 72 h. Cells were harvested by centrifugation and resuspended in medium identical to the DOBA medium described above with the exception that ammonium sulfate as nitrogen source was omitted. Cultures were grown for additional 60 h, cells were harvested by centrifugation. Cells were frozen on dry ice and lyophilized.
[0170] Total fatty acid content of each yeast cell sample was measured in triplicates as follows. Approximately 5-15 mg of yeast powder were weighed into the bottom of a 13100 mm glass culture tube with screw cap and Teflon seal. 5 L of a stock solution of 17:0 TAG (10 mg/mL in toluene) was added followed by addition of 500 L 5% sulfuric acid in methanol (anhydrous). Samples were incubated at 95 C. for 1.5 h. Subsequently, tubes were allowed to cool to room temperature after which 1 mL of 1 M sodium chloride was added followed by mixing. 1 mL of heptane was added, contents were mixed and samples were spun briefly to mediate phase separation. Approximately 500 L of the organic phase was transferred to a GC vial. Fatty acid methyl esters were analyzed by gas chromatography. 4 L of heptane extract were analyzed on Hewlett-Packard 6890 Gas Chromatograph fitted with an Omegawax 320 fused silica capillary column (Supelco Inc., Catalog No. 24152). The oven temperature was programmed to hold at 220 C. for 2.7 min, increase to 240 C. at 20 C/min and then hold for an additional 2.3 min. Carrier gas was supplied by a Whatman hydrogen generator. Retention times were compared to those for methyl esters of standards commercially available (Nu-Chek Prep, Inc. catalog #U-99-A).
[0171] Plasmid DNA of pY75 YL DGAT2 (SEQ ID NO:11) and the empty pY75 vector were transformed into the Saccharomyces cerevisiae strain INVSC1 and total fatty acid content of recombinant yeast cultures was analyzed as described previously. The findings related to over expression of both DGAT genes in yeast are summarized in TABLE 2.
TABLE-US-00005 TABLE 2 Total Fatty Acid Content of Saccharomyces cerevisea Cultures % % % % average stdv palmitic palmitoleic stearic oleic FAME FAME FAME acid acid acid acid (% DCW) stdv (% DCW) (% DCW) pY75 YL 19.1 38.4 7.5 34.9 12.8 2.2 DGAT1 19.4 38.8 7.4 34.3 12.3 0.4 19.2 38.4 7.6 34.8 12.2 0.4 19.3 38.6 7.5 34.6 11.5 0.1 19.1 38.3 7.7 34.9 10.9 0.6 11.9 0.8 pY75 17.9 37.8 7.9 36.4 10.7 1.0 18.2 38.2 7.8 35.8 9.7 0.6 17.9 41.0 6.8 34.2 8.7 0.3 17.2 40.5 6.9 35.4 8.7 0.6 18.1 41.1 6.9 33.9 8.5 0.2 9.3 0.9 pY75 YL 31.8 34.0 14.2 20.0 17.1 0.2 DGAT2 31.4 33.1 14.8 20.6 15.9 0.6 30.7 32.8 14.7 21.8 13.6 1.1 28.9 34.2 13.5 23.5 12.4 1.4 29.2 34.1 13.5 23.1 11.8 1.7 14.2 2.3 pY75 19.7 37.0 9.6 33.7 7.0 0.4 20.0 36.4 9.8 33.7 6.8 0.0 19.6 37.0 9.6 33.8 6.6 0.6 19.7 37.1 9.5 33.6 6.4 0.2 19.3 36.9 9.7 34.1 6.4 0.3 6.6 0.2
[0172] TABLE 2 shows that there is a significant increase of total fatty acids in yeast cells harboring the pY75 YL DGAT1 (SEQ ID NO:4) compared to cells that only contain the empty pY75 plasmid. The average fatty acid dry cell weight (DCW) percentage of five independent cultures is 11.9% compared to 9.3% for vector controls grown under identical conditions. In summary, there is a 28% increase in total fatty acid production. Moreover, there is a slight alteration in the fatty acid profile associated with YL DGAT1 expression characterized by an increase in palmitic acid.
[0173] Constitutive expression of YL DGAT2 under nitrogen starvation increased total fatty acid content by 110% compared to a vector control grown under identical conditions. Total fatty acid content of the vector only control was 6.6% whereas the average fatty acid content of the YL DGAT2 transformants was 14.2%. The fatty acid profile changed as result of YL DGAT2 expression. Palmitic acid content increased significantly accompanied by a moderate decrease in palmitoleic. In addition, stearic acid content increased significantly accompanied by a clear decrease in oleic content. Taken together the results show that YL DGATs over-expression in yeast under conditions of increased carbon/nitrogen ratios lead to increased fatty acid accumulation. The overexpressed YL DGAT enzymes are able to augment endogenous DGAT activity in Saccharomyces cerevisiae. Similar experiments were repeated with both DGAT genes two more times. A difference in fatty acid content between YL DGAT culture and vector control could be observed every time and was at least 8% and 14.3% for YL DGAT1 (SEQ ID NO: 1) and YL DGAT2 (SEQ ID NO:9), respectively.
Example 2
Cloning the Yarrowia lipolytica DGAT1 And DGAT2 into Yarrowia lipolytica Expression Vectors
[0174] The present Example describes the generation of pFBAIN-YDG1 and pFBAIN-YDG2, comprising a chimeric FBAINm::YDGAT1::PEX20 gene and a chimeric FBAINm::YDGAT2::PEX20 gene, respectively (
[0175] Oligonucleotides YDGAT1-F (SEQ ID NO:12) and YDGAT-R (SEQ ID NO:13) were designed and synthesized to allow amplification of the DGAT1 ORF from Yarrowia lipolytica genomic DNA (isolated from strain ATCC Accession No. 20362, purchased from the American Type Culture Collection (Rockville, Md.)), while oligonucleotides YDGAT2-F (SEQ ID NO:14) and YDGAT2-R (SEQ ID NO:15) were designed and synthesized to allow the amplification of the DGAT2 ORF.
[0176] The PCR reactions, with Yarrowia lipolytica genomic DNA as template, were individually carried out in a 50 L total volume comprising: 1 L each of 20 M forward and reverse primers, 1 L genomic DNA (100 ng), 10 L 5PCR buffer, 1 L dNTP mix (10 M each), 35 L water and 1 L Phusion polymerase (New England Biolabs, Inc., Ipswich, Mass.). Amplification was carried out at 98 C. for 1 min, followed by 30 cycles at 98 C. for 10 sec, 55 C. for 10 sec, and 72 C. for 30 sec, followed by a final elongation cycle at 72 C. for 5 min. A 1603 bp DNA fragment (SEQ ID NO:16) and a 1567 bp fragment (SEQ ID NO:17) were generated that contained the DGAT1 and DGAT2 ORFs, respectively.
[0177] The PCR fragments were purified with Qiagen PCR purification kits following the manufacturer's protocol. Purified DNA samples were digested with NcoI and NotI, purified with a Qiagen reaction clean-up kit, and then directionally ligated with NcoI/NotI digested pFBAIN-MOD-1 (
[0178] Thus, pFBAIN-YDG1 (
TABLE-US-00006 TABLE 3 Components of Plasmid pFBAIN-YDG1 (SEQ ID NO: 19) RE Sites And Nucleotides Within Description of Fragment and SEQ ID NO: 19 Chimeric Gene Components BglII-BsiWI FBAINm::YDG1::PEX20, comprising: (6040-301) FBAINm: Yarrowia lipolytica FBAINm promoter (PCT Publication No. WO 2005/049805) YDG1: Y. lipolytica DGAT1 ORF (SEQ ID NO: 16) Pex20: Pex20 terminator sequence of Yarrowia Pex20 gene (GenBank Accession No. AF054613) PacI-BglII Yarrowia URA3 (GenBank Accession No. AJ306421) (4533-6040) (3123-4487) Yarrowia autonomous replicating sequence 18 (ARS18; GenBank Accession No. M91600 and No. A17608) (2464-2864) f1 origin (1424-2284) ampicillin-resistance gene (Amp.sup.R) for selection in E. coli (474-1354) ColE1 plasmid origin of replication
Plasmid pFBAIN-YDG2 (
[0179] The term FBAINm promoter or FBAINm promoter region is a modified version of the FBAIN promoter (infra), wherein FBAINm has a 52 bp deletion between the ATG translation initiation codon and the intron of the FBAIN promoter (thereby including only 22 amino acids of the N-terminus) and a new translation consensus motif after the intron. Furthermore, while the FBAIN promoter generates a fusion protein when fused with the coding region of a gene to be expressed, the FBAINm promoter does not generate such a fusion protein. The FBAIN promoter refers to the 5 upstream untranslated region in front of the ATG translation initiation codon of the Yarrowia lipolytica fructose-bisphosphate aldolase enzyme (E.C. 4.1.2.13) encoded by the fba1 gene and that is necessary for expression, plus a portion of 5 coding region that has an intron of the fba1 gene. These promoters are described in detail in PCT Publication No. WO 2005/049805 and U.S. Pat. No. 7,202,356, which are hereby incorporated by reference in their entirety.
Example 3
Overexpression of Yarrowia lipolytica DGAT1 and DGAT2 Genes in Yarrowia lipolytica Strain Y2224
[0180] The present Example describes increased fatty acid content, and modification to the relative abundance of each fatty acid species, in Yarrowia lipolytica strain Y2224 that was transformed to co-express either the Yarrowia lipolytica DGAT1 (SEQ ID NO:16) or the Yarrowia lipolytica DGAT2 (SEQ ID NO:17). Strain Y2224 is a FOA resistant mutant from an autonomous mutation of the Ura3 gene of wild type Yarrowia strain ATCC Accession No. 20362.
[0181] Generation of Strain Y2224:
[0182] Strain Y2224 was isolated in the following manner: Yarrowia lipolytica ATCC Accession No. 20362 cells from a YPD agar plate (1% yeast extract, 2% bactopeptone, 2% glucose, 2% agar) were streaked onto a minimal media plate (75 mg/L each of uracil and uridine, 6.7 g/L YNB with ammonia sulfate, without amino acid, and 20 g/L glucose) containing 250 mg/L 5-FOA (5-fluorouracil-6-carboxylic acid monohydrate; Zymo Research). Plates were incubated at 28 C. and four of the resulting colonies were patched separately onto minimal media (MM) plates containing 200 mg/mL 5-FOA and MM plates lacking uracil and uridine to confirm uracil Ura3 auxotrophy.
[0183] Transformation of Strain Y2224:
[0184] A clone of pFBAIn-YDG1, a clone of pFBAIn-YDG2 and control plasmid pFBAIN-MOD-1 were transformed into Yarrowia lipolytica strain Y2224 as described below.
[0185] Transformation of Yarrowia lipolytica was performed according to the method of Chen, D. C. et al. (Appl. Microbiol Biotechnol. 48(2):232-235 (1997)), unless otherwise noted. Briefly, Yarrowia was streaked onto a YPD agar plate and grown at 30 C. for approximately 18 h. Several large loopfuls of cells were scraped from the plate and resuspended in 1 mL of transformation buffer containing: 2.25 mL of 50% PEG, average MW 3350; 0.125 mL of 2 M lithium acetate, pH 6.0; 0.125 mL of 2 M DTT; and 50 g sheared salmon sperm DNA. Then, approximately 500 ng of linearized plasmid DNA was incubated in 100 L of resuspended cells, and maintained at 39 C. for 1 h with vortex mixing at 15 min intervals.
[0186] The cells from each transformation were plated onto minimal media (MM) plates lacking uracil (0.17% yeast nitrogen base (DIFCO Laboratories, Detroit, Mich.) without ammonium sulfate or amino acids, 2% glucose, 0.1% proline, pH 6.1, 20 g/L agar) and maintained at 30 C. for 2 days. Three transformants from each transformation plate were used to inoculate individual 25 mL culture in MM medium (0.17% yeast nitrogen base (DIFCO Laboratories) without ammonium sulfate or amino acids, 2% glucose, 0.1% proline, pH 6.1). Each culture was allowed to grow for 2 days at 30 C., then switched into 25 mL of high glucose medium (HG medium, comprising 80 g/L glucose, 27 g/L K.sub.2HPO.sub.4, 6.3 g/L KH.sub.2PO.sub.4, pH 7.5) and allowed to grow for 5 days at 30 C.
[0187] Lipid Analysis:
[0188] Total lipids were extracted, and fatty acid methyl esters (FAMEs) were prepared by trans-esterification, and subsequently analyzed with a Hewlett-Packard 6890 GC.
[0189] More specifically, for fatty acid analysis, cells were collected by centrifugation and lipids were extracted as described in Bligh, E. G. & Dyer, W. J. (Can. J. Biochem. Physiol. 37:911-917 (1959)). Fatty acid methyl esters were prepared by transesterification of the lipid extract with sodium methoxide (Roughan, G. and Nishida I., Arch Biochem Biophys. 276(1):38-46 (1990)) and subsequently analyzed with a Hewlett-Packard 6890 GC fitted with a 30-m0.25 mm (i.d.) HP-INNOWAX (Hewlett-Packard) column. The oven temperature was from 170 C. (25 min hold) to 185 C. at 3.5 C./min.
[0190] For direct base transesterification, Yarrowia culture (3 mL) was harvested, washed once in distilled water, and dried under vacuum in a Speed-Vac for 5-10 min. Sodium methoxide (100 L of 1%) was added to the sample, and then the sample was vortexed and rocked for 20 min. After adding 3 drops of 1 M NaCl and 400 L hexane, the sample was vortexed and spun. The upper layer was removed and analyzed by GC as described above.
[0191] Based on the above analyses, lipid content and composition was determined in transformant strains of Y2224, comprising pFBAIn-YDG1, pFBAIn-YDG2 and pFBAIN-MOD-1 (control), respectively, as shown below in TABLE 4. Three independent transformants of each strain were analyzed, while the average results are shown in the rows highlighted in grey. Fatty acids are identified as 16:0 (palmitate), 16:1 (palmitoleic acid), 18:0, 18:1 (oleic acid) and 18:2 (LA); and the composition of each is presented as a % of the total fatty acids.
[0192] % FAME/DCW represents the percent fatty acid methyl ester/dry cell weight. Dry cell weight was determined by collecting cells from 10 mL of culture via centrifugation, washing the cells with water once to remove residue medium, drying the cells in a vacuum oven at 80 C. overnight, and weighing the dried cells. The total amount of fatty acid methyl esters in a sample was determined by comparing the areas of all peaks in the GC profile with the peak area of an added known amount of internal standard C15:0 fatty acid.
TABLE-US-00007 TABLE 4 Lipid Content A\and Composition in Yarrowia Strain Y2224 Overexpressing YDGAT1 And YDGAT2 % FAME/ Sample Plasmid DCW 16:0 16:1 18:0 18:1 18:2 1 pFBAln-MOD-1 21.91 15.96 16.41 6.01 40.28 18.36 2 pFBAln-MOD-1 23.98 16.72 15.90 5.97 39.64 18.21 3 pFBAln-MOD-1 18.27 14.42 15.74 5.59 41.07 19.89 Avg. Avg. 21.39 15.70 16.02 5.86 40.33 18.82 1-3 pFBAln-MOD-1 4 pFBAln-YDG1 22.50 15.76 16.74 5.95 40.72 17.79 5 pFBAln-YDG1 24.38 14.76 18.86 4.60 43.90 15.89 6 pFBAln-YDG1 24.22 15.20 18.42 4.66 43.20 16.1 Avg. Avg. 23.70 15.24 18.01 5.97 42.61 16.59 4-6 pFBAln-YDG1 7 pFBAln-YDG2 23.51 13.56 13.55 7.70 46.20 16.45 8 pFBAln-YDG2 29.30 15.10 12.87 8.00 45.49 15.24 9 pFBAln-YDG2 29.15 14.57 13.74 8.44 47.00 13.79 Avg. Avg. 27.32 14.41 13.38 8.05 46.23 15.16 7-9 pFBAln-YDG2
[0193] GC analyses showed that there was a significant increase of total fatty acids in cells carrying pFBAIn-YDG1, as compared to cells carrying pFBAIn-MOD-1. The average fatty acid increased from 21.39% FAME/DCW in the control to 23.70% FAME/DCW in cells expressing YDGAT1 (i.e., a 10.8% increase). Furthermore, there was also an increase in the amount of C16:1 and C18:1 fatty acids and a decrease of C18:2 fatty acid (TABLE 4).
[0194] Cells carrying pFBAIn-YDG2 also had a large increase in total fatty acid content relative to the control, resulting in an average of 27.32% FAME/DCW (representing an increase of 27.7%). The distribution of fatty acid species also changed significantly. Specifically, the amount of C18:0 and C18:1 was increased, whereas the amount of C16:0, C16:1 and C18:2 decreased.
[0195] Collectively, these results demonstrate that overexpression of the Yarrowia lipolytica DGAT1 or DGAT2 impacts both total lipid content and the relative abundance of each fatty acid species.
Example 4
Expression of Yarrowia lipolytica DGAT Genes in Arabidopsis Seed
[0196] A binary vector suitable for agrobacterium-mediated transformation was generated as follows. Various restriction sites were added, through a number of cloning steps, to the ends of the Bcon/NotI/Phas3 cassette from KS123 (SEQ ID NO:21), which was previously described in PCT Publication No. WO 02/008269 (the contents of which are hereby incorporated by reference). Briefly, a DNA fragment (cal a24-4; SEQ ID NO:22) was amplified from plasmid CalFad2-2 (described in PCT Publication No. WO 01/12800) using primers oCal-15 (SEQ ID NO:23) and oCal-6 (SEQ ID NO:24). DNA fragment cal a24-4 (SEQ ID NO:22) was digested with BglII and BamHI and cloned into the BamHI site of pKS123 to give pKR53B (SEQ ID NO:25). The XbaI/SbfI fragment of pKR53B, containing the Bcon/NotI/Phas3 cassette was cloned into the XbaI/SbfI fragment of pKR72 (ATCC Accession No. PTA-6019; SEQ ID NO:26) containing the bacterial hygromycin phosphotransferase gene, to give pKR85 (SEQ ID NO:27). The features of pKR72 are as follows. A starting plasmid pKR72 (ATCC Accession No. PTA-6019; SEQ ID NO:26), a derivative of pKS123 which was previously described in PCT Publication No. WO 02/008269 (the contents of which are hereby incorporated by reference), contains the hygromycin B phosphotransferase gene (HPT) (Gritz, L. and Davies, J., Gene 25:179-188 (1983)), flanked by the T7 promoter and transcription terminator (T7prom/hpt/T7term cassette), and a bacterial origin of replication (ori) for selection and replication in bacteria (e.g., E. coli). In addition, pKR72 also contains the hygromycin B phosphotransferase gene, flanked by the 35S promoter (Odell et al., Nature 313:810-812 (1985)) and NOS 3 transcription terminator (Depicker et al., J. Mol. Appl. Genet. 1:561-570 (1982)) (35S/hpt/NOS3 cassette) for selection in plants such as soybean. pKR72 also contains a NotI restriction site, flanked by the promoter for the subunit of -conglycinin (Beachy et al., EMBO J. 4:3047-3053 (1985)) and the 3 transcription termination region of the phaseolin gene (Doyle et al., J. Biol. Chem. 261:9228-9238 (1986)), thus allowing for strong tissue-specific expression in the seeds of soybean of genes cloned into the NotI site.
[0197] The Bcon/NotI/Phas3 cassette was amplified from plasmid pKR85 (SEQ ID NO:27) using primers oKR85-1 (SEQ ID NO:28) and oKR85-2 (SEQ ID NO:29) and the resulting DNA fragment was cloned into PCR-Script (Stratgene) following the manufacture's protocol, to give pPCR85 (SEQ ID NO:30).
[0198] The EcoRI/BglII fragment of pPCR85, containing the Bcon/NotI/Phas3 cassette was cloned into the EcoRI/BamHI fragment of plasmid pZS199 (PCT Publication No. WO 93/11245; also U.S. Pat. No. 5,952,544 which was published on Jun. 10, 1993; the disclosures of which are hereby incorporated by reference), containing the Arabidopsis binary vector backbone to produce pKR91 (SEQ ID NO:31).
[0199] The Bcon/NotI/Phas3 cassette was removed from pKR91 by digestion with AscI and the re-ligated binary vector containing a unique AscI cloning site was produced called pKR92 (SEQ ID NO:32).
Construction of pKR92 YL DGAT2:
[0200] The construction of expression plasmid KS362 is described in Example 5. An expression cassette which harbors the YL DGAT2 gene, fused to betaconglycinin promoter and the phaseolin terminator and DsRed gene fused to Kti promoter and terminator sequences was excised from KS362 as a 6.4 kb AscI fragment. This DNA was ligated to AscI linearized, dephosphorylated pKR92 vector DNA to give pKR92 YL DGAT2 (SEQ ID NO:33).
Construction of pKR92 YL DGAT1/YL DGAT2:
[0201] The construction of expression plasmid KS364 is described in Example 5. An expression cassette in which YL DGAT1 (SEQ ID NO:1) and YL DGAT2 (SEQ ID NO:9) genes are fused to identical sequence of the phaseolin terminator and to glycinin 1 and betaconglycinin promoters respectively was excised from KS364 as a 7 kb AscI fragment. This DNA was ligated to AscI linearized, dephosphorylated pKR92 vector DNA to give pKR92 YL DGAT1/YL DGAT2 (SEQ ID NO:34)
Generation and Analysis of transgenic Arabidospis Lines:
[0202] Plasmid DNA of pKR92 YL DGAT2 and pKR92 YL DGAT1/YL DGAT2 was introduced into Agrobacterium tumefaciens NTL4 (Luo et al, Molecular Plant-Microbe Interactions 14(1):98-103 (2001)) by electroporation. Briefly, 1 g plasmid DNA was mixed with 100 L of electro-competent cells on ice. The cell suspension was transferred to a 100 L electro oration curette (1 mm gap width) and electro orated using a BIORAD electro orator set to 1 kV, 400 and 25 F. Cells were transferred to 1 mL LB medium and incubated for 2 h at 30 C. Cells were plated onto LB medium containing 50 g/mL kanamycin. Plates were incubated at 30 C. for 60 h. Recombinant agrobacterium cultures (500 mL LB, 50 g/mL kanamycin) were inoculated from single colonies of transformed agrobacterium cells and grown at 30 C. for 60 h. Cells were harvested by centrifugation (5000g, 10 min) and resuspended in 1 L of 5% (W/V) sucrose containing 0.05% (V/V) Silwet. Arabidopsis plants were grown in soil at a density of 30 plants per 100 cm.sup.2 pot in metromix 360 soil mixture for 4 weeks (22 C., permanent light, 100 E m.sup.2s.sup.1). Plants were repeatedly dipped into the agrobacterium suspension harboring the binary vectors and kept in a dark, high humidity environment for 24 h. Plants were grown for four to five weeks under standard plant growth conditions described above and plant material was harvested and dried for one week at ambient temperatures in paper bags. Seeds were harvested using a 0.425 mm mesh brass sieve.
[0203] Cleaned Arabidopsis seeds (2 g, corresponding to about 100,000 seeds) were sterilized by washes in 45 mL of 80% ethanol, 0.01% triton X-100, followed by 45 mL of 30% (V/V) household bleach in water, 0.01% triton X-100 and finally by repeated rinsing in sterile water. Aliquots of 20,000 seeds were transferred to square plates (2020 cm) containing 150 mL of sterile plant growth medium comprised of 0.5MS salts, 1.0% (W/V) sucrose, 0.05 MES/KOH (pH 5.8), 200 g/mL timentin, and 50 g/mL kanamycin solidified with 10 g/L agar. Homogeneous dispersion of the seed on the medium was facilitated by mixing the aqueous seed suspension with an equal volume of melted plant growth medium. Plates were incubated under standard growth conditions for ten days. Kanamycin-resistant seedlings were transferred to plant growth medium without selective agent and grown to maturity for 8-10 weeks (22 C., permanent light dark, 100-200 E m.sup.2s.sup.1). Plants were grown in flats with 36 inserts. In every flat at least six untransformed wild type control plants were grown next to approximately thirty T2 plants. Seeds were harvested from individual plants and seed oil content was measured by NMR.
NMR Based Analysis of Seed Oil Content:
[0204] Seed oil content was determined using a Maran Ultra NMR analyzer (Resonance Instruments Ltd, Whitney, Oxfordshire, UK). Samples (either individual soybean seed or batches of Arabidopsis seed ranging in weight between 5 and 200 mg) were placed into pre-weighed 2 mL polypropylene tubes (Corning Inc, Corning N.Y., USA; Part no. 430917) previously labeled with unique bar code identifiers. Samples were then placed into 96 place carriers and processed through the following series of steps by an Adept Cobra 600 SCARA robotic system. [0205] 1. pick up tube (the robotic arm was fitted with a vacuum pickup devise) [0206] 2. read bar code [0207] 3. expose tube to antistatic device (ensured that Arabidopsis seed were not adhering to the tube walls) [0208] 4. weigh tube (containing the sample), to 0.0001 g precision. [0209] 5. NMR reading; measured as the intensity of the proton spin echo 1 msec after a 22.95 MHz signal had been applied to the sample (data was collected for [0210] 32 NMR scans per sample) [0211] 6. return tube to rack [0212] 7. repeat process with next tube
Bar codes, tubes weights and NMR readings were recorded by a computer connected to the system. Sample weight was determined by subtracting the polypropylene tube weight from the weight of the tube containing the sample.
[0213] Seed oil content of soybeans seed was calculated as follows:
[0214] Calibration parameters were determined by precisely weighing samples of soy oil (ranging from 0.0050 to 0.0700 g at approximately 0.0050 g intervals; weighed to a precision of 0.0001 g) into Corning tubes (see above) and subjecting them to NMR analysis. A calibration curve of oil content (% seed wt basis; assuming a standard seed weight of 0.1500 g) to NMR value was established.
[0215] The relationship between seed oil contents measured by NMR and absolute oil contents measured by classical analytical chemistry methods was determined as follows. Fifty soybean seed, chosen to have a range of oil contents, were dried at 40 C. in a forced air oven for 48 h. Individual seeds were subjected to NMR analysis, as described above, and were then ground to a fine powder in a GenoGrinder (SPEX Centriprep (Metuchen, N.J., U.S.A.); 1500 oscillations per minute, for 1 minute). Aliquots of between 70 and 100 mg were weighed (to 0.0001 g precision) into 13100 mm glass tubes fitted with Teflon lined screw caps; the remainder of the powder from each bean was used to determine moisture content, by weight difference after 18 h in a forced air oven at 105 C. Heptane (3 mL) was added to the powders in the tubes and after vortex mixing samples were extracted, on an end-over-end agitator, for 1 h at room temperature. The extracts were centrifuged, 1500g for 10 min, the supernatant decanted into a clean tube and the pellets were extracted two more times (1 h each) with 1 mL heptane. The supernatants from the three extractions were combined and 50 L internal standard (triheptadecanoic acid; 10 mg/mL toluene) was added prior to evaporation to dryness at room temperature under a stream of nitrogen gas; standards containing 0, 0.0050, 0.0100, 0.0150, 0.0200 and 0.0300 g soybean oil, in 5 mL heptane, were prepared in the same manner. Fats were converted to fatty acid methyl esters (FAMEs) by adding 1 mL 5% sulfuric acid (v:v. in anhydrous methanol) to the dried pellets and heating them at 80 C. for 30 min, with occasional vortex mixing. The samples were allowed to cool to room temperature and 1 mL 25% aqueous sodium chloride was added followed by 0.8 mL heptane. After vortex mixing the phases were allowed to separate and the upper organic phase was transferred to a sample vial and subjected to GC analysis.
[0216] Plotting NMR determined oil contents versus GC determined oil contents resulted in a linear relationship between 9.66 and 26.27% oil (GC values; % seed wt basis) with a slope of 1.0225 and an R.sup.2 of 0.9744; based on a seed moisture content that averaged 2.6+/0.8%.
Seed Oil Content of Arabidopsis Seed was Calculated as Follows:
[0217]
mg oil=(NMR signal2.1112)/37.514
% oil (% wt basis)=(mg oil/1000)/sample weight)*100
[0218] Prior to establishing this formula, Arabidopsis seed oil was extracted as follows. Approximately 5 g of mature Arabidopsis seed (cv Columbia) were ground to a fine powder using a mortar and pestle. The powder was placed into a 3394 mm paper thimble (Ahlstrom #7100-3394; Ahlstrom, Mount Holly Springs, Pa., USA) and the oil extracted during approximately 40 extraction cycles with petroleum ether (BP 39.9-51.7 C.) in a Soxhlet apparatus. The extract was allowed to cool and the crude oil was recovered by removing the solvent under vacuum in a rotary evaporator. Calibration parameters were determined by precisely weighing 11 standard samples of partially purified Arabidopsis oil (samples contained 3.6, 6.3, 7.9, 9.6, 12.8, 16.3, 20.3, 28.2, 32.1, 39.9 and 60 mg of partially purified Arabidopsis oil) weighed to a precision of 0.0001 g) into 2 mL polypropylene tubes (Corning Inc, Corning N.Y., USA; Part no. 430917) and subjecting them to NMR analysis. A calibration curve of oil content (% seed wt basis) to NMR value was established.
[0219] Seed for pKR92 YL DGAT2 T2 were grown from a total of 293 independent events alongside 75 wild type controls. Oil content of YL DGAT2 transgenics ranged from 27.9-47.3%. Average oil content was 43.7%. Oil content of wild type controls ranged from 39.5-49.6%. Average oil content of wt controls was 44.8%.
[0220] Seed for pKR92 YL DGAT1/YL DGAT2 T2 were grown from a total of 295 independent events alongside 77 wild type controls. Oil content of YL DGAT1/YL DGAT2 transgenics ranged from 34.5-47.6%. Average oil content was 44%. Oil content of wild type controls ranged from 41.3-46.6%. Average oil content of wild type controls was 45%. In summary, these findings suggest that seed-specific expression of YL DGAT gene does not increase oil content of arabidopsis seed.
Analysis of the Fatty Acid Profile of Arabidopsis Seed Expressing YL DGAT2 Alone or in Combination with YL DGAT1:
[0221] GC analysis of FAME was employed to investigate if YL DGAT expression alters the fatty acid profile of arabidopsis seed. Approximately 100 F2 seed were dispensed into individual wells of 96 well strip tubes. For transesterification, 50 L of trimethylsulfonium hydroxide (TMSH) and 0.5 mL of hexane were added to the each strip tube and incubated for 30 min at room temperature while shaking. Fatty acid methyl esters (1 L injected from hexane layer) were separated and quantified using a Hewlett-Packard 6890 Gas Chromatograph fitted with an Omegawax 320 fused silica capillary column (Catalog #24152, Supelco Inc.). The oven temperature was programmed to hold at 220 C. for 2.6 min, increase to 240 C. at 20 C./min and then hold for an additional 2.4 min. Carrier gas was supplied by a Whatman hydrogen generator. Retention times were compared to those for methyl esters of standards commercially available (Nu-Chek Prep, Inc.). Results are summarized in TABLE 5.
TABLE-US-00008 TABLE 5 avg % range % oleic oleic pKR92 YL DGAT1/YL DGAT2 18.7 15.2-22.3 (n = 28) wild type control 15.2 14.5-15.6 (n = 8) pKR92 YL DGAT2 16.4 14.9-18.4 (n = 26) wild type control 15.7 15.6-16 (n = 7)
Results clearly demonstrate that expression of YL DAGT2 and even more so co-expression of YL DGAT1 and YL DGAT2 in Arabidopsis seed leads to increased incorporation of oleic acid into seed lipids which provides the first indication that active YL DGAT1 and YL DGAT2 proteins can be produced in transgenic seed.
Example 5
Expression of Yarrowia lipolytica DGAT Genes in Soybean Somatic Embryos
[0222] TABLE 6 and TABLE 7 list promoter and terminator sequences that were used in plasmid constructs for seed specific over-expression of YL DGAT genes.
TABLE-US-00009 TABLE 6 Seed-specific Promoters Promoter Organism Promoter Reference -conglycinin -subunit soybean Beachy et al., EMBO J. 4: 3047-3053 (1985) kunitz trypsin inhibitor soybean Jofuku et al., Plant Cell 1: 1079-1093 (1989) glycinin Gy1 soybean WO 2004/071467 BD30 (also called P34) soybean WO 2004/071467
TABLE-US-00010 TABLE 7 Transcription Terminators Transcription Terminator Organism Reference phaseolin 3 bean WO 2004/071467 kunitz trypsin inhibitor 3 soybean WO 2004/071467
Construction of a plasmid construct for expression of the YL DGAT1 gene under control of the glycinin Gy1 promoter (KS349) (
[0223] The isolation of soybean glycinin Gy1 promoter was performed as follows. Based on the sequences of the soybean glycinin Gy1 gene sequence (GenBank Accession No. X15121; SEQ ID NO:35) in the NCBI database, two oligos with either BamHI or NcoI sites at the 5 ends were designed to amplify the soybean glycinin Gy1 promoter (SEQ ID NO:36). The oligonucleotide sequences of these two oligos are as follows:
TABLE-US-00011 SEQIDNO:37(oGy1-1): CGCGGATCCTAGCCTAAGTACGTACTCAAAATGCCA SEQIDNO:38(oGy1-2): GAATTCCCATGGGGTGATGACTGATGAGTGTTTAAGGAC
[0224] Plasmid pKS349 was constructed in many steps from a number of different intermediate vectors. The amplified soybean glycinin Gy1 promoter fragment was digested with BamHI and NcoI, purified and cloned into the BamHI and NcoI sites of p24K-G4G-@SalI (PCT Application No. WO 98/59062) to give pZBL114 (SEQ ID NO:39). The NcoI/KpnI fragment containing GUS was replaced with an NcoI/KpnI fragment containing a fusion product of the soybean GY1 gene (SEQ ID NO:40) and the synthetic barley high lysine 8 (BHL8) gene (U.S. Pat. No. 6,800,726 B1) (SEQ ID NO:41;) to make pZBL133 (SEQ ID NO:43). The DNA sequence of the fusion product of soy GY1 gene and BHL8 gene is set forth as SEQ ID NO: 42. The phaseolin terminator was removed from pZBL133 (XbaI/filled in) and replaced with the phaseolin terminator found in pKS123 (PCT Application No. WO 02/08269) (blunt) to give pKS238 (SEQ ID NO:44). The GY1-BHL8 fusion was replaced with native GY1 sequence as follows. pKS238 was digested with KpnI/BglI, the remaining vector band (5.1 kb) was ligated to a DNA fragment (BglI/KpnI) of the native GY1 gene (SEQ ID NO:40) to give pKS240 (SEQ ID NO: 45) The BamHI/SalI fragment containing Gy1/GM-GY1/Phas3 was excised from pKS 240 and ligated to the BamHI/SalI sites of pKS120 (SEQ ID NO:46) to give pKS242 (SEQ ID NO:47). Plasmid pKS120 is identical to pKS123 (supra) with the exception that the HindIII fragment containing Bcon/NotI/Phas3 cassette was removed. The NcoI/NotI fragment containing GM-GY1 was replaced with the NcoI/NotI fragment containing YL-DGAT1 from pYDA1 to give pKS349 (SEQ ID NO:48).
Construction of a Construct for Expression of the YL DGAT2 Gene Under the Control of the Betaconglycinin Promoter (KS362) (FIG. 3B):
[0225] Plasmid pKS362 was constructed in many steps from a number of different intermediate vectors. The AscI cassette containing Kti/NotI/Kti3 from pKS121 (PCT Application No. WO 02/00904) was blunted into the NotI (filled in) site on pBluescript II SK+ (Stratagene) to give pKS121/BS. The NcoI/NotI fragment from pDsRed-Express Vector (Clontech) was blunted into the NotI (filled in) site of pKS121/BS to give pDS-RED in KS121/BS (SEQ ID NO:49). The BamHI cassette containing Kti/DsRed/Kti3 in pDS-RED in KS121/BS (SEQ ID NO:50) was ligated into the BamHI site of pKS123 (PCT Application No. WO 02/08269) to give pKS332 (SEQ ID NO:51). The gene for the YL-DGAT2 was synthesized by PCR with primers to introduce NotI sites at both ends of the gene (see Example 1). The resulting PCR product is digested with NotI restriction enzyme and ligated into the NotI site of pKS332 to give pKS362 (SEQ ID NO:52).
Construction of a Control Plasmid (KS352) (FIG. 2A):
[0226] Based on the sequences of the cloned soybean P34 promoter (WO 2004/071467) (SEQ ID NO:53), two oligos with either BamH I or NotI sites at the 5 ends were designed to re-amplify the P34 promoter. The oligonucleotide sequences of these two oligos are shown as follows:
TABLE-US-00012 SEQIDNO:54(oP34-1): CGCGGATCCAACTAAAAAAAGCTCTCAAATTACATTTTGAG SEQIDNO:55(oP34-2): GAATTCGCGGCCGCAACTTGGTGGAAGAATTTTATGATTTGAAA
The re-amplified P34 promoter fragment was digested with BamHI and NotI, purified and cloned into the BamHI and NotI sites of plasmid pZBL115 (SEQ ID NO:56) to make pJS89 (SEQ ID NO:57). The pZBL115 plasmid contains the origin of replication from pRB322, the bacterial HPT hygromycin resistance gene driven by T7 promoter and T7 terminator, and a 35S promoter-HPT-Nos3 gene to serve as a hygromycin resistant plant selection marker. Morteriella alpina delta-6 desaturase gene (U.S. Pat. No. 5,968,809) (SEQ ID NO:58) was cloned into the NotI site of pJS89(SEQ ID NO:57) in the sense orientation to make the plant expression cassettes and pJS93 (SEQ ID NO:59).
[0227] The P34 promoter was excised from pJS93 (SEQ ID NO:59) using SalI NotI double digestion and ligated to SalI/NotI linearized pKS127 vector (U.S. patent application Ser. No. 11/476,510) (SEQ ID NO:60) to give pKS343 (SEQ ID NO:61). The BamHI cassette containing Kti/DsRed/Kti3 in pDS-RED in KS121/BS was blunted and ligated into the HindIII (filled in) site of pKS343 to give pKS352 (SEQ ID NO:62)
Construction of a Plasmid for Co-Expression of YL DGAT1 and YL DGAT2 (KS364):
[0228] Plasmid pKS364 (SEQ ID NO:63) was constructed by ligating the 3.3 kb HindIII cassette containing BcongI PRO/YL-DGAT2/Phas TER from pKS362 (SEQ ID NO:52) into the unique HindIII site downstream of the of the Gy1 promoter in pKS349 (SEQ ID NO:48).
Generation of transgenic Somatic Embryos:
[0229] For co-expression of YL DGAT1 and YL DGAT2 gene in soybean somatic embryos soybean tissue was co-bombarded as described below with a mixture of KS349 and KS362. Briefly, DNA of KS349 was digested with restriction enzymes PstI, XhoI to inactivate the selectable marker gene cassette (CaMV35S PRO/HPT/CaMV NOS TER). This DNA was mixed in a 10:1 ratio with SalI-linearized plasmid DNA of KS362 and used for soybean transformation as outlined below. Alternatively, soybean somatic embryos soybean tissue was bombarded as described below with intact plasmid DNA of KS364 which contains functional expression cassettes for both, YL DGAT1 and YL DGAT2. For expression of YL DGAT1 alone, uncut plasmid DNA of KS349 was used for particle bombardment of embryo tissue. Similarly, for expression of YL DGAT2 alone, uncut plasmid DNA of KS362 was used for particle bombardment of embryo tissue. Moreover, DNA that contained a selectable marker only (KS352) was used for soybean tissue transformation in an identical fashion.
Culture Conditions:
[0230] Soybean embryogenic suspension cultures (cv. Jack) were maintained in 35 mL liquid medium SB196 (infra) on a rotary shaker, 150 rpm, 26 C. with cool white fluorescent lights on 16:8 h day/night photoperiod at light intensity of 60-85 E/m2/s. Cultures were subcultured every 7 days to two weeks by inoculating approximately 35 mg of tissue into 35 mL of fresh liquid SB196 (the preferred subculture interval is every 7 days).
[0231] Soybean embryogenic suspension cultures were transformed with the soybean expression plasmids by the method of particle gun bombardment (Klein et al., Nature 327:70 (1987)) using a DuPont Biolistic PDS1000/HE instrument (helium retrofit) for all transformations.
Soybean Embryogenic Suspension Culture Initiation:
[0232] Soybean cultures were initiated twice each month with 5-7 days between each initiation. Pods with immature seeds from available soybean plants 45-55 days after planting were picked, removed from their shells and placed into a sterilized magenta box. The soybean seeds were sterilized by shaking them for 15 min in a 5% Clorox solution with 1 drop of ivory soap (i.e., 95 mL of autoclaved distilled water plus 5 mL Clorox and 1 drop of soap, mixed well). Seeds were rinsed using 2 1-liter bottles of sterile distilled water and those less than 4 mm were placed on individual microscope slides. The small end of the seed was cut and the cotyledons pressed out of the seed coat. Cotyledons were transferred to plates containing SB199 medium (25-30 cotyledons per plate) for 2 weeks, then transferred to SB1 for 2-4 weeks. Plates were wrapped with fiber tape. After this time, secondary embryos were cut and placed into SB196 liquid media for 7 days.
Preparation of DNA for Bombardment:
[0233] Either an intact plasmid or a DNA plasmid fragment containing the genes of interest and the selectable marker gene were used for bombardment.
[0234] A 50 L aliquot of sterile distilled water containing 1 mg of gold particles was added to 5 L of a 1 g/L DNA solution (either intact plasmid or DNA fragment prepared as described above), 50 L 2.5M CaCl.sub.2 and 20 L of 0.1 M spermidine. The mixture was pulsed 5 times on level 4 of a vortex shaker and spun for 5 sec in a bench microfuge. After a wash with 150 L of 100% ethanol, the pellet was suspended by sonication in 85 L of 100% ethanol. Five L of DNA suspension was dispensed to each flying disk of the Biolistic PDS1000/HE instrument disk. Each 5 L aliquot contained approximately 0.058 mg gold particles per bombardment (i.e., per disk).
Tissue Preparation and Bombardment with DNA:
[0235] Approximately 100-150 mg of 7 day old embryonic suspension cultures were placed in an empty, sterile 6015 mm petri dish and the dish was placed inside of an empty 15025 mm Petri dish. Tissue was bombarded 1 shot per plate with membrane rupture pressure set at 650 PSI and the chamber was evacuated to a vacuum of 27-28 inches of mercury. Tissue was placed approximately 2.5 inches from the retaining/stopping screen.
Selection of Transformed Embryos:
[0236] Transformed embryos were selected using hygromycin as the selectable marker. Specifically, following bombardment, the tissue was placed into fresh SB196 media and cultured as described above. Six to eight days post-bombardment, the SB196 is exchanged with fresh SB196 containing 30 mg/L hygromycin. The selection media was refreshed weekly. Four to six weeks post-selection, green, transformed tissue was observed growing from untransformed, necrotic embryogenic clusters. Isolated, green tissue was removed and inoculated into multi-well plates to generate new, clonally propagated, transformed embryogenic suspension cultures.
Embryo Maturation:
[0237] Transformed embryogenic clusters were cultured for one-three weeks at 26 C. in SB196 under cool white fluorescent (Phillips cool white Econowatt F40/CW/RS/EW) and Agro (Phillips F40 Agro) bulbs (40 watt) on a 16:8 hrphotoperiod with light intensity of 90-120 E/m.sup.2s. After this time embryo clusters were removed to a solid agar media, SB166, for 1 week. Then subcultured to medium SB103 for 3 weeks. Alternatively, embryo clusters were removed to SB228 (SHaM) liquid media, 35 mL in 250 mL Erlenmeyer flask, for 2-3 weeks. Tissue cultured in SB228 was maintained on a rotary shaker, 130 rpm, 26 C. with cool white fluorescent lights on 16:8 h day/night photoperiod at light intensity of 60-85 E/m2/s. During this period, individual embryos were removed from the clusters and screened for alterations in their fatty acid compositions as described supra. Media Recipes:
[0238] SB 196FN Lite Liquid Proliferation Medium (Per Liter)
TABLE-US-00013 MS FeEDTA - 100x Stock 1 10 mL MS Sulfate - 100x Stock 2 10 mL FN Lite Halides - 100x Stock 3 10 mL FN Lite P, B, Mo - 100x Stock 4 10 mL B5 vitamins (1 mL/L) 1.0 mL 2,4-D (10 mg/L final concentration) 1.0 mL KNO.sub.3 2.83 gm (NH.sub.4).sub.2SO.sub.4 0.463 gm Asparagine 1.0 gm Sucrose (1%) 10 gm pH 5.8
FN Lite Stock Solutions
[0239]
TABLE-US-00014 Stock Number 1000 mL 500 mL 1 MS Fe EDTA 100x Stock Na.sub.2 EDTA* 3.724 g 1.862 g FeSO.sub.47H.sub.2O 2.784 g 1.392 g 2 MS Sulfate 100x stock MgSO.sub.47H.sub.2O 37.0 g 18.5 g MnSO.sub.4H.sub.2O 1.69 g 0.845 g ZnSO.sub.47H.sub.2O 0.86 g 0.43 g CuSO.sub.45H.sub.2O 0.0025 g 0.00125 g 3 FN Lite Halides 100x Stock CaCl.sub.22H.sub.2O 30.0 g 15.0 g KI 0.083 g 0.0715 g CoCl.sub.26H.sub.2O 0.0025 g 0.00125 g 4 FN Lite P, B, Mo 100x Stock KH.sub.2PO.sub.4 18.5 g 9.25 g H.sub.3BO.sub.3 0.62 g 0.31 g Na.sub.2MoO.sub.42H.sub.2O 0.025 g 0.0125 g *Add first, dissolve in dark bottle while stirring
SB1 Solid Medium (Per Liter)
[0240] 1 package MS salts (Gibco/l BRLCat. No. 11117-066)
[0241] 1 mL B5 vitamins 1000 stock
[0242] 31.5 g Glucose
[0243] 2 mL 2,4-D (20 mg/L final concentration)
[0244] pH 5.7
[0245] 8 g TC agar
SB199 Solid Medium (Per Liter)
[0246] 1 package MS salts (Gibco/BRLCat. No. 11117-066)
[0247] 1 mL B5 vitamins 1000 stock
[0248] 30 g Sucrose
[0249] 4 ml 2,4-D (40 mg/L final concentration)
[0250] pH 7.0
[0251] 2 gm Gelrite
SB 166 Solid Medium (Per Liter)
[0252] 1 package MS salts (Gibco/BRLCat. No. 11117-066)
[0253] 1 mL B5 vitamins 1000 stock
[0254] 60 g maltose
[0255] 750 mg MgCl.sub.2 hexahydrate
[0256] 5 g Activated charcoal
[0257] pH 5.7
[0258] 2 g Gelrite
SB 103 Solid Medium (Per Liter)
[0259] 1 package MS salts (Gibco/l BRLCat. No. 11117-066)
[0260] 1 mL B5 vitamins 1000 stock
[0261] 60 g maltose
[0262] 750 mg MgCl.sub.2 hexahydrate
[0263] pH 5.7
[0264] 2 g Gelrite
SB 71-4 Solid Medium (Per Liter)
[0265] 1 bottle Gamborg's B5 salts w/sucrose (Gibco/BRLCat. No. 21153-036)
[0266] pH 5.7
[0267] 5 g TC agar
2,4-D Stock
[0268] Obtain premade from Phytotech Cat. No. D 295concentration 1 mg/mL
B5 Vitamins Stock (Per 100 mL)
[0269] Store aliquots at 20 C. [0270] 10 g Myo-inositol [0271] 100 mg Nicotinic acid [0272] 100 mg Pyridoxine HCl [0273] 1 g Thiamine
If the solution does not dissolve quickly enough, apply a low level of heat via the hot stir plate.
[0274] SB 228Soybean Histodifferentiation & Maturation (SHaM) (Per Liter)
TABLE-US-00015 DDI H2O 600 ml FN-Lite Macro Salts for SHaM 10X 100 ml MS Micro Salts 1000x 1 ml MS FeEDTA 100x 10 ml CaCl 100x 6.82 ml B5 Vitamins 1000x 1 ml L-Methionine 0.149 g Sucrose 30 g Sorbitol 30 g Adjust volume to 900 mL pH 5.8 Autoclave Add to cooled media (30 C.): *Glutamine (Final conc. 30 mM) 4% 110 mL *Note: Final volume will be 1010 mL after glutamine addition.
Because glutamine degrades relatively rapidly, it may be preferable to add immediately prior to using media. Expiration 2 weeks after glutamine is added; base media can be kept longer w/o glutamine.
FN-Lite Macro for SHAM 10Stock #1 (Per Liter)
[0275]
TABLE-US-00016 (NH.sub.4)2SO.sub.4 (Ammonium Sulfate) 4.63 g KNO.sub.3 (Potassium Nitrate) 28.3 g MgSO.sub.4*7H.sub.20 (Magnesium Sulfate Heptahydrate) 3.7 g KH.sub.2PO.sub.4 (Potassium Phosphate, Monobasic) 1.85 g Bring to volume Autoclave
MS Micro 1000Stock #2 (Per 1 Liter)
[0276]
TABLE-US-00017 H.sub.3BO.sub.3 (Boric Acid) 6.2 g MnSO.sub.4*H.sub.2O (Manganese Sulfate Monohydrate) 16.9 g ZnSO4*7H20 (Zinc Sulfate Heptahydrate) 8.6 g Na.sub.2MoO.sub.4*2H20 (Sodium Molybdate Dihydrate) 0.25 g CuSO.sub.4*5H.sub.20 (Copper Sulfate Pentahydrate) 0.025 g CoCl.sub.2*6H.sub.20 (Cobalt Chloride Hexahydrate) 0.025 g KI (Potassium Iodide) 0.8300 g Bring to volume Autoclave
FeEDTA 100Stock #3 (Per Liter)
[0277]
TABLE-US-00018 Na.sub.2EDTA* (Sodium EDTA) 3.73 g FeSO.sub.4*7H.sub.20 (Iron Sulfate Heptahydrate) 2.78 g Bring to Volume Solution is photosensitive. Bottle(s) should be wrapped in foil to omit light. Autoclave *EDTA must be completely dissolved before adding iron.
Ca 100Stock #4 (Per Liter)
[0278]
TABLE-US-00019 CaCl.sub.2*2H.sub.20 (Calcium Chloride Dihydrate) 44 g Bring to Volume Autoclave
B5 Vitamin 1000Stock #5 (Per Liter)
[0279]
TABLE-US-00020 Thiamine*HCl 10 g Nicotinic Acid 1 g Pyridoxine*HCl 1 g Myo-Inositol 100 g Bring to Volume Store frozen
4% GlutamineStock #6 (Per Liter)
[0280]
TABLE-US-00021 DDI water heated to 30 C. 900 ml L-Glutamine 40 g Gradually add while stirring and applying low heat. Do not exceed 35 C. Bring to Volume Filter Sterilize Store frozen * * Note: Warm thawed stock in 31 C. bath to fully dissolve crystals.
Oil Analysis:
[0281] Somatic embryos were harvested after two weeks of culture in the liquid maturation medium SB228 (SHaM) liquid media. Approximately 30 events were created in transformations with KS352, KS349/KS362, and KS362 and KS364. All embryos generated for a given event were harvested in bulk and processed as follows. Embryos were frozen on dry ice or by incubation in a 80 C. freezer for two h followed by lyophilization for 48 h.
[0282] Dried embryos were ground to a fine powder using a genogrinder vial (2 polycarbonate) and a steel ball (SPEX Centriprep (Metuchen, N.J., U.S.A.). Grinding time was 30 sec at 1450 oscillations per min. For every event, triplicates of approximately 10 mg of tissue were weighed into Eppendorf tubes. The tissue was extracted using 200 L heptane at room temperature under continuous shaking for 2 h. Heptane extracts were cleared by centrifugation and 25 L of extract was derivatized to fatty acid methyl esters as follows. One mL of a 25% sodium methoxide stock solution was added to 24 mL of HPLC grade methanol. Sodium methoxide was stored under an inert gas.
[0283] Five L of a 17:0 TAG (Nu-Chek Prep, Elysian, Minn., USA) stock solution (10 mg/mL) was combined with 25 L of heptane tissue extract in a glass culture tube 500 L of 1% sodium methoxide was added. Sample were derivatized in a water bath at 50 C. for 15 min. Samples were allowed to cool to RT and 1 mL of 1M NaCl was added followed by brief mixing. FAMEs were extracted into 1 mL of hepatene and 4 L sample were quantitated by GC analysis.
[0284] Data analysis was performed by plotting the oleic content (% of total FAME) against the total FAME content (% DW). TABLE 8 shows that somatic embryos generated with a vector control (KS352) show little fluctuation in oleic acid content and some fluctuation in oil content that can very likely be attributed to biological variation that in introduced in the regeneration process. For example, embryos very likely show variation in their developmental stage at the time of harvesting. In embryos generated with the control construct no correlation (R2=0.1142) was observed between the oleic acid content and the oil content (TABLE 8). In embryos generated with plasmid constructs expressing YL DGAT1 and YL DGAT2 s gene alone, KS349 and KS362, respectively or both YL DGAT1 and DGAT2 genes (KS349/KS362, KS364) under control of strong seed specific promoters both oleic acid content and total esterified fatty acid content showed a wide range of fluctuation. Moreover, as shown in
TABLE-US-00022 TABLE 8 Esterified Fatty Acid and Oleic Acid Content of Soybean Somatic Embryos oleic oleic FAME acid FAME acid (% (% total (% (% total Event # DCW) stdv FAME) Event # DCW) stdv FAME) KS352 KS352 22 6.2 nd 18.9 44 4.6 nd 17.1 16 5.7 nd 15.8 65 4.6 nd 19.4 35 5.6 nd 19.5 6 4.5 nd 13.9 48 5.6 nd 18.5 24 4.5 nd 16.1 14 5.5 nd 17.3 31 4.5 nd 15.9 43 5.5 nd 18.7 20 4.4 nd 17.1 42 5.4 nd 19.3 37 4.4 nd 17.3 33 5.3 nd 17.2 69 4.4 nd 19.2 68 5.3 nd 18.6 50 4.3 nd 17.2 3 5.2 nd 18.5 54 4.3 nd 19.5 4 5.2 nd 18.9 55 4.3 nd 16.1 11 5.2 nd 19.1 64 4.3 nd 18.7 41 5.2 nd 16.9 32 4.1 nd 14.4 51 5.2 nd 18.2 61 4.1 nd 16.8 7 5.1 nd 17.2 23 4.0 nd 16.1 10 5.1 nd 19.9 26 4.0 nd 13.6 21 5.1 nd 18.2 49 4.0 nd 16.5 27 5.1 nd 18.3 18 3.9 nd 16.4 1 5.0 nd 17.6 8 3.8 nd 15.5 46 5.0 nd 18.4 53 3.8 nd 20.2 59 5.0 nd 17.5 63 3.8 nd 17.2 66 5.0 nd 19.3 52 3.7 nd 17.3 5 4.9 nd 15.1 17 3.6 nd 14.3 15 4.9 nd 15.7 36 3.6 nd 15.7 29 4.9 nd 16.5 60 3.4 nd 16.6 2 4.8 nd 17.6 12 3.3 nd 15.4 9 4.8 nd 17.4 45 3.3 nd 15.2 30 4.8 nd 17.0 62 3.3 nd 18.8 34 4.8 nd 16.9 40 3.2 nd 13.3 19 4.7 nd 14.8 25 3.0 nd 12.3 47 4.7 nd 17.4 38 3.0 nd 16.2 67 4.7 nd 22.9 57 2.5 nd 18.0 13 4.6 nd 17.2 56 2.3 nd 18.2 28 4.6 nd 15.9 58 2.2 nd 16.5 39 4.6 nd 18.6 KS349 KS362 28 10.8 1.0 33.2 28 14.7 0.3 28.9 16 10.6 3.1 32.7 16 14.5 0.1 33.1 25 10.3 0.9 34.1 19 14.1 0.6 32.6 19 9.7 0.2 31.5 24 13.6 0.0 29.9 8 9.5 0.9 34.7 17 13.3 0.4 31.3 7 9.4 0.3 34.3 21 12.7 0.2 28.0 18 9.3 0.1 34.3 12 12.6 0.1 30.6 30 9.2 0.0 32.3 6 11.6 1.3 32.0 3 8.6 0.6 32.9 18 11.5 0.6 26.5 20 8.5 0.1 32.9 22 10.9 0.7 23.8 24 8.4 0.1 30.8 11 10.8 0.1 27.2 5 8.3 0.3 37.0 26 10.8 0.1 25.8 21 8.2 0.5 32.5 14 10.6 0.2 25.3 12 8.1 0.3 33.2 13 10.4 0.3 22.4 31 8.1 0.2 33.4 20 9.8 0.3 21.1 11 7.5 0.5 30.5 8 9.5 0.7 21.8 6 7.5 0.2 29.9 25 9.3 0.1 19.5 22 7.5 0.7 33.2 10 9.1 0.5 21.1 27 7.1 0.4 19.4 4 8.8 0.3 23.5 29 7.1 1.5 29.9 15 8.8 0.0 19.1 23 6.6 0.3 18.4 23 7.8 0.2 16.1 17 6.3 0.7 22.7 27 7.8 0.6 18.3 15 6.0 0.1 28.1 1 7.2 0.6 20.1 4 5.7 0.1 21.2 3 7.2 0.3 18.1 13 5.7 0.0 23.6 9 7.2 0.2 14.8 14 5.6 0.2 21.7 2 6.3 0.3 17.5 26 5.5 0.1 19.1 7 6.1 0.3 22.9 10 5.5 0.1 30.8 5 4.6 0.2 17.3 2 5.5 0.3 28.2 9 5.2 0.2 16.6 1 4.6 0.3 17.1 KS349/KS362 KS364 12 13.2 0.3 34.1 21 16.1 0.9 35.9 4 11.7 0.7 33.4 29 14.6 2.1 33.8 13 11.4 0.2 33.1 18 14.2 2.3 33.2 18 11.1 0.2 33.5 27 13.4 0.8 31.7 24 11.1 0.1 33.3 20 12.2 0.8 35.6 3 10.9 0.0 34.1 28 11.8 0.7 34.6 10 10.8 0.2 31.8 26 11.5 1.6 30.8 9 10.7 0.2 33.5 3 11.3 1.0 36.2 23 10.6 0.4 32.7 22 10.9 1.4 34.0 17 10.2 0.8 31.5 1 10.7 0.6 30.8 29 10.0 0.5 26.6 24 10.7 0.6 31.2 11 9.9 0.3 31.3 25 10.6 0.2 31.2 16 9.4 0.1 31.7 6 10.2 0.4 32.6 19 9.3 0.3 28.1 2 10.1 0.3 31.0 1 8.9 0.5 27.4 5 9.9 0.5 33.3 25 8.5 0.5 31.8 11 9.8 0.4 37.8 7 8.4 0.0 17.6 12 9.8 0.6 37.0 15 8.4 0.1 29.8 8 9.4 0.1 31.5 26 8.3 0.2 18.6 10 9.3 0.1 31.2 6 8.1 0.2 24.5 15 9.2 0.4 33.7 5 7.4 0.1 19.3 16 9.1 0.2 33.9 21 7.4 0.8 18.0 19 8.7 0.1 27.3 27 6.9 0.8 25.7 7 8.4 0.6 26.7 30 6.9 0.7 24.7 4 7.6 0.1 28.1 2 6.0 0.3 18.2 23 5.7 0.2 21.1 14 5.6 0.4 23.0 9 4.2 0.3 15.1 22 5.6 0.2 17.6 14 4.2 0.2 15.1 8 4.6 0.1 17.4 17 3.6 0.4 21.9 28 4.2 0.2 19.7 13 3.5 0.1 15.0 20 2.8 0.1 11.9
[0285] In summary, the data shows that in soybean somatic embryos, similar to Arabidopsis seed YL DGAT gene expression is associated with increased incorporation of oleic acid into the total esterified fatty acid fraction. However, in contrast to Arabidopsis, in soybean somatic embryos increased oleic acid content is tightly correlated with total accumulation of esterified fatty acid. In other words, expression of YL DGAT2 alone and co-expression of YL DGAT1 and YL DAGT2 in soybean somatic embryos leads to increased biosynthesis and incorporation of fatty acids into the total esterified fatty acid fraction. Taken together this finding strongly suggests that expression of YL DGAT genes provides an efficient strategy to achieve an increase in the total of oil content of soybean seed.
Example 6
Expression of Yarrowia lipolytica DGAT Genes in Soybean Seed
[0286] Construction of a control plasmid (KS332) (
[0287] Transgenic soybean lines were generated by the method of particle gun bombardment (Klein et al., Nature (London) 327:70-73 (1987); U.S. Pat. No. 4,945,050) using a BIORAD Biolistic PDS1000/He instrument and plasmid DNA of KS332, KS362 and a 10:1 mixture of KS349 and KS362 prepared as described in Example 3. The following stock solutions and media were used for transformation and regeneration of soybean plants:
Stock Solutions:
Sulfate 100 Stock:
[0288] 37.0 g MgSO.sub.4.7H.sub.2O, 1.69 g MnSO.sub.4.H.sub.2O, 0.86 g ZnSO.sub.4.7H.sub.2O, 0.0025 g CuSO.sub.4.5H.sub.2O
Halides 100 Stock:
[0289] 30.0 g CaCl.sub.2.2H.sub.2O, 0.083 g KI, 0.0025 g CoCl.sub.2.6H.sub.2O
P, B, Mo 100 Stock:
[0290] 18.5 g KH.sub.2PO.sub.4, 0.62 g H.sub.3BO.sub.3, 0.025 g Na.sub.2MoO.sub.4.2H.sub.2O
Fe EDTA 100 Stock:
[0291] 3.724 g Na.sub.2EDTA, 2.784 g FeSO.sub.4.7H.sub.2O
2,4-D Stock:
[0292] 10 mg/mL Vitamin B5 1000 Stock: 10.0 g myo-inositol, 0.10 g nicotinic acid, 0.10 g pyridoxine HCl, 1 g thiamine.
Media (per Liter):
[0293] SB196: 10 mL of each of the above stock solutions, 1 mL B5 Vitamin stock, 0.463 g (NH.sub.4).sub.2 SO.sub.4, 2.83 g KNO.sub.3, 1 mL 2,4-D stock, 1 g asparagine, 10 g Sucrose, pH 5.7
SB103:
[0294] 1 pk. Murashige & Skoog salts mixture, 1 mL B5 Vitamin stock, 750 mg MgCl.sub.2 hexahydrate, 60 g maltose, 2 g gelrite, pH 5.7.
SB166:
[0295] SB103 supplemented with 5 g per liter activated charcoal.
SB71-4:
[0296] Gamborg's B5 salts, 1 mL B5 vitamin stock, 30 g sucrose, 5 g TC agar, pH 5.7.
[0297] To prepare tissue for transformation, soybean embryogenic suspension cultures were maintained in 35 mL liquid medium (SB196) on a rotary shaker (150 rpm) at 28 C. with fluorescent lights providing a 16 h day/8 h night cycle. Cultures were subcultured every two weeks by inoculating approximately 35 mg of tissue into 35 mL of fresh liquid media.
[0298] In particle gun bombardment procedures it is possible to use purified 1) entire plasmid DNA; or 2) DNA fragments containing only the recombinant DNA expression cassette(s) of interest. For every seventeen bombardment transformations, 85 L of suspension is prepared containing 1 to 90 picograms (pg) of plasmid DNA per base pair of each DNA plasmid. Both recombinant DNA plasmids were co-precipitated onto gold particles as follows. The DNAs in suspension were added to 50 L of a 20-60 mg/mL 0.6 m gold particle suspension and then combined with 50 L CaCl.sub.2 (2.5 M) and 20 L spermidine (0.1 M). The mixture was vortexed for 5 sec, spun in a microfuge for 5 sec, and the supernatant removed. The DNA-coated particles were then washed once with 150 L of 100% ethanol, vortexed and spun in a microfuge again, then resuspended in 85 L of anhydrous ethanol. Five L of the DNA-coated gold particles were then loaded on each macrocarrier disk.
[0299] Approximately 150 to 250 mg of two-week-old suspension culture was placed in an empty 60 mm15 mm petri plate and the residual liquid removed from the tissue using a pipette. The tissue was placed about 3.5 inches away from the retaining screen and each plate of tissue was bombarded once. Membrane rupture pressure was set at 650 psi and the chamber was evacuated to 28 inches of Hg. Three plates were bombarded, and, following bombardment, the tissue from each plate was divided between two flasks, placed back into liquid media, and cultured as described above.
[0300] Seven days after bombardment, the liquid medium was exchanged with fresh SB196 medium supplemented with 30-50 mg/L hygromycin. The selective medium was subsequently refreshed weekly or biweekly. Seven weeks post-bombardment, bright green, transformed tissue was observed growing from untransformed, chlorotic or necrotic embryogenic clusters. Isolated green tissue was removed and inoculated into individual wells in six-well culture dishes to generate new, clonally-propagated, transformed embryogenic suspension cultures. Thus, each new line was treated as independent transformation event in an individual well. These suspensions can then be maintained as suspensions of embryos clustered in an immature developmental stage through subculture or they can be regenerated into whole plants by maturation and germination of individual somatic embryos.
[0301] After two weeks in individual cell wells, transformed embryogenic clusters were removed from liquid culture and placed on solidified medium (SB166) containing no hormones or antibiotics for one week. Embryos were cultured for at 26 C. with mixed fluorescent and incandescent lights on a 16 h day/8 h night schedule. After one week, the cultures were then transferred to SB103 medium and maintained in the same growth conditions for 3 additional weeks.
[0302] Somatic embryos became suitable for germination after four weeks and were then removed from the maturation medium and dried in empty petri dishes for one to five days. The dried embryos were then planted in SB71-4 medium where they were allowed to germinate under the same light and temperature conditions as described above. Germinated embryos were transferred to sterile soil and grown to maturity for seed production.
[0303] A total of 29 transgenic lines with seed were generated with intact plasmid DNA of KS362 at concentration of 15 pg per bp of plasmid DNA per gold particle preparation (see above). For every event 20 seed were scored for the presence of the DS marker gene. Briefly, seeds were observed under a stereo microscope (Leica MZ Fluo III) using a UV light source. A filter set customized for fluorescence associated with DsRed expression with the following properties was used: Exitation =540-580 nm/Emssion 570 nm. In cases were less that 20 seed were available all seed were scored in this manner. Subsequently soybean seed oil content was measured by NMR as described previously 3. Nineteen events generated with KS362 contained seed that were positive for DsRed. Of these, 11 events showed a detectable difference in oil content between DsRed positive transgenic segregants and DsRed negative null segregants. Data are summarized in TABLE 9.
TABLE-US-00023 TABLE 9 Oil Content of T1 Soybean Seed Generated with KS362 avg % avg % delta delta n oil null n oil DsRed + % points % AFS4822.4.5.1 5 13.3 15 20.4 7.2 54.1 AFS4822.3.2.1 10 14.2 9 18.9 4.7 32.7 AFS4822.3.3.1 5 12.4 8 16.1 3.7 29.5 AFS4822.4.2.1 4 16.2 6 20.9 4.7 29.3 AFS4822.4.1.1 9 15.1 8 19.4 4.3 28.9 AFS4822.1.13.1 5 15.3 15 19.1 3.7 24.4 AFS4822.1.2.1 2 15.8 18 19.6 3.8 24.1 AFS4822.4.17.1 7 14.9 13 18.5 3.6 23.9 AFS4822.1.9.1 8 16.9 12 19.8 3.0 17.5 AFS4822.2.11.1 6 17.9 14 20.7 2.8 15.7 AFS4822.2.10.1 6 20.6 14 23.5 2.8 13.7
[0304] A total of 10 transgenic lines with seed were generated with DNA of KS332. For every event 20 seed were scored for the presence of the DS marker gene as described above. In cases were less that 20 seed were available all seed were scored in this manner. Subsequently soybean seed oil content was measured by NMR as described in Example 4. Seven events generated with KS 332 contained seed that were positive for DsRed. Data are summarized in TABLE 10.
TABLE-US-00024 TABLE 10 Oil Content of T1 Soybean Seed Generated with KS332 avg % avg % delta delta n oil null n oil DsRed + % points % AFS4703.1.1.1 3 21.8 17 20.5 1.4 6.2 AFS4703.1.2.1 4 20.8 16 18.5 2.3 11.2 AFS4703.1.6.1 5 20.4 15 21.4 1.0 5.0 AFS4703.2.3.1 8 22.1 12 21.1 0.9 4.1 AFS4703.2.4.1 6 22.2 14 21.7 0.4 2.0 AFS4703.3.8.1 6 21.8 14 21.8 0.0 0.2 AFS4703.3.16.1 5 23.9 15 23.3 0.6 2.5
[0305] In contrast to seed generated with KS362, for transgenic seed generated with KS332 no consistent oil increase could be associated with the presence of the DsRed marker in T1 segregants.
[0306] Four events generated with KS362 were subjected to analysis of DsRed status and oil NMR of all available T1 seed. Data are summarized in TABLE 11.
TABLE-US-00025 TABLE 11 Oil Content of T1 Soybean Seed Generated with KS362 avg % avg % delta delta n oil null n oil DS red + % points % AFS4822.4.5.1 8 12.0 24 18.3 6.3 52.9 AFS4822.1.13.1 17 15.0 42 18.7 3.7 24.6 AFS4822.1.2.1 4 15.7 40 19.3 3.5 22.3 AFS4822.2.10.1 8 19.5 25 23.0 3.5 17.8 AFS4822.2.11.1 6 17.9 17 20.3 2.4 13.5
[0307] In summary, the data in the previous tables and
[0308] A total of 16 transgenic lines with seed were generated by co-bombardment with DNA of KS349 and KS362 that had been mixed at a 10:1 ratio (see Example 4). The DNA mixture was delivered in soybean transformation at a final concentration of 15 pg per bp of plasmid DNA per gold particle preparation. Briefly, prior to bombardment DNA KS349 was digested with PstI, XhoI for inactivation of the selectable marker gene on this plasmid. DNA of KS362 was linearized with SalI.
[0309] It is reasonable to assume that because of the pre-treatment of the DNA, the selectable marker gene in all transformations was delivered from the plasmid (KS362) that was bombarded at the lower DNA concentration. Initial inspection of these seed under the fluorescence stereo-microscope revealed that very few events of this transformation contained T1 seed that were positive for the DsRed marker gene. This result may be due to the proximity of the DsRed expression cassette to the end of the SalI restriction fragment of KS362 that was used for soybean transformation. It may have resulted in the integration of KS362 DNA fragments that did not contain a functional DsRed expression cassette. For this reason T1 seed were screened for the absence of presence of the transgene-derived YL DGAT by assaying the seed fatty acid composition. For every event 20 seed were analyzed by GC. 50 seed of untransformed soybean seed were processed in the same manner. Soybean seed chips were produced by cutting the seed with a razorblade avoiding the embryonic axis. Seed chips of approximately 2 mg were placed in a vial containing 50 L trimethylsulfonium hydroxide and 0.5 mL hexane. The chips were incubated for 30 min at room temperature while shaking. 5 L of the hexane layer was injected into a Hewlett Packard 6890 Gas Chromatograph containing a Omegawax 320 fused silica capillary column (Supelco Cat. No. 24152). Oven conditions were as follows: initial temperature of 220 C. for 2.7 minutes, ramped to 240 C. over 1 min and held at 240 C. For a total run time of 6 min. Retention times were compared to standards commercially available (Nu-Chek Prep, Inc. Cat. No. U-99-A). Fatty acids were determined by direct trans-esterification of individual standards in 0.5 mL of methanolic H.sub.2SO.sub.4 (2.5%). Fatty acid methyl esters were extracted from the methanolic solutions into hexane after the addition of an equal volume of water.
[0310] Ten events were identified that contained T1 seed with 25% oleic acid content. Since this oleic acid content was not observed in untransformed soybean seed (see
TABLE-US-00026 TABLE 12 Oil Content of T1 Soybean Seed Generated with KS349/KS362 avg % avg % oil <25% oil 25% delta % R.sup.2 % n oleic n oleic points delta % oleic/% oil AFS4818.3.1.1 15 11.9 5 16.8 4.9 41.0 0.38 AFS4818.1.5.1 10 15.5 10 20.0 4.5 28.7 0.69 AFS4818.2.10.1 10 13.2 10 16.5 3.3 25.2 0.39 AFS4818.1.9.1 5 12.9 14 15.9 3.0 22.9 0.51 AFS4818.2.6.1 12 18.6 8 21.9 3.4 18.1 0.51 AFS4818.1.3.1 6 20.5 14 23.6 3.1 14.9 0.45 AFS4818.1.2.1 6 19.4 14 21.8 2.4 12.4 0.37 Jack (wt control) 56 21.7 0.003
Jack wild type seed were grown under similar condition to those used for T1 seed generation and analyzed by GC and NMR analysis. It was observed that oleic acid and oil content fluctuated between 7.6-20.5% and 18.6-25.2%, respectively. No correlation between oleic acid content and oil content could be observed in untransformed soybean seed.
[0311] Four events generated with KS349/KS362 were subjected to GC and NMR analysis of all available T1 seed. Data are summarized in TABLE 13.
TABLE-US-00027 TABLE 13 Oil Content of T1 Soybean Seed Generated with KS349/KS362 avg % avg % R.sup.2 % oil <25% oil 25% delta % delta oleic/ n oleic n oleic points % % oil AFS4818.1.5.1 21 16.3 21 20.2 3.9 23.8 0.55 AFS4818.2.6.1 49 18.1 23 21.9 3.7 20.7 0.50 AFS4818.1.3.1 33 20.2 67 23.5 3.3 16.2 0.43 AFS4818.1.2.1 13 19.3 26 22.1 2.7 14.1 0.45
Taken together the data in the previous tables and
Example 7
Expression of Yarrowia lipolytica DGAT Genes in Maize
[0312] Based on results disclosed in Examples 4, 5 and 6 of the instant application, the YL DGAT1 and YL DGAT2 genes can be expressed in the seed embryo of maize to increase the oil content of this tissue. As described below, this result can be achieved by transforming maize with expression cassettes comprising open reading frames of DGAT1 and DGAT2 from Yarrowia lipolytica operably linked on their 5 ends to embryo preferred promoters, such as the promoter for the maize 16 kDa oleosin gene (Lee, K. and Huang, A. H., Plant Mol. Biol. 26:1981-1987 (1984)) and maize embryo abundant (EAP1) promoter and terminator (US 2006272058 A1).
[0313] An expression cassette comprising the promoter from the maize 16 kDa oleosin gene (OLE PRO), the coding sequence of the YL DGAT2 gene (SEQ ID NO:9) and the polyadenylation signal sequence/terminator from the nopaline synthase (NOS) gene of Agrobacterium tumefaciens is constructed using methods and technologies known in the art. A second expression cassette comprises the YL DGAT1 gene under the transcriptional control of the maize embryo abundant protein (EAP1) promoter and terminator, with the maize ADH1 INTRON1 inserted between the promoter and coding sequence for enhanced expression. The two expression cassettes are linked, together with a gene encoding a selectable marker, in a binary vector suitable for Agrobacterium-mediated transformation of maize.
[0314] An Agrobacterium-based protocol can be used for the transformation of maize (see below). The resulting binary vector is introduced into Agrobacterium LBA4404 (PHP10523) cells, preferably by electroporation. An in vivo recombination generates a cointegrate plasmid between the introduced binary vector and the vir plasmid (PHP10523) resident in the Agrobacterium cells. The resulting Agrobacterium cells are used to transform maize.
Transformation of Maize Mediated by Agrobacterium:
[0315] Freshly isolated immature embryos of maize, about ten days after pollination (DAP), can be incubated with the Agrobacterium. The preferred genotype for transformation is the highly transformable genotype Hi-II (Armstrong, Maize Gen. Coop. Newsletter 65:92-93 (1991)). An F1 hybrid created by crossing a Hi-II with an elite inbred may also be used. After Agrobacterium treatment of immature embryos, the embryos can be cultured on medium containing toxic levels of herbicide. Only those cells that receive the herbicide resistance gene, and the linked gene(s), grow on selective medium. Transgenic events so selected can be propagated and regenerated to whole plants, produce seed, and transmit transgenes to progeny.
Preparation of Agrobacterium:
[0316] The engineered Agrobacterium tumefaciens LBA4404 can be constructed to contain plasmids for seed-preferred expression of YL DGAT1 and YL DGAT2 genes, as disclosed in U.S. Pat. No. 5,591,616 (the contents of which are hereby incorporated by reference). To use the engineered construct in plant transformation, a master plate of a single bacterial colony transformed with plasmids for seed-preferred expression of YL DGAT1 and YL DGAT2 genes can be prepared by inoculating the bacteria on minimal AB medium and allowing incubation at 28 C. for approximately three days. (The composition and preparation of minimal AB medium has been previously described in PCT Publication No. WO 02/009040 (the contents of which are hereby incorporated by reference). A working plate can then be prepared by streaking the transformed Agrobacterium on YP medium (0.5% (w/v) yeast extract, 1% (w/v) peptone, 0.5% (w/v) sodium chloride, 1.5% (w/v) agar) that contains 50 g/mL of spectinomycin.
[0317] The transformed Agrobacterium for plant transfection and co-cultivation can then be prepared one day prior to maize transformation. Into 30 mL of minimal A medium (prepared as described in PCT Publication No. WO 02/009040) in a flask was placed 50 g/mL spectinomycin, 100 M acetosyringone, and about a loopful of Agrobacterium from a one to two-day-old working plate. The Agrobacterium can then be grown at 28 C. with shaking at 200 rpm for approximately fourteen h. At mid-log phase, the Agrobacterium can be harvested and resuspended at a density of 3 to 5108 CFU/mL in 561Q medium that contains 100 M acetosyringone using standard microbial techniques. The composition and preparation of 561Q medium was described in PCT Publication No. WO 02/009040.
Immature Embryo Preparation:
[0318] Nine to ten days after controlled pollination of a maize plant, developing immature embryos are opaque and 1-1.5 mm long. This length is the optimal size for infection with the PHP18749-transformed Agrobacterium. The husked ears can be sterilized in 50% commercial bleach and one drop Tween-20 for thirty minutes, and then rinsed twice with sterile water. The immature embryos can then be aseptically removed from the caryopsis and placed into 2 mL of sterile holding solution consisting of medium 561Q that contains 100 M of acetosyringone.
Agrobacterium Infection and Co-Cultivation of Embryos:
[0319] The holding solution can be decanted from the excised immature embryos and replaced with transformed Agrobacterium. Following gentle mixing and incubation for about five minutes, the Agrobacterium can be decanted from the immature embryos. Immature embryos were then moved to a plate of 562P medium, the composition of which has been previously described in PCT Publication No. WO 02/009040. The immature embryos can be placed on this media scutellum surface pointed upwards and then incubated at 20 C. for three days in darkness. This step can be followed by incubation at 28 C. for three days in darkness on medium 562P that contains 100 g/mL carbenecillin as described in U.S. Pat. No. 5,981,840.
Selection of Transgenic Events:
[0320] Following incubation, the immature embryos can be transferred to 5630 medium, which can be prepared as described in PCT Publication No. WO 02/009040. This medium contains Bialaphos for selection of transgenic plant cells as conferred by the BAR gene that is linked to barley HGGT expression cassette. At ten to fourteen-day intervals, embryos were transferred to 5630 medium. Actively growing putative transgenic embryogenic tissue can be after six to eight weeks of incubation on the 5630 medium.
Regeneration of TO Plants:
[0321] Transgenic embryogenic tissue is transferred to 288W medium and incubated at 28 C. in darkness until somatic embryos matured, or about ten to eighteen days. Individual matured somatic embryos with well-defined scutellum and coleoptile are transferred to 272 embryo germination medium and incubated at 28 C. in the light. After shoots and roots emerge, individual plants are potted in soil and hardened-off using typical horticultural methods.
[0322] 288W medium contains the following ingredients: 950 mL of deionized water; 4.3 g of MS Salts (Gibco); 0.1 g of myo-inositol; 5 mL of MS Vitamins Stock Solution (Gibco); 1 mL of zeatin (5 mg/mL solution); 60 g sucrose; 8 g of agar (Sigma A-7049, Purified), 2 mL of indole acetic acid (0.5 mg/mL solution*); 1 mL of 0.1 mM ABA*; 3 mL of Bialaphos (1 mg/mL solution*); and 2 mL of carbenicillin (50 mg/mL solution). The pH of this solution is adjusted to pH 5.6. The solution is autoclaved and ingredients marked with an asterisk (*) are added after the media has cooled to 60 C.
[0323] Medium 272 contains the following ingredients: 950 mL of deionized water; 4.3 g of MS salts (Gibco); 0.1 g of myo-inositol; 5 mL of MS vitamins stock solution (Gibco); 40 g of Sucrose; and 1.5 g of Gelrite. This solution is adjusted to pH 5.6 and then autoclaved.
Example 8
Analysis of Kernel Oil Content
Nuclear Magnetic Resonance (NMR) Analysis:
[0324] Seed are imbibed in distilled water for 12-24 hours at 4 C. The embryo is dissected away and stored in a 48 well plate. The samples are lyophilized overnight in a Virtis 2448 lyophilizer. The NMR (Process Control TechnologiesPCT (Ft. Collins, Colo.) is set up as per the manufacturer's instructions. The NMR is calibrated using a series of 5 mm NMR tubes containing precisely measured amounts of corn oil (Mazola). The calibration standards are 3, 6, 9, 12, 15, 18, 21, 27, 33, and 40 mg of oil.
Example 9
Synthesis of YL DGAT1 and YL DGAT2 Genes
[0325] Nucleotide sequences encoding YL DGAT1 and YL DGAT2 were designed for optimized expression in soybean seed using methods similar to those described in Wu, G et al. Nucleic Acids Research (2007), 35: D76-D79; Villalobos, A. et al. BMC Bioinformatics (2006), 7 No pp. given; Wu, G. et al. Protein Expression and Purification (2006), 47: 441-445; Richardson, S. M. et al. Genome Research (2006), 16: 550-556; Jayaraj, S. et al. Nucleic Acids Research (2005) 33: 3011-3016. DNA molecules were synthesized by DNA 2.0 (Menlo Park, Calif., USA). Expression-optimized DNA sequences of YL DGAT1 and YL DGAT2 are set forth in SEQ ID NO:64 and SEQ ID NO:66, respectively. The amino acid sequences for soy optimized enzymes are set forth in SEQ ID NO:65 (YL DGAT1) and SEQ ID NO:67 (YL DGAT2) and are identical to the translation products of SEQ ID NO:1 and SEQ ID NO:9, respectively.
Example 10
Fatty Acid Composition of Soybean Somatic Embryos Expressing YL DGAT Genes
[0326] Transgenic somatic embryos were generated using the plasmid constructs KS352, KS349, KS362 and KS364. Generation of the DNA constructs and the transformation process is described in detail in EXAMPLE 5. Fatty acid composition was determined by GC analysis of fatty acid methyl esters generated by sodium methoxide derivatization of heptane extracts. The findings are summarized in TABLE 14. The table compares the fatty acid composition of 100 events generated with a control plasmid lacking YL DGAT genes with that of events created with plasmids containing YL DGAT1 (KS349), YL DGAT2 (KS362) or both genes (KS364). For events generated with YL DGAT containing DNA constructs the average fatty acid composition of all events with greater than 30% oleic is shown.
TABLE-US-00028 TABLE 14 Fatty Acid Composition of Soybean Somatic Embryos generated with KS 352, 349, 362, 349&362 and 364 palmitic stearic oleic linoleic linolenic Plasmid n acid acid acid acid acid KS352 average 100 15.9 5.2 17.9 44.1 16.9 KS352 range 12.6-20.8 4.2-6.6 12.3-22.9 39.3-46.9 12.4-23.5 KS349 average 18 11.6 5.4 33.0 41.3 8.6 (>30% oleic) KS349 range 10.7-12.8 4.2-6.5 30.5-37.0 38.7-44.6 7.8-10.7 (>30% oleic) KS362 average 5 11.5 6.3 31.9 43.2 6.9 (>30% oleic) KS362 range 10.9-12.7 5.7-7.0 30.6-33.1 41.9-44.8 6.2-7.7 (>30% oleic) KS349&362 14 12.8 5.4 33.8 39.7 8.4 average (>30% oleic) KS349&362 11.5-14.4 3.8-7.0 30.8-35.5 38-42.7 6.3-10.3 range (>30% oleic) KS364 average 14 10.9 6.4 39.0 38 5.7 (>30% oleic) KS364 range 9.2-12.6 5.9-7.7 32.8-48.6 31.4-42.7 3.2-6.5 (>30% oleic)
[0327] The table shows that expression of YL DGAT1 or YL DGAT2 as well as co-expression of said genes alters the FA profile of soybean somatic embryos. The most pronounced alteration is an increase in oleic acid and a decrease in linolenic acid that is consistently observed with all DNA constructs tested. Expression of YL DGAT genes also leads to a decrease in palmitic and linoleic acid and an increase in stearic acid.
Example 11
Fatty Acid Composition of Soybean Seed Expressing YL DGAT Genes
[0328] Event AFS4822.1.13.1 was generated using plasmid DNA of KS362 as described in EXAMPLE 6. Transgenic T1 seed show an increase in oil content of 24.6% when compared to null segregant seed from the same T1 plant. This observation strongly supports the conclusion that this events expresses YL DGAT2. T1 seed of AFS4822.1.13.1 with or without the YL DGAT2 transgene were germinated and grown in the growth chamber for three month. DS-red positive T1 seed of event AFS4703.1.6 were germinated and grown alongside the YL DGAT2 event. AFS4703.1.6 was generated with KS332, a plasmid vector hat contains the DS-red marker gene but does not contain YL DGAT2 (see EXAMPLE 5). Several T1 segregants could be identified that only produced DS-red positive T2 seed indicating that these lines were homozygous for the respective transgene. T2 seed harvested from null-segregant progeny were DS-red negative confirming that these lines likely did not contain a functional transgene.
[0329] For each selection six seed were chipped and the fatty acid composition of the seed chips was analyzed by TMSH-derivatization followed by gas chromatography as described in EXAMPLE 6. TABLE15A compares the average fatty acid composition of six seed chips of DS-red positive segregants of AFS4822.1.13.1 with that of seed chips derived form a null-segregant plant and that of seed chips of event AFS4703.1.6 containing only the DS-red marker gene. It demonstrates that expression of YL DGAT2 alters the FA profile of soybean seed. The most pronounced alteration is an increase in oleic acid and a decrease in linolenic acid. Expression of YL DGAT genes also leads to a decrease in palmitic and linoleic acid and an increase in stearic acid.
TABLE-US-00029 TABLE 15A Fatty Acid Composition of T2 Soybean Seed Generated with KS362 palmitic stearic oleic linoleic linolenic Event n acid acid acid acid acid AFS4822.1.13.1 6 10.8 4.6 29.2 49.5 6.0 average (DS red positive) AFS4822.1.13.1 6 12.0 3.4 16.3 59.0 9.4 average (Null segregant) AFS4703.1.6 6 11.5 3.3 15.8 59.8 9.6 average (DS red positive)
[0330] Events AFS4818.1.9 and AFS4818.1.3 were generated using a mixture of DNA fragments derived from plasmids KS349 (YL DGAT1) and KS362 (YL DGAT2) as described in EXAMPLE 5. Transgenic T1 seed of these two events show an increase in oil content of 22.9 and 16.2%, respectively when compared to null segregant seed from the same T1 plant. Although this observation strongly supports the conclusion that both events express transgene derived YL DGAT it is not clear if both events contain intact copies of both or just one DGAT gene present in the DNA mixture used for transformation. T1 seed with increased oil and oleic acid content (see Example 6) were planted for events AFS4818.1.2, AFS4818.1.3, AFS4818.1.5, AFS48182.6, AFS4818.1.9. DNA was isolated, digested with the two restriction enzymes EcoRI and HindIII and transferred to nylon membranes using standard protocols. Duplicate blots were produced and hybridized independently with probes corresponding to a 1.21 kb restriction fragment of the YL DGAT1 gene (generated by digestion of KS349 with NcoI/EcoRI) and the intact YL DGAT2 genes (generated by NotI digestion of KS 362). Based on the sequence of KS 349 (SEQ ID NO:48) and KS 362 (SEQ ID NO: 52) insertion of an intact copy of YL DGAT1 and YL DGAT2 gene in the soybean genome would be indicated by a strong hybridization signal of restriction fragments with a size of 1.908 and 3.335 kb, respectively. In keeping with this, all events showed strongly hybridizing bands of 1.908 kb when a YL DGAT1 probe was used (
[0331] T1 plants of events 4818.1.9 and 4818.1.3 that were derived from seed with increased oil and oleic content of event 4818.1.9 and 4818.1.3 were grown to maturity and seed were harvested. Fatty acid composition of T2 seed was determined by TMSH-derivatization and GC analysis of seed chips derived from T2 seed. Table compares fatty acid composition of transgenic and null segregant seed from a T2 plant of 4818.1.9 and 4818.1.3 (Table 15B). It demonstrates that expression of YL DGAT1 as well as co-expression of YL DGAT1 and YL DGAT2 alters the FA profile of soybean seed. The most pronounced alteration is an increase in oleic acid and a decrease in linolenic acid. Expression of YL DGAT genes also leads to a decrease in palmitic and linoleic acid and an increase in stearic acid.
TABLE-US-00030 TABLE 15B Fatty Acid Composition of T2 Soybean Seed Generated by co-transformation with KS349 and KS362 palmitic stearic oleic linoleic linolenic Event n acid acid acid acid acid AFS4818.1.9 58 10.8 4.5 27.9 49.6 7.2 average AFS4818.1.9 42 12.2 3.4 14.3 57.0 13.0 average (Null segregant) AFS4818.1.3 34 10 4.2 31.6 48.7 5.5 average AFS4818.1.3 14 11.4 3.0 16.4 58.7 10.5 average (Null segregant)
Example 12
Analysis of Transgenic Events: Growth Chamber
[0332] The present example describes measurements of oil content of soybean derived form T2 plants that were homozygous or heterozygous for transgenes comprising YL DGAT1 or YL DGAT2 or both YL DGAT genes. T2 plants were grown in a controlled environment (growth chamber).
[0333] Oil analysis of T2 soybean seed derived from plants grown in a plant growth chamber was performed by NMR. Seed were harvested form individual plants. Seed selections from heterozygous plants derived form transformations with the DGAT2 gene from Yarrowia showed segregation of the DS red marker. Oil content of DS red positive seed (with DGAT2 transgene) and null segregant seed from the same plant is shown in Table 16. In said table oil content of seed containing the DGAT2 transgene is compared to that of non-transgenic null segregant seed from the same plant.
TABLE-US-00031 TABLE 16 Oil content of transgenic seed and null segregant seed derived from transgenic soybean T2 plants that segregate for transgene with the yarrowia DGAT2 gene average average oil (%) w oil (%) % Event PLANT transg. n null n points % 4822.1.13 A 22.2 37 19.6 11 2.3 11.5 B 21.4 27 19.5 13 average 21.8 19.6 4822.4.5 A 22.3 35 18.4 13 3.6 19.6 B 22.5 38 18.5 10 C 21.7 31 17.7 17 D 22.7 31 18.2 17 E 21.7 23 18.9 17 average 22.2 18.6 4822.1.9 A 22.9 33 20.4 7 2.5 12.3 4822.2.10 A 24.3 62 20.1 24 3.3 16.3 B 23 30 19.5 10 C 22.5 23 20.5 17 average 23.3 20.0
[0334] T2 seed selections of events generated by co-transformation of KS349 and KS362 were screened by GC analysis of seed chips as described above (Example 6). Seed were harvested from individual plants. Seed selections from heterozygous plants derived from transformations with Yarrowia DGAT genes segregated for elevated oleic acid content (>22% of total FA). Example 11 describes that event 4818.1.9 only contains an intact expression cassette for the DGAT1 gene from Yarrowia. Oil content of seed with elevated oleic acid content (with DGAT1 transgene) and null segregant seed from the same plant is shown in Table 17. In this table, oil content of seed containing the DGAT1 transgene was compared to that of non-transgenic null segregant plants from the same plant.
TABLE-US-00032 TABLE 17 Oil content of transgenic seed and null segregant seed derived from transgenic soybean T1 plants that segregate for a transgene with the yarrowia DGAT1 gene average average oil (%) w oil (%) % Event PLANT transg. n null n points % 4818.1.9 A 21.8 58 18.9 42 4.4 25.1 B 21.3 16 17.0 6 C 23.1 34 17.0 14 average 22.1 17.6
[0335] Example 11 describes that other events generated by co-transformation of KS349 and KS362 contain an intact expression cassette for both DGAT genes of Yarrowia. Oil content of seed with elevated oleic acid content (with both DGAT transgenes) and null segregant seed from the same plant is shown in Table 18. In this table, oil content of seed containing both DGAT trangenes was compared to that of non-transgenic null segregant plants from the same plant.
TABLE-US-00033 TABLE 18 Oil content of transgenic seed and null segregant seed derived from transgenic soybean T1 plants that segregate for transgenes with DGAT1 and DGAT2 genes from yarrowia average average oil (%) w oil (%) % Event PLANT transg. n null n points % 4818.1.2 A 23.9 33 20 15 3.4 17.3 B 22.9 35 20.3 13 C 23 31 19.2 17 average 23.3 19.8 4818.1.3 A 24.5 32 21.6 16 3.4 16.3 B 23.6 34 19.5 14 C 25.3 28 22 20 average 24.5 21.0 4818.2.6 A 22.3 31 19 17 3.2 15.8 B 24.1 21 20.6 27 C 24.1 23 20.7 25 D 23.2 30 20.6 18 average 23.4 20.2
[0336] T2 seed selection homozygous for the KS362 derived Yarrowia DGAT2 expression cassette no longer segregated for the DS red marker. Oil content of 48 seed (or all available seed if less than 48 seed were available) was measured by NMR. For each event DS-red negative T1 seed were planted and T2 seed of null segregants were harvested from plants grown in the same growth chamber used for cultivation of T1 plants homozygous for the DGAT transgene. Oil content of seed derived form null segregant selections and lines homozygous for the DGAT transgene in shown in Table 19.
TABLE-US-00034 TABLE 19 Oil content of null segregant seed and transgenic seed derived from transgenic soybean T1 plants that are homozygous for transgenes with yarrowia DGAT2 gene average % EVENT PLANT n oil (%) points % 4822.1.13 A 48 22.7 2.3 11.6 B 48 21.9 C 48 22.7 average 22.4 NULL-A 48 19.7 NULL-B 48 20.5 average 20.1 4822.1.9 A 48 23.0 3.6 18.5 B 48 24.0 C 48 22.7 average 23.2 NULL-A 48 19.6 4822.2.10 A 48 22.5 2.3 10.9 B 48 24.4 average 23.5 NULL-A 48 20.9 NULL-B 48 21.4 average 21.2
[0337] T2 seed selection homozygous for KS349-derived Yarrowia DGAT1 and KS362-derived DGAT2 expression cassettes no longer segregated with respect to the elevated oleic acid phenotype (22% oleic) associated with expression of yarrowia DGAT genes. Oil content of 48 seed (or all available seed if less than 48 seed were available) was measured by NMR. For each event T1 null segregant seed that showed no elevation oleic acid of were planted and T2 seed of these null segregants were harvested from plants grown in the same growth chamber used for cultivation of T1 plants homozygous for the DGAT transgenes. Oil content of seed derived form null segregant selections and lines homozygous for the DGAT transgene in shown in Table 20
TABLE-US-00035 TABLE 20 Oil content of null segregant seed and transgenic seed derived from transgenic soybean T1 plants that are homozygous for transgenes with DGAT1 and DGAT2 genes from yarrowia average % EVENT PLANT n oil (%) points % 4818.1.2 A 35 23.9 3.8 18.5 B 48 24.1 average 24.0 NULL-A 48 20.1 NULL-B 48 20.4 average 20.3 4818.1.3 A 48 24.4 4.5 22.8 B 48 24.4 C 48 24.3 average 24.4 NULL-A 48 20.2 NULL-B 48 19.5 average 19.9 4818.1.5 A 48 24.4 4.8 24.2 B 13 24.4 C 48 25.1 average 24.6 NULL-A 48 19.4 NULL-B 48 20.2 average 19.8 4818.2.6 A 46 24.2 3.1 14.4 NULL-A 11 21.4 NULL-B 48 20.9 average 21.2
[0338] In summary, growth chamber results show excellent heritability of the increased oil trait associated with overexpression of either a single yarrowia DGAT genes or co-expression of both yarrowia DGAT genes in soybean seed. Oil increase (compared to null segregant seed) associated with expression of a single yarrowia DGAT genes is at least 10.9% and as high as 25.1%. Oil increase (compared to null segregant seed) associated with expression of both yarrowia DGAT genes is at least 14.4% and as high as 24.2%.
Example 13A
Analysis of Transgenic Events: Field
[0339] The present example describes measurements of oil content of soybean derived from T2 plants that were homozygous or heterozygous for transgenes comprising YL DGAT1 or YL DGAT2 or both YL DGAT genes. T2 plants were grown in a non-controlled environment (field).
[0340] DS red positive T1 seed of transgenic events generated with YL DGAT2 (contained in KS 362) and corresponding DS red negative null segregant seed were grown in a field in Iowa in the summer of 2007. T1 seed with elevated oleic acid content that had been generated by co-transformation with YL DGAT1 and YL DGAT2 and corresponding null segregant seed with normal levels of oleic acid were grown in a similar fashion. T2 seed were harvested from individual plants and subjected to NMR analysis to measure oil content. Table 21 shows oil content of 48 uniformly DS red positive seed derived from events that were homozygous for the KS362 transgene and that of DS-red negative seed from null segregant seed of the same event grown in the same environment.
TABLE-US-00036 TABLE 21 Oil content null segregant seed and transgenic seed derived from field-grown transgenic soybean T1 plants that are homozygous for transgenes with the yarrowia DGAT2 gene average % EVENT PLANT n oil (%) points % 4822.1.2 A 48 22.4 2.4 13 B 48 20.5 C 48 21.5 E 48 21.7 F 48 20.7 G 40 19.5 H 16 23 average 21.3 Null A 48 18.9 Null B 48 19 Null C 48 18.7 Null D 16 17.9 Null E 24 20.2 average 18.9 4822.2.11 A 48 22.1 2.6 14 B 47 21 C 48 23.8 D 48 21.1 E 48 23.1 F 48 22 G 48 20.4 H 48 20.8 I 48 20.3 average 21.6 Null A 48 19.2 Null B 48 19.5 Null C 48 18.3 average 19.0 4822.2.10 A 40 21.8 2.6 13.6 B 48 21.8 average 21.8 Null A 48 18.6 Null B 48 19.2 Null C 48 19.2 Null E 16 19.7 Null F 48 19.7 Null G 48 19 average 19.2
[0341] Table 22 shows oil content of 48 seed from segregants that were homozygous for YL DGAT1 and YL DGAT2 transgenes. All seed harvested from these homozygous T2 seed selections showed the elevated oleic acid content associated with YL DGAT expression. In Table 22 oil content of these lines is compared to that of null segregant seed of the same events with unaltered levels of oleic acid, derived from plants grown in the same environment.
TABLE-US-00037 TABLE 22 Oil content null segregant seed and transgenic seed derived from field-grown transgenic soybean T1 plants that are homozygous for transgenes with the yarrowia DGAT1 and DGAT2 genes. average % EVENT PLANT n oil (%) points % 4818.1.2 A 37 22.2 3.8 20 B 48 22.5 C 48 22.7 D 48 22.6 E 48 24.3 F 40 21.5 average 22.6 Null A 48 17.9 Null B 48 18.9 Null C 48 19.4 Null D 48 19.5 Null E 48 19.7 Null F 48 18.4 Null G 48 17.9 average 18.8 4818.1.3 A 48 23.5 3.5 19 B 48 22.4 C 48 22.8 D 19 21.3 E 48 20.5 F 48 22.3 G 48 22.8 H 48 22.5 average 22.3 Null A 48 18.4 Null B 48 19.1 Null C 48 17.9 Null D 48 19 Null E 48 19.3 Null F 48 18.3 Null G 48 18.3 average 18.6
[0342] Example 11 describes that event 4818.1.9 only contains an intact expression cassette for the DGAT1 gene from Yarrowia. Three T1 plants of this event derived from T1 seed with elevated oleic acid content were grown in the Iowa field along side null segregant plants derived from T1 seed with unaltered oleic acid content. T2 seed from all three transgenic segregants still showed segregation of the elevated oleic acid phenotype indicating that the parental lines were still heterozygous for the DGAT1 transgene. Using GC analysis all transgene-positive seed were identified from these lines and subjected to oil analysis by NMR. In Table 23 oil content of these seed is compared to that of null segregant seed derived from T1 plants gown in the same environment.
TABLE-US-00038 TABLE 23 Oil content null segregant seed and transgenic seed derived from field-grown transgenic soybean T1 plants that are heterozygous for transgenes with the yarrowia DGAT1 gene. average % EVENT PLANT n oil (%) points % 4818.1.9 A 14 20.7 2.0 11 B 14 19.1 C 20 20 average 20.0 Null A 40 18.1 Null B 40 17.8 average 18.0
[0343] In summary, field environment results show excellent heritability of the increased oil trait associated with overexpression of either a single yarrowia DGAT genes, or co-expression of both yarrowia DGAT genes in soybean seed. Oil increase (compared to null segregant seed) associated with expression of a single yarrowia DGAT genes is at least 11% and as high as 14%. Oil increase (compared to null segregant seed) associated with expression of both yarrowia DGAT genes is at least 19% and as high as 20%.
Example 13B
Compositional Analysis of Soybean Seed
[0344] The present example describes measurements of seed compositional parameters such as protein content and content of soluble carbohydrates of soybean seed derived from transgenic events that express single YL DGAT genes (YL DGAT2) of both YL DGAT genes.
[0345] Changes in the composition of soybean seed associated with expression of YL DGAT genes were measured. To this end the concentrations of protein, soluble carbohydrates and starch were measured as follows.
Non-Structural Carbohydrate and Protein Analysis.
[0346] Dry soybean seed were ground to a fine powder in a GenoGrinder and subsamples were weighed (to an accuracy of 0.1 mg) into 13100 mm glass tubes; the tubes had Teflon lined screw-cap closures. Three replicates were prepared for each sample tested. Tissue dry weights were calculated by weighing sub-samples before and after drying in a forced air oven for 18 h at 105 C.
[0347] Lipid extraction was performed by adding 2 ml aliquots of heptane to each tube. The tubes were vortex mixed and placed into an ultrasonic bath (VWR Scientific Model 750D) filled with water heated to 60 C. The samples were sonicated at full-power (360W) for 15 min and were then centrifuged (5 min1700 g). The supernatants were transferred to clean 13100 mm glass tubes and the pellets were extracted 2 more times with heptane (2 ml, second extraction, 1 ml third extraction) with the supernatants from each extraction being pooled. After lipid extraction 1 ml acetone was added to the pellets and after vortex mixing, to fully disperse the material, they were taken to dryness in a Speedvac.
Non-Structural Carbohydrate Extraction and Analysis.
[0348] Two ml of 80% ethanol was added to the dried pellets from above. The samples were thoroughly vortex mixed until the plant material was fully dispersed in the solvent prior to sonication at 60 C for 15 min. After centrifugation, 5 min1700 g, the supernatants were decanted into clean 13100 mm glass tubes. Two more extractions with 80% ethanol were performed and the supernatants from each were pooled. The extracted pellets were suspended in acetone and dried (as above). An internal standard -phenyl glucopyranoside (100 ul of a 0.5000+/0.0010 g/100 ml stock) was added to each extract prior to drying in a Speedvac. The extracts were maintained in a desiccator until further analysis.
[0349] The acetone dried powders from above were suspended in 0.9 ml MOPS (3-N[Morpholino]propane-sulfonic acid; 50 mM, 5 mM CaCl.sub.2, pH 7.0) buffer containing 100 U of heat stable -amylase (from Bacillus licheniformis; Sigma A-4551). Samples were placed in a heat block (90 C) for 75 min and were vortex mixed every min. Samples were then allowed to cool to room temperature and 0.6 ml acetate buffer (285 mM, pH 4.5) containing 5 U amyloglucosidase (Roche 110 202 367 001) was added to each. Samples were incubated for 15-18 h at 55 C in a water bath fitted with a reciprocating shaker; standards of soluble potato starch (Sigma S-2630) were included to ensure that starch digestion went to completion.
[0350] Post-digestion the released carbohydrates were extracted prior to analysis. Absolute ethanol (6 ml) was added to each tube and after vortex mixing the samples were sonicated for 15 min at 60 C. Samples were centrifuged (5 min1700 g) and the supernatants were decanted into clean 13100 mm glass tubes. The pellets were extracted 2 more times with 3 ml of 80% ethanol and the resulting supernatants were pooled. Internal standard (100 ul 3-phenyl glucopyranoside, as above) was added to each sample prior to drying in a Speedvac.
Sample Preparation and Analysis
[0351] The dried samples from the soluble and starch extractions described above were solubilized in anhydrous pyridine (Sigma-Aldrich P57506) containing 30 mg/ml of hydroxylamine HCl (Sigma-Aldrich 159417). Samples were placed on an orbital shaker (300 rpm) overnight and were then heated for 1 hr (75 C) with vigorous vortex mixing applied every 15 min. After cooling to room temperature 1 ml hexamethyldisilazane (Sigma-Aldrich H-4875) and 100 ul trifluoroacetic acid (Sigma-Aldrich T-6508) were added. The samples were vortex mixed and the precipitates were allowed to settle prior to transferring the supernatants to GC sample vials.
[0352] Samples were analyzed on an Agilent 6890 gas chromatograph fitted with a DB-17MS capillary column (15 m0.32 mm0.25 um film). Inlet and detector temperatures were both 275 C. After injection (2 ul, 20:1 split) the initial column temperature (150 C) was increased to 180 C at a rate 3 C/min and then at 25 C/min to a final temperature of 320 C. The final temperature was maintained for 10 min. The carrier gas was H.sub.2 at a linear velocity of 51 cm/sec. Detection was by flame ionization. Data analysis was performed using Agilent ChemStation software. Each sugar was quantified relative to the internal standard and detector responses were applied for each individual carbohydrate (calculated from standards run with each set of samples). Final carbohydrate concentrations were expressed on a tissue dry weight basis.
Protein Analysis
[0353] Protein contents were estimated by combustion analysis on a Thermo Finnigan Flash 1112EA combustion analyzer. Samples, 4-8 mg, weighed to an accuracy of 0.001 mg on a Mettler-Toledo MX5 micro balance were used for analysis. Protein contents were calculated by multiplying % N, determined by the analyzer, by 6.25. Final protein contents were expressed on a % tissue dry weight basis.
TABLE-US-00039 TABLE 24 Compositional analysis of soybean seed derived from two T1 plants that were either a null segregant or homozygous for an YL DGAT1 YL DGAT2 transgene. The plants were grown in the same growth chamber environment. If not indicated otherwise values are reported as g/kg DW. Myo- Total Protein Event Pinitol Sorbitol Fructose Glucose Inositol Sucrose Raffinose Stachyose g/kg Starch (% DW) 4818.1.5 Mean 1.57 0.26 4.60 1.61 0.27 47.0 8.01 35.88 99.2 0.45 38.6 NULL SD 0.03 0.02 0.18 0.27 0.01 1.6 0.15 0.72 2.0 0.03 0.3 4818.1.5 Mean 1.31 0.24 2.67 0.79 0.31 21.2 5.08 32.60 64.2 0.03 43.4 TG SD 0.09 0.00 0.07 0.02 0.01 0.4 0.11 1.21 1.7 0.02 0.2
TABLE-US-00040 TABLE 25 Compositional analysis of soybean seed derived from a T1 plant that was heterozygous for an YL DGAT2 transgene. The plant was grown in a growth chamber. YL DGAT transgenic seed and null segregant seed were selected based on DS red expression as a visible marker. Eight DS red positive and DS red- negative seed were combined and analyzed as described above. If not indicated otherwise values are reported as g/kg DW. Protein Myo- Total (% Event Pinitol Sorbitol Fructose Glucose Inositol Sucrose Raffinose Stachyose g/kg Starch DW) 4822.2.10 Mean 1.66 0.17 5.50 2.57 0.28 47.2 6.64 45.0 108.9 0.31 40.2 NULL SD 0.12 0.04 1.76 0.87 0.09 0.2 0.68 1.6 3.1 0.05 0.7 4822.2.10 Mean 2.02 0.19 5.02 1.72 0.33 32.7 6.91 41.4 90.3 0.31 40.8 TG SD 0.06 0.01 0.33 0.18 0.02 1.0 0.18 0.6 1.5 0.11 0.9
TABLE-US-00041 TABLE 26 Compositional analysis of soybean seed derived from T1 plants that were heterozygous for a YL DGAT2 or a YL DGAT1 YL DGAT2 transgene. The plants were grown in the field. YL DGAT transgenic seed and null segregant seed were selected based on DS red expression (4822.2.10) as a visible marker or elevated oleic acid content determined by GC analysis (4818.1.2). Eight transgene-positive and transgene-negative seed were combined and analyzed as described above. If not indicated otherwise values are reported as g/kg DW. Myo- Total Protein Event Pinitol Sorbitol Fructose Glucose Inositol Sucrose Raffinose Stachyose g/kg Starch (% DW) 4822.2.10 Mean 2.44 0.26 1.16 1.12 0.44 57.7 8.5 39.0 110.6 3.20 41.5 NULL SD 0.05 0.01 0.05 0.02 0.00 0.7 0.4 0.5 1.3 0.55 0.5 4822.2.10 Mean 1.89 0.35 0.82 0.67 0.32 29.7 5.5 31.7 70.9 1.00 46.1 TG SD 0.06 0.09 0.14 0.06 0.01 1.5 0.1 0.5 2.2 0.23 0.7 4818.1.2 Mean 1.79 0.51 1.17 1.12 0.37 49.8 6.1 42.0 102.8 0.51 44.5 NULL SD 0.02 0.01 0.13 0.13 0.01 2.6 0.4 2.4 5.1 0.07 2.2 4818.1.2 Mean 1.87 0.32 0.71 0.52 0.40 35.7 6.0 37.7 83.2 0.35 46.4 TG SD 0.05 0.02 0.05 0.01 0.02 0.8 0.2 1.5 2.5 0.08 0.2
[0354] Tables 24-26 illustrate that expression one or two YL DGAT genes in different environments (growth chamber, field) is associated with a consistent shift in seed composition that is characterized by a reduction in soluble carbohydrates, namely a reduction in sucrose and to a smaller extent a reduction in stachyose. Most importantly there is no reduction in protein content observed when oil accumulation is increased through expression of YL DGAT genes.
Example 14
Measurements of DGAT Activity in Developing Seed and Somatic Embryos
[0355] The present example describes construction of soybean expression vectors comprising Yarrowia DGAT2 alone or Yarrowia DGAT2 and DGAT1, expression of these gene(s) in soybean seed or somatic embryos and DGAT enzyme activity in these tissues.
Construction of pKR1234 Comprising YL DGAT2
[0356] The NotI fragment of KS362 (SEQ ID NO:52), containing the YL DGAT2, was cloned into the NotI fragment of pKR72 (SEQ ID NO:26; Example 4) to produce pKR1234 (SEQ ID NO:68).
Construction of pKR1236 Comprising YL DGAT1 and DGAT2
[0357] The glycinin Gy1 promoter was PCR amplified from pZBL119 (which is described in PCT Publication No. WO 2004/071467 and the contents of which are hereby incorporated by reference) using primers oSGly-2 (SEQ ID NO:69) and oSGly-3 (SEQ ID NO:70). The resulting PCR fragment was subcloned into the intermediate cloning vector pCR-Script AMP SK(+) (Stratagene), according to the manufacturer's protocol, to produce plasmid pPSgly32 (SEQ ID NO:71).
[0358] The PstI/NotI fragment of plasmid pSGly32 (SEQ ID NO:71), containing the Gy1 promoter, was cloned into the PstI/NotI fragment from plasmid pKR142 (which is described in PCT Publication No. WO 2004/071467), containing the leguminA2 3 transcription termination region, an ampicillin resistance gene, and bacterial ori, to produce pKR264 (SEQ ID NO:72). Thus, vector pKR264 contains a NotI site flanked by the promoter for the glycinin Gy1 gene and the leguminA2 3 transcription termination region (Gy1/NotI/legA2 cassette).
[0359] The NcoI/XbaI fragment of KS349 (SEQ ID NO:48), containing Yarrowia DGAT1, was cloned into the NcoI/XbaI sites of pKR908, (US Pat. Pub. 20080095915), which contains NcoI/XbaI sites flanked by NotI sites, to produce pKR1212 (SEQ ID NO:73).
[0360] The NotI fragment of pKR1212 (SEQ ID NO:73), containing the Yarrowia DGAT1 gene, was cloned into the NotI site of pKR264 (SEQ ID NO:72) to produce pKR1235 (SEQ ID NO:74).
[0361] The BsiWI fragment of pKR1235 (74), containing the Yarrowia DGAT1, gene was cloned into the BsiWI site of pKR1234 (SEQ ID NO:68) to produce pKR1236 (SEQ ID NO:75).
DGAT Assays on Microsomal Extracts from Developing T2 Seed
[0362] Soybean embryogenic suspension cultures (cv. Jack) were transformed with KS362 as described herein (Example 6), comprising Yarrowia DGAT2, as described herein and T1 seed from soy plants AFS4822.1.13.1 (seed called 7GR11-58) and AFS4822.2.10.1 (seed called 7GR11-66) were planted and plants grown as described in Example 12. In both of these events seed oil concentration of transgene positive seed was found to be elevated when compared to null segregant seed of the same event.
[0363] Similarly, soybean embryogenic suspension cultures (cv. Jack) were co-transformed with KS362 (comprising YL DGAT2) and KS349 (comprising YL DGAT1) as described herein (Example 6). Transgene-positive T1 seed from event AFS4818.1.2.1 are represented by seed 7GR11-2. In this event, seed oil concentration of transgene positive seed was found to be elevated when compared to null segregant seed of the same event (Example 6). Transgene-negative, null segregant T1 seed derived from AFS4818.1.2.1 and AFS4818.1.3.1 are represented by 7GR11-7 and 7GR11-15. These seed were planted and plants grown as described in Example 12.
[0364] Approximately 1 g of T2 seed were collected from selected plants 30 days after flowering (DAF) and were snap frozen in liquid nitrogen and stored at 80 C until ready to process. After grinding 1 g of frozen seed tissue in liquid nitrogen in a mortar and pestle, 3 mL of plant homogenization buffer (300 mM sucrose; 1 mM EDTA; 10 mM Tris.HCl, pH 8.0; 1 mM DTT; 0.1% polyvinylpolypyrrolidine) was added and tissue was further homogenized using a polytron homogenizer for 1 minute. Debris was collected by vacuum filtration through 3 layers of cheese cloth followed by filtration through 1 layer of mira cloth. The resulting filtrate was centrifuged for 15 min. twice at 1,500g and the resulting supernatant was then centrifuged at 100,000g for 60 min. The resulting pellet was responded in approximately 0.5 to 1 mL of microsome buffer (100 mM potassium phosphate, pH 7.2) by gentle pipetting followed by further resuspension in a 2 mL sized Teflon-coated Dounce homogenizer. Protein concentrations were determine using Bradford reagent (Sigma-Aldrich) and microsomes were snap frozen in liquid nitrogen and stored at 80 C until assayed.
[0365] DGAT assays were carried out for 5 min at 25 C. in plant assay buffer (500 mM Tricine, pH 7.8; 28 mM sodium chloride; 0.06% CHAPS), with 20 M 1-14C-labeled oleoyl-coenzyme A (50 mCi/mmol, Perkin Elmer), 1.5 mM dioleoylglyceride (Sigma-Aldrich) and 20 pg of microsomal protein in a total reaction volume of 100 l. Each reaction was initiated by addition of the microsomal membranes to the remainder of the reaction components. Assays were terminated by the addition of 1 mL of hot isopropanol (75 C) and heating at 75 for 10 min. Assays were cooled to RT, 1.5 mL of hexane was added and samples were mixed. Phases were separated by low speed centrifugation after addition of 1.25 ml of 500 mM sodium sulfate and the upper phase was transferred to another glass tube. The top phase was then dried under nitrogen gas. The lipid from each assay was re-dissolved in 75 uL of hexane spiked with 1 uL of soybean oil. Lipid was applied to a Partisil K6 Silica Gel 60 A TLC plate (Whatman, 250 um thickness, 20 cm20 cm) and triglycerides were separated from other lipids by development with 80:20:1 (v/v/v) hexane:diethylether:acetic acid. Triacylglycerol was visualized and marked by light staining in iodine vapor in a tank. The plate was removed from the iodine tank and after the stain faded, the triacylglycerol was scraped, and radioactivity determined by liquid scintillation counting and expressed as dpm per min. Total activity was determined as the amount of radiolabeled oleic acid incorporated into triacylglycerol per minute per mg of protein using the following formula: ([dpm]/[2200000 dpm/uCi]/[50 uCi/umol]/[5 min.]/[0.02 mg protein][1000 nmol/umol]). DGAT activities for each of the samples described are shown in Table 27.
TABLE-US-00042 TABLE 27 DGAT activities for selected developing T2 seed T2 Developing Seed T1 DGAT Seed Activity T1 Oil (nmol .Math. min1 .Math. Exp. Plasmid DGAT Event T1 plant Seed Phenotype mg1) 4818 KS362 DGAT2 AFS4818.1.2 AFS4818.1.2.1 7GR DGAT 2.8 KS349 DAGT1 11-2 4818 KS362 DGAT2 AFS4818.1.2 AFS4818.1.2.1 7GR null 0.4 KS349 DAGT1 11-7 4818 KS362 DGAT2 AFS4818.1.3 AFS4818.1.3.1 7GR null 0.4 KS349 DAGT1 11-15 4822 KS362 DGAT2 AFS4822.1.13 AFS4822.1.13.1 7GR DGAT 2.4 11-58 4822 KS362 DGAT2 AFS4822.2.10 AFS4822.2.10.1 7GR DGAT 1.6 11-66
DGAT Assays on Microsomal Extracts from Soybean Somatic Embryos
[0366] Soybean embryogenic suspension cultures (cv. Jack) were transformed with either pKR1234 (SEQ ID NO:68), comprising Yarrowia DGAT2 and having experiment number MSE2181, or with pKR1236 (SEQ ID NO:75), comprising Yarrowia DGAT2 and DGAT1 and having experiment number MSE2182. Events were selected and somatic embryos matured in SHaM as described in Example 5.
[0367] After 2 weeks of maturation in SHaM, approximately 1 g of tissue from each event was frozen in liquid nitrogen and tissue was ground with a mortar and pestle as described for soybean developing seed. A small amount of ground tissue (approximately 100 mg) was lyophilized overnight and the remaining tissue was stored at 80 C.
[0368] Oil concentrations were determined on approximately 10 mg of lyophilized tissue from each event using the GC method and 17:0 internal standard exactly as described in Example 5 and results for oil concentrations and oleic acid content (% of total FAME) are shown in Table 28. Microsomal protein preparations were made, protein concentrations determined and DGAT assays were carried out on selected events determined to have a range of oil concentrations exactly as previously described for seed tissue. Results for DGAT assays are also shown in Table 28.
TABLE-US-00043 TABLE 28 Esterified Fatty Acid, Oleic Acid Content and DGAT activities of Soybean Somatic Embryos Transformed with either pKR1234 or pKR1236 oleic acid FAME (% total DGAT Activity Event # (% DCW) FAME) (nmol .Math. min.sup.1 .Math. mg.sup.1) MSE2181-pKR1234 (YL DGAT2) 8 8.9 31.9 3.6 5 7.3 33.8 4.5 3 6.6 32.6 2.5 9 6.2 30.7 2.5 7 6.1 30.4 16 5.8 25.4 1.6 12 5.6 26.1 15 5.4 26.7 2.8 4 4.6 22.5 0.7 11 4.2 22.7 0.5 14 4.0 21.2 13 3.8 23.2 1.8 6 3.5 25.3 10 3.2 21.2 0.5 MSE2182-pKR1236 (YL DGAT2/YL DGAT1) 2 10.9 38.8 6.3 7 10.8 38.8 4 10.3 38.4 5.1 3 10.0 38.0 8 9.8 38.1 4.4 17 9.6 29.3 10 8.6 33.3 5.7 28 8.2 36.3 13 8.1 43.6 5 8.0 25.4 20 8.0 36.4 12 7.7 29.3 4.8 26 7.6 30.5 24 7.2 33.4 9 6.3 20.4 0.7 29 6.3 29.8 21 6.1 31.1 19 5.7 32.5 6 5.6 21.7 0.5 23 5.6 33.5 16 5.4 26.3 25 5.1 20.3 14 5.1 26.2 0.9 1 5.0 24.9 18 4.9 22.2 30 4.5 17.0 0.4 27 3.7 19.7 15 3.2 21.6 11 2.9 16.6 2.5 22 2.8 20.7
[0369] Events transformed with pKR1234 and having some of the highest oil concentrations had increases in DGAT activity of up to 9-fold compared with those events having wild-type levels of oil. Events transformed with pKR1236 and having some of the highest oil concentrations had increases in DGAT activity of up to 15.8-fold compared with those events having wild-type levels of oil.
[0370] Soybean embryogenic suspension culture (cv. Jack) was also transformed with KS364 (SEQ ID NO:63), comprising Yarrowia DGAT2 and DGAT1 (Experiment # MSE2134) and individual events were analyzed for fatty acid profile and oil concentration as described in Example 5. Based on this data, one event (Event 54) having high oleic acid (32.83% of total fatty acids) and oil concentrations (12.5% DCWt) and one event (Event 33) having wild-type levels of oleic acid (15.52% of total fatty acids) and oil concentrations (8.2% DCWt) were chosen for DGAT assays. Transformed embryogenic suspension culture from each event was bulked up in SB 196 media and embryos matured in SHaM as described in Example 5.
[0371] After 2 weeks of maturation in SHaM, approximately 1 g of tissue from each event was frozen in liquid nitrogen, microsomal protein preparations were made and DGAT assays were carried out on each event exactly as previously described and results are shown in Table 29. Total lipid was also extracted and oleic acid and oil concentrations were determined as described below and results are reported in Table 29.
TABLE-US-00044 TABLE 29 Esterified Fatty Acid, Oleic Acid Content and DGAT activities of Soybean Somatic Embryos Transformed with KS364 KS364 (DGAT2/DGAT1) oleic acid FAME (% total DGAT Activity Event # (% DCW) FAME) (nmol .Math. min.sup.1 .Math. mg.sup.1) 33 8.2 15.5 0.3 54 12.7 32.1 3.2
[0372] The event having the high oil concentration (Event 54) had increases in DGAT activity of 10.7-fold compared with the event having wild-type levels of oil (Event 33).
Example 15
Analysis of Lipid Fractions of Transgenic Seed and Somatic Embryos Expressing DGAT Genes
[0373] Soy somatic embryos transformed with KS364 from an event with wild-type concentrations of oil and oleic acid (Event 33) and from an event with high concentrations of oil and oleic acid (Event 54) were lyophilized for 48 hr and tissue was ground using a genogrinder exactly as described in Example 5.
Total Lipid Extraction
[0374] Total lipid was extracted from each event by the method of Bligh, E. G. & Dyer, W. J. (Can. J. Biochem. Physiol. 37:911-917 (1959)) with some modifications. Briefly, approximately 100 mg of ground tissue from each event was added to a 16 mm125 mm sized test-tube with a teflon-lined screw cap lid. A mixture of methanol:chloroform/2:1 (6 mL) was added and the sample was extracted with gentle mixing for 1 hr after which 2 mL of chloroform was added followed by continued mixing for 30 min. Afterwards, 3.6 mL of water was added, the tube was vortexed vigorously and phases were separated by centrifugation in a clinical centrifuge. The lower organic layer was gently removed to a second glass test tube and the upper aqueous layers were re-extracted with 2 mL of chloroform. Centrifugation was repeated and the lower organic phase was combined with the first organic phase. Samples were dried under a stream of nitrogen at 50 C, total lipid was estimated by weighing and lipid was dissolved in chloroform:methanol/6:1 to a concentration of approximately 10 mg/mL. FAME analysis was carried out on approximately 50 ug of each sample using the sulfuric acid/methanol procedure described herein (Example 4) and results are shown in Table 30.
Separation of Neutral and Polar Lipids
[0375] Sep-pak amino-propyl solid phase extraction columns (Waters; 6 cc columns, WAT054560) were equilibrated with 5 mL of methanol followed by 5 mL of methanol:chloroform/1:1 followed by 5 mL of chloroform. Approximately 5 mg of total lipid in chloroform:methanol/6:1 was added to each column, followed by 51 mL aliquots of chloroform to elute neutral lipids and all fractions were collected, combined and dried under a stream of nitrogen at 50 C. Polar lipids were then eluted from each column using 51 mL aliquots of methanol:chloroform/1:1 followed by 51 mL aliquots of methanol and all fractions were combined and dried under nitrogen. Neutral lipids were dissolved in approximately 1 mL of CHCl3:MeOH/6:1 and polar lipids were dissolved in approximately 200 uL of CHCl3:MeOH/6:1. FAME analysis was carried out on approximately 50 ug of neutral lipid using the sulfuric acid/methanol procedure described herein (Example 4) and results are shown in Table 30.
Separation of TAG, PC and PE by TLC
[0376] Approximately 100 uL of neutral lipid extract was loaded 2 cm from the bottom of a Partisil K6 Silica Gel 60 A TLC plate (Whatman, 250 um thickness, 20 cm20 cm). Similarly, approximately 200 uL of the polar lipid fraction was loaded onto the same TLC plate. Standard solutions (10 mg/mL in chloroform:methanol/6:1) of TAG, PC and PE were also spotted onto the plates. TLC plates were developed in CHCl3:MeOH:AcOH/65:35:8 until solvent front was approximately half way up the plate. TLC plates were then air dried for 10 min and developed fully in 70:30:1 (v/v/v) hexane:diethylether:acetic acid. Standards were visualized by light staining with iodine vapour and corresponding bands for TAG, PC and PE were cut out of the TLC plate. Silica gel containing each lipid species was derivatized directly with sulfuric acid/methanol as described herein (Example 4) and results are shown in Table 30.
Fatty Acid Positional Analysis of TAG
[0377] Fatty acid profiles of the sn2 position of TAG were determined using porcine pancreatic lipase to remove acyl groups from the sn1 and sn3 position of TAG only, followed by transesterification of the resulting monoacylglyceride (MAG) produced. Approximately 5 mg of neutral lipid extract was suspended in 2 mL of 1M Tris.HCl, pH 8.0 along with 0.2 mL of 2.2% calcium chloride and 0.5 mL of 0.05% Bile salts in a glass screw cap test tube. The lipid was incubated at 37 C for 5 min, 5 mg of porcine pancreatic lipase was added directly and the suspension was incubated with shaking at 37 C for 20 min. After incubation, the reaction was reaction was terminated with the addition of 1 mL of ethanol followed by 1 mL of 6 M HCl. After mixing, 2.5 mL of diethyl ether was added, phases were separated by centrifugation and the top organic layer was removed carefully. The diethyl ether extraction was repeated and the top diethyl ether phase was combined with the first. After drying over anhydrous sodium sulfate, the diethyl ether was evaporated under a stream of nitrogen at 50 C and the resulting lipid was dissolved in 200 uL of chloroform:methanol/6:1. The lipid was loaded onto a Partisil K6 TLC plate along with triacylglyceride (TAG), diacylglyceride (DAG), monoacylglyceride (MAG) and free fatty acid (FFA) standards and the TLC plate was developed as described herein. Afterwards, standards were visualized with light iodine staining and the MAG band was cut and derivatized with methanol/sulfuric acid as previously described herein. Results for the fatty acid profile of FAME from the MAG band, representing the fatty acid profile of the sn2 position of TAG (i.e. the acyl group on C2 of glycerol), along with the calculated sn1 and sn3 positions, is shown in Table 30. In Table 30, the % of total fatty acid for each fatty acid (i.e. 16:0, 18:0, 18:1, 18:2, 18:3) at the sn1 and sn3 positions of TAG is calculated with the following formula: =([TAGx][sn2x]/3)*3/2; where the x indicates the fatty acid of interest.
TABLE-US-00045 TABLE 30 Fatty acid composition of various lipid species and positional distribution in TAG % Sample Event Oil 16:0 18:0 18:1 18:2 18:3 Total 33 8.2 15.6 3.9 15.5 50.8 14.2 Extract 54 12.7 10.5 4.7 32.1 43.9 8.8 Neutral 33 8.2 14.4 3.7 17.0 52.5 12.4 lipids 54 12.7 9.8 5.3 36.0 42.3 6.6 TAG 33 8.2 18.2 4.8 20.8 47.4 8.7 54 12.7 11.8 5.8 40.7 37.0 4.6 PC 33 8.2 34.1 10.6 17.2 33.8 4.3 54 12.7 21.5 10.0 32.1 33.7 2.7 PE 33 8.2 41.1 6.8 13.4 25.9 12.8 54 12.7 45.8 9.8 21.9 15.3 7.1 TAG-sn1 33 8.2 1.0 0.3 14.9 72.7 11.0 54 12.7 1.0 0.5 24.0 67.1 7.4 TAG-sn1,3 33 8.2 26.8 7.0 23.8 34.9 7.5 (Calculated) 54 12.7 17.3 8.5 49.1 22.0 3.2
Changes in fatty acid profiles associated with YL DGAT expression observed in TAG are also observed in polar lipids.
Example 16
Yarrowia DGAT Variants with Altered Amino Acid Sequence
[0378] The present example describes the creation of mutant forms of Yarrowia DGAT2, cloning them into a yeast expression vector and assaying microsomal protein fractions for DGAT activity.
[0379] Constructing Saccharomyces Expression Vectors Containing Mutant Yarrowia DGAT2s
[0380] Yarrowia DGAT2 was amplified from pKR1234 (SEQ ID NO:68; Example 14) with oligonucleotide primers oYDG2-1 (SEQ ID NO:76) and oYDG2-2 (SEQ ID NO:77), using the Phusion High-Fidelity DNA Polymerase (Cat. No. F553S, Finnzymes Oy, Finland) following the manufacturer's protocol. The resulting DNA fragment was cloned into the pCR-Blunt cloning vector using the Zero Blunt PCR Cloning Kit (Invitrogen Corporation), following the manufacturer's protocol, to produce pKR1254 (SEQ ID NO:78).
[0381] A single codon in the Yarrowia DGAT2 sequence, which codes for amino acid Y326 in the corresponding amino acid sequence SEQ ID NO: 10, was changed using the Quickchange Site Directed Mutagenesis kit (Cat. No. 200518, Stratagene, La Jolla, Calif.), with oligonucleotides YID2_Y326F-5 (SEQ ID NO:79) and YID2_Y326F-3 (SEQ ID NO:80), following the manufacturer's protocol. After extensive sequencing, a clone coding for an amino acid sequence which is identical to the Yarrowia DGAT2 (SEQ ID NO:10), except that Y326 was changed to F326, was chosen for further study. This clone was designated pKR1254_Y326F (SEQ ID NO:81). The nucleotide sequence for altered coding sequence (YIDGAT2_Y326F) is set forth in SEQ ID NO:82 and the corresponding amino acid sequence is set forth in SEQ ID NO:83.
[0382] A single codon in the Yarrowia DGAT2 sequence, which codes for amino acid Y326 in the corresponding amino acid sequence SEQ ID NO:10, was changed using the Quickchange Site Directed Mutagenesis kit (Cat. No. 200518, Stratagene, La Jolla, Calif.), with oligonucleotides YID2_Y326L-5 (SEQ ID NO:84) and YID2_Y326L-3 (SEQ ID NO:85), following the manufacturer's protocol. After extensive sequencing, a clone coding for an amino acid sequence which is identical to the Yarrowia DGAT2 (SEQ ID NO:10), except that Y326 was changed to L326, was chosen for further study. This clone was designated pKR1254_Y326L (SEQ ID NO:86). The nucleotide sequence for altered coding sequence (YIDGAT2_Y326L) is set forth in SEQ ID NO:87 and the corresponding amino acid sequence is set forth in SEQ ID NO:88.
[0383] A single codon in the Yarrowia DGAT2 sequence, which codes for amino acid R327 in the corresponding amino acid sequence SEQ ID NO:10, was changed using the Quickchange Site Directed Mutagenesis kit (Cat. No. 200518, Stratagene, La Jolla, Calif.), with oligonucleotides YID2_R327K-5 (SEQ ID NO:89) and YID2_R327K-3 (SEQ ID NO:90), following the manufacturer's protocol. After extensive sequencing, a clone coding for an amino acid sequence which is identical to the Yarrowia DGAT2 (SEQ ID NO:10), except that R327 was changed to K327, was chosen for further study. This clone was designated pKR1254_R327K (SEQ ID NO:91). The nucleotide sequence for altered coding sequence (YIDGAT2_Y326L) is set forth in SEQ ID NO:92 and the corresponding amino acid sequence is set forth in SEQ ID NO:93.
[0384] The NotI fragments of pKR1254, pKR1254_Y326F, pKR1254_Y326L or pKR1254_R327K, each containing a wild-type or mutant version of YIDGAT2, were cloned into the NotI site of pY75 (SEQ ID NO:3; Example 1) to produce pY191 (SEQ ID NO:94), pY192 (SEQ ID NO:95), pY193 (SEQ ID NO:96) or pY194 (SEQ ID NO:97), respectively.
Assaying DGAT Activity of Mutant Yarrowia DGAT2s
[0385] A mutant strain of Saccharomyces cerevisiae where the endogenous DGAT2 gene (DGA1) was knocked out and has the following genotype (BY4741, MATa his31 leu20 met150 ura30) was obtained from Open Biosystems (http://www.openbiosystems.com/). It was transformed with pY191, pY192, pY193 or pY194 and transformants were isolated as described herein. Three individual transformants per transformation were inoculated into 2 mL cultures of DOBA media supplemented with CSM-leu 30 C. for 16 h. Cells (1 mL) were transferred to 50 mL of DOBA medium described above and grown at 30 C. for an additional 16 h. Cells were pelleted by centrifugation, frozen in liquid nitrogen and stored at 80 C. until required for use.
[0386] Pellets were re-suspended in 2 mL of yeast homogenization buffer (20 mM Tris.HCl, pH 8.0; 10 mM MgCl2; 1 mM EDTA; 5% glycerol; 1 mM DTT; 0.3 M (NH.sub.4).sub.2SO.sub.4) and the suspension was added to a 2 mL screw cap tube containing approximately 1 mL of 0.5 mm glass beads. The after removal of air pockets by vortexing, the resuspension was filled to the top of the tube, the tube capped and the cells broken with three, 1 min. pulses in a mini bead beater at 5000 rpm with storage on ice for 5 min. The yeast homogenate was centrifuged at 1,500g for 15 min. at 4 C and the resulting supernatant was then centrifuged at 100,000g for 60 min. The resulting pellet was responded in approximately 0.2 to 0.5 mL of microsome buffer (100 mM potassium phosphate, pH 7.2) by gentle pipetting followed by further resuspension in a 2 mL sized Teflon-coated Dounce homogenizer. Protein concentrations were determine using Bradford reagent (Sigma-Aldrich) and microsomes were snap frozen in liquid nitrogen and stored at 80 C until assayed.
[0387] DGAT assays were carried out for 1 min at 25 C. in yeast assay buffer (50 mM potassium phosphate (pH 7.2)), with 20 M 1-14C-labeled oleoyl-coenzyme A (50 mCi/mmol, Perkin Elmer), and 20 pg of microsomal protein in a total reaction volume of 100 l. Each reaction was initiated by addition of the microsomal membranes to the remainder of the reaction components. Assays were terminated and radioactivity into TAG determined exactly as described for the plant DGAT assays except the formula was changed to reflect a 1 min. assay time (i.e. [dpm]/[2200000 dpm/uCi]/[50 uCi/umol]/[5 min.]/[0.02 mg protein][1000 nmol/umol]). DGAT activities for each of the samples as well as the averages described are shown in Table 31.
TABLE-US-00046 TABLE 31 DGAT activities for DGA1 Transformed with pY191, pY192, pY193 or pY194. Avg. DGAT Activity DGAT Activity Std. Plasmid Mutant (nmol .Math. min.sup.1 .Math. mg.sup.1) (nmol .Math. min.sup.1 .Math. mg.sup.1) Dev. pY191 wt 7.6 10.4 2.7 10.6 13.0 pY192 Y326F 6.5 8.3 1.7 8.4 10.0 pY193 Y326L 6.2 8.1 1.9 10.0 8.2 pY194 R327K 5.9 6.2 0.4 6.0 6.7
From Table 31, it appears that the Y326F and Y326L amino acid changes have minimal effect on Yarrowia DGAT2 activity when assayed in yeast and these two mutants were chosen for expression in soy somatic embryos.
[0388] Constructing Soy Expression Vectors Containing Mutant Yarrowia DGAT2s
[0389] The NotI fragment of pKR1254 (SEQ ID NO:78), pKR1254_Y326F (SEQ ID NO:81) or pKR1254_Y326L (SEQ ID NO:86), containing wild-type or mutant forms of Yarrowia DGAT2, were cloned into the NotI fragment of pKR72 (SEQ ID NO:26; Example 4) to produce pKR1256 (SEQ ID NO:98), pKR1277 (SEQ ID NO:99) or pKR1278 (SEQ ID NO:100), respectively.
Determining Oil Concentrations of Soy Somatic Embryos Expressing Mutant Yarrowia DGAT2s
[0390] Soybean embryogenic suspension culture (cv. Jack) was transformed with either pKR1256 (SEQ ID NO:98), comprising wild-type Yarrowia DGAT2 and having experiment number MSE2228, pKR1277 (SEQ ID NO:99), comprising Yarrowia DGAT2_Y326F and having experiment number MSE2229, or pKR1278 (SEQ ID NO:100), comprising Yarrowia DGAT2_Y326L and having experiment number MSE2230. Events were selected and somatic embryos matured in SHaM as described in Example 5. Oil concentrations were determined for each event using the NMR and described herein and fatty acid profiles were determined by GC exactly as described in herein and results for oil concentrations and oleic acid content (% of total FAME) are shown in Table 32.
TABLE-US-00047 TABLE 32 Oil concentrations for somatic soy embryos transformed with pKR1256, pKR1277 or pKR1278 MSE2228-pKR1256 MSE2229-pKR1277 MSE2230-pKR1278 (wt DGAT2) (Y326F) (Y326L) oleic oleic oleic FAME acid FAME acid FAME acid (% (% total (% (% total (% (% total Event # DCW) FAME) Event # DCW) FAME) Event # DCW) FAME) 2228-9 14.3 44.4 2229-6 15.1 43.5 2230-4 11.6 35.1 2228-20 12.6 34.3 2229-20 14.4 44.3 2230-21 10.1 22.3 2228-3 12.4 39.3 2229-13 14.4 38.1 2230-15 9.8 22.4 2228-14 12.3 36.8 2229-21 14.0 36.5 2230-8 9.7 34.9 2228-2 11.7 36.8 2229-16 13.2 36.3 2230-29 9.6 33.0 2228-15 10.9 35.2 2229-24 13.1 39.9 2230-27 9.4 35.6 2228-5 10.1 23.3 2229-23 12.3 42.7 2230-3 9.4 36.7 2228-17 10.0 23.5 2229-3 12.2 41.3 2230-19 9.0 34.7 2228-24 10.0 27.6 2229-25 12.0 40.4 2230-6 8.6 23.6 2228-6 9.5 25.2 2229-31 11.9 39.0 2230-24 8.5 23.3 2228-18 9.5 32.4 2229-18 11.6 40.8 2230-18 8.4 35.8 2228-21 9.0 32.9 2229-5 11.4 38.7 2230-22 7.3 23.3 2228-12 8.7 22.7 2229-12 11.3 36.7 2230-2 7.0 26.7 2228-10 8.4 24.3 2229-10 11.3 35.6 2230-14 6.9 25.9 2228-22 7.5 29.9 2229-27 10.9 27.8 2230-9 6.9 22.9 2228-8 6.8 21.4 2229-30 10.7 39.0 2230-25 6.8 27.3 2228-19 6.5 27.3 2229-15 10.4 36.3 2230-7 6.8 37.5 2228-23 6.4 26.5 2229-8 9.7 39.5 2230-5 6.5 25.6 2228-7 6.1 22.2 2229-9 9.4 37.4 2230-10 6.4 31.1 2228-13 6.1 24.0 2229-22 9.2 22.3 2230-30 6.3 24.7 2228-11 5.2 24.3 2229-7 8.7 23.0 2230-26 6.3 23.4 2228-4 5.1 18.5 2229-26 8.4 31.2 2230-17 6.3 25.2 2228-16 4.2 19.3 2229-17 8.3 38.2 2230-20 6.3 19.5 2228-1 3.2 23.1 2229-28 7.9 27.2 2230-13 5.8 22.3 average 8.6 28.1 2229-29 7.8 25.7 2230-12 5.7 21.7 2229-1 7.4 32.8 2230-23 5.6 25.1 2229-2 5.9 18.6 2230-11 5.5 20.7 2229-11 4.6 18.6 2230-1 5.4 26.3 2229-19 4.1 22.6 2230-16 5.3 24.0 2229-4 4.0 21.2 2230-28 4.6 20.4 2229-14 3.1 39.8 2230-31 4.3 18.3 average 8.8 32.2 average 6.5 25.4
[0391] In soy somatic embryos, a variant of the YL DGAT2 protein carrying the Y326F mutation increases oil concentrations and shifts the fatty acid profile of the oil at least to the same extent as the wild-type Yarrowia DGAT2.
Example 17
Expression Optimized DGAT Genes
[0392] Sequences encoding YL DGAT1 and YL DGAT2 genes that are optimized for expression in soybean plants are set forth as SEQ ID NO:64 and SEQ ID NO:66. The design of these sequences is described in Example 9. DNA molecules with this DNA sequence flanked by Not I restriction sites were synthesized by DNA 2.0 (California, USA). Plasmid DNA with the synthesized genes was digested with Not I. Not I restriction fragments with the DGAT genes were ligated to Not linearized, dephosphorylated DNA of KS332, which is described in Example 5. The resulting DNA constructs in which expression of expression-optimized variants of yarrowia DGAT1 or yarrowia DGAT2 genes are under the control of the betaconglycinin promoter are henceforth referred to as KS392 and KS393. Their sequence is set forth as SEQ ID NO:101 and SEQ ID NO:102. Moreover plasmid KS391 was constructed. To this end DNA of KS349 was digested with NotI and NcoI. Ends of the of the resulting DGAT1 restriction fragment were completely filled-in and ligated to NotI linearized and filled in DNA of KS332. The resulting plasmid construct is henceforth referred to as KS391. In this construct the native YL DGAT1 sequences is under the control of the betaconglycinin promoter. The sequence of KS391 is set forth as SEQ ID NO:103. Transgenic soybean somatic embryos were regenerated as after particle bombardment with plasmid DNA of KS391, KS392, KS 362 and KS393 as described above (Example 5). Oil content of somatic embryos was measured using NMR. Briefly lyophilized embryo tissue was pulverized in genogrnder vial as described previously (Example 4). 20-200 mg of tissue powder were transferred to NMR tubes. Oil content of the somatic embryo tissue powder was calculated from the NMR signal as described in Example 4.
TABLE-US-00048 TABLE 33 Oil concentrations for somatic soy embryos transformed with pKS392 and pKS391 SAMPLE ID % oil Construct KS392 1 2196.1.08 15.7 2 2196.3.03 13.9 3 2196.1.05 13.7 4 2196.1.15 13.4 5 2196.1.02 12.2 6 2196.3.07 12.1 7 2196.3.04 12.1 8 2196.3.05 11.6 9 2196.1.06 11.4 10 2196.1.07 11.4 11 2196.1.03 10.4 12 2196.1.14 10.2 13 2196.1.12 9.4 14 2196.3.08 9.1 15 2196.3.09 8.1 16 2196.4.02 8.1 17 2196.1.09 7.8 18 2196.2.01 7.6 19 2196.5.01 7.4 20 2196.3.01 7.4 21 2196.1.04 7.3 22 2196.2.02 7.3 23 2196.3.02 6.9 24 2196.1.10 6.5 25 2196.4.03 6.5 26 2196.1.11 6.0 27 2196.4.01 5.7 28 2196.3.06 5.4 29 2196.5.02 5.3 30 2196.1.13 3.5 AVERAGE 9.1 % OIL Construct KS391 1 2195.3.15 12.8 2 2195.5.02 11.5 3 2195.3.01 11.2 4 2195.3.03 11.0 5 2195.3.02 10.6 6 2195.4.06 10.4 7 2195.3.08 10.2 8 2195.2.01 10.1 9 2195.3.04 9.3 10 2195.3.05 9.2 11 2195.5.01 9.1 12 2195.2.04 8.8 13 2195.3.14 8.6 14 2195.3.10 7.8 15 2195.4.01 7.7 16 2195.5.03 6.5 17 2195.4.02 6.4 18 2195.3.09 6.3 19 2195.4.07 6.2 20 2195.3.06 6.1 21 2195.3.13 6.0 22 2195.5.05 5.9 23 2195.4.03 5.6 24 2195.5.04 5.5 25 2196.1.01 5.3 26 2195.4.04 5.3 27 2195.3.11 5.2 28 2195.2.03 5.0 29 2195.4.05 4.9 30 2195.3.07 4.4 31 2195.2.02 4.3 AVERAGE 7.6 % OIL
[0393] Table 33 compares the oil content of 30 and 31 events generated with KS392 and KS 391, respectively. Average oil content of all events generated with KS392 was 9.1% whereas oil content of all events generated with KS391 was 7.6%. More over the highest oil content observed with KS392 was 15.7% compared to 12.8% for KS391. Applicants have demonstrated that expression optimization of YL DGAT1 leads to increased oil content in developing soybean embryos when compared to the native YL DGAT1 gene.
TABLE-US-00049 TABLE 34 Oil concentrations for somatic soy embryos transformed with pKS393 and pKS362 SAMPLE ID % oil Construct KS393 1 2207.5.05 12.3 2 2207.5.08 12.2 3 2207.5.06 11.7 4 2207.5.03 10.8 5 2207.5.01 10.6 6 2207.5.04 10.3 7 2207.4.04 10.3 8 2207.3.09 9.5 9 2207.5.07 9.3 10 2207.4.01 8.8 11 2207.4.02 8.7 12 2207.3.06 8.0 13 2207.3.04 7.9 14 2207.4.06 7.8 15 2207.4.03 7.7 16 2207.4.08 7.4 17 2207.3.14 7.1 18 2207.4.05 7.0 19 2207.3.12 7.0 20 2207.3.01 6.9 21 2207.5.02 6.8 22 2207.3.02 6.7 23 2207.3.07 6.7 24 2207.3.03 6.6 25 2207.3.13 6.5 26 2207.3.11 6.3 27 2207.3.05 5.8 28 2207.3.10 5.8 29 2207.4.07 5.5 30 2207.3.08 5.4 31 2207.4.09 5.4 AVERAGE 8.0 % OIL Construct KS362 1 2208.2.08 11.6 2 2208.5.04 11.5 3 2208.2.04 11.5 4 2208.2.10 11.2 5 2208.2.09 10.3 6 2208.2.02 10.2 7 2208.5.02 10.0 8 2208.3.10 9.8 9 2208.3.12 9.8 10 2208.3.06 9.5 11 2208.3.04 8.8 12 2208.5.05 8.6 13 2208.2.07 8.1 14 2208.2.03 8.0 15 2208.3.03 8.0 16 2208.5.01 8.0 17 2208.2.06 7.8 18 2208.2.11 7.4 19 2208.5.07 7.3 20 2208.3.14 7.2 21 2208.3.02 7.0 22 2208.3.08 6.4 23 2208.3.07 6.1 24 2208.2.12 6.1 25 2208.3.09 6.0 26 2208.3.11 6.0 27 2208.2.01 5.8 28 2208.2.05 5.7 29 2208.3.01 5.4 30 2208.5.03 5.1 31 2208.3.13 4.7 32 2208.5.06 4.1 33 2208.3.05 3.2 AVERAGE 7.8 % OIL
[0394] Table 34 compares the oil content 31 of and 33 events generated with KS393 and KS 362. Average oil content of all events generated with KS393 was 8.0% whereas oil content of all events generated with KS393 was 7.8%. More over the highest oil content observed with KS393 was 12.3% compared to 11.6% for KS362. Applicants have demonstrated that expression optimization of YL DGAT2 leads a very small increase in oil content in developing soybean embryos when compared to the native YL DGAT2 gene.
Example 18
Co-Expression of Either YL LPAAT1 or YL LPAAT2 with YL DGAT1 and YL DGAT2 in Soybean Somatic Embryos
[0395] The present example describes construction of soybean expression vectors pKR1242, comprising Yarrowia lyso-phosphatidic acid acyltransferase protein homolog 1 (YL LPAAT1) and pKR1243, comprising Yarrowia lyso-phosphatidic acid acyltransferase protein homolog 2 (YL LPAAT2), and co-expression of these with pKR1236, comprising Yarrowia DGAT1 and DGAT2, in somatic embryos. Vector pKR1236 alone was also included as a control.
Construction of pKR1242 Comprising YL LPAAT1
[0396] The NcoI/BsiWI fragment of pFBAIn-YLPAT1 (SEQ ID NO:104), containing the YL LPAAT1, was cloned into the NcoI/BsiWI fragment of pKR908 (US Pat. Pub. 20080095915), to produce pKR1239 (SEQ ID NO:105) which generates NotI sites flanking the YL LPAAT1 gene.
[0397] A starting vector pKR457 (SEQ ID NO:106), which was previously described in PCT Publication No. WO 2005/047479 (the contents of which are hereby incorporated by reference), contains a NotI site flanked by the Kunitz soybean Trypsin Inhibitor (KTi) promoter (Jofuku et al., Plant Cell 1:1079-1093 (1989)) and the KTi 3 termination region, the isolation of which is described in U.S. Pat. No. 6,372,965, followed by the soy albumin transcription terminator, which was previously described in PCT Publication No. WO 2004/071467.
[0398] The NotI fragment of pKR1239 (SEQ ID NO:105), containing YL LPAAT1, was cloned into the NotI site of pKR457 (SEQ ID NO:106) to produce pKR1242 (SEQ ID NO:107).
Construction of pKR1243 Comprising YL LPAAT2
[0399] The NcoI/BsiWI fragment of pFBAIn-YLPAAT2 (SEQ ID NO:108), containing the YL LPAAT2, was cloned into the NcoI/BsiWI fragment of pKR908 to produce pKR1240 (SEQ ID NO:109) which generates NotI sites flanking YL LPAAT2 gene.
[0400] The NotI fragment of pKR1240 (SEQ ID NO:109), containing YL LPAAT2, was cloned into the NotI site of pKR457 (SEQ ID NO:106) to produce pKR1243 (SEQ ID NO:110).
Co-Expression of Either YL LPAAT1 or YL LPAAT2 with YL DGAT1 and YL DGAT2
[0401] Vector pKR1242 (SEQ ID NO:107) and pKR1243 (SEQ ID NO:110) were digested with BsiWI and fragment purified as described herein (Example 5). Soybean embryogenic suspension culture (cv. Jack) was transformed with the BsiWI fragment from pKR1242 (SEQ ID NO:107) and pKR1236 (SEQ ID NO:75) and having experiment number MSE2183 or with BsiWI fragment of pKR1243 (SEQ ID NO:110) and pKR1236 (SEQ ID NO:75) and having experiment number MSE2184. Plasmid pKR1236 (SEQ ID NO:75) was also transformed alone in a similar way for a control and has experiment number MSE2185. Events were selected and somatic embryos matured in SHaM as described in Example 5. Oil concentrations and fatty acid profiles were determined as described in Example 4 for MSE2183, MS2184 and MSE2185 and results for each experiment are shown in Table 35, Table 36 and Table 37, respectively.
TABLE-US-00050 TABLE 35 Oil concentrations and fatty acid profiles for events from MSE2183 MSE2183 (YL LPAAT1 + YL DGAT1 & YL DGAT2) % Event 16:0 18:0 18:1 18:2 18:3 Oil 2183-8 12.6 5.3 34.3 40.0 7.9 11.8 2183-26 11.8 5.4 42.2 34.2 6.4 11.2 2183-24 12.0 6.1 35.2 38.3 8.3 11.0 2183-23 12.6 6.5 33.7 38.6 8.7 10.9 2183-1 12.7 6.0 38.4 35.0 8.0 10.8 2183-15 13.2 6.0 32.0 39.1 9.7 10.5 2183-12 13.5 5.3 35.7 36.5 9.0 9.9 2183-27 13.6 5.5 29.7 40.5 10.7 9.8 2183-11 12.4 5.3 33.0 38.3 11.0 8.8 2183-10 14.5 6.0 29.4 38.7 11.4 8.0 2183-28 13.9 6.2 29.6 40.0 10.3 7.8 2183-17 13.8 6.3 32.3 37.0 10.7 7.7 2183-33 16.3 6.2 23.4 42.2 11.9 7.6 2183-7 14.2 6.3 31.2 37.2 11.2 7.1 2183-19 13.2 5.3 35.1 36.2 10.2 6.9 2183-30 15.3 5.6 28.4 38.5 12.1 6.9 2183-21 14.3 6.1 33.1 35.6 10.9 6.6 2183-2 12.8 4.5 29.3 41.4 12.1 6.6 2183-13 12.8 5.2 34.1 36.9 11.0 6.4 2183-20 16.6 5.3 22.4 42.5 13.2 6.4 2183-3 16.6 5.4 23.4 40.3 14.3 6.3 2183-5 14.2 5.8 31.4 36.6 11.9 6.2 2183-22 15.1 5.2 24.6 40.2 14.9 6.2 2183-6 17.7 5.0 20.7 41.3 15.3 6.0 2183-18 15.9 5.0 23.0 41.5 14.6 5.7 2183-25 17.4 4.1 15.4 45.6 17.5 5.5 2183-29 17.3 5.9 22.7 39.0 15.2 4.3 2183-9 17.9 5.7 21.9 37.6 16.9 4.3 2183-4 18.4 4.2 15.1 42.8 19.5 3.4 2183-32 20.1 3.8 15.0 39.4 21.7 3.4 Avg. 14.8 5.5 28.5 39.0 12.2 7.5
TABLE-US-00051 TABLE 36 Oil concentrations and fatty acid profiles for events from MSE2184 MSE2184 (YL LPAAT2 + YL DGAT1 & YL DGAT2) % Event 16:0 18:0 18:1 18:2 18:3 Oil 2184-27 12.5 5.9 32.4 40.8 8.3 11.0 2184-24 13.1 6.9 34.1 37.1 8.8 9.5 2184-30 12.6 5.2 32.4 40.2 9.6 9.1 2184-20 14.3 5.6 26.8 42.4 10.9 9.1 2184-13 12.1 5.4 31.7 40.8 10.0 9.0 2184-18 14.5 5.3 28.4 41.8 10.1 8.9 2184-12 12.5 5.8 36.3 36.8 8.6 8.7 2184-16 14.1 5.4 29.5 40.8 10.1 8.5 2184-1 13.1 6.4 33.4 37.5 9.5 8.1 2184-8 18.7 5.2 18.7 44.1 13.3 8.1 2184-23 13.4 5.8 33.6 37.8 9.3 8.0 2184-4 14.5 5.1 30.9 39.5 10.0 7.9 2184-14 14.5 5.5 34.4 35.3 10.3 7.9 2184-29 12.7 5.7 31.4 40.0 10.1 7.9 2184-3 13.4 5.7 33.5 37.3 10.1 7.7 2184-9 14.2 4.8 29.2 39.5 12.2 7.4 2184-26 16.0 5.2 19.4 45.6 13.8 7.1 2184-2 15.8 4.8 24.7 42.7 12.0 6.1 2184-17 13.2 5.4 27.3 41.8 12.3 6.1 2184-31 17.0 4.9 18.0 43.5 16.6 5.6 2184-6 17.8 5.2 20.9 41.1 15.0 5.5 2184-25 17.1 6.0 23.6 38.7 14.5 5.2 2184-22 15.9 4.6 21.4 42.1 16.0 5.0 2184-21 16.6 4.6 16.8 44.8 17.2 4.9 2184-28 16.2 4.6 20.4 42.3 16.5 4.8 2184-5 15.5 4.6 16.8 43.9 19.2 4.7 2184-19 16.7 5.5 22.6 39.9 15.2 4.3 2184-7 16.0 4.0 13.6 39.9 26.5 3.6 Avg. 14.8 5.3 26.5 40.6 12.7 7.1
TABLE-US-00052 TABLE 37 Oil concentrations and fatty acid profiles for events from MSE2185 MSE2185 (YL DGAT1 & YL DGAT2) % Event 16:0 18:0 18:1 18:2 18:3 Oil 2185-17 12.6 6.4 32.8 39.6 8.6 11.8 2185-26 11.2 6.4 36.3 38.5 7.6 11.7 2185-18 11.8 6.5 38.8 35.7 7.1 11.6 2185-25 12.1 6.3 34.0 39.0 8.6 11.3 2185-15 12.2 5.9 36.8 37.6 7.6 11.1 2185-23 12.7 6.1 30.2 41.7 9.3 10.7 2185-21 11.8 6.5 35.3 38.1 8.3 10.5 2185-20 12.3 7.1 34.1 37.8 8.7 10.2 2185-31 13.6 6.4 34.4 37.0 8.5 10.1 2185-27 12.5 5.9 32.0 40.0 9.6 10.1 2185-14 13.2 5.9 31.7 39.7 9.5 9.5 2185-2 14.7 5.6 27.3 41.7 10.8 9.4 2185-6 12.4 6.2 35.3 37.7 8.3 9.2 2185-11 13.4 6.0 30.9 39.0 10.6 9.1 2185-19 13.5 6.1 30.2 39.1 11.0 9.1 2185-16 13.2 5.8 30.4 39.0 11.6 9.0 2185-1 15.6 5.0 24.5 42.9 11.9 8.6 2185-28 16.6 5.1 21.7 44.3 12.3 8.5 2185-3 13.9 6.0 30.4 39.2 10.5 8.4 2185-13 14.4 6.1 27.4 41.3 10.8 8.2 2185-5 14.1 5.5 31.4 38.6 10.4 7.4 2185-24 15.3 6.9 26.0 38.8 12.9 7.2 2185-4 18.1 5.4 22.4 39.3 14.8 6.3 2185-7 16.6 6.3 15.1 43.6 18.4 5.5 2185-29 15.9 6.0 24.3 39.4 14.4 5.1 2185-9 17.4 5.9 20.0 40.9 15.8 4.8 2185-30 15.6 5.0 17.5 41.2 20.8 4.3 Avg. 14.0 6.0 29.3 39.6 11.1 8.9
Example 19
Co-Expression of Either YL LPAAT3 or YL PDAT with YL DGAT1 and YL DGAT2 in Soybean Somatic Embryos
[0402] The present example describes construction of soybean expression vectors pKR1244, comprising Yarrowia lyso-phosphatidic acid acyltransferase protein homolog 3 (YL LPAAT3) and pKR1246, comprising Yarrowia phospholipid:diacylglyceride acyltransferase (YL PDAT), and co-expression of these with pKR1236, comprising Yarrowia DGAT1 and DGAT2, in somatic embryos. Vector pKR1236 alone was also included as a control.
Construction of pKR1244 Comprising YL LPAAT3
[0403] The NcoI/BsiWI fragment of pFBAIn-YLPAT3 (SEQ ID NO: 111), containing the YL LPAAT3, was cloned into the NcoI/BsiWI fragment of pKR908 (US Pat. Pub. 20080095915), to produce pKR1241 (SEQ ID NO:112) which generates NotI sites flanking the YL LPAAT3 gene.
[0404] The NotI fragment of pKR1241 (SEQ ID NO:112), containing YL LPAAT3, was cloned into the NotI site of pKR457 (SEQ ID NO:106) to produce pKR1244 (SEQ ID NO:113).
Construction of pKR1246 Comprising YL PDAT
[0405] A starting vector pY27-PDAT (SEQ ID NO:114), which is described in U.S. Pat. No. 7,267,976, contains the YL PDAT flanked by NotI sites.
[0406] The NotI fragment of pY27-PDAT, containing YL PDAT, was cloned into the NotI site of pKR457 (SEQ ID NO: 106) to produce pKR1246 (SEQ ID NO: 115).
Co-Expression of Either YL LPAAT3 or YL PDAT with YL DGAT1 and YL DGAT2
[0407] Vector pKR1244 (SEQ ID NO:112) or pKR1246 (SEQ ID NO:114) were digested with BsiWI or SbfI/SmaI, respectively and fragment was purified as described herein (Example 5). Soybean embryogenic suspension culture (cv. Jack) was transformed with BsiWI fragment from pKR1244 (SEQ ID NO: 113) and pKR1236 (SEQ ID NO:75) and having experiment number MSE2189 or with the SbfI/SmaI fragment of pKR1246 (SEQ ID NO:115) and pKR1236 (SEQ ID NO:75) and having experiment number MSE2190. Plasmid pKR1236 (SEQ ID NO:75) was also transformed alone in a similar way for a control and has experiment number MSE2191. Events were selected and somatic embryos matured in SHaM as described in Example 5. Oil concentrations and fatty acid profiles were determined as described in Example 4 for MSE2189, MS2190 and MSE2191 and results for each experiment are shown in Table 38, Table 39 and Table 40, respectively.
TABLE-US-00053 TABLE 38 Oil concentrations and fatty acid profiles for events from MSE2189 MSE2189 (YL LPAAT3 + YL DGAT1 & YL DGAT2) Event 16:0 18:0 18:1 18:2 18:3 % Oil 2189-31 14.1 6.2 32.7 38.6 8.4 9.7 2189-22 14.3 6.5 32.6 37.5 9.1 9.6 2189-30 12.7 7.0 39.0 33.4 7.8 9.4 2189-2 13.5 6.0 37.0 34.8 8.8 9.4 2189-27 12.5 6.0 36.5 36.3 8.7 8.6 2189-19 14.1 5.4 28.2 40.8 11.5 8.2 2189-4 15.2 5.6 28.3 37.2 13.7 8.0 2189-7 14.9 6.9 28.6 38.3 11.3 7.9 2189-21 14.4 6.5 31.8 37.3 10.0 7.5 2189-13 15.4 7.0 34.1 34.7 8.8 7.2 2189-12 13.8 5.7 32.2 36.2 12.0 6.9 2189-20 16.7 5.1 19.2 44.6 14.3 6.3 2189-5 15.6 6.2 31.0 35.9 11.3 6.2 2189-25 15.9 6.6 24.3 39.0 14.2 6.0 2189-23 15.9 5.4 23.0 40.6 15.1 5.5 2189-28 20.7 5.2 16.8 43.2 14.1 5.3 2189-29 16.7 5.2 21.5 40.6 16.0 5.0 2189-1 18.8 4.8 16.5 41.0 18.9 4.9 2189-15 20.2 6.4 25.2 36.8 11.4 4.6 2189-8 17.9 4.8 17.1 41.0 19.1 4.1 2189-9 18.0 6.3 17.4 40.1 18.1 4.0 2189-24 16.6 5.4 19.9 40.5 17.6 4.0 2189-18 17.6 5.2 20.2 39.9 17.0 4.0 2189-3 17.7 5.2 19.1 39.4 18.6 3.8 Avg. 16.0 5.9 26.3 38.7 13.2 6.5
TABLE-US-00054 TABLE 39 Oil concentrations and fatty acid profiles for events from MSE2190 MSE2190 (YL PDAT + YL DGAT1 & YL DGAT2) Event 16:0 18:0 18:1 18:2 18:3 % Oil 2190-13 14.4 6.2 32.9 38.1 8.5 11.1 2190-6 13.6 7.1 35.0 36.3 8.1 10.3 2190-27 12.5 5.6 44.4 30.5 6.9 9.8 2190-18 12.9 6.0 36.8 35.2 9.1 9.0 2190-8 14.1 6.1 31.7 36.7 11.5 8.1 2190-7 13.9 5.8 31.6 37.7 11.0 7.7 2190-2 15.0 5.7 20.1 44.9 14.3 7.2 2190-20 14.1 6.5 30.1 38.0 11.3 7.1 2190-30 17.5 6.9 24.3 38.2 13.1 7.1 2190-26 16.1 5.6 25.5 38.8 13.9 7.0 2190-12 15.2 6.7 31.1 34.8 12.2 6.8 2190-1 14.7 5.0 25.7 40.7 13.9 6.3 2190-28 16.6 5.3 19.9 43.2 15.0 6.3 2190-16 14.0 8.6 27.4 38.6 11.5 6.1 2190-5 16.2 5.8 24.2 40.5 13.3 6.1 2190-14 16.2 5.6 21.4 41.4 15.4 6.1 2190-3 17.3 5.5 20.9 39.5 16.8 6.1 2190-29 16.5 5.7 24.9 40.1 12.9 6.0 2190-24 16.5 5.4 21.9 40.3 15.9 5.9 2190-4 18.7 5.9 20.4 41.4 13.5 5.8 2190-23 17.6 4.9 15.8 43.7 18.0 5.5 2190-9 17.5 5.1 17.5 44.3 15.6 5.3 2190-21 16.6 5.8 20.7 42.0 14.9 5.2 2190-19 16.6 4.9 17.4 40.9 20.2 5.0 2190-10 17.4 6.4 22.9 38.9 14.4 4.7 2190-17 17.1 6.3 23.5 38.4 14.6 4.7 2190-15 16.7 5.3 19.9 40.2 17.9 4.6 2190-11 16.1 5.0 18.8 39.6 20.5 4.0 Avg. 15.8 5.9 25.2 39.4 13.7 6.6
TABLE-US-00055 TABLE 40 Oil concentrations and fatty acid profiles for events from MSE2191 MSE2191 (YL DGAT1 & YL DGAT2) Event 16:0 18:0 18:1 18:2 18:3 % Oil 2191-17 12.6 6.6 37.6 36.0 7.1 11.2 2191-30 13.1 5.8 38.2 35.4 7.5 10.6 2191-29 12.7 4.5 33.9 39.6 9.2 10.6 2191-2 12.6 6.3 35.5 36.7 8.9 9.9 2191-26 13.1 6.6 35.5 36.5 8.4 9.8 2191-8 13.0 6.5 35.6 36.5 8.4 9.6 2191-1 13.1 5.5 36.9 36.4 8.1 9.4 2191-24 12.8 4.6 34.1 39.4 9.1 9.3 2191-5 13.0 6.2 36.3 36.0 8.5 9.0 2191-20 13.6 6.9 34.1 35.5 9.9 8.8 2191-28 13.1 6.6 33.9 36.2 10.2 8.7 2191-23 12.7 5.6 36.7 36.0 9.0 8.7 2191-12 13.0 5.4 36.1 35.4 10.0 8.6 2191-9 14.5 7.1 29.3 37.4 11.7 8.2 2191-15 14.4 5.8 32.2 36.6 10.9 7.0 2191-7 15.9 5.7 29.5 38.1 10.9 6.1 2191-27 16.9 6.0 22.5 39.6 15.0 5.7 2191-14 16.0 5.5 24.4 39.1 15.0 5.7 2191-25 18.2 5.8 22.1 37.6 16.3 5.3 2191-19 16.8 6.0 22.3 39.9 15.0 5.1 2191-21 15.8 4.5 24.0 39.6 16.2 4.8 2191-6 17.4 5.5 22.0 38.3 16.9 4.4 2191-3 17.6 4.8 20.0 40.6 17.0 4.4 2191-18 19.1 6.3 21.1 39.3 14.3 4.2 2191-16 17.1 4.8 17.0 40.5 20.6 4.0 2191-10 17.5 4.6 21.0 38.3 18.6 3.7 2191-13 18.4 4.6 16.2 40.9 20.0 3.3 2191-22 17.4 4.6 15.3 40.8 21.9 3.1 Avg. 15.1 5.7 28.7 37.9 12.7 7.1
Example 20
Co-Expression of Either YL ACBP or YL CPT with YL DGAT1 and YL DGAT2 in Soybean Somatic Embryos
[0408] The present example describes construction of soybean expression vectors pKR1250, comprising Yarrowia acyl-CoA binding protein homolog (YL ACBP) and pKR1251, comprising Yarrowia choline phosphotransferase homolog (YL CPT), and co-expression of these with pKR1236, comprising Yarrowia DGAT1 and DGAT2, in somatic embryos. Vector pKR1236 alone was also included as a control.
Construction of pKR1250 Comprising YL ACBP
[0409] The NcoI/BsiWI fragment of pYAT-ACBP (SEQ ID NO:116), containing the YL ACBP, was cloned into the NcoI/BsiWI fragment of pKR908 (US Pat. Pub. 20080095915), to produce pKR1245 (SEQ ID NO:117) which generates NotI sites flanking the YL ACBP gene.
[0410] The NotI fragment of pKR1245 (SEQ ID NO:116), containing YL ACBP, was cloned into the NotI site of pKR457 (SEQ ID NO:106) to produce pKR1250 (SEQ ID NO: 118).
Construction of pKR1251 Comprising YL CPT
[0411] The NcoI/BsiWI fragment of pFBAIn-YCPT1 (SEQ ID NO:119), containing the YL CPT, was cloned into the NcoI/BsiWI fragment of pKR908 to produce pKR1247 (SEQ ID NO:120) which generates NotI sites flanking YL CPT gene.
[0412] The NotI fragment of pKR1247 (SEQ ID NO:120), containing YL CPT, was cloned into the NotI site of pKR457 (SEQ ID NO:106) to produce pKR1251 (SEQ ID NO:121).
Co-Expression of Either YL ACBP or YL CPT with YL DGAT1 and YL DGAT2
[0413] Vector pKR1250 (SEQ ID NO: 118) and pKR1251 (SEQ ID NO: 121) were digested with BsiWI and fragment purified as described in Example 5. Soybean embryogenic suspension culture (cv. Jack) was transformed with the BsiWI fragment from pKR1250 (SEQ ID NO:118) and pKR1236 (SEQ ID NO:75) and having experiment number MSE2192 or with the BsiWI fragment of pKR1251 (SEQ ID NO:121) and pKR1236 (SEQ ID NO:75) and having experiment number MSE2193. Plasmid pKR1236 (SEQ ID NO:75) was also transformed alone in a similar way for a control and has experiment number MSE2194. Events were selected and somatic embryos matured in SHaM as described in Example 5. Oil concentrations and fatty acid profiles were determined as described in Example 4 for MSE2192, MS2193 and MSE2194 and results for each experiment are shown in Table 41, Table 42 and Table 43, respectively.
TABLE-US-00056 TABLE 41 Oil concentrations and fatty acid profiles for events from MSE2192 MSE2192 (YL ACBP + YL DGAT1 & YL DGAT2) Event 16:0 18:0 18:1 18:2 18:3 % Oil 2192-2 13.1 6.2 33.5 38.6 8.5 13.8 2192-5 12.0 4.7 41.5 34.2 7.4 12.8 2192-24 13.1 5.9 34.5 38.1 8.4 12.3 2192-27 12.5 6.5 34.7 37.6 8.7 11.5 2192-30 13.1 6.2 34.2 37.1 9.4 11.5 2192-1 13.9 5.5 26.0 43.6 11.0 10.6 2192-25 14.0 6.6 28.2 38.7 12.5 10.2 2192-17 13.2 7.0 31.3 38.1 10.4 10.1 2192-29 14.1 6.5 30.0 38.6 10.8 10.1 2192-13 15.5 6.5 31.4 36.2 10.5 9.9 2192-20 12.9 5.6 31.7 38.4 11.4 9.8 2192-14 14.2 6.5 28.9 38.7 11.8 9.6 2192-15 13.8 5.9 31.5 39.0 9.7 9.5 2192-9 14.1 6.5 29.4 38.7 11.3 8.7 2192-12 13.9 6.2 29.6 37.4 12.9 8.4 2192-11 14.2 6.3 28.5 38.6 12.4 8.4 2192-6 13.9 6.2 29.2 38.2 12.5 8.0 2192-19 16.2 5.8 22.5 41.4 14.0 7.8 2192-23 13.9 5.8 28.5 39.0 12.7 7.5 2192-4 14.5 6.1 27.9 39.1 12.5 7.4 2192-31 15.9 6.0 21.2 42.0 14.9 7.3 2192-10 16.7 6.0 19.1 43.1 15.1 7.1 2192-28 15.5 5.0 24.0 40.2 15.4 6.5 2192-22 16.2 5.6 23.2 38.8 16.2 6.2 2192-26 17.2 5.3 18.0 41.1 18.4 5.8 2192-8 17.9 4.9 16.3 43.0 17.9 5.4 2192-16 17.7 5.3 15.1 41.8 20.1 4.8 2192-18 16.3 4.7 16.1 41.0 21.8 4.4 2192-3 17.0 4.6 16.0 40.3 22.1 4.1 Avg. 14.7 5.9 27.0 39.3 13.1 8.6
TABLE-US-00057 TABLE 42 Oil concentrations and fatty acid profiles for events from MSE2193 MSE2193 (YL CPT + YL DGAT1 & YL DGAT2) Event 16:0 18:0 18:1 18:2 18:3 % Oil 2193-3 12.6 7.1 36.9 35.7 7.7 12.4 2193-22 13.2 7.4 35.6 34.4 9.4 12.2 2193-16 13.4 7.9 36.5 33.0 9.2 10.9 2193-10 13.9 6.0 32.2 38.1 9.8 10.1 2193-6 13.8 6.9 31.7 37.5 10.1 10.0 2193-14 13.5 6.7 30.5 39.3 10.0 9.9 2193-20 14.4 6.8 29.8 37.2 11.7 9.7 2193-8 13.4 7.0 33.8 35.9 9.9 9.2 2193-9 14.8 6.9 27.5 38.8 12.0 8.3 2193-18 15.5 6.4 26.1 38.4 13.5 7.2 2193-19 14.9 6.4 28.8 37.8 12.1 6.7 2193-17 16.9 6.4 24.0 37.7 15.0 6.5 2193-4 17.1 6.1 20.2 40.0 16.6 5.8 2193-11 16.2 5.7 22.2 38.8 17.1 5.5 2193-15 16.9 6.0 21.0 39.5 16.6 5.2 2193-7 17.1 6.3 21.2 39.1 16.3 5.1 2193-13 15.8 7.3 26.6 35.7 14.6 5.0 2193-21 17.2 6.5 21.7 38.0 16.6 4.7 2193-1 18.1 4.5 15.1 39.7 22.5 3.6 2193-2 19.7 5.1 14.9 40.8 19.6 3.4 Avg. 15.4 6.5 26.8 37.8 13.5 7.6
TABLE-US-00058 TABLE 43 Oil concentrations and fatty acid profiles for events from MSE2194 MSE2194 (YL DGAT1 & YL DGAT2) Event 16:0 18:0 18:1 18:2 18:3 % Oil 2194-16 12.2 5.8 41.6 33.2 7.2 12.0 2194-23 12.3 5.5 37.5 36.2 8.5 10.6 2194-5 15.1 5.6 30.6 36.6 12.2 10.0 2194-10 14.0 5.9 34.3 35.9 9.9 9.5 2194-15 13.6 5.7 32.1 36.8 11.8 9.4 2194-4 14.6 5.9 32.4 35.7 11.4 9.2 2194-20 13.1 6.1 33.1 37.0 10.7 8.8 2194-8 13.6 4.9 32.8 37.7 10.9 8.8 2194-11 11.8 5.3 38.3 33.4 11.2 8.7 2194-3 14.1 5.3 30.5 37.8 12.2 8.6 2194-13 13.8 5.5 31.0 37.7 11.9 8.5 2194-7 15.0 5.7 27.8 38.3 13.2 8.1 2194-22 14.5 4.9 28.7 38.5 13.4 7.4 2194-25 15.2 5.1 27.3 37.6 14.8 7.4 2194-21 15.1 5.4 25.9 40.1 13.5 7.3 2194-6 14.3 5.9 27.7 38.2 13.9 7.2 2194-27 13.9 5.2 30.3 37.5 13.1 7.2 2194-1 14.8 5.2 29.2 37.8 13.0 7.1 2194-17 14.2 4.6 27.9 37.2 16.0 6.8 2194-28 14.8 5.2 27.6 37.3 15.1 6.3 2194-14 16.0 5.0 21.2 41.6 16.2 6.2 2194-19 15.2 4.3 24.2 39.7 16.6 5.7 2194-2 15.8 4.8 17.0 45.1 17.4 5.5 2194-9 17.5 5.2 17.9 41.5 17.9 5.4 2194-12 16.8 4.9 18.3 39.5 20.5 4.5 2194-18 17.3 4.7 17.9 41.2 18.9 4.5 2194-24 16.5 4.0 15.5 43.1 20.9 4.4 2194-26 14.4 4.7 15.1 44.2 21.7 3.3 Avg. 14.6 5.2 27.6 38.5 14.1 7.4
[0414] The results in Tables 41-43 show that average oil concentrations are higher when YL ACBP is co-expressed with YL DGAT1 and YL DGAT2 than when YL DGAT1 and YL DGAT2 are expressed alone.
Example 21
Co-Expression of YL GPAT with YL DGAT1 and YL DGAT2 in Soybean Somatic Embryos
[0415] The present example describes construction of soybean expression vectors pKR1257, comprising Yarrowia glycerolphosphate acyltransferase homolog (YL GPAT) and co-expression with pKR1236, comprising Yarrowia DGAT1 and DGAT2, in somatic embryos. Vector pKR1236 alone was also included as a control.
Construction of pKR1257 Comprising YL GPAT
[0416] The nucleotide and amino acid sequences for YL GPAT are set forth in SEQ ID NO:122 and SEQ ID NO:123, respectively. YL GPAT (SEQ ID NO:122) was amplified from Yarrowia genomic DNA as described in Example 2 with oligonucleotide primers YIGPAT-5 (SEQ ID NO:124) and YIGPAT-3 (SEQ ID NO:125), using the Phusion High-Fidelity DNA Polymerase (Cat. No. F553S, Finnzymes Oy, Finland) following the manufacturer's protocol. The resulting DNA fragment was cloned into the pCR-Blunt cloning vector using the Zero Blunt PCR Cloning Kit (Invitrogen Corporation), following the manufacturer's protocol, to produce PCRblunt-YIGPAT (SEQ ID NO:126).
[0417] The NotI fragment of PCRblunt-YIGPAT (SEQ ID NO:126), containing YL GPAT, was cloned into the NotI site of pKR457 (SEQ ID NO:106) to produce pKR1257 (SEQ ID NO:127).
Co-Expression of YL GPAT with YL DGAT1 and YL DGAT2
[0418] Vector pKR1257 (SEQ ID NO:127) was digested with BsiWI and the fragment purified as described in Example 5. Soybean embryogenic suspension culture (cv. Jack) was transformed with the BsiWI fragment from pKR1257 (SEQ ID NO:127) and pKR1236 (SEQ ID NO:75) and having experiment number MSE2216. Plasmid pKR1236 (SEQ ID NO:75) was also transformed alone in a similar way for a control and has experiment number MSE2217. Events were selected and somatic embryos matured in SHaM as described in Example 5. Oil concentrations and fatty acid profiles were determined as described in Example 4 for MSE2216 and MSE2217 and results for each experiment are shown in Table 44 and Table 45, respectively.
TABLE-US-00059 TABLE 44 Oil concentrations and fatty acid profiles for events from MSE2216 MSE2216 (YL GPAT + YL DGAT1 & YL DGAT2) Event 16:0 18:0 18:1 18:2 18:3 % Oil 2216-4 12.9 6.6 29.0 42.8 8.8 12.6 2216-2 11.9 7.0 32.4 39.7 9.0 11.8 2216-30 11.5 7.6 35.3 37.0 8.6 11.5 2216-28 12.0 7.2 33.3 39.1 8.4 11.1 2216-17 13.6 6.1 32.7 39.0 8.5 11.0 2216-9 13.2 7.6 33.9 37.2 8.1 11.0 2216-24 11.6 7.5 35.8 37.1 7.9 11.0 2216-31 12.0 6.1 39.2 36.5 6.1 10.9 2216-11 12.7 6.7 30.9 39.5 10.2 9.9 2216-5 13.3 6.0 31.5 39.2 10.0 9.8 2216-12 13.1 6.8 31.4 38.8 10.0 9.3 2216-14 13.1 6.9 33.7 37.1 9.3 9.1 2216-13 13.5 6.5 28.4 40.2 11.4 8.3 2216-8 14.6 7.5 27.9 38.5 11.5 7.8 2216-22 14.2 7.8 27.6 38.4 11.9 7.8 2216-18 15.6 7.1 24.4 39.2 13.7 6.6 2216-20 15.9 7.0 22.7 41.7 12.7 6.5 2216-19 16.8 6.2 19.2 42.7 15.1 6.3 2216-27 15.3 6.5 23.1 40.5 14.6 6.2 2216-3 15.9 7.4 21.3 40.4 15.0 6.1 2216-16 16.7 7.0 21.1 40.2 15.1 5.9 2216-1 17.6 5.3 15.2 44.5 17.4 5.4 2216-26 17.1 6.1 18.0 42.4 16.4 5.3 2216-25 16.4 7.6 22.4 38.3 15.3 5.3 2216-15 17.3 7.2 21.3 40.4 13.8 5.2 2216-10 17.0 6.3 20.1 40.7 15.8 5.2 2216-29 16.2 7.5 20.6 37.5 18.2 5.0 2216-21 17.3 8.9 23.7 34.1 16.0 4.5 2216-6 17.2 5.7 16.8 43.5 16.8 4.4 2216-7 18.2 5.5 15.3 43.7 17.4 4.3 2216-23 18.4 6.0 17.3 39.8 18.5 3.3 Avg. 14.9 6.8 26.0 39.7 12.6 7.7
TABLE-US-00060 TABLE 45 Oil concentrations and fatty acid profiles for events from MSE2217 MSE2217 (YL DGAT1 & YL DGAT2) Event 16:0 18:0 18:1 18:2 18:3 % Oil 2217-11 11.6 6.1 33.8 40.4 8.1 13.8 2217-17 12.8 4.7 27.9 45.4 9.1 13.5 2217-25 10.6 6.5 37.4 38.4 7.1 13.2 2217-4 11.6 6.0 38.5 36.9 7.0 13.2 2217-27 11.2 4.7 42.6 34.5 7.0 13.0 2217-15 11.9 9.2 37.0 34.7 7.2 11.5 2217-21 12.3 7.4 33.0 38.2 9.1 11.0 2217-6 14.1 6.8 31.4 38.7 9.0 10.7 2217-14 13.5 7.5 32.8 37.6 8.6 10.7 2217-19 13.2 5.7 28.5 42.1 10.6 10.5 2217-26 11.6 7.3 36.5 36.8 7.7 10.3 2217-24 11.5 7.1 38.2 35.2 7.9 9.7 2217-5 12.4 6.8 31.9 38.9 10.0 9.7 2217-28 14.9 6.7 27.5 40.3 10.6 9.5 2217-12 12.8 6.7 33.0 37.6 9.9 9.4 2217-31 15.2 5.6 21.5 46.4 11.3 9.3 2217-18 13.0 6.7 33.4 37.2 9.7 9.0 2217-13 14.2 5.2 25.1 45.2 10.3 8.7 2217-22 13.6 6.7 30.2 38.2 11.2 8.5 2217-3 12.9 6.4 33.0 37.6 10.1 8.2 2217-20 13.9 7.3 29.0 37.6 12.1 7.9 2217-23 14.7 6.7 27.7 38.9 11.9 7.7 2217-2 14.1 6.9 28.4 39.0 11.7 7.5 2217-9 15.5 6.6 23.1 41.1 13.7 7.3 2217-7 16.5 5.6 20.1 42.8 15.1 7.3 2217-16 14.7 7.3 25.9 39.2 12.9 7.3 2217-10 15.4 6.6 22.1 42.2 13.7 7.3 2217-1 13.7 5.5 17.7 45.3 17.8 6.7 2217-30 16.1 7.0 22.8 40.4 13.7 6.7 2217-8 13.0 6.2 27.8 39.8 13.1 6.2 2217-29 15.4 6.2 21.0 42.0 15.5 5.2 Avg. 13.5 6.5 29.6 39.6 10.7 9.4
Example 22
Co-Expression of Either YL PAP1, YL PAP2 or YL PAP3 and YL DGAT1 YL DGAT2 in Soybean Somatic Embryos
[0419] The present example describes construction of soybean expression vectors pKR1347, comprising Yarrowia phosphatidic acid phosphatase homolog 1 (YL PAP1), pKR1348, comprising Yarrowia phosphatidic acid phosphatase homolog 3 (YL PAP3) and pKR1349, comprising Yarrowia phosphatidic acid phosphatase homolog 2 (YL PAP2), and co-expression of these with pKR1236, comprising Yarrowia DGAT1 and DGAT2, in somatic embryos. Vector pKR1236 alone was also included as a control.
Construction of pKR1347 Comprising YL PAP1
[0420] The nucleotide and amino acid sequences for YL PAP1 are set forth in SEQ ID NO:128 and SEQ ID NO:129, respectively. YL PAP1 (SEQ ID NO:128) was amplified from Yarrowia genomic DNA as described in Example 2 with oligonucleotide primers YIPAP1-5 (SEQ ID NO:130) and YIPAP1-3 (SEQ ID NO:131), using the Phusion High-Fidelity DNA Polymerase (Cat. No. F553S, Finnzymes Oy, Finland) following the manufacturer's protocol. The resulting DNA fragment was cloned into the pCR-Blunt cloning vector using the Zero Blunt PCR Cloning Kit (Invitrogen Corporation), following the manufacturer's protocol, to produce pHD33 (SEQ ID NO:132).
[0421] The NotI fragment of pHD33 (SEQ ID NO:132), containing YL PAP1, was cloned into the NotI site of pKR457 (SEQ ID NO:106) to produce pKR1347 (SEQ ID NO:133).
Construction of pKR1348 2 Comprising YL PAP3
[0422] The nucleotide and amino acid sequences for YL PAP3 are set forth in SEQ ID NO:134 and SEQ ID NO:135, respectively. YL PAP3 (SEQ ID NO:134) was amplified from Yarrowia genomic DNA as described in Example 2 with oligonucleotide primers YIPAP3-5 (SEQ ID NO:136) and YIPAP3-3 (SEQ ID NO:137), using the Phusion High-Fidelity DNA Polymerase (Cat. No. F553S, Finnzymes Oy, Finland) following the manufacturer's protocol. The resulting DNA fragment was cloned into the pCR-Blunt cloning vector using the Zero Blunt PCR Cloning Kit (Invitrogen Corporation), following the manufacturer's protocol, to produce pHD34 (SEQ ID NO:138).
[0423] The NotI fragment of pHD34 (SEQ ID NO:138), containing YL PAP3, was cloned into the NotI site of pKR457 (SEQ ID NO:106) to produce pKR1348_2 (SEQ ID NO:139).
Construction of pKR1349 Comprising YL PAP2
[0424] The nucleotide and amino acid sequences for YL PAP2 are set forth in SEQ ID NO:140 and SEQ ID NO:141, respectively. YL PAP2 (SEQ ID NO:140) was amplified from Yarrowia genomic DNA as described in Example 2 with oligonucleotide primers YIPAP2-5 (SEQ ID NO:142) and YIPAP2-3 (SEQ ID NO:143), using the Phusion High-Fidelity DNA Polymerase (Cat. No. F553S, Finnzymes Oy, Finland) following the manufacturer's protocol. The resulting DNA fragment was cloned into the pCR-Blunt cloning vector using the Zero Blunt PCR Cloning Kit (Invitrogen Corporation), following the manufacturer's protocol, to produce pHD35 (SEQ ID NO:144).
[0425] The NotI fragment of pHD35 (SEQ ID NO:144), containing YL PAP2, was cloned into the NotI site of pKR457 (SEQ ID NO:106) to produce pKR1349 (SEQ ID NO:145).
Co-Expression of Either YL PAP1, YL PAP2 or YL PAP3 with YL DGAT1 and YL DGAT2
[0426] Vector pKR1347 (SEQ ID NO:133), pKR1348_2 (SEQ ID NO:139) and pKR1349 (SEQ ID NO:145) were digested with BsiWI and fragments purified as described in Example 5. Soybean embryogenic suspension culture (cv. Jack) was transformed with the BsiWI fragment from pKR1347 (SEQ ID NO: 133) and pKR1236 (SEQ ID NO:75) and having experiment number MSE2322 or with the BsiWI fragment of pKR1348_2 (SEQ ID NO:139) and pKR1236 (SEQ ID NO:75) and having experiment number MSE2323 or with the BsiWI fragment of pKR1349 (SEQ ID NO:145) and pKR1236 (SEQ ID NO:75) and having experiment number MSE2324. Plasmid pKR1236 (SEQ ID NO:75) was also transformed alone in a similar way for a control and has experiment number MSE2325.
Example 23
Co-Expression of YL GPD and YL DGAT1 YL DGAT2 in Soybean Somatic Embryos
[0427] The present example describes construction of soybean expression vector pKR1369, comprising a Yarrowia glycerol phosphate dehydrogenase homolog (YL GPD), and co-expression with pKR1236, comprising Yarrowia DGAT1 and DGAT2, in somatic embryos. Vector pKR1236 alone was also included as a control.
Construction of pKR1369 Comprising YL GPD
[0428] The nucleotide and amino acid sequences for YL GPD are set forth in SEQ ID NO:146 and SEQ ID NO:147, respectively. YL GPD genomic sequence contains an intron in the coding sequence and this was removed using PCR. The 5 end of YL GPD was amplified from Yarrowia genomic DNA as described in Example 2 with oligonucleotides YIGPD-5 (SEQ ID NO:148) and YIGPD-3-2 (SEQ ID NO:149), using the Phusion High-Fidelity DNA Polymerase (Cat. No. F553S, Finnzymes Oy, Finland), following the manufacturer's protocol. The 3 end of YL GPD was amplified in a similar way with oligonucleotides YIGPDintron-5-2 (SEQ ID NO:150) and YIGPD-3 (SEQ ID NO:151). The two resulting PCR products were combined and re-amplified using YIGPD-5 (SEQ ID NO:148) and YIGPD-3 (SEQ ID NO:151). The resulting DNA fragment was cloned into the pCR-Blunt cloning vector using the Zero Blunt PCR Cloning Kit (Invitrogen Corporation), following the manufacturer's protocol, to produce pHD36 (SEQ ID NO:152).
[0429] An SbfI site was added to the 3 end of the soy albumin terminator in pKR457 (SEQ ID NO:106) using PCR and the resulting plasmid, which is almost identical to pKR457 (SEQ ID NO:106) is called pKR1273 (SEQ ID NO:153).
[0430] The NotI fragment of pHD36 (SEQ ID NO:152), containing YL GPD, was cloned into the NotI site of pKR457 (SEQ ID NO:106) to produce pKR1369 (SEQ ID NO: 154).
Co-Expression of YL GPD with YL DGAT1 and YL DGAT2
[0431] pKR1369 (SEQ ID NO:154) was digested with BsiWI and the fragment purified as described in Example 5. Soybean embryogenic suspension culture (cv. Jack) was transformed with the BsiWI fragment from pKR1369 (SEQ ID NO: 154) and pKR1236 (SEQ ID NO:75) and having experiment number MSE2357. Plasmid pKR1236 (SEQ ID NO:75) was also transformed alone in a similar way for a control and has experiment number MSE2353.
Example 24
Co-Expression of Plant LPAAT-Like Sequences and YL DGAT1 YL DGAT2 in Soybean Somatic Embryos
[0432] The following example describes experiments that demonstrate that co-expression of certain LPAAT-like proteins and YL DGAT proteins in soybean somatic embryos increases oil content and allows to achieve oil levels that exceed those observed when only YL DGAT genes are expressed.
[0433] WO2000049156, U.S. Pat. No. 7,235,714 describes EST clones from soybean and the catalpa tree that show similarity to lysophosphatidic acid acyltransferase (LPAATs) enzymes. One LPAAT-like gene from soybean was amplified from plasmid DNA of applicant's EST clone (sI2.pk121.a19) using oligonucleotide primers. Nucleotide sequence of the EST clone and amino acid sequence of the corresponding protein are listed as SEQ ID NO:155 and SEQ ID NO:156 The sequences of the sense (forward) and antisense (reverse) oligonucleotide primers used in this reaction were as follows:
TABLE-US-00061 (SEQIDNO:157) 5-CACCATGAATGGCATTGGGAAACTCAAATC-3 and (SEQIDNO:158) 5-CATTATTTTTCCTCAAAGCGCCGCAACAC-3.
PCR amplification was achieved using TAQ polymerase, and plasmid DNA of the EST clone was used as the template. The product of this PCR reaction was purified by agarose gel electrophoresis and subcloned into pENTR/D-TOPO (Invitrogen) as described in the manufacturer's protocol. A 1149 bp fragment containing the entire open-reading frame of was excised using restriction enzymes AscI and NotI. Ends were completely filled in with T4 polymerase (Invitrogen, USA) according to instructions of the manufacturer and ligated to NotI linearized, filled-in pKR561 vector. Recombinant clones were subjected to analysis by restriction enzyme digestion to identify ligation products in which the start codon was in proximity of the annexin promoter in pKR561 (sense orientation). Plasmids with this orientation are henceforth referred to as pKR561-SOY LPAAT-like (SEQ ID NO:159).
[0434] One LPAAT-like gene from the catalpa tree was amplified from plasmid DNA of applicants EST clone (ncs.pk0013.d2) using oligonucleotide primers. Nucleotide sequence of the EST clone and amino acid sequence of the corresponding protein are listed as SEQ ID NO:160 and SEQ ID NO:161. The sequences of the sense (forward) and antisense (reverse) oligonucleotide primers used in this reaction were as follows:
TABLE-US-00062 (SEQIDNO:162) 5-CACCATGAGCAAGCTAAAAACATCCAGC-3 and (SEQIDNO:163) 5-CTTCAATCTATTTCTCTTCCAGGTG-3.
PCR amplification was achieved using TAQ polymerase, and plasmid DNA of the EST clone was used as the template. The product of this PCR reaction was purified by agarose gel electrophoresis and subcloned into pENTR/D-TOPO (Invitrogen) as described in the manufacturer's protocol. An 1148 bp fragment containing the entire open-reading frame of was excised using restriction enzymes AscI and NotI. Ends were completely filled in with T4 polymerase (Invitrogen, USA) according to instructions of the manufacturer and ligated to NotI linearized, filled-in pKR561 vector. Recombinant clones were subjected to analysis by restriction enzyme digestion to identify ligation products in which the start codon was in proximity of the annexin promoter in pKR561 (sense orientation). Plasmids with this orientation are henceforth referred to as pKR561-CATALPA LPAAT-like (SEQ ID NO:164).
[0435] Vector pKR561 had previously been constructed as follows. Vector pKR268 (SEQ ID NO:165), which was previously described in U.S. Pat. No. 7,256,033 (the contents of which are hereby incorporated by reference), contains a NotI site flanked by the soybean annexin promoter (U.S. Pat. No. 7,129,089) and the BD30 3 termination region (Ann/NotI/BD30 cassette). Vector pKR145 (SEQ ID NO:166), which was previously described in PCT Publication No. WO 2004/071467 (the contents of which are hereby incorporated by reference), contains the hygromycin B phosphotransferase gene [Gritz, L. and Davies, J. (1983) Gene 25:179-188], flanked by the T7 promoter and transcription terminator (T7prom/hpt/T7term cassette), and a bacterial origin of replication (ori) for selection and replication in E. coli. In addition, pKR145 contains the hygromycin B phosphotransferase gene, flanked by the 35S promoter [Odell et al., (1985) Nature 313:810-812] and NOS 3 transcription terminator [Depicker et al., (1982) J. Mol. Appl. Genet. 1:561:570] (35S/hpt/NOS3 cassette) for selection in soybean. The BsiWI fragment of pKR268, containing the Ann/NotI/BD30 cassette, was cloned into the BsiWI fragment of pKR145, containing the 35S/hpt/NOS3 cassette), to produce pKR561 (SEQ ID NO:167).
[0436] For co-expression of YL DGAT1 YL DGAT2 and LPAAT-like sequences genes in soybean somatic embryos, soybean tissue was co-bombarded as described herein (Example 5) with a mixture KS387 which is described below. Plasmid DNA of KS387 and pKR561-SOY LPAAT-like or KR561-CATALPA LPAAT-like were combined in a 10:1 ratio and used for transformation of soybean somatic embryos as described below. In the resulting DNA mixture KS387 provides expression cassettes for YL DGAT1 and YL DGAT2 whereas the KR561 plasmids provide expression cassettes for LPAAT like genes and for a gene generating hygromycin resistance comprised of CaMV 35S promoter hygromycin phosphotransferase gene and nos terminator.
[0437] KS387 was constructed as follows. A 6818 bp restriction fragment was excised form KS364 (SEQ ID NO:63) by digestion with AscI. This DNA fragment contains expression cassettes for both YL DGAT genes. It was completely filled in with T4 polymerase and ligated to SalI-linearized DNA of KS178 that had previously been treated with T4 polymerase to generate blunt ends for ligation. The sequence of KS387 is set forth as SEQ ID NO:168.
[0438] Prior to this KS178 was constructed as follows. The 4.0 kb DNA fragment containing the SAMS/ALS/ALS3 cassette was excised from pZSL13LeuB (PCT Publication No. WO 04/071467) using the restriction enzymes PstI and SmaI, the ends were blunted with the large fragment of DNA polymerase I, and ligated to DNA of KS102 (PCT Publication No. WO 04/071467) linearized with the restriction enzyme BamHI, to give KS178 (SEQ ID NO:169). Prior to ligation the ends of the linearized KS102 vector were blunted with the large fragment of DNA polymerase I.
[0439] Fatty acid profile and oil content of soybean somatic embryos generated by co-transformation of YL DGATs with LPAAT-like genes from soy and catalpa is shown in Tables 46 and Table 47, respectively. Fatty acid profile and oil content of soybean somatic embryos generated by transformation with YL DGATs only is shown in Tables 48. Average oil content of all events created is higher when YL DGATs are co-expressed with LPAAT-like genes. Similarly, changes in the fatty acid profile, namely an increase in oleic acid is more pronounced when YL DGATs are co-expressed with LPAAT-like genes from soy and catalpa.
TABLE-US-00063 TABLE 46 Oil concentrations and fatty acid profiles for events generated by co-transformation with KS387 and pKR561-SOY LPAAT-like KS387 area % pKR561-SOY LPAAT-like 16:0 18:0 18:1 18:2 18:3 % oil 1 11.1 6.4 35.4 39.9 7.3 13.4 2 12.5 5.4 30.6 43.2 8.4 13.2 3 11.3 6.0 37.6 39.1 6.1 12.6 4 12.2 6.5 32.4 41.3 7.6 12.4 5 11.3 9.4 39.8 32.8 6.7 12.0 6 10.6 5.6 34.0 41.5 8.3 11.8 7 14.2 6.1 23.2 46.3 10.1 11.5 8 10.9 5.5 34.3 41.1 8.3 11.5 9 11.0 5.2 37.2 38.9 7.7 11.1 10 12.0 6.8 33.3 39.6 8.3 11.1 11 14.4 4.8 22.4 47.0 11.4 10.7 12 11.2 6.0 37.6 37.4 7.8 9.5 13 11.5 4.9 31.4 41.5 10.7 9.4 14 12.3 5.6 31.9 39.9 10.3 8.6 15 11.6 5.3 32.3 40.7 10.1 8.4 16 15.3 6.4 23.8 44.0 10.5 7.6 17 14.7 6.1 23.7 43.7 11.8 7.4 18 14.4 7.2 18.7 43.8 15.9 7.3 19 13.8 5.4 20.0 45.2 15.5 7.1 20 14.5 7.3 29.5 38.3 10.4 6.9 21 17.1 5.9 22.3 39.8 14.8 6.9 22 13.3 4.0 18.0 48.3 16.4 6.2 23 12.4 4.7 24.8 44.6 13.6 6.1 24 13.3 5.0 28.0 40.3 13.4 6.0 25 15.3 4.9 19.6 44.3 15.9 6.0 26 13.8 4.7 22.7 44.3 14.5 5.8 27 13.9 4.6 17.1 47.8 16.5 5.7 28 15.6 6.7 25.0 38.6 14.2 5.6 29 15.5 6.7 25.6 41.1 11.1 5.4 30 14.5 4.8 16.7 46.7 17.2 5.0 average 13.2 5.8 27.6 42.0 11.4 8.7
TABLE-US-00064 TABLE 48 Oil concentrations and fatty acid profiles for events generated by co-transformation with KS387 and pKR561-CATALPA LPAAT-like KS387 area % pKR561-CATALPA LPAAT-like 16:0 18:0 18:1 18:2 18:3 % oil 1 10.7 5.7 32.4 44.0 7.2 14.5 2 10.5 6.8 37.2 38.9 6.6 12.8 3 11.9 5.9 37.8 37.0 7.3 10.6 4 11.7 5.8 31.4 42.3 8.8 10.5 5 11.5 7.0 33.6 39.8 8.2 10.1 6 12.3 6.8 37.4 35.3 8.2 10.0 7 14.2 6.2 25.7 43.1 10.9 9.4 8 13.2 5.3 28.9 42.3 10.2 9.3 9 13.4 6.7 29.0 41.1 9.9 9.2 10 12.2 5.7 28.8 42.3 11.0 9.1 11 12.9 6.7 30.4 41.2 8.8 9.1 12 11.1 5.6 32.0 37.2 14.2 9.0 13 13.2 5.8 28.0 42.4 10.5 8.9 14 13.1 5.3 27.1 43.7 10.7 8.9 15 13.1 7.9 29.3 40.8 8.9 8.8 16 10.8 5.6 34.2 39.8 9.6 8.5 17 15.9 5.4 21.2 46.0 11.4 8.4 18 10.2 6.2 36.2 37.7 9.8 8.4 19 14.3 7.5 28.6 38.6 11.0 7.2 20 13.2 5.6 25.1 41.6 14.5 6.6 21 14.8 5.7 22.7 43.5 13.3 6.6 22 12.6 5.4 26.8 41.6 13.7 6.3 23 13.7 7.3 26.3 40.0 12.7 6.2 24 15.6 5.2 16.3 47.3 15.7 5.8 25 16.4 4.8 16.9 45.3 16.6 5.3 26 15.1 5.4 19.4 43.6 16.4 5.0 27 14.2 5.5 18.6 43.3 18.3 4.5 average 13.0 6.0 28.2 41.5 11.3 8.5
TABLE-US-00065 TABLE 49 Oil concentrations and fatty acid profiles for events generated by transformation with KS387 KS387 area % 16:0 18:0 18:1 18:2 18:3 % oil 1 11.3 7.7 31.6 41.4 8.0 13.3 2 11.5 6.9 33.4 40.8 7.4 12.8 3 11.6 6.0 31.6 42.7 8.1 11.3 4 11.1 6.1 31.7 43.0 8.2 10.8 5 13.1 6.5 27.5 43.6 9.4 10.6 6 12.8 7.4 28.7 42.5 8.6 10.5 7 15.1 5.3 21.4 46.9 11.3 9.3 8 16.6 5.4 17.7 48.7 11.7 8.7 9 10.0 6.8 35.6 38.6 9.0 8.6 10 11.4 6.9 32.9 40.1 8.7 8.1 11 15.7 6.2 19.7 45.7 12.8 7.8 12 13.4 6.6 29.0 40.8 10.3 7.7 13 15.0 6.4 21.8 45.2 11.7 7.5 14 16.9 6.2 22.2 42.0 12.8 7.3 15 14.9 6.7 21.3 44.1 13.0 7.0 16 15.2 6.9 20.7 43.8 13.3 7.0 17 15.6 5.8 19.1 45.2 14.3 6.9 18 15.1 6.1 20.4 45.1 13.2 6.9 19 15.6 6.3 20.6 45.0 12.5 6.9 20 16.2 6.0 18.3 45.9 13.6 6.7 21 15.1 6.1 22.0 43.4 13.4 6.4 22 12.4 5.6 27.4 41.8 12.9 6.4 23 14.2 5.8 18.4 43.9 17.8 6.1 24 15.7 5.4 18.3 45.0 15.5 5.8 25 16.0 5.9 18.1 45.2 14.8 5.6 26 15.6 5.6 18.8 44.4 15.6 5.3 27 12.8 4.4 13.4 48.2 21.2 5.2 average 14.1 6.2 23.8 43.8 12.2 8.0
Example 24
Co-Expression of a LPAAT-Like Gene from Soybean with YL ACBP and YL DGAT1 YL DGAT2 in Soybean Somatic Embryos
[0440] The present example describes construction of soybean expression vectors pKR1358, comprising a LPAAT-like gene from soybean and pKR1364, comprising a LPAAT-like gene from soybean and YL ACBP and the co-transformation of these vectors with pKR1236, comprising Yarrowia DGAT1 and DGAT2, into somatic embryos. Vector pKR1236 alone was also included as a control.
Construction of pKR1358 Comprising a Soy LPAAT-Like Gene
[0441] The nucleotide and amino acid sequences for a soy LPAAT-like gene are set forth in SEQ ID NO:155 and SEQ ID NO:156, respectively. The BsiWI fragment of pKR561-SOY LPAAT-like (SEQ ID NO:159), was cloned into the BsiWI site of pKR268 (previously described in PCT Publication No. WO 04/071467) to produce pKR1358 (SEQ ID NO:170).
Construction of pKR1364 Comprising a Soy LPAAT-Like Gene and YL ACBP
[0442] The PstI fragment of pKR1358 (SEQ ID NO:170), containing a soy LPAAT-like gene was cloned into the SbfI site of pKR1250 (SEQ ID NO:118; Example 20) to produce pKR1364 (SEQ ID NO:171).
Co-Expression in Soybean Somatic Embryos of Either YL ACBP, a Soy LPAAT-Like Gene or YL ACBP and a Soy LPAAT-Like Gene with YL DGAT1 and YL DGAT2
[0443] Vector pKR1250 (SEQ ID NO:118) and pKR1358 (SEQ ID NO:170) were digested with BsiWI and fragments were purified as described in Example 5. Fragment from pKR1364 (SEQ ID NO: 171) was similarly prepared after digestion with Acc65I/FspI. Soybean embryogenic suspension culture (cv. Jack) was transformed with the BsiWI fragment from pKR1250 (SEQ ID NO:118) and pKR1236 (SEQ ID NO:75) and having experiment number MSE2354 or with the BsiWI fragment of pKR1358 (SEQ ID NO:170) and pKR1236 (SEQ ID NO:75) and having experiment number MSE2355 or with the Acc651/FspI fragment of pKR1364 (SEQ ID NO:171) and pKR1236 (SEQ ID NO:75) and having experiment number MSE2356. Plasmid pKR1236 (SEQ ID NO:75) was also transformed alone in a similar way for a control and has experiment number MSE2353.
Example 25
Cloning of Kennedy Pathway Genes from Yarrowia lipolytica
[0444] The present example describes cloning of Kennedy pathway genes from Yarrowia. Genes described here were co-transformed with YL DGAT genes into soybean somatic embryos as described in Examples 18-20.
pFBAIn-YLPAT1
[0445] Y. lipolytica LPAT1 cDNA was cloned by amplification of the ORF using primers YLPAT1-F (SEQ ID NO:172; GATGATCCATGGTGGTCGTGGACGATGTTC) and YLPAT1-R (SEQ ID NO:173; GATCGAGCGGCCGCTGCAGTTAGTTAGTATCACTTATC). The reaction mixture contained 1 l of each primers at 20 M, 1 l Y. lipolytica cDNA as template, 10 l 5HF buffer for Phusion polymerase (New England Biolab), 1 l dNTP mix (10 mM each) 34 l water and 1 l Phusion polymerase. Amplification condition was as follows: initial denaturation at 98 C. for 60 sec, followed by 30 cycles of denaturation at 98 C. for 10 sec, annealing at 55 C. for 10 sec, and elongation at 72 C. for 30 sec. A final elongation cycle at 72 C. for 3 min was carried out, followed by reaction termination at 4 C. A 690 bp DNA fragment was obtained. This fragment was purified with Qiagen PCR purification kit according to the manufacturer's protocol. The purified PCR product was digested with NcoI and NotI and cloned into pFBAIn-MOD-1 (SEQ ID NO:18) between NcoI and NotI. The resulting plasmid was named pFBAIn-YLPAT1 (SEQ ID NO:104).
pFBAIn-YLPAAT2
[0446] Y. lipolytica LPAT2 cDNA was cloned by amplification of the ORF using primers YLPAAT2-FNCOI (SEQ ID NO:174; ACGTCCATGGCCGTTGCATCCAAGCTCGT) and YLPAAT2-RNOTI (SEQ ID NO:175; ACGTGCGGCCGCCTACTGAGTCTTCTGGCCAGCGT). The reaction mixture contained 0.5 l of the cDNA, 1 l each of the primers at 20 M, 22 l water and 25 l ExTaq premix 2 Taq PCR solution (TaKaRa Bio Inc., Otsu, Shiga, 520-2193, Japan). Amplification was carried out as follows: initial denaturation at 94 C. for 60 sec, followed by 30 cycles of denaturation at 94 C. for 20 sec, annealing at 55 C. for 20 sec, and elongation at 72 C. for 60 sec. A final elongation cycle at 72 C. for 3 min was carried out, followed by reaction termination at 4 C. A 850 bp DNA fragment was obtained. This fragment was purified with Qiagen PCR purification kit according to the manufacturer's protocol. The purified PCR product was digested with NcoI and NotI and cloned into pFBAIn-MOD-1 (SEQ ID NO:18) between NcoI and NotI. The resulting plasmid was named pFBAIn-YLPAAT2) SEQ ID NO:108).
pFBAIn-YLPAT3
[0447] Y. lipolytica LPAT3 cDNA was cloned by amplification of the ORF using primers YLPAT3-F (SEQ ID NO:176; GAAGATCCATGGCTACTGCAGAGGCTGTCAAG) and YLPAT3-R (SEQ ID NO: 177; GAAGATCGCGGCCGCCTTACTAACAACTTCAGATCGTC). The reaction mixture contained 1 l of each primers at 20 M, 1 l Y. lipolytica cDNA as template, 10 l 5HF buffer for Phusion polymerase (New England Biolab), 1 l dNTP mix (10 mM each), 34 l water and 1 l Phusion polymerase. Amplification condition was as follows: initial denaturation at 98 C. for 60 sec, followed by 30 cycles of denaturation at 98 C. for 10 sec, annealing at 55 C. for 10 sec, and elongation at 72 C. for 40 sec. A final elongation cycle at 72 C. for 3 min was carried out, followed by reaction termination at 4 C. A 1250 bp DNA fragment was obtained. This fragment was purified with a Qiagen PCR purification kit according to the manufacturer's protocol. The purified PCR product was digested with NcoI and NotI and cloned into pFBAIn-MOD-1 (SEQ ID NO:18) between NcoI and NotI. The resulting plasmid was named pFBAIn-YLPAT3 (SEQ ID NO:111).
pYAT-ACBP
[0448] The Y. lipolytica ACBP cDNA was cloned as follows. Primers ACBP-F1 (SEQ ID NO:178; GATCAACCATGGCTTCCGCCGAATTCACCGCCGCTGCCGACTC) and ACBP-R (SEQ ID NO:179; GATCAAGCGGCCGCTTAGTTGTACTTGTCGGAAAG) were used to amplify the ACBP ORF from the cDNA of Y. lipolytica by PCR. The reaction mixture contained 0.5 l of the cDNA, 1 l each of the primers at 20 M, 22 l water and 25 l ExTaq premix 2 Taq PCR solution (TaKaRa Bio Inc., Otsu, Shiga, 520-2193, Japan). Amplification was carried out as follows: initial denaturation at 94 C. for 60 sec, followed by 30 cycles of denaturation at 94 C. for 20 sec, annealing at 55 C. for 20 sec, and elongation at 72 C. for 20 sec. A final elongation cycle at 72 C. for 3 min was carried out, followed by reaction termination at 4 C. A 250 bp DNA fragment was obtained from the PCR reaction. It was purified using Qiagen's PCR purification kit according to the manufacturer's protocol. The purified PCR product was digested with NcoI and NotI, and cloned into Nco I-Not I digested pYAT-MOD-1 vector (SEQ ID NO: 180), such that the gene was under the control of the Y. lipolytica YAT1 promoter (PCT Publication No. WO 2006/052754) and the PEX20-3 terminator region. Correct transformants were confirmed by miniprep analysis and the resultant plasmid was designated as pYAT-ACBP (SEQ ID NO:116). The nucleotide sequence of the YL ACBP gene comprised in pYAT-ACBP and corresponding amino acid sequence of the YL ACBP protein are set forth as SEQ ID NO:181 and SEQ ID NO:182, respectively.
pFBAIn-YCPT1
[0449] The Y. lipolytica CPT1 cDNA was cloned as follows. Primers CPT1-5-NcoI (SEQ ID NO:183; ACGTCCATGGGCGTATTCATTAAACAGG) and CPT1-3-NotI (SEQ ID NO:184; ACGTGCGGCCGCTTATTCGGTCTTCTTCTCCTG) were used to amplify the Y. lipolytica ORF from the cDNA of Y. lipolytica by PCR. The reaction mixture contained 0.5 l of the cDNA, 0.5 l each of the primers, 11 l water and 12.5 l ExTaq premix 2 Taq PCR solution (TaKaRa Bio Inc., Otsu, Shiga, 520-2193, Japan). Amplification was carried out as follows: initial denaturation at 94 C. for 300 sec, followed by 30 cycles of denaturation at 94 C. for 30 sec, annealing at 55 C. for 30 sec, and elongation at 72 C. for 60 sec. A final elongation cycle at 72 C. for 10 min was carried out, followed by reaction termination at 4 C. A 1190 bp DNA fragment was obtained from the PCR reaction. It was purified using Qiagen's PCR purification kit according to the manufacturer's protocol. The purified PCR product was digested with NcoI and NotI, and cloned into Nco I-Not I digested pFBAIn-MOD-1 vector (SEQ ID NO:18; described in PCT Publication No. WO2007/061742), such that the gene was under the control of the Y. lipolytica FBAIN promoter (U.S. Pat. No. 7,202,356) and the PEX20Pex20 terminator sequence of the Yarrowia Pex20 gene (GenBank Accession No. AF054613) (i.e., PEX20-3). Correct transformants were confirmed by miniprep analysis and the resultant plasmid was designated as pFBAIn-YCPT1 (SEQ ID NO:119).
TABLE-US-00066 TABLE 50 Nucleotide sequences and corresponding amino acid sequences of Yarrowia kennedy pathway genes comprised in soybean transformation vectors Vector name/ Kennedy path- SEQ ID NO: SEQ ID NO: SEQ ID NO: way gene DNA sequence AA sequence pKR1239/105 YL LPAAT1 185 186 pKR1243/110 YL LPAAT2 187 188 pKR1244/113 YL LPAAT3 189 190 pKR1246/115 YL PDAT 191 192 pKR1251/121 YL CPT 193 194
Example 26
Co-Expression of YL DGAT1 with a FAD2/TE2 Down Regulation Construct in Soybean Somatic Embryos
[0450] The present example describes construction of soybean expression vectors pKR1274, comprising Yarrowia DGAT1 (YL DGAT1) and either pKR1267 or pKR1269, comprising a soybean fatty acid desaturase 2 (GM FAD2)/thioesterase 2 (GM TE2) down-regulation construct. While the GM FAD2-TE2 down-regulation region of pKR1267 and pKR1269 are identical in each construct and both are driven by the KTi3 promoter, pKR1267 contains only the KTi3 terminator and pKR1269 contains both the KTi3 and soy albumin terminators.
Construction of pKR1274 Comprising YL DGAT1
[0451] A starting plasmid pKR85 (SEQ ID NO:27), which was previously described in Example 4 contains the hygromycin B phosphotransferase gene (HPT) (Gritz, L. and Davies, J., Gene 25:179-188 (1983)), flanked by the T7 promoter and transcription terminator (T7prom/hpt/T7term cassette), and a bacterial origin of replication (ori) for selection and replication in bacteria (e.g., E. coli). In addition, pKR72 also contains the hygromycin B phosphotransferase gene, flanked by the 35S promoter (Odell et al., Nature 313:810-812 (1985)) and NOS 3 transcription terminator (Depicker et al., J. Mol. Appl. Genet. 1:561-570 (1982)) (35S/hpt/NOS3 cassette) for selection in plants such as soybean. Plasmid pKR85 (SEQ ID NO:27) also contains a NotI restriction site, flanked by the promoter for the subunit of -conglycinin (Beachy et al., EMBO J. 4:3047-3053 (1985)) and the 3 transcription termination region of the phaseolin gene (Doyle et al., J. Biol. Chem. 261:9228-9238 (1986)), called Bcon/NotI/Phas3 cassette.
[0452] The Bcon/NotI/Phas3 cassette was removed from pKR85 (SEQ ID NO:27) by digestion with HindIII and the resulting fragment was re-ligated to produce pKR278 (SEQ ID NO:195).
[0453] The BsiWI fragment of pKR1235 (SEQ ID NO:74, Example 14), containing the YL DGAT1, was cloned into the BsiWI site of pKR278 (SEQ ID NO: 195), which was previously described in U Pat. Pub. US20080095915 (the contents of which are incorporated by reference), to produce pKR1274 (SEQ ID NO:196).
Construction of pKR1267 Comprising GM FAD2-TE2 Down-Regulation Cassette
[0454] The 5 end of GM TE2 (SEQ ID NO:197) was amplified from pTC4 (SEQ ID NO:198), which was previously described in WO19960069361 (the contents of which are incorporated by reference), with oligonucleotide primers GmTE2_5-1 (SEQ ID NO:199) and GmTE2_3-1 (SEQ ID NO:200), using the Phusion High-Fidelity DNA Polymerase (Cat. No. F553S, Finnzymes Oy, Finland) following the manufacturer's protocol. The 3 end of GM TE2 (SEQ ID NO:197) was amplified from pTC4 (SEQ ID NO:198) with oligonucleotide primers GmTE2_5-2 (SEQ ID NO:201) and GmTE2_3-2 (SEQ ID NO:202), using the Phusion High-Fidelity DNA Polymerase (Cat. No. F553S, Finnzymes Oy, Finland) following the manufacturer's protocol. The resulting two PCR products were combined and amplified with GmTE2_5-1 (SEQ ID NO:199) and GmTE2_3-2 (SEQ ID NO:202) using the Phusion High-Fidelity DNA Polymerase (Cat. No. F553S, Finnzymes Oy, Finland) following the manufacturer's protocol. The resulting DNA fragment was cloned into the pCR-Blunt cloning vector using the Zero Blunt PCR Cloning Kit (Invitrogen Corporation), following the manufacturer's protocol, to produce pKR1258 (SEQ ID NO:203).
[0455] The 5 end of GM FAD2 (SEQ ID NO:204) was amplified from pBS43 (SEQ ID NO:205), which was previously described in WO19970477312 (the contents of which are incorporated by reference), with oligonucleotide primers GmFAD2-1_5-1 (SEQ ID NO:206) and GmFAD2-1_3-1 (SEQ ID NO:207), using the Phusion High-Fidelity DNA Polymerase (Cat. No. F553S, Finnzymes Oy, Finland) following the manufacturer's protocol. The 3 end of GM FAD2-1 (SEQ ID NO:204) was amplified from pBS43 (SEQ ID NO:205) with oligonucleotide primers GmFAD2-1_5-2 (SEQ ID NO:208) and GmFAD2-1_3-2 (SEQ ID NO:209), using the Phusion High-Fidelity DNA Polymerase (Cat. No. F553S, Finnzymes Oy, Finland) following the manufacturer's protocol. The resulting two PCR products were combined and amplified with GmFAD2-1_5-1 (SEQ ID NO:206) and GmFAD2-1_3-2 (SEQ ID NO:209) using the Phusion High-Fidelity DNA Polymerase (Cat. No. F553S, Finnzymes Oy, Finland) following the manufacturer's protocol. The resulting DNA fragment was cloned into the pCR-Blunt cloning vector using the Zero Blunt PCR Cloning Kit (Invitrogen Corporation), following the manufacturer's protocol, to produce PCRblunt-Fad2-1 (SEQ ID NO:210).
[0456] The MluI fragment of pKR1258 (SEQ ID NO:331), containing GM TE2, was cloned into the MluI fragment of PCRblunt-Fad2-1 (SEQ ID NO:210), containing GM FAD2-1, to produce pKR1259 (SEQ ID NO:211).
[0457] The EcoRI fragment of pKR1259 (SEQ ID NO:211) comprised of the 5 end of the GM FAD2/TE2 fragment, was cloned into the MfeI site of pKR1259 (SEQ ID NO:211) to produce pKR1261(SEQ ID NO:212) which contains a GM FAD2-TE2-TE2loop-TE2-FAD2 haripin structure flanked by NotI sites.
[0458] The NotI fragment of pKR1261(SEQ ID NO:212), containing GM FAD2-TE2-TE2loop-TE2-FAD2, was cloned into the NotI site of pKR123R (SEQ ID NO:213), which was previously described in WO20040714672 (the contents of which are incorporated by reference), to produce pKR1266 (SEQ ID NO:214).
[0459] The BsiWI/PstI fragment of pKR1266 (SEQ ID NO:214), containing the GM FAD2-TE2-TE2loop-TE2-FAD2 was cloned into the BsiWI/SbfI fragment of pKR278 (SEQ ID NO:195) to produce pKR1267 (SEQ ID NO:215).
Construction of pKR1269 Comprising GM FAD2-TE2 Down-Regulation Cassette
[0460] The NotI fragment of pKR1261(SEQ ID NO:212), containing GM FAD2-TE2-TE2loop-TE2-FAD2, was cloned into the NotI site of pKR457 (SEQ ID NO:216), which was previously described in PCT Publication No. WO 2005/047479 (the contents of which are hereby incorporated by reference), to produce pKR1264 (SEQ ID NO:1264).
[0461] The PstI fragment of pKR1264 (SEQ ID NO:217), containing the GM FAD2-TE2-TE2loop-TE2-FAD2 was cloned into the SbfI fragment of pKR277 (SEQ ID NO:218), which was previously described in PCT Publication No. WO 2004/071467 to produce pKR1269 (SEQ ID NO:219).
Co-Expression of GM FAD2-TE2-TE2loop-TE2-FAD2 Down-Regulation Constructs Either Alone or with YL DGAT2
[0462] Soybean embryogenic suspension culture (cv. Jack) was transformed with the pKR1267 (SEQ ID NO:215) alone and having experiment number MSE2213 or with the BsiWI fragment of pKR1269 (SEQ ID NO:219) and pKR1274 (SEQ ID NO:196) and having experiment number MSE2210. Events were selected and somatic embryos matured in SHaM as described in Example 5. Oil concentrations and fatty acid profiles were determined as described in Example 4 for MSE2213 and MSE2210 and results for each experiment are shown in Table 51 and Table 52, respectively.
TABLE-US-00067 TABLE 51 Oil concentrations and fatty acid profiles for events from MSE2213 MSE2213 (GM FAD2-TE2-TE2loop-TE2-FAD2) Event 16:0 18:0 18:1 18:2 18:3 % Oil 2213-16 5.8 2.6 72.7 10.5 8.5 16.8 2213-26 12.0 5.7 24.8 47.2 10.4 16.5 2213-30 11.7 5.3 18.5 53.1 11.4 15.4 2213-23 9.0 3.2 52.2 24.7 11.0 15.3 2213-29 13.1 3.7 13.3 57.1 12.8 15.0 2213-7 6.4 3.1 66.3 15.6 8.6 14.9 2213-31 11.7 3.0 26.9 46.5 11.9 14.5 2213-13 6.7 3.3 64.5 16.6 8.9 14.4 2213-5 3.5 3.0 78.0 7.5 8.1 13.8 2213-9 7.6 3.4 57.6 20.3 11.0 13.2 2213-20 7.8 4.1 56.7 20.8 10.6 13.1 2213-4 4.1 2.7 72.1 11.1 10.0 12.7 2213-17 7.7 5.2 57.0 19.7 10.4 12.5 2213-3 7.4 3.6 64.4 14.4 10.2 12.5 2213-24 12.9 7.3 29.4 39.0 11.4 12.1 2213-1 13.8 7.1 22.1 44.6 12.4 11.9 2213-6 6.7 2.2 57.2 22.2 11.7 11.8 2213-11 9.2 5.2 58.2 16.4 11.0 10.9 2213-2 7.8 4.3 45.3 31.0 11.7 10.6 2213-14 7.3 4.6 63.0 15.0 10.2 10.5 2213-27 8.5 6.0 48.9 25.0 11.6 10.1 2213-19 8.0 4.0 53.7 21.4 12.8 9.9 2213-21 11.1 5.6 28.3 40.6 14.4 9.8 2213-18 7.4 4.1 57.2 17.7 13.5 9.4 2213-12 6.4 4.3 63.2 15.5 10.6 9.4 2213-10 13.8 7.0 24.0 42.1 13.2 9.4 2213-28 8.8 4.1 54.1 19.1 13.8 9.1 2213-25 6.9 3.5 53.9 21.9 13.8 9.0 2213-15 5.2 3.4 61.7 17.6 12.1 8.0 2213-8 14.4 6.6 20.0 42.9 16.1 7.6 2213-22 14.3 6.3 21.3 41.9 16.2 7.2 Avg. 8.9 4.4 47.9 27.1 11.6 11.9
TABLE-US-00068 TABLE 52 Oil concentrations and fatty acid profiles for events from MSE2210 MSE2210 (YL DGAT1 & GM FAD2-TE2-TE2loop- TE2-FAD2) Event 16:0 18:0 18:1 18:2 18:3 % Oil 2210-2 3.8 2.7 74.7 13.1 5.8 22.1 2210-23 10.3 6.8 32.0 44.4 6.5 20.0 2210-29 7.5 5.5 63.9 17.1 6.0 20.0 2210-19 3.9 3.5 79.1 8.1 5.4 19.7 2210-10 7.3 3.8 66.6 15.6 6.7 19.6 2210-12 5.7 3.6 67.6 17.6 5.6 19.6 2210-14 4.5 2.4 67.9 17.8 7.4 19.3 2210-25 5.1 3.5 71.8 13.1 6.4 18.4 2210-5 9.0 4.1 43.1 35.9 7.9 17.8 2210-24 13.7 4.3 20.5 52.5 9.1 17.5 2210-13 10.2 5.5 36.8 40.4 7.0 17.4 2210-11 10.9 7.8 30.6 43.2 7.5 16.6 2210-1 4.1 3.0 75.6 9.6 7.7 15.9 2210-6 2.7 1.7 83.9 5.3 6.4 15.5 2210-16 8.4 3.7 48.5 31.3 8.1 15.3 2210-26 7.1 4.9 55.2 24.7 8.1 14.4 2210-7 4.3 3.2 62.9 20.8 8.7 14.3 2210-20 6.8 4.3 65.2 15.7 7.9 13.8 2210-27 10.9 7.4 42.4 30.0 9.3 13.8 2210-30 5.0 2.4 65.1 17.1 10.4 13.7 2210-3 7.1 4.8 52.9 27.4 7.9 13.6 2210-4 6.0 3.7 66.0 15.9 8.5 13.3 2210-22 3.2 3.3 77.7 8.1 7.8 13.2 2210-8 9.1 4.9 49.7 27.3 9.0 13.1 2210-21 6.0 3.5 67.8 14.9 7.8 12.8 2210-18 12.7 5.2 20.2 49.7 12.1 12.5 2210-31 4.4 2.9 73.1 10.1 9.5 11.7 2210-9 4.0 3.1 74.1 9.3 9.6 11.2 2210-15 3.5 2.4 72.5 11.0 10.6 11.1 2210-28 14.1 5.7 20.2 45.5 14.5 10.1 2217-29 12.0 7.5 28.0 38.8 13.8 8.7 Avg. 7.2 4.2 56.6 23.6 8.4 15.4
[0463] Comparison of results in Tables 51 and 52 demonstrates that combination of YL DGAT1 expression with down-regulation of GM FAD2-1 and GM TE2 changes the fatty acid profile to an extend that exceeds the change that observed when only GM FAD2-1 and GM TE2 genes are suppressed.
Example 27
Construction of Chimeric Vectors for Seed-Targeted Silencing of Galactinol Synthase and Plastidial Phosphoglucomutase
Amplification of Partial Galactinol Synthase Polynucleotides:
[0464] Polynucleotide fragments encoding parts of the galactinol synthase 1 (GAS1, described in Applicants' Assignee's U.S. Pat. No. 5,648,210; Issued Jul. 15, 1997; Attorney Docket No. BB1032USPCT), galactinol synthase 2 (GAS2; Applicants' Assignee's U.S. Pat. No. 6,967,262; Issued Nov. 22, 2005; Attorney Docket No. BB1442USPCT) and galactinol synthase 3 (GAS3; described in Applicants' Assignee's U.S. Pat. No. 7,294,756 B2; Issued Nov. 13, 2007; Attorney Docket No. BB1539USNA) were amplified by standard PCR methods using Pfu Turbo DNA polymerase (Stratagene, La Jolla, Calif.) and the following primer sets. The DNA template for the PCR reaction was plasmid SH58 (SEQ ID NO: 220).
TABLE-US-00069 ForwardprimerG1HPFW04forwardprimer (SEQIDNO:221): aagcttgcggccgctagtcgactaagtcatcaactattccaagctac ReverseprimerG3HPRV02reverseprimer (SEQIDNO:222): aagcttcgtacgcctaggctacttccccgtatatctccatggcttgg
The oligonucleotide primers were designed to add Not I and SalI restriction endonuclease sites at the 5end of GAS1 and AvrII and BsiWI sites to the 3end of GAS3. The DNA sequence comprising the resulting polynucleotide (H-NotI-SalI-GAS1sGAS2GAS3-AvrII-B-H) is shown in SEQ ID NO:223.
Preparation of PHP25069:
[0465] The polynucleotide product obtained from the amplification described above (H-NotI-Sal1-GAS1sGAS2GAS3-AvrII-B-H, SEQ ID NO:223) was digested with SalI and AvrII and assembled into vector pJMS33 (SEQ ID NO: 224, described in U.S. application Ser. No. 11/133,075 filed May 19, 2005) by the following steps. First, the plasmid pJMS33 was digested with Sal1 and AvrII. Then, the isolated DNA fragment containing partial sequences of GAS1, GAS2 and GAS3 was inserted into SalI/AvrIII-digested plasmid pJMS33 to obtain an intermediary vector. Secondly, the polynucleotide product obtained from the amplification described above (H-Not1-Sal1-GAS1sGAS2GAS3-AvrII-B-H, SEQ ID NO:223) was digested with NotI and BsiWI and assembled into the NotI/BiWI-digested intermediary vector to obtain plasmid PHP25069 (SEQ ID NO: 225).
Amplification of Partial Plastidial Phosphoglucmutase (pPGM):
[0466] A polynucleotide fragment encoding a part of pPGM (pPGM is described in Applicants' Assignee's U.S. Pat. No. 7,250,557; Issued Jul. 31, 2007; Attorney Docket No. BB1451USNA), was amplified by standard PCR methods using Pfu Turbo DNA polymerase (Stratagene, La Jolla, Calif.) and the following primer sets. The DNA template for the PCR reaction was plasmid pTC103 (described in Applicants' Assignee's U.S. Pat. No. 7,250,557; Issued Jul. 31, 2007; Attorney Docket No. BB1451USNA).
TABLE-US-00070 ForwardprimerGMPGMFW02primer (SEQIDNO:226): gaattccctaggtgagctgatttaagatttatcaaaagttg ReverseprimerGMPGMRV02primer (SEQIDNO:227): Gatatccctaggcgtacgttaaatcagctcagaaagggaggttc
The oligonucleotide primers were designed to add an AvrII restriction endonuclease site at the 3 and at the 5end of the pPGM fragment. The DNA sequence comprising the resulting polynucleotide (PGMPCRAA) is shown in SEQ ID NO:228.
[0467] Preparation of PHP28656:
[0468] The polynucleotide product PGMPCRAA (SEQ ID NO:228) was digested with AvrII and assembled into an AvrII-digested vector PHP25069 (SEQ ID NO: 225) to obtain vector PHP28656 (SEQ ID NO: 229).
[0469] Preparation of PHP29252:
[0470] The polynucleotide product of SEQ ID NO:223 was digested with SalI and AvrII and assembled into vector pJMS33 (SEQ ID NO: 224) to obtain an intermediary vector SH73.
[0471] A polynucleotide fragment representing a potato intron (STLS1) was amplified by standard PCR methods using Pfu Turbo DNA polymerase (Stratagene, La Jolla, Calif.) and the following primer sets. The DNA template for the PCR reaction was plasmid PHP21155 (SEQ ID NO:230).
TABLE-US-00071 ForwardprimerPHP21155FW01(SEQIDNO:231): gaattccctgcaggacctgcacatcaccatgttttggtca ReverseprimerPHP21155RV01(SEQIDNO:232) gaattccgtacgcaggtaagtttctgcttctacctttg
The DNA sequence comprising the resulting polynucleotide (STLS1-BsiWI/SbfI) is shown in SEQ ID NO:233.
[0472] A polynucleotide fragment encoding a part of pPGM was amplified by standard PCR methods using Pfu Turbo DNA polymerase (Stratagene, La Jolla, Calif.) and a primer set designed to add an AvrII restriction endonuclease site at the 3 of the pPGM fragment and a SbfI, PstI and EcoRV sites at the 5end of the pPGM fragment. The DNA sequence comprising the resulting polynucleotide (PGMPCRAS) is shown in SEQ ID NO:234.
[0473] A second intermediary vector, pJMS40, was assembled by ligating the BsiWI/SbfI-digested STLS1 intron (SEQ ID NO:233) and the AvrII/SbfI digested PGMPCRAS (SEQ ID NO:234) into the AvrII/BsiWI digested vector SH73.
[0474] PHP29252 (SEQ ID NO: 235) was assembled by ligating a 2168 bp Not1-BsiWI fragment of PHP28656 (SEQ ID NO: 229), containing the partial GAS1 GAS2 GAS3 polynucleotides linked to the partial pPGM polynucleotide, into the NotI/BsiWI-digested pJMS40 (containing the STLS1 intron linked to the inverse partial GAS1 GAS2 GAS3 pPGM polynucleotides). PHP29252 can encode for a hairpin structure with the partial GAS1 GAS2 GAS3 pPGM polynucleotides representing the stem structure of the hairpin and the STLS1 intron representing the loop structure.
Example 28
Transformation of Soybeans with Chimeric Vectors for Seed-Targeted Silencing of Galactinol Synthase and Plastidial Phosphoglucomutase
[0475] Soybean were transformed with a seed-specific expression AscI fragment of PHP29252 (SEQ ID NO: 235) containing the KTi promoter linked to the GAS1 GAS2 GAS3 PGM haripin structure described in Example 27 by the method of particle gun bombardment (Klein, T. M. et al. (1987) Nature (London) 327:70-73; U.S. Pat. No. 4,945,050; described in Example 6).
[0476] The AscI-PHP29252 fragment was co-bombarded with a DNA fragment (PHP19031A, SEQ ID NO: 236) containing the ALS selectable marker driven by the soybean SAMS promoter.
[0477] Soybean somatic embryos as well as mature seeds were analyzed as described in Example 29 and 30
Example 29
Raffinose Family Oligosaccharide (RFO) Analysis in Transgenic Soybean Somatic Embryos and Soybean Seeds
[0478] Individual immature soybean embryos were dried-down (by transferring them into an empty small Petri dish that was seated on top of a 10 cm Petri dish containing some agar gel to allow slow dry down) to mimic the last stages of soybean seed development. Dried-down embryos are capable of producing plants when transferred to soil or soil-less media. Storage products produced by embryos at this stage are similar in composition to storage products produced by zygotic embryos at a similar stage of development and most importantly the storage product profile is predictive of plants derived from a somatic embryo line (PCT Publication No. WO 94/11516, which published on May 26, 1994). Raffinose Family Oligosaccharides (raffinose, stachyose) of transgenic somatic embryos containing recombinant expression construct described in Example 27 was measured by thin layer chromatography. Somatic embryos were extracted with hexane then dried. The dried material was re-suspended in 80% methanol, incubated at room temperature for 1-2 hours, centrifuged, and 2 l of the supernatant is spotted onto a TLC plate (Kieselgel 60 CF, from EM Scientific, Gibbstown, N.J.; Catalog No. 13749-6). The TLC was run in ethylacetate:isopropanol:20% acetic acid (3:4:4) for 1-1.5 hours. The air dried plates were sprayed with 2% sulfuric acid and heated until the charred sugars were detected. The somatic embryos from event 4871.6.10 showed reduced levels of raffinose sugars (raffinose and stachyose) when compared to untransformed wild type soybean (WT) somatic embryos.
[0479] Mature soybean T1 and T2 seeds of event 4871.6.10 were chipped and the chips were analyzed by TLC as described above. Seed from events 4871.6.10 showed reduced levels of raffinose sugars (raffinose and stachyose) when compared to untransformed wild type soybean (WT) somatic embryos.
Example 30
Down Regulation of Plastidic Phosphoglucomutase in Soybean
[0480] Transgenic soybean lines containing the recombinant construct of the invention were screened for down regulation of plastidic phosphoglucomutase. The screening assay involved iodine staining for the presence or absence of starch in immature seeds (mid-pod stage) or dried down embryos (see example 29). The method involved harvesting a slice of the immature seed or the entire dried down embryo and placing this tissue in 100% ethanol overnight. Thereafter, the ethanol was decanted and the tissue was subsequently stained with water:lugol (4:1) solution for 10 to 30 minutes at room temperature. Lugol is an iodine/potassium iodide solution, commercially available from Sigma (USA).
[0481] The somatic embryos from event 4871.6.10 showed reduced starch accumulation as indicated by reduced iodine staining.
Example 31
Seed Composition of Event 4871.6.10
[0482] T2 seeds derived from a T1 plant that was heterozygous for the 4871.6.10 transgenic event were genotyped by TLC analysis of raffinosaccharides. Eight transgenic seeds lacking RFO and eight null segregant seeds containing RFO were pooled. The soluble carbohydrate and starch levels were measured as described in Example 13B.
TABLE-US-00072 TABLE 53 Composition of T2 seed of event 4871.6.10 g/kg tissue (dry wt); Mean +/ SD of three reps Myo- Total g/kg (dry Pinitol Sorbitol Fructose Glucose Inositol Sucrose Raffinose Stachyose wt) Starch Null Mean 1.6 0.4 1.2 1.2 0.2 61.4 9.2 39.2 114.3 0.2 SD 0.0 0.0 0.0 0.2 0.0 0.9 0.1 1.4 0.4 0.0 TG Mean 3.8 0.1 1.2 1.7 0.3 78.1 1.3 0.2 86.7 0.1 SD 0.0 0.0 0.1 0.3 0.0 1.7 0.1 0.1 1.6 0.1
According to Table 53 seeds of event 4871.6.10 from plants grown in a controlled environment show a 97% reduction in raffinosaccharides and a 27% increase in sucrose. Overall there is a 24% reduction in soluble carbohydrate associated with the presence of the transgene.
[0483] Homozygous T3 seeds of event 4871.6.10 and a non-transgenic null isolines derived from the same event were submitted to Eurofins Scientific Inc. (USA) for compositional analysis.
TABLE-US-00073 TABLE 54 Composition of T3 seed of event 4871.6.10 % % % % % Pro % Oil sucrose stachyose raffinose % crude ash % carbs, calc DW DW DW DW DW fiber DW DW DW 4871.6.10 42.4 24.6 6.2 <0.2 <0.2 4.6 8.2 24.8 TG 4871.6.10 42.4 23.5 7.8 <0.2 <0.2 4.9 8.2 25.9 TG 4871.6.10 41.2 24.0 6.6 <0.2 <0.2 5.2 8.3 26.5 TG avg 42.0 24.0 6.9 4.9 8.2 25.7 4871.6.10 39.8 22.3 5.1 4.7 1.0 6.1 8.1 29.8 null 4871.6.10 39.6 22.5 4.6 4.4 0.8 5.6 7.7 30.2 null avg 39.7 22.4 4.9 4.6 0.9 5.9 7.9 30.0
[0484] According to Table 54 T3 seeds of event 4871.6.10 grown in a controlled environment have raffinosaccharide levels below the detection level of 0.2% DW and show an increase in oil and protein levels of 1.6 and 2.3% points, respectively and an increase in sucrose levels of 1.7% points compared to null segregant seed of the same event.
[0485] Homozygous T3 seeds of event 4871.6.10 and a non-transgenic null isoline derived from the same event were planted in three field environments in the spring of 2008. For each seed source, transgenic or null-segregant seeds of event 4871.6.10, at least three double rows comprised of 220 plants and as many as twelve double rows comprised of said number of plants were planted in a given environment.
TABLE-US-00074 TABLE 55 Oil and protein content of T4 seed of event 4871.6.10 grown in field environments % protein % oil 4871.6.10 33.4 18.7 Null 4871.6.10 35.9 19.5 TG
[0486] Table 55 shows the average oil and protein content as measured by NIR spectroscopy of T4 seed of 4871.6.10 grown in the three different field environments. There is an increase in oil content of 4% (0.8% points) and an increase in protein content of 7% (2.4% points) associated with the presence of the 4871.6.10 transgene when plants are grown in a field environment.
In summary the event 4871.6.10 shows >90% reduction of raffinose and stachyose levels indicative of efficient silencing galactinol synthase genes (U.S. Pat. No. 5,648,210, U.S. Pat. No. 6,967,262, U.S. Pat. No. 7,294,756 B2) and an increase in oil and protein of soybean seed indicative of efficient silencing of plastidal phosglucomutase genes (U.S. Pat. No. 7,250,557).
Example 32
[0487] Generation of Soybean Lines with Seed-Targeted Silencing of Galactinol Synthase and Plastidial Phosphoglucomutase and Seed Targeted Over-Expression of DGAT Enzymes
[0488] T2 plants of events EAFS 4818.1.5 and EAFS 4871.6.10 that were homozygous for an YL DGAT1/YL DGAT2 event (Example 6) and a PGM/RFO ko event (Example 31), respectively were crossed. Resulting F1 seed were analyzed by GC and TLC as described above to monitor presence of the DGAT trait (elevated oleic acid) and PGM/RFO ko trait (reduced raffinose and stachyose). A total of 23 F1 seed with elevated oleic acid content and reduced raffinosaccharide levels were planted, resulting plants were grown to maturity. For every F1 plant a total of 48 F2 seed were subjected to the following analysis sequence. Seed oil content was measured non-destructively by NMR (Example 4). Seed were chipped and the resulting seed chip was extracted with heptane. Heptane extracts were subjected to GC analysis to determine the presence of the DGAT transgene (indicated by the altered fatty acid profile of the oil). The heptane-extracted residue was subjected to TLC analysis of raffinose and stachyose content (Example 29) to determine presence or absence of the EAFS 4871.6.10 transgene. In this manner 1104 seed were genotyped and the effect of transgene genotype on oil content was determined.
TABLE-US-00075 TABLE 56 Comparison of oil content of F2 progeny of a cross between events EAFS 4818.1.5 and EAFS 4871.6.10 oil % points over null F1 plant # DGAT + PGM/RFO ko DGAT PGM/RFO ko null 1 5.3 4.4 2 0 2 4.1 2.7 0.2 0 3 5.2 4.9 2.2 0 4 3.1 2.2 0.8 0 5 5.1 4.5 2 0 6 1.8 1.8 1.9 0 7 3.8 2.1 0.7 0 8 5.3 3.9 3.3 0 9 5.4 4.2 0.4 0 10 4.9 4.3 0.1 0 11 4.9 3.6 1 0 12 5 2.7 0.3 0 13 4.5 3.4 1.3 0 14 2.8 2.4 0 0 15 4 3.2 1.1 0 16 3.8 2 1.8 0 17 4.2 4.5 0.9 0 18 3.4 2.8 1.5 0 19 3.9 3.3 0.2 0 20 4.8 3.2 1 0 21 5.2 5.6 3 0 22 5.1 4.3 0.1 0 23 7.5 6.6 2.8 0 avg 4.5 3.6 0.7 0.0
[0489] Table 56 shows that the oil increases associated with the presence of 4818.1.5 and 4871.6.10 transgenes are additive. The average oil content of all F2 seed positive for DGAT and PGM/RFO ko traits is 22.8%. There is an oil increase of 4.5% points compared to the average oil content of all seeds of the same 23 F2 segregants that did not contain DGAT and PGM/RFO ko traits which was 18.3%. Thus combination of DGAT over expression represented by event 4818.1.5 and plastidal PGM-down regulation represented by event 4871.6.10 allows increasing the oil content of soybean seed by more than 20%.