METAL ION-START DNA POLYMERASE SWITCH AND ISOTHERMAL POLYMERASE AMPLIFICATION METHOD USING THE SAME
20230074735 · 2023-03-09
Inventors
Cpc classification
C12Q2527/125
CHEMISTRY; METALLURGY
C12Q2527/125
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention relates to a metal ion-start DNA polymerase switch, a composition for isothermal polymerase amplification containing the same, and an isothermal amplification method using the metal ion-start DNA polymerase switch. The metal ion-start DNA polymerase switch according to the present invention may comprise: a binding module composed of TQ30 aptamer; a locking or unlocking module; and a catalytic module connecting between the binding module and the locking or unlocking module and composed of DNAzyme.
Claims
1. A metal ion-start DNA polymerase switch comprising: a binding module composed of an aptamer for inhibiting DNA polymerase activity; a locking or unlocking module; and a catalytic module connecting between the binding module and the locking or unlocking module and composed of DNAzyme.
2. The metal ion-start DNA polymerase switch of claim 1, wherein the DNAzyme is selected from the group consisting of Pb.sup.2+-responsive and RNA-cleaving GR5 DNAzyme, Na.sup.+-responsive NaA43 DNAzyme, Cu.sup.2+ ion-responsive PSCu10 DNAzyme, Ca.sup.2+-responsive EtNa DNAzyme, Ln.sup.3+-responsive Dy10a, and other DNAzymes.
3. The metal ion-start DNA polymerase switch of claim 1, wherein the metal ion-start DNA polymerase switch comprising the locking module comprises a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1 to 3.
4. The metal ion-start DNA polymerase switch of claim 1, wherein the metal ion-start DNA polymerase switch comprising the unlocking module comprises a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 4 to 6.
5. A composition for isothermal polymerase amplification containing: the metal ion-start DNA polymerase switch of claim 1; and a DNA polymerase.
6. The composition of claim 5, wherein the metal ion-start DNA polymerase switch comprising the locking module is configured to activate the DNA polymerase by binding of the binding module to the DNA polymerase in the presence of metal ions.
7. The composition of claim 5, wherein the metal ion-start DNA polymerase switch comprising the unlocking module is configured to deactivate the DNA polymerase by binding of the binding module to the DNA polymerase in the presence of metal ions.
8. A method for quantitative analysis of a target gene comprising steps of: preparing a mixture by mixing the metal ion-start DNA polymerase switch according to claim 1, metal ions, and a sample to be analyzed, and heating and incubating the mixture; and quantifying an amount of the target gene in the sample.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
DETAILED DESCRIPTION
[0026] The present invention relates to a metal ion-start DNA polymerase switch, a composition for isothermal polymerase amplification containing the same, and an isothermal polymerase amplification method using the metal ion-start DNA polymerase switch.
[0027] According to one embodiment of the present invention, the metal ion-start DNA polymerase switch comprises: a binding module; a locking or unlocking module; and a catalytic module composed of DNAzyme.
[0028] Hereinafter, the present invention will be described in detail with reference to the accompanying drawings.
[0029]
[0030] As the binding module, an aptamer that inhibits DNA polymerase activity may be used. For example, a hairpin-shaped TQ30 aptamer that can inhibit the activity of Taq DNA polymerase may be used (Dang and Jayasena 1996; Ho et al. 2018; Lin and Jayasena 1997; Park et al. 2016a; Park et al. 2015, 2016b). Specifically, this TQ30 aptamer is composed of: a fixed loop that directly contacts the DNA polymerase; and a programmable stem that serves as a binding stabilizer. In addition to the TQ30 aptamer, a TQ21 aptamer that inhibits Tth polymerase activity may also be used. Additionally, other binding modules may also be used to control the activities of various enzymes other than the DNA polymerase.
[0031] The catalytic module that is used in the present invention may be selected from among GR5 DNAzyme, which is a classic Pb.sup.2+-dependent, RNA-cleaving DNAzyme, that displays an exceptionally high selectivity to Pb.sup.2+ targets (Saran and Liu 2016), Na.sup.+ ion-responsive NaA43 DNAzyme, Cu.sup.2+ ion-responsive PSCu10 DNAzyme, Ca.sup.2+ ion-responsive EtNa DNAzyme, Ln.sup.3+-responsive Dy10a, and the like. In addition, any DNAzyme capable of causing cleavage in response to ions may also be used. This module composed of GR5 DNAzyme provides a Pb.sup.2+ recognition site for the molecular switch of the present invention, which eventually undergoes a dynamic conformation change as a result of Pb.sup.2+-triggered RNA cleavage.
[0032] In addition, a faster reaction can be induced using a non-catalytic module, which can also be applied to real-time detection. For example, an aptamer that causes a large structural change instead of cleavage may be used, and as an example, a switch responsive to K+ may be constructed using a G-quadruplex nanostructure. As another example, using a structure-switching aptamer such as an ATP aptamer, it is possible to construct a switch that responds not only to ions but also to small molecules such as ATP.
[0033] Finally, the locking or unlocking module is included as a key component that determines activation or deactivation of DNA polymerases in response to a metal ion such as Pb.sup.2+.
[0034] As the three modules are systematically correlated with each other, the lead ion-start switch of the present invention behaves as an elaborate nanomachine, allowing bidirectional control of DNA polymerase activity initiated by metal ion addition.
[0035] Relying on the choice between the locking module and the unlocking module, it is possible to switch from deactivation (OFF state) to activation (ON state) of DNA polymerase and vice versa (
[0036] On the other hand, the molecular switch equipped with the unlocking module (ON.fwdarw.OFF switch, right) responds to Pb.sup.2+ in the opposite manner. That is, the unlocking module disturbs the stable formation of the binding module, but upon Pb.sup.2+ addition, the cleavage of the catalytic module permits the structural reorganization of the molecular switch, making the binding module to suppress the primer extension of the DNA polymerase.
[0037] The metal ion-start switch was rationally constructed as the three functional modules were systematically integrated with one another (
[0038] In addition, according to one embodiment of the present invention, not only Taq DNA polymerase but also various types of DNA polymerase can be controlled in the same manner. This is possible through replacement of the aptamer module. Various polymerase inhibitory aptamers suitable for isothermal amplification can be newly discovered with the help of in vitro selection technology. For example, transcription of T7 RNA polymerase may be controlled in the same manner by using an RNA aptamer. Furthermore, the system of the present invention may also be applied to control the activities of various biological enzymes in addition to DNA polymerase. The activities of various enzymes can be controlled in the same manner only through replacement of the aptamer module.
[0039] Table 1 below shows the DNA sequences (5′.fwdarw.3′) of the OFF.fwdarw.ON switches among the lead ion-start switches comprising the locking module according to one embodiment of the present invention. In Table 1, rA signifies an RNA nucleotide.
TABLE-US-00001 TABLE 1 Name DNA sequence (5′.fwdarw.3′) OFF.fwdarw.ON switch 5′-GAGTCCAATrAGGAAGAGTCCAATGTACAGT (optimal ATTGGACTCTGAAGTAGCGCCGCCGTATTGGACT locking) CTTCC-3′ (SEQ ID NO: 1) OFF.fwdarw.OFF switch 5′-GCGGCGTCACTATrAGGAAGATCCAATGTAC (too strong AGTATTGGATCTGAAGTAGCGCCGCCGTATAGTG locking) ACGCCGC-3′ (SEQ ID NO: 2) ON.fwdarw.ON switch 5′-AAGACAATrAGGAAGACAATGTACAGTATTG (too weak TCTGAAGTAGCGCCGCCGTATTGTCTTC-3′ locking) (SEQ ID NO: 3)
[0040] Table 2 below shows the DNA sequences (5′.fwdarw.3′) of the ON.fwdarw.OFF switches among the lead ion-start switches comprising the unlocking module according to the present invention. In Table 2, rA signifies an RNA nucleotide.
TABLE-US-00002 TABLE 2 Name DNA sequence (5′.fwdarw.3′) ON.fwdarw.OFF switch 5′-CTGTACATTGTrAGGAAGAGCTTTGCTCTGA (optimal AGTAGCGCCGCCGTACAATGTACAGTATTGTAC unlocking) G-3′ (SEQ ID NO: 4) OFF.fwdarw.OFF switch 5′-CTGTACATTACTrAGGAAGAGCTTTGCTCTG (too weak AAGTAGCGCCGCCGTAGTAATGTACAGTATTACT unlocking) ACG-3′ (SEQ ID NO: 5) ON.fwdarw.ON switch 5′-CGTAATACTGTACATTrAGGAAGAGCTTTGC (too strong TCTGAAGTAGCGCCGCCGTAATGTACAGTATTAC unlocking) G-3′ (SEQ ID NO: 6)
[0041] For optimal construction of the lead ion-start switch, the present inventors evaluated the melting temperature (T.sub.m) and Gibbs free energy change (ΔG) of each designed molecular switch before and after Pb.sup.2+-triggered cleavage under isothermal amplification conditions. In consideration of ΔG between ON and OFF states, the optimal OFF.fwdarw.ON switch (
[0042] The 64-nt-long ON.fwdarw.OFF switch (
[0043]
[0044] Before Pb.sup.2+ addition, the locking module induces the stem-loop structure of the binding module to be fully locked, inhibiting the isothermal amplification of DNA polymerase (OFF state). However, Pb.sup.2+-triggered strand cleavage by the catalytic module can cause denaturing of the binding module, making the liberated DNA polymerase active for target amplicon production (ON state). The unlocking module that prevents the structural folding of the binding module is disabled upon Pb.sup.2+ addition, switching the activity of DNA polymerase from ON to OFF (left).
[0045]
[0046] The present invention is characterized by systematically integrating the TQ30 aptamer module functioning to inhibit DNA polymerase with the Pb.sup.2+-start, RNA-cleaving GR5 DNAzyme module. In particular, relying on the type of interconnector that correlates the two modules with each other, Pb.sup.2+ may serve as an initiator or a terminator of isothermal DNA amplification. The lead ion-start molecular switch constructed as described above may be specific to lead ions among various metal ions, and may dramatically increase the enzymatic activity of DNA polymerase (>25 times).
[0047] Another embodiment of the present invention provides a composition for isothermal polymerase amplification containing the metal ion-start DNA polymerase switch and a DNA polymerase.
[0048] Still another embodiment of the present invention provides an isothermal amplification method comprising steps of: preparing a mixture by mixing the metal ion-start DNA polymerase switch, metal ions, and a sample to be analyzed, and heating and incubating the mixture; preparing a composition for isothermal polymerase amplification by adding a DNA polymerase to the incubated mixture, followed by incubation; and isothermally amplifying a target gene using a mixture obtained by mixing a solution containing target gene-start primers and a template with the composition for isothermal polymerase amplification.
[0049] Hereinafter, the present invention will be described in detail with reference to Examples and Experimental Examples, but the scope of the present invention is not limited by these Examples.
I. Material and Methods
[0050] 1. Reagents and Materials
[0051] DNA oligonucleotides used herein were synthesized by Bioneer Co. (Daejeon, Korea) and Integrated DNA Technologies, Inc. (Coralville, USA). The oligonucleotide sequences are listed in Table 3 below. Thermus aquaticus DNA polymerase (Taq DNA polymerase) was bought from New England Biolabs (Massachusetts, USA). Human Serum was purchased from Sigma-Aldrich, Inc. (St. Louis, US). Ethylenediaminetetraacetic acid (EDTA, pH 7.4) was bought from T&I Biotechnology (Hebei, China).
TABLE-US-00003 TABLE 3 Name DNA Sequence (5′.fwdarw.3′) OFF.fwdarw.ON system OFF.fwdarw.ON switch GAGTCCAATrAGGAAGAGTCCAATGTACAGTATTGGACTCTGAAGTAGCGCCGCC (optimal locking) GTATTGGACTCTTCC (Seq. No. 1) OFF.fwdarw.OFF switch GCGGCGTCACTATrAGGAAGATCCAATGTACAGTATTGGATCTGAAGTAGCGCCG (too strong CCGTATAGTGACGCCGC (Seq. No. 2) locking) ON-ON switch AAGACAATrAGGAAGACAATGTACAGTATTGTCTGAAGTAGCGCCGCCGTATTGT (too weak locking) CTTC (Seq. No. 3) ON.fwdarw.OFF system ON.fwdarw.OFF switch CTGTACATTGTrAGGAAGAGCTTTGCTCTGAAGTAGCGCCGCCGTACAATGTACA (optimal GTATTGTACG (Seq. No. 4) unlocking) OFF.fwdarw.OFF switch CTGTACATTACTrAGGAAGAGCTTTGCTCTGAAGTAGCGCCGCCGTAGTAATGTA (too weak CAGTATTACTACG (Seq. No. 5) unlocking) ON.fwdarw.ON switch CGTAATACTGTACATTrAGGAAGAGCTTTGCTCTGAAGTAGCGCCGCCGTAATGT (too strong ACAGTATTACG (Seq. No. 6) unlocking) DNA templates and primers Template CAGAAATCTCAGGGACTCTAAAGCTCAACTTGCATAAACTTCTGAGGA FAM-primer FAM-TCCTCAGAAGTTTATGCA COVID template CACATTGGCACCCGCAATCCTGCTAACAATGCTGCAATCGTGCTACAACT COVID primer AGTTGTAGCACGATTGCAGC COVID FAM-primer FAM-AGTTGTAGCACGATTGCAGC
[0052] 2. General Reaction Conditions
[0053] The reaction mixtures were separately prepared as part A and part B. Part A (total volume of 25 μL) was composed of 1× Taq reaction buffer (10 mM Tris-HCl, 50 mM KCl, 1.5 mM MgCl.sub.2, pH 8.3), 500 μM dNTPs, 1 μM DNAzymatic switch, and 20 μM PbCl.sub.2. The sample mixture was heated at 90° C. for 5 min, cooled slowly to 25° C. (0.1° C./s) and incubated at 25° C. for more than 2 h. Taq DNA polymerase (22 nM) was then added to the mixture and incubated for 20 min. Part B (total volume of 25 μL), composed of 1× Taq reaction buffer, 150 nM template, and 100 nM FAM-primer, was heated at 90° C. for 5 min, cooled slowly to 25° C. (0.1° C./s) and incubated at 25° C. for 20 min. Part A and B were mixed together and incubated at 25° C. for 2 h. To immediately quench the reaction, 2 μL of 0.5 M EDTA was added.
[0054] 3. Denaturing Urea Polyacrylamide Gel Electrophoresis (Urea PAGE)
[0055] 13 μL of the final reacted solution was mixed with 6× loading buffer (5 μL) and 8 M urea (7 μL) for efficient loading, and subjected to electrophoresis analysis on a 10% urea-polyacrylamide gel. The analysis was carried out in 1×TBE (89 mM Tris, 89 mM borate, and 2 mM EDTA, pH 8.3) at 300 V for 25 min. The gel image was taken using Azure Gel Imaging System and the band intensities were quantified through a Gel Analyzer software.
[0056] 4. Estimation of Thermodynamic Values and Secondary Structures
[0057] To obtain the calculated thermodynamic values and the predicted secondary structures of the designed molecular switches, the present inventors utilized the IDT OligoAnalyzer Tool.
[0058] 5. Reaction Conditions at Complex Bioanalytes (Human Serum and Saliva)
[0059] Overall experimental procedures followed the general reaction conditions. However, in preparation of part A, 10% human serum or 8% human saliva was additionally mixed with the existing components. Instead of using normal primer/template, COVID-19 nucleocapsid protein (N-protein) gene-based primer/template was used to prepare part B. After the reaction was quenched by EDTA, the product was stained with SYBR Green dye for 6 minutes and the fluorescence signal was detected through the Tecan Spark™ 10M. For in-field analysis, the reaction product was irradiated with a portable UV lamp to take a picture with a mobile phone. The intensity of the obtained picture was quantitatively evaluated through ImageJ, an image analyzing software.
II. Results and Discussions
[0060] 1. Characterization of Pb.sup.2+-Specific DNA Polymerase Switches
[0061] In the OFF.fwdarw.ON switch, the Pb.sup.2+-triggered activity change of DNA polymerase was evaluated by comparing the amounts of target amplicons resulting from isothermal polymerization, and the results of the evaluation are shown in
[0062] The TQ30 aptamer completely inhibited the activity of DNA polymerase, and the inhibition efficiency thereof showed no significant difference between with and without Pb.sup.2+ (
[0063]
[0064] That is, in the presence of 10 μM Pb.sup.2+, the activity of DNA polymerase increased to a certain degree, which might be caused by the collapse of stems as a result of Pb.sup.2+-triggered strand cleavage.
[0065]
[0066] To achieve Pb.sup.2+-induced polymerase activation, the TQ30 aptamer within the OFF.fwdarw.ON switch should bind to a DNA polymerase only in the absence of Pb.sup.2+ (
[0067] The optimized switch of the present invention regulated the DNA polymerase to produce a negligible amount of target amplicons without Pb.sup.2+ (>2% of the maximal production), but their target amplicon production dramatically increased in the presence of Pb.sup.2+, yielding 25 times larger amplicons (
[0068]
[0069] Importantly, the OFF.fwdarw.ON switch was highly Pb.sup.2+-start in activating DNA polymerases. To evaluate the metal ion dependence, the present inventors incubated the optimal OFF.fwdarw.ON switch of the present invention with various metal ions (K.sup.+, Na.sup.+, Li.sup.+, Ca.sup.2+, Mg.sup.2+, Mn.sup.2+, Pb.sup.2+, Cu.sup.2+, and Ni.sup.2+) (
[0070]
[0071] 2. Quantitative and Parallel Gene Detection in Complex Bioanalytes
[0072] The lead-start DNA polymerase switch of the present invention can serve as an excellent isothermal amplification controller, allowing PoC tests to be performed in a parallel and quantitative manner. Inherently, the isothermal amplification guarantees significantly high sensitivity and reliability in analyte detection even if the target analytes exist in complex mixtures, such as human serum or saliva (Calvert et al. 2017). During the sensitive and reliable isothermal amplification, the lead-start switches of the present invention can precisely control a number of reactions to be initiated and terminated at the same time, avoiding nonspecific amplification. All the reactions can be prepared individually, but they are isothermally amplified under the identical conditions, allowing quantitative and reproducible analysis of all the amplicons. It is well known that there are many ways to easily and simply visualize the amplified dsDNAs, and for example, SYBR Green dye's selective intercalation into dsDNAs can be used for fluorescence-based naked eye detection (Noble and Fuhrman 1998). To actualize the in-field fluorescent detection, the present inventors performed the isothermal amplification of multiple samples simultaneously, and using a portable UV lamp and a smartphone, the fluorescent signals of the resulting amplicons were obtained and subsequently analyzed by the image analyzing mobile app (
[0073] To validate the potential of the lead-start switch for on-demand isothermal amplification of multiple samples, the OFF.fwdarw.ON switch of the present invention was applied to detect the clinically important HPV type 16 DNA in human serum without an additional purification process (
[0074] The DNAzymatic switch of the present invention can also be applicable for quantifying another type of target DNA with clinical significance, which is reverse-transcribed nucleocapsid protein (N-protein) gene of SARS-CoV-2 in human serum (
[0075] As DNA polymerases are known to tolerate compositional differences by the choice of clinical specimens, the present inventors quantitatively measured the concentrations of N-protein genes after reverse transcription in saliva, which is a representative type of specimens for the primary COVID-19 diagnostic method. The fluorescent signals of saliva samples were exactly fitted on the serum-based calibration curve (r>0.999), indicating the reliability and generality of the in-field gene detection technique of the present invention (Mullis et al. 1986; Nagai et al. 1998; Wyllie et al. 2020).
[0076] Therefore, the present invention provides a method of quantitatively analyzing a target gene using the metal ion-start DNA polymerase switch.
[0077] As lots of structure-switching aptamers targeting diverse metal ions and small molecules have been developed recently, their successful application to regulation of isothermal amplification could not only vary the trigger of reaction, but also make the reaction begin immediately (Fong et al. 2016; Oh et al. 2010; Oh et al. 2013; Qu et al. 2016). In addition, to be compatible with a variety of isothermal amplification techniques, the molecular switches of the present invention are necessary to be further tailored for regulating other types of DNA polymerases, which can be also benefited by in vitro selection technology (Gening et al. 2006; Li and Macdonald 2015; Mori et al. 2012; Ohuchi et al. 2012; Zhao et al. 2015). Given the availability of various polymerase-binding aptamers, the current state-of-art isothermal amplification techniques, including RCA and LAMP, would be further upgraded to be used even in quantitative and parallel manner.
REFERENCES
[0078] 1. W. Coleman and G. Tsongalis, Diagn. Mol. Pathol., 2017, 15-23. [0079] 2. K. A. Eckert and T. A. Kunkel, Genome Res., 1991, 1, 17-24. [0080] 3. M. F. Kramer and D. M. Coen, Curr. Protoc. Mol. Biol., 2001, 56, 15. [0081] 4. Q. Chou, M. Russell, D. E. Birch, J. Raymond and W. Bloch, Nucleic Acids Res., 1992, 20, 1717-1723. [0082] 5. S. A. Bustin and T. Nolan, J. Biomol. Tech., 2004, 15, 155. [0083] 6. N. Paul, J. Shum and T. Le, RT-PCR Protocols, 2010, 301-318. [0084] 7. M. R. Green and J. Sambrook, Cold Spring Harbor Protocols, 2018, 2018, pdb. prot095125. [0085] 8. D. E. Birch, L. Kolmodin, J. Wong, G. Zangenberg, M. Zoccoli, N. McKinney and K. Young, Nature, 1996, 381, 445-446. [0086] 9. D. J. Sharkey, E. R. Scalice, K. G. Christy, S. M. Atwood and J. L. Daiss, Nat. Biotechnol., 1994, 12, 506-509. [0087] 10. E. R. Scalice, D. J. Sharkey and J. L. Daiss, J. Immunol. Methods., 1994, 172, 147-163. [0088] 11. C. Dang and S. D. Jayasena, J. Mol. Biol., 1996, 264, 268-278. [0089] 12. Y. Lin and S. D. Jayasena, J. Mol. Biol., 1997, 271, 100-111. [0090] 13. V. Marx, Nat. Methods., 2015, 12, 393-397. [0091] 14. P. L. Lee, Mol. Ecol. Resour., 2017, 17, 138. [0092] 15. K. Hsieh, A. S. Patterson, B. S. Ferguson, K. W. Plaxco and H. T. Soh, Angew. Chem., Int. Ed., 2012, 51, 4896-4900. [0093] 16. J. Song, M. G. Mauk, B. A. Hackett, S. Cherry, H. H. Bau and C. Liu, Anal. Chem., 2016, 88, 7289-7294. [0094] 17. K. S. Park, C. Y. Lee and H. G. Park, Chem. Commun., 2015, 51, 9942-9945. [0095] 18. K. S. Park, C. Y. Lee and H. G. Park, Chem. Commun., 2016, 52, 4868-4871. [0096] 19. N. R. Ho, G. S. Lim, N. R. Sundah, D. Lim, T. P. Loh and H. Shao, Nat. Commun., 2018, 9, 1-11. [0097] 20. K. S. Park, C.-H. Huang, K. Lee, Y.-E. Yoo, C. M. Castro, R. Weissleder and H. Lee, Sci. Adv., 2016, 2, e1600300. [0098] 21. R. Saran and J. Liu, Inorg. Chem. Front., 2016, 3, 494-501. [0099] 22. R. R. Breaker and G. F. Joyce, Chem. Biol., 1994, 1, 223-229. [0100] 23. S. H. Eom, J. Wang and T. A. Steitz, Nature, 1996, 382, 278-281. [0101] 24. Y. Kim, S. H. Eom, J. Wang, D.-S. Lee, S. W. Suh and T. A. Steitz, Nature, 1995, 376, 612-616. [0102] 25. A. E. Calvert, B. J. Biggerstaff, N. A. Tanner, M. Lauterbach and R. S. Lanciotti, PloS one, 2017, 12, e0185340. [0103] 26. R. T. Noble and J. A. Fuhrman, Aquat. Microb. Ecol., 1998, 14, 113-118. [0104] 27. J. Cuzick, G. Terry, L. Ho, T. Hollingworth and M. Anderson, Lancet, 1992, 339, 959-960. [0105] 28. S. Jampasa, W. Siangproh, R. Laocharoensuk, P. Yanatatsaneejit, T. Vilaivan and O. Chailapakul, Sens. Actuators B Chem., 2018, 265, 514-521. [0106] 29. J. R. Espinosa, M. GalvAn, A. S. Quihones, J. L. Ayala, V. Avila and S. M. Dur6n, Molecules, 2021, 26, 3436. [0107] 30. M. Nagai, A. Yoshida and N. Sato, IUBMB Life, 1998, 44, 157-163. [0108] 31. K. Mullis, F. Faloona, S. Scharf, R. Saiki, G. Horn and H. Erlich, Cold Spring Harb. Symp. Quant. Biol., 1986, 263-273. [0109] 32. A. L. Wyllie, J. Fournier, A. Casanovas-Massana, M. Campbell, M. Tokuyama, P. Vijayakumar, J. L. Warren, B. Geng, M. C. Muenker and A. J. Moore, N. Engl. J. Med., 2020, 383, 1283-1286. [0110] 33. B. S. Ferguson, D. A. Hoggarth, D. Maliniak, K. Ploense, R. J. White, N. Woodward, K. Hsieh, A. J. Bonham, M. Eisenstein and T. E. Kippin, Sci. Transl. Med., 2013, 5, 213ra165-213ra165. [0111] 34. R. Nutiu and Y. Li, J. Am. Chem. Soc., 2003, 125, 4771-4778. [0112] 35. H. Qu, A. T. Csordas, J. Wang, S. S. Oh, M. S. Eisenstein and H. T. Soh, ACS Nano, 2016, 10, 7558-7565. [0113] 36. S. S. Oh, K. Plakos, X. Lou, Y. Xiao and H. T. Soh, Proc. Natl. Acad. Sci. U.S.A., 2010, 107, 14053-14058. [0114] 37. S. S. Oh, K. Plakos, Y. Xiao, M. Eisenstein and H. T. Soh, ACS Nano, 2013, 7, 9675-9683. [0115] 38. F. Y. Fong, S. S. Oh, C. J. Hawker and H. T. Soh, Angew. Chem., Int. Ed., 2016, 55, 15258-15262. [0116] 39. Y. Zhao, F. Chen, Q. Li, L. Wang and C. Fan, Chem. Rev., 2015, 115, 12491-12545. [0117] 40. J. Li and J. Macdonald, Biosens. Bioelectron., 2015, 64, 196-211. [0118] 41. Y. Mori, Y. Nakamura and S. Ohuchi, Biochem. Biophys. Res. Commun., 2012, 420, 440-443. [0119] 42. L. V. Gening, S. A. Klincheva, A. Reshetnjak, A. P. Grollman and H. Miller, Nucleic Acids Res., 2006, 34, 2579-2586. [0120] 43. S. Ohuchi, Y. Mori and Y. Nakamura, FEBS open bio, 2012, 2, 203-207.