METHODS FOR VARIANT DETECTION

20170145486 ยท 2017-05-25

    Inventors

    Cpc classification

    International classification

    Abstract

    The invention can be used to provide a more efficient and less error-prone method of detecting variants in DNA, such as SNPs and indels. The invention also provides a method for performing inexpensive multiplex assays.

    Claims

    1-9. (canceled)

    10: A method of detecting a variation in a target DNA sequence, the method comprising: (a) providing a reaction mixture comprising: (i) an oligonucleotide primer having a cleavage domain positioned 5 of a blocking group and 3 of a position of variation, the blocking group linked at or near the end of the 3-end of the oligonucleotide primer wherein the blocking group prevents primer extension and/or inhibits the primer from serving as a template for DNA synthesis, (ii) a sample nucleic acid that may or may not have the target sequence, and where the target sequence may or may not have the variation, (iii) a cleaving enzyme, and (iv) a polymerase; (b) hybridizing the primer to the target DNA sequence to form a double-stranded substrate; (c) cleaving the hybridized primer, if the primer is complementary at the variation, with the cleaving enzyme at a point within or adjacent to the cleavage domain to remove the blocking group from the primer; and (d) extending the primer with the polymerase.

    11: The method of claim 10, wherein the cleaving enzyme is a hot start cleaving enzyme that is thermostable and has reduced activity at lower temperatures.

    12: The method of claim 10, wherein the cleaving enzyme is a chemically modified hot start cleaving enzyme that is thermostable and has reduced activity at lower temperatures.

    13: The method of claim 12, wherein the hot start cleaving enzyme is a chemically modified Pyrococcus abyssi RNase H2.

    14: The method of claim 10, wherein the cleaving enzyme is a hot start cleaving enzyme that is reversibly inactivated through interaction with an antibody at lower temperatures.

    15: The method of claim 10, wherein the cleaving domain is comprised of at least one RNA base, and the cleaving enzyme cleaves between the position complementary to the variation and the RNA base.

    16: The method of claim 10, wherein the cleaving domain is comprised of one or more 2-modified nucleosides, and the cleaving enzyme cleaves between the position complementary to the variation and the one or more modified nucleosides.

    17: The method of claim 16, wherein the one or more modified nucleosides are 2-fluoronucleosides.

    18: The method of claim 10, wherein the polymerase is a high-discrimination polymerase.

    19: The method of claim 10, wherein the polymerase is a mutant H784Q Taq polymerase.

    20: The method of claim 19, wherein the mutant H784Q Taq polymerase is reversibly inactivated via chemical, aptamer, or antibody modification.

    21: The method of claim 10, wherein the primer contains a 5 tail sequence that comprises a universal primer sequence and optionally a universal probe sequence, wherein the tail is non-complementary to the target DNA sequence.

    22-53. (canceled)

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0008] FIG. 1 is a diagram showing two primer designs utilized in this invention. Part a) is a blocked-cleavable primer designed so that the SNP of interest is 5 of the RNA base when hybridized to a template. The RNase H2 cleaves, leaving a 3 interrogating base, which is determined to be either a match or a mismatch by the highly discriminative DNA polymerase. Thermal cycling allows for this process to continue. Part b) illustrates the RNase H2 cleavage and SNP detection are identical to a), but the primer also includes a 5 tail domain that includes a binding site for a probe and a universal forward primer. After 1-10 cycles of discrimination with the RNase H2 and the polymerase, the highly concentrated universal forward primer comes to dominate the amplification, degrading the probe when it amplifies. This cycle is repeated 25-50, generating the output signal. This primer design may be multiplexed, allowing for one-tube multi-color assay designs.

    [0009] FIGS. 2A and 2B are end-point fluorescence plots from the assay described in Example 1. FAM and HEX fluorescence values are plotted onto the X and Y axis. FIG. 2A is a Universal SNP assay for rs351855 performed with WT Taq polymerase. FIG. 2B is a Universal SNP assay for rs351855 performed with mutant H784Q Taq polymerase, demonstrating greatly enhanced discrimination between each of the allelic variants as observed by the greater separation of the clusters in the mutant Taq case. In both cases, the no template controls (NTCs) (squares) are near the (0,0) coordinates, as desired. Allele 1 samples are shown as circles, allele 2 samples as diamonds, and heterozygotes as triangles. Each reaction was performed in triplicate.

    [0010] FIGS. 3A and 3B are allelic discrimination plots with genotyping calls for rs4655751. The reaction plate was cycled immediately after reaction setup (A) or held at room temperature on the benchtop for 48 hours prior to cycling (B). Diamonds: no template controls (NTCs); squares: allele 1 samples; circles: allele 2 samples; triangles: heterozygotes. Genotypes are tightly clustered and have good angle separation, indicating excellent allelic specificity. Each sample was assigned the correct genotyping call, and no change in performance was observed over the 48 hour hold period.

    [0011] FIGS. 4A and 4B illustrate a side-by-side comparison of Allelic Discrimination Plots of gene CCR2, rs1799865 from a TaqMan based assay versus rhPCR. Diamonds: no template controls (NTCs); squares: allele 1 samples; circles: allele 2 samples; triangles: heterozygotes. The rhPCR Genotyping Assay (FIG. 4B) achieved higher fluorescence signal compared to a traditional 5-nuclease genotyping assay (FIG. 4A) while showing concordant results.

    [0012] FIGS. 5A and 5B are Allelic Discrimination plots of tri-allelic SNP, CYP2C8 (rs72558195), using an rhPCR genotyping single tube multiplex assay on the QuantStudio 7 Flex platform (Thermo Fisher). In FIG. 5A, diamonds: no template controls (NTCs); squares: allele G (allele 1) samples; circles: allele A (allele 2) samples; triangles: heterozygotes. In FIG. 5B, diamonds: no template controls (NTCs); squares: allele G (allele 1) samples; circles: allele C (allele 3) samples; triangles: heterozygotes.

    [0013] FIG. 6 shows the Tri-allelic Allelic Discrimination 360plot of CYP2C8 rs72558195, using rhPCR genotyping assay with 3 allele-specific primers multiplexed in a single reaction.

    [0014] FIG. 7 is an allelic discrimination plot illustrating the ability of the rhPCR assay to perform quantitative genotyping.

    [0015] FIGS. 8A and 8B illustrate genotyping results and detection of allelic copy number variation that is possible with the present invention. gDNA samples were tested using varying copy numbers and varying reference genotypes. In FIG. 8A, diamonds: no template controls (NTCs); squares: allele G samples; circles: allele C samples; and triangles: heterozygotes. The resulting data correlates with the test input.

    [0016] FIG. 9 is a schematic representation of multiplex rhPCR.

    [0017] FIG. 10 is the resulting tape station image indicating the effectiveness of the multiplex rhPCR methods in reducing primer dimers and increasing desired amplicon yield.

    [0018] FIG. 11 graphically represents the effectiveness of the rhPrimers in the percent of mapped reads and on-target reads.

    DETAILED DESCRIPTION OF THE INVENTION

    [0019] The invention pertains to a methods of single-nucleotide polymorphism (SNP) discrimination utilizing blocked-cleavable rhPCR primers (see U.S. Patent Application Publication No. US 2009/0325169 A1, incorporated by reference herein in its entirety) and a DNA polymerase with high levels of mismatch discrimination. In one embodiment, the mismatch is placed at a location other than opposite the RNA base. In these situations, the majority of the discrimination comes not from the RNase H2, but from the high discrimination polymerase. The use of blocked-cleavable primers with RNase H2 acts to reduce or eliminate primer-dimers and provide some increased amount of SNP or indel (insertion/deletion) discrimination (FIG. 1a).

    [0020] For the purposes of this invention, high discrimination is defined as any amount of discrimination over the average discrimination of WT Thermus aquaticus (Taq) polymerase. Examples include KlenTaq DNA polymerase (Wayne Barnes), and mutant polymerases described in U.S. Patent Application Publication No. US 2015/0191707 (incorporated by reference herein in its entirety) such as H784M, H784S, H784A and H784Q mutants.

    [0021] In a further embodiment a universal detection sequence(s) is added to the 5-end of the blocked-cleavable primers. The detection sequence includes a binding site for a probe, and a binding site for a universal amplification primer. The primer binding site is positioned at or near the 5-end of the final oligonucleotide and the probe binding site is positioned internally between the universal primer site and the SNP-detection primer domain. Use of more than one such chimeric probe in a detection reaction wherein distinct probe binding sites are employed allows primers to be multiplexed and further allows for multiple color detection of SNPs or other genomic features. Blocked-cleavable rhPCR primers reduce or eliminate primer-dimers. Primer-dimers are a major problem for use of universal primer designs in SNP detection assays, and that limits their utility (FIG. 1b). Combining a universal amplification/detection domain with a SNP primer domain in blocked-cleavable primer format overcomes this difficulty.

    [0022] Previously, the best preferred embodiment for rhPCR SNP discrimination employed blocked-cleavable primers having the mismatch (SNP site) positioned opposite the single RNA base (cleavage site). While this works for many SNP targets, there are base match/mismatch pairings where sufficient discrimination is not obtained for robust base calling. Moreover, due to the high level of differential SNP discrimination observed with rhPCR, end-point detection can be difficult, especially with heterozygous target DNAs. In the proposed method, the RNA base is identical in both discriminating primers, eliminating this issue.

    [0023] In one embodiment of the invention, the method involves the use of blocked-cleavable primers wherein the mismatch is placed 1-2 bases 5 of the RNA. In a further embodiment, the method involves the use of blocked-cleavable primers with three or more DNA bases 3 of an RNA residue, and the primers are designed such that the mismatch is placed immediately 5 of the RNA.

    [0024] Following cleavage by RNase H2, the remaining primer has a DNA residue positioned at the 3-end exactly at the SNP site, effectively creating an ASPCR primer. In this configuration, a high-specificity DNA polymerase can discriminate between match and mismatch with the template strand (FIGS. 1a and b). Native DNA polymerases, such as Taq DNA polymerase, will show some level of discrimination in this primer configuration, and if the level of discrimination achieved is not sufficient for robust SNP calling in a high throughput assay format then the use of polymerases with improved template discrimination can be used. In one embodiment, mutant DNA polymerases, such as those disclosed in U.S. Patent Application Publication No. US 2015/0191707 (incorporated by reference herein in its entirety) or any other polymerase designed or optimized to improve template discrimination can be used. When using polymerases with increased mismatch discrimination, the final level of match/mismatch discrimination achieved will be additive with contributions from both the ASPCR primer polymerase interaction and from the rhPCR primer/RNaseH2 interaction. Further, the use of blocked-cleavable primers reduces risk of primer-dimer formation, which produces false-positive signals, making the overall reaction more robust and having higher sensitivity and higher specificity. The relative contributions of each component of the assay may vary with use of different polymerases, different blocking groups on the 3-end of the primer and different RNase H2 enzymes.

    [0025] In another embodiment, the invention may utilize a tail domain added to the 5 end of the primer, containing a universal forward primer binding site sequence and optionally a universal probe sequence. This tail would not be complementary to the template of interest, and when a probe is used, the tail would allow for inexpensive fluorescent signal detection, which could be multiplexed to allow for multiple color signal detection in qPCR (FIG. 1b). In one embodiment, 1-10 cycles of initial cycling and discrimination occurs from both the RNase H2 and the DNA polymerase. After this initial pre-cycling, a highly concentrated and non-discriminatory universal forward primer comes to dominate the amplification, degrading the probe and generating the fluorescent signal when the DNA amplifies. This cycle is repeated 25-50, allowing for robust detection. This assay design is prone to issues with primer-dimers, and the presence of the blocked-cleavable domain in the primers will suppress or eliminate these issues.

    [0026] In another embodiment, a forward primer is optionally used with a reverse primer, and a tail domain is added to the 5 end of one or both of a forward and reverse primer set. The tail domain comprises a universal forward primer binding site. The primers can be used to hybridize and amplify a target such as a genomic sample of interest. The primers would add universal priming sites to the target, and further cycles of amplification can be performed using universal primers that contain adapter sequences that enable further processing of the sample, such as the addition of P5/P7 flow cell binding sites and associated index or barcoding sequences useful in adapters for next-generation sequencing (see FIG. 9). In a further embodiment a high fidelity polymerase is used, which will further lower the rate of base misincorporation into the extended product and increase the accuracy of the methods of the invention.

    [0027] In a further embodiment, the tailed primers detailed above could be used to detect editing events for genome editing technology. For example, CRISPR/Cas9 is a revolutionary strategy in genome editing that enables generation of targeted, double-stranded breaks (DSBs) in genomic DNA. Methods to achieve DSBs by CRISPR/Cas9which is a bacterial immune defense system comprised of an endonuclease that is targeted to double-stranded DNA by a guide RNAare being widely used in gene disruption, gene knockout, gene insertion, etc. In mammalian cells, the endonuclease activity is followed by an endogenous repair process that leads to some frequency of insertions/deletions/substitutions in wild-type DNA at the target locus which gives the resultant genome editing.

    [0028] RNase H-cleavable primers have been designed to flank edited loci in order to 1) generate locus-specific amplicons with universal tails, and 2) be subsequently amplified with indexed P5/P7 universal primers for next-generation sequencing. In pilot experiments, this strategy resulted in reliable, locus-specific amplification which captures CRISPR/Cas9 editing events in a high-throughput and reproducible manner. The key finding is that the overall targeted editing by this NGS-based method was determined to be 95%; whereas, previous enzymatic strategies suggested overall editing from the same samples was approximately 55% at the intended target site. Further, primers were designed to amplify off-target locations of genomic editing based on in silico predictions by internal bioinformatics tools.

    [0029] These assays would be pooled for amplification of a single genomic DNA sample in order to capture the on-target as well as >100 potential sites for off-target genome editing mediated by sequence homology to the guide RNA. The results from this experiment would allow for 1) identification of CRISPR/Cas9 off-target sites and provide an assay for comparing strategies to reduce those effects, 2) improved design of the CRISPR/Cas9 off-target prediction algorithm, and 3) improved design of primer sets.

    [0030] As noted in U.S. Patent Application Publication No. US 2009/0325169 (incorporated by reference herein in its entirety), RNase H2 can cleave at positions containing one or more RNA bases, at 2-modified nucleosides such as 2-fluoronucleosides. The primers can also contain nuclease resistant linkages such as phosphorothioate, phosphorodithioate, or methylphosphonate.

    [0031] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. In case of conflict, the present document, including definitions, will control. Preferred methods and materials are described below, although methods and materials similar or equivalent to those described herein can be used in practice or testing of the present invention.

    [0032] Complement or complementary as used herein means a nucleic acid, and can mean Watson-Crick (e.g., A-T/U and C-G) or Hoogsteen base pairing between nucleotides or nucleotide analogs of nucleic acid molecules.

    [0033] Fluorophore or fluorescent label refers to compounds with a fluorescent emission maximum between about 350 and 900 nm.

    [0034] Hybridization as used herein, refers to the formation of a duplex structure by two single-stranded nucleic acids due to complementary base pairing. Hybridization can occur between fully complementary nucleic acid strands or between substantially complementary nucleic acid strands that contain minor regions of mismatch. Identical sequences refers to sequences of the exact same sequence or sequences similar enough to act in the same manner for the purpose of signal generation or hybridizing to complementary nucleic acid sequences. Primer dimers refers to the hybridization of two oligonucleotide primers. Stringent hybridization conditions as used herein means conditions under which hybridization of fully complementary nucleic acid strands is strongly preferred. Under stringent hybridization conditions, a first nucleic acid sequence (for example, a primer) will hybridize to a second nucleic acid sequence (for example, a target sequence), such as in a complex mixture of nucleic acids. Stringent conditions are sequence-dependent and will be different in different circumstances. Stringent conditions can be selected to be about 5-10 C. lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength pH. The Tm can be the temperature (under defined ionic strength, pH, and nucleic concentration) at which 50% of an oligonucleotide complementary to a target hybridize to the target sequence at equilibrium (as the target sequences are present in excess, at Tm, 50% of the probes are occupied at equilibrium). Stringent conditions can be those in which the salt concentration is less than about 1.0 M sodium ion, such as about 0.01-1.0 M sodium ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30 C. for short probes (e.g., about 10-50 nucleotides) and at least about 60 C. for long probes (e.g., greater than about 50 nucleotides). Stringent conditions can also be achieved with the addition of destabilizing agents such as formamide. For selective or specific hybridization, a positive signal can be at least 2 to 10 times background hybridization. Exemplary stringent hybridization conditions include the following: 50% formamide, 5SSC, and 1% SDS, incubating at 42 C., or, 5SSC, 1% SDS, incubating at 65 C., with wash in 0.2SSC, and 0.1% SDS at 65 C.

    [0035] The terms nucleic acid, oligonucleotide, or polynucleotide, as used herein, refer to at least two nucleotides covalently linked together. The depiction of a single strand also defines the sequence of the complementary strand. Thus, a nucleic acid also encompasses the complementary strand of a depicted single strand. Many variants of a nucleic acid can be used for the same purpose as a given nucleic acid. Thus, a nucleic acid also encompasses substantially identical nucleic acids and complements thereof. A single strand provides a probe that can hybridize to a target sequence under stringent hybridization conditions. Thus, a nucleic acid also encompasses a probe that hybridizes under stringent hybridization conditions.

    [0036] Nucleic acids can be single stranded or double stranded, or can contain portions of both double stranded and single stranded sequences. The nucleic acid can be DNA, both genomic and cDNA, RNA, or a hybrid, where the nucleic acid can contain combinations of deoxyribo- and ribonucleotides, and combinations of bases including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine hypoxanthine, isocytosine and isoguanine. Nucleic acids can be obtained by chemical synthesis methods or by recombinant methods. A particular nucleic acid sequence can encompass conservatively modified variants thereof (e.g., codon substitutions), alleles, orthologs, single nucleotide polymorphisms (SNPs), and complementary sequences as well as the sequence explicitly indicated.

    [0037] Polymerase Chain Reaction (PCR) refers to the enzymatic reaction in which DNA fragments are synthesized and amplified from a substrate DNA in vitro. The reaction typically involves the use of two synthetic oligonucleotide primers, which are complementary to nucleotide sequences in the substrate DNA which are separated by a short distance of a few hundred to a few thousand base pairs, and the use of a thermostable DNA polymerase. The chain reaction consists of a series of 10 to 40 cycles. In each cycle, the substrate DNA is first denatured at high temperature. After cooling down, synthetic primers which are present in vast excess, hybridize to the substrate DNA to form double-stranded structures along complementary nucleotide sequences. The primer-substrate DNA complexes will then serve as initiation sites for a DNA synthesis reaction catalyzed by a DNA polymerase, resulting in the synthesis of a new DNA strand complementary to the substrate DNA strand. The synthesis process is repeated with each additional cycle, creating an amplified product of the substrate DNA.

    [0038] Primer, as used herein, refers to an oligonucleotide capable of acting as a point of initiation for DNA synthesis under suitable conditions. Suitable conditions include those in which hybridization of the oligonucleotide to a template nucleic acid occurs, and synthesis or amplification of the target sequence occurs, in the presence of four different nucleoside triphosphates and an agent for extension (e.g., a DNA polymerase) in an appropriate buffer and at a suitable temperature.

    [0039] Probe and fluorescent generation probe are synonymous and refer to either a) a sequence-specific oligonucleotide having an attached fluorophore and/or a quencher, and optionally a minor groove binder or b) a DNA binding reagent, such as, but not limited to, SYBR Green dye.

    [0040] Quencher refers to a molecule or part of a compound, which is capable of reducing the emission from a fluorescent donor when attached to or in proximity to the donor. Quenching may occur by any of several mechanisms including fluorescence resonance energy transfer, photo-induced electron transfer, paramagnetic enhancement of intersystem crossing, Dexter exchange coupling, and exciton coupling such as the formation of dark complexes.

    [0041] The term RNase H PCR (rhPCR) refers to a PCR reaction which utilizes blocked oligonucleotide primers and an RNase H enzyme. Blocked primers contain at least one chemical moiety (such as, but not limited to, a ribonucleic acid residue) bound to the primer or other oligonucleotide, such that hybridization of the blocked primer to the template nucleic acid occurs, without amplification of the nucleic acid by the DNA polymerase. Once the blocked primer hybridizes to the template or target nucleic acid, the chemical moiety is removed by cleavage by an RNase H enzyme, which is activated at a high temperature (e.g., 50 C. or greater). Following RNase H cleavage, amplification of the target DNA can occur.

    [0042] In one embodiment, the 3 end of a blocked primer can comprise the moiety rDDDDMx, wherein relative to the target nucleic acid sequence, r is an RNA residue, D is a complementary DNA residue, M is a mismatched DNA residue, and x is a C3 spacer. A C3 spacer is a short 3-carbon chain attached to the terminal 3 hydroxyl group of the oligonucleotide, which further inhibits the DNA polymerase from binding before cleavage of the RNA residue.

    [0043] The methods described herein can be performed using any suitable RNase H enzyme that is derived or obtained from any organism. Typically, RNase H-dependent PCR reactions are performed using an RNase H enzyme obtained or derived from the hyperthermophilic archaeon Pyrococcus abyssi (P.a.), such as RNase H2. Thus, in one embodiment, the RNase H enzyme employed in the methods described herein desirably is obtained or derived from Pyrococcus abyssi, preferably an RNase H2 obtained or derived from Pyrococcus abyssi. In other embodiments, the RNase H enzyme employed in the methods described herein can be obtained or derived from other species, for example, Pyrococcus furiosis, Pyrococcus horikoshii, Thermococcus kodakarensis, or Thermococcus litoralis.

    [0044] The following examples further illustrate the invention but should not be construed as in any way limiting its scope.

    Example 1

    [0045] This example demonstrates an enhanced rhPCR assay that utilizes a highly discriminatory DNA polymerase and RNase H2 for discrimination

    [0046] To demonstrate the utility of these new assay designs, rhPrimers and standard allele-specific primers were designed against rs113488022, the V600E mutation in the human BRAF gene. These primers were tested in PCR and rhPCR with WT or H784Q mutant Taq polymerase. Primers utilized in these assays were as shown in Table 1 (SEQ ID NOs: 1-7).

    TABLE-US-00001 TABLE1 Sequenceofoligonucleotidesemployed inSNPdiscriminationassaydescribedin Example1. Name Sequence SEQIDNO. Forwardnon- GCTGTGATTTTGGT SEQIDNO.1 discriminating CTAGCTACAG primer ForwardAllele GCTGTGATTTTGGT SEQIDNO.2 1ASP1ASPCR CTAGCTACAGT primer ForwardAllele GCTGTGATTTTGGT SEQIDNO.3 2ASP2ASPCR CTAGCTACAGA primer Probe FAM-TCCCATCAG- SEQIDNO.4 ZEN-TTTGAACAGT TGTCTGGA-IBFQ rs113488022 GCTGTGATTTTGGT SEQIDNO.5 Allele1 CTAGCTACAGTgAA ForwardASP1 ATG-x rhPrimer rs113488022 GCTGTGATTTTGGT SEQIDNO.6 Allele2 CTAGCTACAGAgAA ForwardASP2 ATG-x rhPrimer Reverse GCCCTCAATTCTTA SEQIDNO.7 rhPrimer CCATCCACAAAaTG GAA-x Nucleic acid sequences are shown 5-3. DNA is uppercase, RNA is lowercase. Location of potential mismatch is underlined. ZEN = internal ZEN quencher (IDT, Coralville, IA), FAM = 6-carboxyfluorescein, IBFQ = Iowa Black FQ (fluorescence quencher, IDT, Coralville, IA), and x = C3 propanediol spacer block

    [0047] 10 L reaction volumes were used in these assays. To perform the reaction, 5 L of 2 Integrated DNA Technologies (IDT) (Coralville, Iowa) rhPCR genotyping master mix (containing dNTPs, H784Q mutant or WT Taq DNA polymerase, stabilizers, and MgCl.sub.2) was combined with 200 nM (2 pmol) of either of the allelic primers. 200 nM (2 pmol) of the probe, as well as 200 nM (5 pmol) of the reverse primer were also added. Additionally, 2.5 mU (5.25 fmol/0.53 nM) of P.a. RNase H2 and 1000 copies of synthetic gBlock (Integrated DNA Technologies, Coralville, Iowa) template (1000 copies Allele 1, 500 copies allele 1+500 copies allele 2 (heterozygote), or 1000 copies Allele 2 (for gBlock sequences, see Table 2, SEQ ID NOs: 8-9) were added to the reaction mix. The reaction was thermocycled on a Bio-Rad CFX384 Real-time system. Cycling conditions were as follows: 953:00(950:10650:30)65 cycles. Each reaction was performed in triplicate.

    TABLE-US-00002 TABLE2 SyntheticgBlocktemplates forExample1assay Name Sequence SEQIDNO. rs113488022 AAAAAATAAGAACACTGATTTTT SEQIDNO.8 gBlock GTGAATACTGGGAACTATGAAAA Template1 TACTATAGTTGAGACCTTCAATG ACTTTCTAGTAACTCAGCAGCAT CTCAGGGCCAAAAATTTAATCAG TGGAAAAATAGCCTCAATTCTTA CCATCCACAAAATGGATCCAGAC AACTGTTCAAACTGATGGGACCC ACTCCATCGAGATTTCACTGTAG CTAGACCAAAATCACCTATTTTT ACTGTGAGGTCTTCATGAAGAAA TATATCTGAGGTGTAGTAAGTAA AGGAAAACAGTAGATCTCATTTT CCTATCAGAGCAAGCATTATGAA GAGTTTAGGTAAGAGATCTAATT TCTATAATTCTGTAATATAATAT TCTTTAAAACATAGTACTTCATC TTTCCTCTTA rs113488022 AAAAAATAAGAACACTGATTTTT SEQIDNO.9 gBlock GTGAATACTGGGAACTATGAAAA Template2 TACTATAGTTGAGACCTTCAATG ACTTTCTAGTAACTCAGCAGCAT CTCAGGGCCAAAAATTTAATCAG TGGAAAAATAGCCTCAATTCTTA CCATCCACAAAATGGATCCAGAC AACTGTTCAAACTGATGGGACCC ACTCCATCGAGATTTCTCTGTAG CTAGACCAAAATCACCTATTTTT ACTGTGAGGTCTTCATGAAGAAA TATATCTGAGGTGTAGTAAGTAA AGGAAAACAGTAGATCTCATTTT CCTATCAGAGCAAGCATTATGAA GAGTTTAGGTAAGAGATCTAATT TCTATAATTCTGTAATATAATAT TCTTTAAAACATAGTACTTCATC TTTCCTCTTA Nucleic acid sequences are shown 5-3. Location of SNPs are shown bold and underlined.

    [0048] Cq Results of the experiment are shown in Table 3. This data shows that the mismatch discrimination of the assay system increases with rhPCR over ASPCR with WT Taq polymerase, and that the discrimination is enhanced by the use of the H784Q Taq polymerase.

    TABLE-US-00003 TABLE 3 Resulting Cq values WT Taq H784Q Allele 1 Het Allele 2 NTC Allele 1 Het Allele 2 NTC Non discrmin 29.3 29.3 29.4 >65 30.6 30.6 30.8 >65 ASP1 ASPCR 30.2 30.2 31.4 >65 29.2 32.5 40.3 >65 ASP2 ASPCR 36.7 30.5 29.4 >65 44.2 31.7 30.8 >65 ASP1 rhPCR 30.9 32.1 38.2 >65 31.9 31.4 49.2 >65 ASP2 rhPCR 39.3 31.0 30.8 >65 43.4 33.9 32.5 >65 All numbers in this table represent Cq values obtained from the CFX384 instrument (Bio-Rad, Hercules, CA).

    Example 2

    [0049] The following example demonstrates an enhanced rhPCR assay that utilizes a highly discriminatory DNA polymerase and RNase H2 for discrimination.

    [0050] In order to demonstrate that this new assay design could function, rhPrimers and standard allele-specific primers were designed against rs113488022, the V600E mutation in the human BRAF gene. These primers were tested in PCR and rhPCR with H784Q mutant Taq polymerase. Primers utilized in these assays were as shown in Table 4 (SEQ ID NOs: 1, 4 and 10-12).

    TABLE-US-00004 TABLE4 Sequenceofoligonucleotidesemployed inSNPdiscriminationassaydescribedin Example2 Name Sequence SEQIDNO. Forwardnon- GCTGTGATTTTGGT SEQIDNO.1 discrimin CTAGCTACAG primer Probe FAM-TCCCATCAG- SEQIDNO.4 ZEN-TTTGAACAGT TGTCTGGA-IBFQ rs113488022 GCTGTGATTTTGGT SEQIDNO.10 Allele1Forward CTAGCTACAGTgAx dxxdrhPrimer xTG rs113488022 GCTGTGATTTTGGT SEQIDNO.11 Allele2Forward CTAGCTACAGAgAx dxxdrhPrimer xTG ReverserhPrimer GCCCTCAATTCTTA SEQIDNO.12 CCATCCACAAAaTG GAA-x Nucleic acid sequences are shown 5-3. DNA is uppercase, RNA is lowercase. Location of potential mismatch is underlined. ZEN = internal Zen fluorescent quencher (IDT, Coralville, IA). FAM = 6-carboxyfluorescein, IBFQ = Iowa Black FQ (fluorescence quencher), and x = C3 propanediol spacer.

    [0051] 10 L reaction volumes were used in these assays. To perform the reaction, 5 L of 2 Integrated DNA Technologies (IDT) (Coralville, Iowa) rhPCR genotyping master mix (containing dNTPs, H784Q mutant DNA polymerase, stabilizers, and MgCl.sub.2) was combined with 200 nM (2 pmol) of either of the allelic primers. 200 nM (2 pmol) of the probe, as well as 200 nM (5 pmol) of the reverse primer were also added. Additionally, 7.5 mU (15.75 fmol/1.58 nM), 50 mU (105 fmol/10.5 nM) or 200 mU (420 fmol/42 nM) of P.a. RNase H2 and 5e4 copies of synthetic gBlock (Integrated DNA Technologies, Coralville, Iowa) template (1e5 copies Allele 1, 5e4 copies allele 1+5e4 copies allele 2 (heterozygote), or 1e5 copies Allele 2 (for gBlock sequences, see Table 2, SEQ ID NOs: 8-9) were added to the reaction mix. The reaction was thermocycled on a Bio-Rad CFX384 Real-time system. Cycling conditions were as follows: 95.sup.3:00(95.sup.0:1065.sup.0:30)65 cycles. Each reaction was performed in triplicate.

    [0052] Cq Results of the experiment are shown in Table 5. This data shows that the mismatch discrimination of the assay system increases with rhPCR over ASPCR with WT Taq polymerase, and that the discrimination is enhanced by the use of the H784Q Taq polymerase.

    TABLE-US-00005 TABLE 5 Resulting Cq values Averages Allele 1 Het Allele 2 NTC Cq Unblocked 7.5 mU 21.9 22.3 22.1 >75 50 mU 22.7 22.5 22.7 >75 200 mU 21.8 21.8 21.9 >75 AgAxxTG 7.5 mU 43.7 25.6 24.6 >75 19.1 50 mU 50.3 24.5 23.5 >75 26.8 200 mU 48.5 25.2 24.1 >75 24.4 TgAxxTG 7.5 mU 25.1 26.3 42.5 >75 17.4 50 mU 24.2 25.4 41.0 >75 16.9 200 mU 22.9 23.8 37.2 >75 14.3 All numbers in this table represent Cq values obtained from the CFX384 instrument (Bio-Rad, Hercules, CA).

    [0053] The delta Cq values were significantly higher than the ones obtained with the Gen 1 versions of these primers, indicating that there is an advantage to this primer design, as seen before in rhPCR.

    Example 3

    [0054] The following example illustrates the heightened reliability of universal assays using a DNA polymerase with a high mismatch discrimination.

    [0055] To demonstrate that the disclosed assays can function in a universal format and that they are significantly improved with a polymerase with high mismatch discrimination, universal assay primers were designed against rs351855, the G338R mutation in the human FGFR4 gene. This universal assay design has numerous advantages, including the ability to multiplex the allele-specific rhPrimers and obtain multiple-color readouts. Primers utilized in this assay were as shown in Table 6 (SEQ ID NOs: 13-18).

    TABLE-US-00006 TABLE6 Sequencesofoligonucleotidesemployed inuniversal SNPdiscriminationassay Name Sequence SEQIDNO. Universal CGCCGCGTATAGTCCCGCGTAAA SEQIDNO.13 Forward primer Probe1 FAM-C+CATC+A+C+CGTG+ SEQIDNO.14 (FAM) CT-IBFQ Probe2 HEX-CAATC+C+C+CGAG+ SEQIDNO.15 (HEX) CT-IBFQ rs351855 GCCCATGTCCCAGCGAACCA SEQIDNO.16 Allele1 TCACCGTGCTAGCCCTCGAT Forward ACAGCCCgGCCAC-x primer rs351855 GCCCATGTCCCAGCGAACAA SEQIDNO.17 Allele2 TCCCCGAGCTGCCCTCGATA Forward CAGCCTgGCCAC-x primer Reverse GCGGCCAGGTATACGGACAT SEQIDNO.18 primer cATCCA-x Nucleic acid sequences are shown 5-3. DNA is uppercase, RNA is lowercase. Location of potential mismatch is underlined. LNA residues are designated with a carboxyfluorescein, HEX = 6-carboxy-2,4,4,5,7,7-hexachlorofluorescein, IBFQ = Iowa Black FQ (fluorescence quencher), and x = C3 propanediol spacer block.

    [0056] 10 L reaction volumes were used in these assays. To perform the reaction, 5 L of 2 Integrated DNA Technologies (IDT) (Coralville, Iowa) rhPCR genotyping master mix (containing dNTPs, mutant or WT Taq DNA polymerase, stabilizers, and MgCl.sub.2) was combined with 50 nM (500 fmol) of each of the two allelic primers. 250 nM (2.5 pmol) of each of the two probes, as well as 500 nM (5 pmol) of the Universal Forward primer and 500 nM (5 pmol) of the reverse primer were also added. Additionally, 2.5 mU (5.25 fmol/0.53 nM) of P.a. RNase H2 and 1000 copies of synthetic gBlock (Integrated DNA Technologies, Coralville, Iowa) template (1000 copies Allele 1, 500 copies allele 1+500 copies allele 2 (heterozygote), or 1000 copies Allele 2 (for gBlock sequences, see Table 7, SEQ ID NOs: 19-20) were added to the reaction mix. The reaction was thermocycled on a Bio-Rad CFX384 Real-time system. Cycling conditions were as follows: 95.sup.3:00(95.sup.0:1060.sup.0:30)3 cycles(95.sup.0:1065.sup.0:30)65 cycles. Each reaction was performed in triplicate. Fluorescence reads were taken after a total of 50 cycles were completed. Fluorescence values were plotted on the FAM and HEX axis, and results are shown in FIGS. 2a and 2b.

    TABLE-US-00007 TABLE7 SyntheticgBlocktemplatesforExample3 Name Sequence SEQIDNO. rs351855 GTTGGGAGCTGGGAGGGACTGAG SEQIDNO.19 gBlock TTAGGGTGCACGGGGCGGCCAGT Template1 CTCACCACTGACCAGTTTGTCTG TCTGTGTGTGTCCATGTGCGAGG GCAGAGGAGGACCCCACATGGAC CGCAGCAGCGCCCGAGGCCAGGT ATACGGACATCATCCTGTACGCG TCGGGCTCCCTGGCCTTGGCTGT GCTCCTGCTGCTGGCCGGGCTGT ATCGAGGGCAGGCGCTCCACGGC CGGCACCCCCGCCCGCCCGCCAC TGTGCAGAAGCTCTCCCGCTTCC CTCTGGCCCGACAGGTACTGGGC GCATCCCCCACCTCACATGTGAC AGCCTGACTCCAGCAGGCAGAAC CAAGTCTCCCACTTTGCAGTTCT CCCTGGAGTCAGGCTCTTCCGGC AAGTCAAGCT rs351855 GTTGGGAGCTGGGAGGGACTGAG SEQIDNO.20 gBlock TTAGGGTGCACGGGGCGGCCAGT Template2 CTCACCACTGACCAGTTTGTCTG TCTGTGTGTGTCCATGTGCGAGG GCAGAGGAGGACCCCACATGGAC CGCAGCAGCGCCCGAGGCCAGGT ATACGGACATCATCCTGTACGCG TCGGGCTCCCTGGCCTTGGCTGT GCTCCTGCTGCTGGCCAGGCTGT ATCGAGGGCAGGCGCTCCACGGC CGGCACCCCCGCCCGCCCGCCAC TGTGCAGAAGCTCTCCCGCTTCC CTCTGGCCCGACAGGTACTGGGC GCATCCCCCACCTCACATGTGAC AGCCTGACTCCAGCAGGCAGAAC CAAGTCTCCCACTTTGCAGTTCT CCCTGGAGTCAGGCTCTTCCGGC AAGTCAAGCT Nucleic acid sequences are shown 5-3. Location of SNPs are shown bold and underlined.

    [0057] The results illustrate that the mismatch discrimination between homozygotes is sufficient with both polymerases, although the resulting data using the WT Taq demonstrate that it is more difficult to make an allelic call. Importantly, however, the WT Taq polymerase cannot efficiently discriminate heterozygotes from homozygotes, and places them too close to the allele 1 and 2 signals (FIG. 2a). In contrast, the signal from the heterozygotes in the assays utilizing the mutant Taq polymerase are easily distinguishable from the homozygotes (FIG. 2b).

    [0058] The importance of the mutant Taq can be further understood when examining the Cq values from this example (Table 8). The data show that not only does the H784Q Taq mutant increase mismatch discrimination dramatically, but the Cqs of the NTCs decrease from the low-to-mid 50s, to greater than the number tested in the assay (>65). From this experiment, it is shown that allele identity can be determined from Cq values as well as end-point fluorescence.

    TABLE-US-00008 TABLE 8 Cq and delta Cq data for the experiment described in Example 3 WT Taq H784Q Template FAM HEX Delta Cq FAM HEX Delta Cq Allele 1 32.9 31.3 1.6 37.5 56.8 19.3 Allele 1 31.9 31.1 0.8 36.2 51.4 15.2 Allele 1 31.8 31.0 0.9 36.6 54.3 17.8 Heterozygote 33.0 29.4 3.5 38.7 37.8 0.9 Heterozygote 32.8 29.7 3.1 38.7 38.2 0.5 Heterozygote 33.2 30.0 3.3 39.9 39.1 0.8 Allele 2 35.1 29.1 6.0 50.6 36.5 14.1 Allele 2 34.7 29.3 5.4 52.1 36.6 15.5 Allele 2 34.5 29.0 5.5 50.7 36.1 14.6 NTC 51.8 56.1 >65 >65 NTC 52.8 56.1 >65 >65 NTC 52.1 50.7 >65 >65 All numbers in this table represent Cq and delta Cq values values obtained from the CFX384 instrument (Bio-Rad, Hercules, CA).

    Example 4

    [0059] The following example illustrates the detection of rare allelic variants with the assay designs of the present invention. To demonstrate the utility of these new assay designs to detect rare allelic variants, previously described second generation rhPrimers (rdxxdm) were utilized against rs113488022, the V600E mutation in the human BRAF gene (see Table 4; SEQ ID NOs: 1, 4 and 10-12).

    [0060] 10 L reaction volumes were used in these assays. To perform the reaction, 5 L of 2 Integrated DNA Technologies (IDT) (Coralville, Iowa) rhPCR genotyping master mix (containing dNTPs, H784Q mutant or WT Taq DNA polymerase, stabilizers, and MgCl.sub.2) was combined with 200 nM (2 pmol) of either of the allelic primers, or the non-discriminatory forward primer. 200 nM (2 pmol) of the probe, as well as 200 nM (5 pmol) of the reverse primer were also added. Additionally, 50 mU (105 fmol/10.5 nM) of P.a. RNase H2 and 50,000 copies of synthetic gBlock (Integrated DNA Technologies, Coralville, Iowa) match template, was combined with either 0, 50, or 500 copies of the opposite allele (for gBlock sequences, see Table 6, SEQ ID NOs: 16-17) were added to the reaction mix. The reaction was thermocycled on a Bio-Rad CFX384 Real-time system. Cycling conditions were as follows: 95.sup.3:00(95.sup.0:1060.sup.0:30)65 cycles. Each reaction was performed in triplicate.

    [0061] Data for the WT polymerase is shown in Table 9, and for the H784Q mutant Taq polymerase in Table 10. One of the advantages of this system for rare allele detection over conventional rhPCR is the ability to utilize a single amount of RNase H2 for both alleles. This advantage halves the potential requirement for determining the enzyme amount required for cleavage.

    TABLE-US-00009 TABLE 9 Average Cq and delta Cq values for the rare allele experiment with the WT Taq polymerase described in Example 4. Back-ground 50,000 50,000 50,000 0 0 0 Target 500 50 0 500 50 0 SEQ Non-discrimin 22.9 23.1 22.8 30.4 34.2 >65 ID No. 1 SEQ . . . TgAxxTG 31.6 34.5 36.1 31.6 36.0 >65 ID NO. 10 SEQ . . . AgAxxTG 29.1 29.1 29.9 30.8 34.4 >65 ID NO. 11 All numbers in this table represent Cq and delta Cq values values obtained from the CFX384 instrument (Bio-Rad, Hercules, CA). DNA is uppercase, RNA is lowercase. Location of potential mismatch is underlined. x = internal C3 propanediol spacer block.

    TABLE-US-00010 TABLE 10 Average Cq and delta Cq values for the rare allele experiment with the H784Q mutant Taq polymerase described in Example 4. Back-ground 50,000 50,000 50,000 0 0 0 Target 500 50 0 500 50 0 SEQ Non-discrimin 22.7 23.2 23.2 31.5 34.2 >65 ID No. 1 SEQ . . . TgAxxTG 33.8 36.6 47.3 33.1 36.4 >65 ID NO. 10 SEQ . . . AgAxxTG 32.1 35.2 38.8 32.0 35.5 >65 ID NO. 11 All numbers in this table represent Cq and delta Cq values obtained from the CFX384 instrument (Bio-Rad, Hercules, CA). DNA is uppercase, RNA is lowercase. Location of potential mismatch is underlined. x = internal C3 propanediol spacer block.

    [0062] The data clearly shows that the H784Q DNA polymerase allows for detection of 50 copies of target in a 50,000 copies of background DNA (a 1:1000 discrimination level) for the mutant A allele of rs113488022, with a delta Cq of over 11 cycles. While only slightly more than 3 cycles was observed for the T allele in this assay, this was a significant improvement over the WT Taq polymerase, which did not show any discrimination for the T allele, and only a delta of 3 cycles for the A allele.

    Example 5

    [0063] This example demonstrates successful allelic discrimination with the use of a universal rhPCR genotyping assay and Integrated DNA Technologies (IDT) (Coralville, Iowa) rhPCR genotyping master mix, and the robust stability of the reaction components. To demonstrate the robust nature of the assay design and mixture components, universal primers were designed against rs4657751, a SNP located on the human Chromosome 1 (See Table 11, SEQ ID NOs: 14, 21-25).

    [0064] Identical universal rhPCR genotyping reactions were set up in two white Hard-Shell 384-well skirted PCR plates (Bio-Rad, Hercules, Calif.) on the Bio-Rad CFX384 Touch Real-Time PCR Detection System with 10 L final volume. Each well contained the rhPCR assay primers (150 nM of rs4657751 Allele Specific Primer 1 (SEQ ID NO: 23), 150 nM of rs4657751 Allele Specific Primer 2 (SEQ ID NO: 24), and 500 nM rs4657751 Locus Specific Primer (SEQ ID NO: 25). Reactions contained universal reporter oligos at the following concentrations: 250 nM of universal FAM probe (SEQ ID NO: 14), 450 nM of universal Yakima Yellow (SEQ ID NO: 22) probe, and 1000 nM of universal forward primer (SEQ ID NO: 21), and 5 L of 2 Integrated DNA Technologies (IDT) (Coralville, Iowa) rhPCR genotyping master mix (containing dNTPs, a mutant H784Q Taq polymerase (see Behlke, et al. U.S. 2015/0191707), chemically modified Pyrococcus abyssi RNase H2 (See Walder et al. UA20130288245A1), stabilizers, and MgCl.sub.2).

    [0065] gBlocks Gene Fragments (Integrated DNA Technologies, Inc., Coralville, Iowa) containing either allele of the rs4657751 SNP were utilized as the source of template DNA (See Table 12, SEQ ID NOs: 26 and 27). Each well contained template representing one of three possible genotypes: allele 1 homozygote (1000 copies rs4657751 Allele 1 gBlock template (SEQ ID NO: 26)), allele 2 homozygote (1000 copies rs4657751 Allele 2 gBlock template (SEQ ID NO: 27)), or heterozygote (mix of 500 copies of rs4657751 Allele 1 gBlock template (SEQ ID NO: 26) and 500 copies of rs4657751 Allele 2 gBlock template (SEQ ID NO: 27)). Template or water for the no template control (NTC) reactions were added into three replicate wells of two individual plates. The reactions underwent the following cycling protocol: 95 C. for 10 minutes, then 45 cycles of 95 C. for 10 seconds and 60 C. for 45 seconds.

    TABLE-US-00011 TABLE11 SequencesofoligonucleotidesusedinExample5 Name Sequence SEQIDNO. Universal CGGCCCATGTCCCAGCGAA SEQIDNO.21 Forward primer Probe1 FAM-C+CATC+A+C+CGTG+CT-IBFQ SEQIDNO.14 (FAM) Probe2 Yak-CAATC+C+C+CGAG+CT-IBFQ SEQIDNO.22 (Yakima Yellow) rs4657751 GCCCATGTCCCAGCGAACCATCACCGT SEQIDNO.23 Allele1 GCTACTTCCCACACCCTCATATCuTGT Forward TA-x primer rs4657751 GCCCATGTCCCAGCGAACAATCCCCGA SEQIDNO.24 Allele2 GCTCTTACTTCCCACACCCTCATATAu Forward TGTTA-x primer rs4657751 GCGCTAAGTAAACATTCCTGATTGCAa SEQIDNO.25 Reverse CTTAT-x primer Nucleic acid sequences are shown 5-3. DNA is uppercase, RNA is lowercase. Location of potential mismatch is underlined. LNA residues are designated with a carboxyfluorescein, Yak = Yakima Yellow (3-(5,6,4,7-tetrachloro-5-methyl-3,6-dipivaloylfluorescein-2-yl)), IBFQ = Iowa Black FQ (fluorescence quencher), and x = C3 propanediol spacer block.

    TABLE-US-00012 TABLE12 SyntheticgBlock templatesusedinExample5. Name Sequence SEQIDNO. rs4657751 GATTTTTTTTTTTTGGCATTTCT SEQIDNO.26 Allele1 TCTTAGATTTCTATCTCCTAACA gBlock TAGGATCACTTATTTGTGAAATT template ATTTGTATACCTTTTTTATGGAG TGATGATGTGATACAAATTCTAT CCTTAAGGATATAAGAACATCTT TTCTTTATATTAGGATTTTTCTG GACCCATGAGTTACATGCTTACT TCCCACACCCTCATATCTTGTTT AAATTTGTAGAATTAAATTCATA GGTAATTATTTCTGAAACTTCTT CCCTGTGTGAGCAATCTAAATAA TTATTACAATGCCTTAAGTTGCA ATCAGGAATGTTTACTTAGCACA GACTTTTTTCCCCACTACTGCAC TCAAAGGATAACAGATATATGGC AAATCTAACCATATTCTTTGTCC TTTGTCCATGTTGCGGAGGGAAG CTCATCAGTGGGGCCACGAGCTG AGTGCGTCCTGTCACTCCACTCC CATGTCCCTTGGGAAGGTCTGAG ACTAGGG rs4657751 GATTTTTTTTTTTTGGCATTTCT SEQIDNO.27 Allele2 TCTTAGATTTCTATCTCCTAACA gBlock TAGGATCACTTATTTGTGAAATT template ATTTGTATACCTTTTTTATGGAG TGATGATGTGATACAAATTCTAT CCTTAAGGATATAAGAACATCTT TTCTTTATATTAGGATTTTTCTG GACCCATGAGTTACATGCTTACT TCCCACACCCTCATATATTGTTT AAATTTGTAGAATTAAATTCATA GGTAATTATTTCTGAAACTTCTT CCCTGTGTGAGCAATCTAAATAA TTATTACAATGCCTTAAGTTGCA ATCAGGAATGTTTACTTAGCACA GACTTTTTTCCCCACTACTGCAC TCAAAGGATAACAGATATATGGC AAATCTAACCATATTCTTTGTCC TTTGTCCATGTTGCGGAGGGAAG CTCATCAGTGGGGCCACGAGCTG AGTGCGTCCTGTCACTCCACTCC CATGTCCCTTGGGAAGGTCTGAG ACTAGGG Nucleic acid sequences are shown 5-3. DNA is uppercase. The location of the SNP is underlined.

    [0066] One reaction plate was cycled immediately (0 hr benchtop hold) and one reaction plate was held at room temperature for 2 days (48 hr benchtop hold) to demonstrate reaction stability over time. Allelic discrimination analysis was performed using Bio-Rad CFX Manager 3.1 software (Bio-Rad, Hercules, Calif.). FAM and Yakima Yellow fluorophores were detected in each well. For both fluorophores the baseline cycles were set to begin at cycle 10 and end at cycle 25. Fluorescence signal (RFU) in each well at the end of 45 cycles was used to generate an allelic discrimination plot and genotypes were determined with auto-call features of the analysis software. Identical performance was obtained with the immediate run (FIG. 3A) and 48 hour hold plate (FIG. 3B), demonstrating robust stability of the reaction components. Each sample is assigned the correct genotyping call and samples of the same genotype are tightly clustered together. The heterozygote cluster is separated from both of the homozygous clusters by an approximate 45 degree angle, indicating excellent allelic specificity of the universal rhPCR genotyping assays and master mix.

    Example 6

    [0067] The following example compares the performance of the genotyping methods of the present invention versus traditional 5 nuclease genotyping assay methods (Taqman).

    [0068] The rs1799865 SNP in the CCR2 gene was selected, and rhPCR genotyping primers as well as an rs1799865 5 nuclease assay (Thermo-Fisher (Waltham, Mass.)), were designed and obtained. Sequences for the rs1799865 rhPCR genomic SNP assay are shown in Table 14 (SEQ ID NOs: 14, 21, 22, and 28-30). Thermo-Fisher 5 nuclease primer/probe (Taqman) sequences are not published, and therefore are not included in this document.

    [0069] Reactions were performed in 10 L volumes, containing 10 ng Coriell genomic DNA (Camden, N.J.), 250 nM of universal FAM probe (SEQ ID NO: 14), 450 nM of universal Yakima Yellow (SEQ ID NO: 22) probe, 1000 nM of universal forward primer (SEQ ID NO: 21), 150 nM of the two allele-specific forward primers (SEQ ID NOs: 28 and 29), 500 nM of the reverse primer (SEQ ID NO: 30), and 5 L of 2 Integrated DNA Technologies (IDT) (Coralville, Iowa) rhPCR genotyping master mix (containing dNTPs, a mutant H784Q Taq polymerase (see Behlke, et al. U.S. 2015/0191707), chemically modified Pyrococcus abyssi RNase H2 (See Walder et al. UA20130288245A1), stabilizers, and MgCl.sub.2).

    [0070] PCR was performed on Life Technologies (Carlsbad, Calif.) QuantStudio 7 Flex real-time PCR instrument using the following cycling conditions: 10 mins at 95 C. followed by 50 cycles of 95 C. for 10 seconds and 60 C. for 45 seconds. End-point analysis of each of the plates was performed after 45 cycles with the QuantStudio Real-Time PCR Software v1.3 (Carlsbad, Calif.).

    TABLE-US-00013 TABLE14 Sequencesofoligonucleotidesusedforthe rs1799865genotypingassayinExample6. Name Sequence SEQIDNO. Universal CGGCCCATGTCCCAGCGAA SEQIDNO.21 Forward primer Probe1 FAM-C+CATC+A+C+CGTG+CT-IBFQ SEQIDNO.14 (FAM) Probe2 Yak-CAATC+C+C+CGAG+CT-IBFQ SEQIDNO.22 (Yakima Yellow) rs1799865 GCCCATGTCCCAGCGAACCATCACCGT SEQIDNO.28 Allele1 GCTTTCTCTTCTGGACTCCCTATAATa Forward TTGTG-x primer rs1799865 GCCCATGTCCCAGCGAACAATCCCCGA SEQIDNO.29 Allele2 GCTTTCTCTTCTGGACTCCCTATAACa Forward TTGTG-x primer rs1799865 GCGGATTGATGCAGCAGTGAgTCAT SEQIDNO.30 Reverse G-x primer Nucleic acid sequences are shown 5-3. DNA is uppercase, RNA is lowercase. LNA residues are designated with a +. Location of potential mismatch is underlined. FAM = 6-carboxyfluorescein, Yak = Yakima Yellow (3-(5,6,4,7-tetrachloro-5-methyl-3,6-dipivaloylfluorescein-2-yl)), IBFQ = Iowa Black FQ (fluorescence quencher), and x = C3 propanediol spacer block.

    [0071] FIGS. 4A and 4B show a side-by-side comparison of the resulting allelic discrimination plots. The rhPCR Genotyping Assay (FIG. 4B) achieved higher fluorescence signal compared to a traditional 5-nuclease genotyping assay (FIG. 4A) while showing concordant results. The higher signal and minimal non-specific amplification from NTC in the rhPCR assay allow better cluster separation and accurate genotype calls.

    Example 7

    [0072] The following example illustrates the present methods allowing for detection and analysis of tri-allelic SNP. The rs72558195 SNP is present in the CYP2C8 gene, and has three potential genotypes. This SNP was selected for analysis with the rhPCR genotyping system.

    [0073] Conventional workflow of interrogating tri-allelic SNP, as illustrated in FIGS. 5A and 5B, involves running a pair of assays using the same samples, manual calling, and comparing the paired assay result to obtain the true genotype of samples.

    [0074] To demonstrate that such a system can function with the universal rhPCR genotyping system, reactions were set up in a white Hard-Shell 384-well skirted PCR plates (Bio-Rad, Hercules, Calif.) on the Life Technologies (Carlsbad, Calif.) QuantStudio 7 Flex real-time PCR with 10 L final volume. Each well contained the rhPCR assay primers (See Table 16, SEQ ID NOs: 14, 21, 22, 31-33). Specifically, 150 nM of rs72558195 G:A Allele Specific Primer 1 (SEQ ID NO: 31) and 150 nM of rs72558195 G:A Allele Specific Primer 2 (SEQ ID NO: 32), or 150 nM of rs72558195 G:A Allele Specific Primer 1 (SEQ ID NO: 31) and 150 nM of rs72558195 G:C Allele Specific Primer 3 (SEQ ID NO: 33) as well as 500 nM rs72558195 Locus Specific Primer (SEQ ID NO: 34) were included in the reactions.

    [0075] Reactions contained universal reporter oligos at the following concentrations: 250 nM of universal FAM probe (SEQ ID NO: 14), 450 nM of universal Yakima Yellow (SEQ ID NO: 22) probe, and 1000 nM of universal forward primer (SEQ ID NO: 21), 50 nM ROX internal standard, and 5 L of 2 Integrated DNA Technologies (IDT) (Coralville, Iowa) rhPCR genotyping master mix (containing dNTPs, a mutant H784Q Taq polymerase (see Behlke, et al. U.S. 2015/0191707), chemically modified Pyrococcus abyssi RNase H2 (See Walder et al. UA20130288245A1), stabilizers, and MgCl.sub.2).

    TABLE-US-00014 TABLE16 Sequencesofoligonucleotidesusedforthe rs72558195genotypingassayinExample7. Name Sequence SEQIDNO. Universal CGGCCCATGTCCCAGCGAA SEQIDNO.21 Forward primer Probe1 FAM-C+CATC+A+C+CGTG+CT- SEQIDNO.14 (FAM) IBFQ Probe2 Yak-CAATC+C+C+CGAG+CT- SEQIDNO.22 (Yakima IBFQ Yellow) rs72558195: GCCCATGTCCCAGCGAACCATCA SEQIDNO.31 G:AAllele CCGTGCTCTCCGTTGTTTTCCAG 1Forward AAACgATTTC-x primer rs72558195: GCCCATGTCCCAGCGAACAATCC SEQIDNO.32 G:AAllele CCGAGCTCTCCGTTGTTTTCCAG 2Forward AAATgATTTC-x primer rs72558195: GCCCATGTCCCAGCGAACAATCC SEQIDNO.33 G:CAllele CCGAGCTCTCCGTTGTTTTCCAG 3Forward AAAGgATTTC-x primer rs1135840 GCAACCAAGTCTTCCCTACAACc SEQIDNO.34 Reverse TTGAT-x primer Nucleic acid sequences are shown 5-3. DNA is uppercase, RNA is lowercase. LNA residues are designated with a +. Location of potential mismatch in underlined. FAM = 6-carboxyfluorescein, Yak = Yakima Yellow (3-(5,6,4,7-tetrachloro-5-methyl-3,6-dipivaloylfluorescein-2-yl)), IBFQ = Iowa Black FQ (fluorescence quencher), and x = C3 propanediol spacer block.

    [0076] gBlocks Gene Fragments (Integrated DNA Technologies, Inc., Coralville, Iowa) containing alleles of the rs72558195 SNP were utilized as the source of template DNA (See Table 17, SEQ ID NOs: 35, 36 and 37). Each well contained template representing one of six possible genotypes: allele 1 homozygote (1000 copies rs72558195 Allele 1 gBlock template (SEQ ID NO: 35)), allele 2 homozygote (1000 copies rs72558195 Allele 2 gBlock template (SEQ ID NO: 36)), allele 3 homozygote (1000 copies rs72558195 Allele 2 gBlock template (SEQ ID NO: 37)), heterozygote (mix of 500 copies of rs72558195 Allele 1 gBlock template (SEQ ID NO: 35) and 500 copies of rs72558195 Allele 2 gBlock template (SEQ ID NO: 36). heterozygote (mix of 500 copies of rs72558195 Allele 1 gBlock template (SEQ ID NO: 35) and 500 copies of rs72558195 Allele 3 gBlock template (SEQ ID NO: 37)). Template or water for the no template control (NTC) reactions were added into three replicate wells of two individual plates. The reactions underwent the following cycling protocol: 95 C. for 10 minutes, then 45 cycles of 95 C. for 10 seconds and 60 C. for 45 seconds.

    TABLE-US-00015 TABLE17 gBlock sequencesusedinExample7 Name Sequence SEQIDNO. rs72558195 ACATCATTTTTATTGTATAA SEQIDNO.35 Allele1 AAGCATTTTAGTATCAATTT gBlock TCTCATTTTTAAACCAAGTC template TTCCCTACAACCTTGAATAA ATGGTTTCCAAGGAAAATAA AATCTTGGCCTTACCTGGAT CCATGGGGAGTTCAGAATCC TGAAGTTTTCATTGAATCTT TTCATCAGGGTGAGAAAATT CTGATCTTTATAATCAAATC GTTTCTGGAAAACAACGGAG CAGATCACATTGCAGGGAGC ACAGCCCAGGATGAAAGTGG GATCACAGGGTGAAGCTAAA GATTTAAAAATTTTTAAAAA AATTATTAAAAAATAAATAT TTAAAAGATTTGCATTTGTT AAGACATAAAGGAAATTTAG AAATTTTAAACAATATCTTA CAAATTCCCCATGTGTCCAA A rs72558195 ACATCATTTTTATTGTATAA SEQIDNO.36 Allele2 AAGCATTTTAGTATCAATTT gBlock TCTCATTTTTAAACCAAGTC template TTCCCTACAACCTTGAATAA ATGGTTTCCAAGGAAAATAA AATCTTGGCCTTACCTGGAT CCATGGGGAGTTCAGAATCC TGAAGTTTTCATTGAATCTT TTCATCAGGGTGAGAAAATT CTGATCTTTATAATCAAATC ATTTCTGGAAAACAACGGAG CAGATCACATTGCAGGGAGC ACAGCCCAGGATGAAAGTGG GATCACAGGGTGAAGCTAAA GATTTAAAAATTTTTAAAAA AATTATTAAAAAATAAATAT TTAAAAGATTTGCATTTGTT AAGACATAAAGGAAATTTAG AAATTTTAAACAATATCTTA CAAATTCCCCATGTGTCCAA A rs72558195 ACATCATTTTTATTGTATAA SEQIDNO.37 Allele3 AAGCATTTTAGTATCAATTT gBlock TCTCATTTTTAAACCAAGTC template TTCCCTACAACCTTGAATAA ATGGTTTCCAAGGAAAATAA AATCTTGGCCTTACCTGGAT CCATGGGGAGTTCAGAATCC TGAAGTTTTCATTGAATCTT TTCATCAGGGTGAGAAAATT CTGATCTTTATAATCAAATC CTTTCTGGAAAACAACGGAG CAGATCACATTGCAGGGAGC ACAGCCCAGGATGAAAGTGG GATCACAGGGTGAAGCTAAA GATTTAAAAATTTTTAAAAA AATTATTAAAAAATAAATAT TTAAAAGATTTGCATTTGTT AAGACATAAAGGAAATTTAG AAATTTTAAACAATATCTTA CAAATTCCCCATGTGTCCAA A Nucleic acid sequences are shown 5-3. DNA is uppercase. The location of the SNP is underlined.

    [0077] The results are shown in FIGS. 5A and 5B. From this, it is clear that the universal rhPCR genotyping system can be used to characterize multi-allelic genotypes.

    [0078] A Tri-allelic AD 360plot was designed for illustrating allelic discrimination. Fluorescence signal (Rn) from the last PCR cycle of each dye was normalized across the three dyes from the same well. Angle and distance of data point from the origin is calculated using formula below:


    Angle=tan.sup.1(RnDye.sub.1RnDye.sub.2)120/90


    Distance from origin={square root over ((RnDye.sub.1).sup.2+(RnDye.sub.2).sup.2)}

    [0079] FIG. 5B shows the Tri-allelic Allelic Discrimination 360plot of rs72558195, using rhPCR genotyping assay with 3 allele-specific primers multiplexed in a single reaction. By collecting fluorescence signal from all assays, six genotypes could be detected in a single reaction. The distance of data points from origin indicated the signal strength of dyes and the wide angle separation between data clusters indicated specificity of multiplex assay. NTC in the center of the plot indicated no primer dimers or non-specific amplification. The specificity of multiplex assay is achieved by the selectivity of RNase H2 and the mutant Taq DNA polymerase as used in the previous examples. This AD 360plot will also enable auto-calling capability by genotyping software.

    [0080] A 360plot could be implemented for tetra-allelic, penta-allelic or hexa-allelic visualization. Therefore, visualization is possible for positions that could have multiple bases as well as potential deletions. The distance from origin remains unchanged for each calculation, and the angle formulas would be:


    tetra-allelic (4 alleles): Angle=tan.sup.1(RnDye.sub.1RnDye.sub.2)


    penta-allelic (5 alleles): Angle=tan.sup.1(RnDye.sub.1RnDye.sub.2)72/90


    hexa-allelic (6 alleles): Angle=tan.sup.1(RnDye.sub.1RnDye.sub.2)60/90

    Example 8

    [0081] The following example illustrates the capability of the methods of the present invention to provide quantitative SNP genotyping, allowing for determination of the copy numbers of different alleles. To demonstrate this, an assay was designed against rs1135840, a SNP in the human CYP2D6 gene. This gene can be present in multiple copies, and the number of copies with the rs1135840 SNP appears to affect drug metabolism (rapid metabolism of the drug Debrisoquine).

    [0082] To demonstrate that the assay system can detect small differences in allele rations, a standard curve for analysis was created. Two gBlock (IDT, Coralville, Iowa) gene fragments were synthesized (Allele 1 and Allele 2, representing the two allelic variants (G>C) of the rs1135840 SNP) and then mixed at different ratios. Reactions were performed in 10 L volumes, containing a total of 1500 copies of template at the ratios shown (10:0, 9:1, 8:2, 7:3, 6:4, 5:5, 4:6, 3:7, 2:8, 1:9, and 0:10), 250 nM of universal FAM probe (SEQ ID NO: 14), 450 nM of universal Yakima Yellow (SEQ ID NO: 22) probe, 1000 nM of universal forward primer (SEQ ID NO: 21), 150 nM of the two allele-specific forward primers, 500 nM of the reverse primer, and 5 L of 2 Integrated DNA Technologies (IDT) (Coralville, Iowa) rhPCR genotyping master mix (containing dNTPs, a mutant H784Q Taq polymerase (see Behlke, et al. U.S. 2015/0191707), chemically modified Pyrococcus abyssi RNase H2 (See Walder et al. UA20130288245A1), stabilizers, and MgCl.sub.2).

    [0083] PCR was performed on Life Technologies (Carlsbad, Calif.) QuantStudio 7 Flex real-time PCR instrument using the following cycling conditions: 10 mins at 95 C. followed by 45 cycles of 95 C. for 10 seconds and 60 C. for 45 seconds. End-point analysis of each of the plates was performed after 45 cycles with software provided by the respective companies (Bio-Rad CFX Manager 3.1 software (Bio-Rad, Hercules, Calif.) and QuantStudio Real-Time PCR Software v1.3 (Carlsbad, Calif.)).

    TABLE-US-00016 TABLE16 OligonucleotidesequencesusedinExample8. Name Sequence SEQIDNO. Universal CGGCCCATGTCCCAGCGAA SEQIDNO.21 Forward primer Probe1 FAM-C+CATC+A+C+CGTG+ SEQIDNO.14 (FAM) CT-IBFQ Probe2 Yak-CAATC+C+C+CGAG+ SEQIDNO.22 (Yakima CT-IBFQ Yellow) rs1135840 GCCCATGTCCCAGCGAACCA SEQIDNO.38 Allele1 TCACCGTGCTGTCTTTGCTT Forward TCCTGGTGAGcCCATG-x primer rs1135840 GCCCATGTCCCAGCGAACAA SEQIDNO.39 Allele2 TCCCCGAGCTGTCTTTGCTT Forward TCCTGGTGAcCCATG-x primer rs1135840 GCGTTGGAACTACCACATTG SEQIDNO.40 Reverse CTTTATuGTACT-x primer Nucleic acid sequences are shown 5-3. DNA is uppercase, RNA is lowercase. LNA residues are designated with a +. Location of potential mismatch is underlined. FAM = 6-carboxyfluorescein, Yak = Yakima Yellow (3-(5,6,4,7-tetrachloro-5-methyl-3,6-dipivaloylfluorescein-2-yl)), IBFQ = Iowa Black FQ (fluorescence quencher), and x = C3 propanediol spacer block.

    [0084] The resulting data is illustrated in FIG. 7. The spread of each of the sample mixes is sufficient for the determination of the number of copies of each template.

    [0085] After demonstration of the required amount of separation of allelic quantities, it is possible to determine the number of copies present of each allele in an experimental sample. To test this, the previously described assay designed against rs1135840, was utilized to test thirteen Coriell genomic DNA (Camden, N.J.) samples with varying CYP2D6 copy numbers with varying rs1135840 genotypes. These samples have known defined copy numbers and rs1135840 genotypes which could be verified after testing with the universal rhPCR genotyping mix. From this, these samples can also be categorized as being homozygotes for either allele, or heterozygotes.

    [0086] To calculate the copy number from the data, two duplex reactions were run for each sample. Reactions were performed in 10 L volumes, containing 3 ng of one of the following genomic DNAs: NA17123, NA17131, NA17132, NA17149, NA17104, NA17113, NA17144, NA17213, NA17221, NA17114, NA17235, or NA17241. Each individual assay also contained 50 nM ROX normalizer oligo, 250 nM of universal FAM probe (SEQ ID NO: 14), 450 nM of universal Yakima Yellow (SEQ ID NO: 22) probe, 1000 nM of universal forward primer (SEQ ID NO: 21), 150 nM of the two allele-specific forward primers (SEQ ID NO: 38 and 39), 500 nM of the reverse primer (SEQ ID NO: 40), and 5 L of 2 Integrated DNA Technologies (IDT) (Coralville, Iowa) rhPCR genotyping master mix (containing dNTPs, a mutant H784Q Taq polymerase (see Behlke, et al. U.S. 2015/0191707), chemically modified Pyrococcus abyssi RNase H2 (See Walder et al. UA20130288245A1), stabilizers, and MgCl.sub.2). Assays also contained a separate RNase P assay (See table 17, SEQ ID NOs: 41-43)) for normalization of the template concentration.

    TABLE-US-00017 TABLE17 RNasePassaysequencesusedinExample8. Name Sequence SEQIDNO. RNaseP GCGGAGGGAAGCTCATCAG SEQIDNO.41 Forward primer RNaseP CCCTAGTCTCAGACCTTCCCAA SEQIDNO.42 Reverse primer Probe2 Yak-CCACGAGCTGAGTGCGTC SEQIDNO.43 (Yakima CTGTCA-IBFQ Yellow) Nucleic acid sequences are shown 5-3. DNA is uppercase. FAM = 6-carboxyfluorescein, Yak = Yakima Yellow (3-(5,6,4,7-tetrachloro-5-methyl-3,6-dipivaloylfluorescein-2-yl)), IBFQ = Iowa Black FQ (fluorescence quencher).

    [0087] Quantitative PCR was performed on Life Technologies (Carlsbad, Calif.) QuantStudio 7 Flex real-time PCR instrument using the following cycling conditions: 10 mins at 95 C. followed by 45 cycles of 95 C. for 10 seconds and 60 C. for 45 seconds. End-point analysis of each of the plates was performed after 45 cycles with the QuantStudio Real-Time PCR Software v1.3 (Carlsbad, Calif.) software provided by the company.

    [0088] Copy number was determined by the following method. For each sample shown to be a homozygote, Cq (RNase P Cqrs1135840 assay Cq) was calculated for each sample. For samples shown to be heterozygotes, Cq was calculated for both alleles (RNase P Cqrs1135840 assay 1 Cq and RNase P Cqrs1135840 assay 2 Cq). Next, Cq (Cqmean Cq for known 2 copy control DNA samples) was calculated for each allele. This correction allowed for normalization against amplification differences between the SNP assay and the RNase P assay. Finally, the following equation was used to calculate copy number for each allele:


    Copy number of allele=2*(2(Cq))

    [0089] The resulting end-point data is shown in FIG. 8A and calculated copy numbers are shown in FIG. 8B. The genotypes determined in FIG. 8A (homozygotes allele 1, Homozygotes allele 2, or heterozygote) all matched the known genotypes, and allowed correct calculation of the copy number. The established reference copy number of the individual samples is shown under each result. In each case, the copy number determined by the assay correctly determined the genotype and copy number of the input DNA.

    Example 9

    [0090] The following example demonstrates that a variation of an rhPCR probe can be used for multiplexed rhPCR.

    [0091] The assay schematic is provided in FIG. 9. In the first round of PCR, 5 tailed target-specific rhPrimers are used. The 5 tails upon incorporation into the amplicon contain binding sites for a second round of PCR with different primers (blocked or unblocked) to add application specific sequences. For example, as depicted in FIG. 9, this system can be used for amplification enrichment for next generation sequencing. In this case, 5 tailed rhPCR primers contain read 1/read 2 primer sequences. The second round of PCR adds adapter sequences such as the P5/P7 series for Illumina based sequencing platforms or other adaptors, including ones containing barcodes/unique molecular identifiers. This approach allows for adding any additional sequences onto the amplicon necessary for input into any NGS platform type.

    [0092] As illustrated in FIG. 10, two primers sets, including one containing a 96-plex set of 5 tailed rhPrimers, and one containing 96 DNA standard 5 tailed PCR primers were designed using an IDT algorithm. The two primer sets differed only in that the rhPrimers contained an internal cleavable RNA base and a blocking group on the 3 end. Once the blocking group was removed by RNase H2 cleavage, the primer sequences become identical.

    [0093] The first round of PCR reactions contained the 96 plex at 10 nM of each blocked target specific primer, 10 ng of NA12878 human genomic DNA (Coriell Institute for Medical Research, Camden, N.J.), 200 mU of chemically modified Pyrococcus abyssi RNase H2 (See Walder et al. UA20130288245A1) (IDT, Coralville, Iowa) and 1KAPA 2G HotStart Fast Ready Mix (Kapa Biosystems, Wilmington, Mass.). The thermal cycling profile was 10 mins at 95 C. followed by 8 cycles of 95 C. for 15 seconds and 60 C. for 4 minutes, and a final 99 C. finishing step for 15 minutes. Reactions were cleaned up with a 2 AMPure XP beads (Beckman Coulter, Brea, Calif.). Briefly, 100 L AMPure SPRI beads were added to each PCR well, incubated for 5 minutes at room temperature and collected for 5 minutes at room temperature on plate magnet (DynaMag (Thermo-Fisher, (Watherham, Mass.) 96-well plate side-magnet). Beads were washed twice with 80% ethanol, and allowed to dry for 3 minutes at room temperature. Samples were eluted in 22 L of TE at pH 8.0.

    [0094] The second round of PCR was set up using 20 L of the cleaned up first round PCR products, universal PCR-50F and PCR-47R primers (See table 18, SEQ ID NOs: 44 and 45) at 2 uM and 1KAPA 2G HotStart Fast Ready Mix (KAPA Biosystems, Wilmington, Mass.). Reactions were cycled for 45 seconds at 98 C. followed by 20 cycles of 98 C. for 15 seconds, 60 C. for 30 seconds, and 72 C. for 30 seconds. A final 1 minute 72 C. polishing step finished the reaction. Samples were cleaned up again with 0.8 AMPure beads. Briefly, 40 L AMPure SPRI beads were added the second PCR wells, incubated for 5 minutes at room temperature and collected for 5 minutes at room temperature on plate magnet (DynaMag (Thermo-Fisher, (Watherham, Mass.) 96-well plate side-magnet). Beads were washed twice with 80% ethanol, and allowed to dry for 3 minutes at room temperature. Samples were eluted in 22 L of TE at pH 8.0, and 20 L was transferred to a new tube.

    [0095] 2 L of the samples were analyzed using the Agilent High Sensitivity D1000 Screen Tape on the Agilent 2200 Tape Station (Agilent Technologies, Santa Clara, Calif.). Quantification was performed using the KAPA Library Quantification Kit (KAPA Biosystems, Wilmington, Mass.) for Illumina Platforms, according to the manufacturer's protocol. Replicate samples were pooled to a final concentration of 10 pM, and 1% PhiX bacteriophage sequencing control was added. Samples were run with a V2 300 cycle MiSeq kit on an Illumina (San Diego, Calif.) MiSeq platform, using standard protocols from the manufacturer.

    TABLE-US-00018 TABLE18 UniversalassaysequencesusedinExample9. Name Sequence SEQIDNO. Universal AATGATACGGCGACCAC SEQIDNO.44 PCR-50F CGAGATCTACACTCTTT CCCTACACGACGCTCT Universal CAAGCAGAAGACGGCAT SEQIDNO.45 PCR-47R ACGAGATGGACCTATGT GACTGGAGTTCAGACGT GTGC Nucleic acid sequences are shown 5-3. DNA is uppercase.

    [0096] FIG. 10 shows the results from the Agilent Tape Station. The primer dimer product was the most significant product produced using standard DNA primers in the presence of DNA template, with only a small amount of full length expected product. In the absence of template, the primer dimer product was the major component of the reaction. In the case of the blocked rhPCR primers, the vast majority of the material was the desired PCR products, with little primer dimer observed. In the absence of template, there is no primer dimer present, contrasting with the overwhelming abundance of primer dimer observed in the no template lane of the unblocked DNA primers. Quantitation of the product versus primer dimer bands show that mass ratio of product to primer dimer for the unblocked DNA primers was 0.6. The mass ratio for the rhPCR primers was 6.3.

    [0097] FIG. 11 summarizes two key sequencing metrics. The first is the percent of mapped reads from the sequencing data. The rhPCR reactions gave a percentage of reads mapped to the human genome at 85%, whereas the non-blocked DNA primers on give a mapped read percentage of less than 20. A second metric, the percentage of on-target reads, is almost 95% when using rhPCR primers, but less than 85% when the non-blocked primers are used in the multiplex. These results clearly demonstrate the utility of using rhPCR in multiplexing, where a large increase of the desired material is seen, and a vast reduction in undesired side products is observed. The differences mean less unwanted sequencing reads, and the depth of coverage of desired sequences is higher.

    [0098] All references, including publications, patent applications, and patents, cited herein are hereby incorporated by reference to the same extent as if each reference were individually and specifically indicated to be incorporated by reference and were set forth in its entirety herein.

    [0099] The use of the terms a and an and the and similar referents in the context of describing the invention (especially in the context of the following claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. The terms comprising, having, including, and containing are to be construed as open-ended terms (i.e., meaning including, but not limited to,) unless otherwise noted. Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., such as) provided herein, is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention.

    [0100] Preferred embodiments of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Variations of those preferred embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventors expect skilled artisans to employ such variations as appropriate, and the inventors intend for the invention to be practiced otherwise than as specifically described herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.