Promoters for increased protein expression in meningococcus

09657297 ยท 2017-05-23

Assignee

Inventors

Cpc classification

International classification

Abstract

New promoters are described to drive transcription in meningococcus e.g. for over-expression of protein antigens for retention in membrane vesicles. Modified porA promoters lack the wild-type poly-G sequence which can cause phase variation. Meningococcal rRNA-coding genes (e.g. for 16S rRNA) can be used to drive transcription of a protein-coding gene. These approaches can be used in combination.

Claims

1. A nucleic acid comprising a promoter operably linked to a heterologous coding sequence, wherein the promoter is selected from the group consisting of: (a) a promoter comprising (i) a 10 region from a meningococcal porA gene promoter comprising TATAAT and (ii) a 35 region comprising the nucleic acid sequence TGGTTT or the nucleic acid sequence TTGACA, wherein the 10 region and the 35 region are separated by an intervening sequence comprising 12-20 nucleotides, wherein the intervening sequence either comprises no poly-G sequence or includes a poly-G sequence comprising no more than five consecutive G nucleotides; and (b) a promoter comprising a sequence selected from the group consisting of (i) the sequence of SEQ ID NO: 18 and (ii) a variant of SEQ ID NO: 18 which differs from SEQ ID NO: 18 by up to 4 single-nucleotide insertions, deletions, or substitutions.

2. The nucleic acid of claim 1, wherein the promoter of (a) has a nucleic acid sequence selected from the group consisting of: SEQ ID NO: 32, SEQ ID NO: 33, and SEQ ID NO: 34.

3. The nucleic acid of claim 1, wherein the intervening sequence does not comprise a sequence GGGGG.

4. The nucleic acid of claim 1, wherein non-transcribed sequence downstream of the 10 sequence and upstream of the transcription start site comprises 5-10 nucleotides.

5. The nucleic acid of claim 1, wherein the promoter of (a) comprises the sequence of SEQ ID NO: 30.

6. The nucleic acid of claim 1, wherein the promoter of (b) is selected from the group consisting of: nucleotides 6-39 of SEQ ID NO: 36, nucleotides 6-38 of SEQ ID NO: 37, and nucleotides 6-39 of SEQ ID NO: 38.

7. A bacterial expression vector comprising a DNA sequence comprising the nucleic acid of claim 1.

8. A meningococcus comprising a DNA sequence comprising the nucleic acid of claim 1.

9. The meningococcus of claim 8, wherein the heterologous coding sequence encodes an outer membrane protein.

10. The meningococcus of claim 9, wherein the outer membrane protein is a fHbp.

11. The meningococcus of claim 8, wherein the meningococcus does not express an active MltA.

12. The meningococcus of claim 8, wherein the meningococcus comprises a knockout of at least one of SynX and LpxL1.

13. The meningococcus of claim 8 comprising a meningococcus selected from the group consisting of serogroup B and serogroup W135.

14. The meningococcus of claim 8 comprising a lipopolysaccharide of immunotype L3.

15. The nucleic acid of claim 4, wherein the non-transcribed sequence comprises a sequence selected from the group consisting of TGAAGAC and TCGCAAC.

Description

BRIEF DESCRIPTION OF DRAWINGS

(1) FIG. 1 illustrates fHbp expression levels in the same background strain (NZ98/254) using five different promoters and the benchmark strain overexpressing the same fHbp allele in the same background [112,113]. A variant 2 allele of fHbp was overexpressed in the benchmark strain or from either 2 wildtype phase variants of the porA promoter with either 11 Gs or 13 Gs in the spacer tract or with the modified ST1, ST2 and ST3 porA promoters as indicated. Western blotting of equivalent quantities of total protein were loaded from 0.5 to 2 as indicated for each strain, and the arrow shows fHbp.

(2) FIG. 2 illustrates comparative analysis of fHbp expression from porA and 16S modified promoters. The NZ98/254 strain expressing fHBP variant 2 under the control of the indicated promoters was grown on plates (A) and in liquid to logarithmic (B) and stationary phase (C) and levels of fHBP expression were measured by western blot from duplicate cultures (#1, #2) or from the benchmark overexpression strain. The unbroken arrow shows fHbp, whereas the lower broken arrow shows a loading control.

(3) FIG. 3 shows expression of fHbp from three strains: (a) a lpxL1 knockout; (b) a synX knockout; and (c) a lpxL1synX double knockout. In all cases the knocked out gene(s) was replaced by fHbp under the control of a modified PorA promoter. Expression of fHbp was assessed by western blot on crude cell extracts using anti-fHbp serum, and was compared to Hfq as a control. FIG. 3A shows the western blot, and FIG. 3B quantifies expression in arbitrary units.

(4) FIG. 4 shows fHbp levels in vesicles isolated from (i) lpxL1synX and (ii) lpxL1synXmltA knockout strains. FIG. 4A shows yield in mg/OD, and FIG. 4B is a western blot of 0.5 g vesicles.

(5) FIG. 5 shows expression of fHbp in two strains that overexpress either variant 1 or variant 2 fHbp in distinct loci (lanes c & d) or a strain that overexpresses both variant 1 and variant 2 in respective loci (lane e). Lane a is the wild-type strain, and lane b is a fHbp knockout of that strain.

(6) FIG. 6 shows silver-stained SDS-PAGE of vesicles purified from the triple knockout.

MODES FOR CARRYING OUT THE INVENTION

Modified PorA Promoters

(7) The sequences upstream of the transcription start site of two phase variants of the wild-type meningococcal porA promoter, containing 11 and 13 consecutive Gs in the spacer region, are as follows, with the 35 and 10 regions underlined:

(8) TABLE-US-00001 (SEQIDNO:31) AAAAATGGTTTTTTGCGGGGGGGGGGGTATAATTGAAGAC (SEQIDNO:40) AAAAATGGTTTTTTGCGGGGGGGGGGGGGTATAATTGAAGAC

(9) The intervening sequence between the 35 and 10 regions includes a G.sub.11 poly-G sequence which is connected to phase variation of PorA expression. To stabilise expression from this promoter, three modifications were tested (modifications in lower case):

(10) TABLE-US-00002 (ST1;SEQIDNO:32) AAAAATGGTTTTTTGCGaGGGaGGtGGTATAATTGAAGAC (ST2;SEQIDNO:33) AAAAATtGacaTTTGCGaGGGaGGtGGTATAATTGAAGAC (ST3;SEQIDNO:34) AAAAtTGacaTTTTGCGaGGGaGGtGGTATAATTGAAGAC

(11) Thus in ST1 the G.sub.11 sequence was interrupted in three places, leaving no more than 3 consecutive G residues. In ST2 the same intervening sequence was used, but the 35 region was substituted by a consensus 35 region TTGACA. In ST3 an extra T residue was inserted immediately downstream of the 35 region.

(12) These three promoters were used to drive expression of a fHbp sequence (fHbp variant 2) in the NZ98/258 strain. All three modified promoters resulted in high level overexpression of fHBP in the strain when compared to an equivalent overexpressing strain which has been reported in the literature [112,113]. The best expression was seen with ST2 (FIGS. 1 & 2).

(13) Modified rRNA Promoters

(14) In further experiments the 16S rRNA promoter was fused to the 5 UTR of the porA gene:

(15) TABLE-US-00003 (SEQIDNO:35) ATATCTTGACAGGCGGAAGGAATACTTTATAATTCGCAAC...

(16) This promoter was subjected to mutation and three variants downstream of the 35 region were sequenced as follows:

(17) TABLE-US-00004 (wt;SEQIDNO:35) ATATCTTGACAGGCGGAAGGAATACTTTATAATTCGCAAC (#5;SEQIDNO:36) ATATCTTGACAGGCGGAAGGAATACTTTATATTCGCAAC... (#6;SEQIDNO:37) ATATCTTGACAGGCGGAAGGAATACTTTTAATTCGCAC... (#8;SEQIDNO:38) ATATCTTGACAGGCGGAAGGAAACTTTATAATTCGCAAC...

(18) Thus in variants #5 and #6 the 10 sequence is a 5-mer, and variant #6 also lost a nucleotide between the 10 region and the transcription start site. In variant #8 the 10 region and its downstream sequence are the same as wt, but the intervening sequence between the 35 and 10 regions is one nucleotide shorter than wt.

(19) Expression of fHbp from Modified Promoters

(20) These promoters were fused to the 5UTR region of the porA gene and used to drive expression of the fHbp coding sequence. As seen in FIG. 2, variants #5 and #6, variants #5 and #6 showed the strongest expression, approaching levels seen with ST2.

(21) The complete region spanning the wild-type promoter (SEQ ID NO: 35), extending downstream into the transcribed region and also upstream, was as follows (SEQ ID NO: 41; 358mer), with the 35 and 10 regions underlined, and nucleotide +1 (following reference 10) double-underlined:

(22) TABLE-US-00005 (SEQIDNO:41) ...CGTCTGAGTCCCCGAGTTTCAGACAGCATATTCACAAAGGCGCACCAGCCGGAGGAGGGAGAGGAAAG GATTGTTGGAGGCGGCGCAGTATTTAGCAGAAATAAAAAACCTTATCCGACAGCGACATGACGAATTTCCC CAAAAAAATCCCGCTGAAAGCATTGACCGTTTTTCCCTGTGGGCGTATAGTTCGGTTCTTCGCTGCTGCAG AAGTGGCGGACGAACTGAAAAGTATAGCACAGAATGTTGGGGATATCGAGAGATATCTTGACAGGCGGAAG GAATACTTTATAATTCGCAACGTATCGGGTGTTTGCCCGATGTTTTTAGGTTTTTATCAAATTTACAAAAG GAAGCC...

(23) Similarly, the surrounding sequences for variants #5 and #6 were as follows:

(24) TABLE-US-00006 (SEQIDNO:42) #5:...CGTCTGAGTCCCCGAGTTTCAGACAGCATATTCACAAAGGCGCACCAGCCGGAGGAGGGAGAGG AAAGGATTGTTGGAGGCGGCGCAGTATTTAGCAGAAATAAAAAACCTTATCCGACAGCGACATGACGAATT TCCCCAAAAAAATCCCGCTGAAAGCATTGACCGTTTTTCCCTGTGGGCGTATAGTTCGGTTCTTCGCTGCT GCAGAAGTGGCGGACGAACTGAAAAGTATAGCACAGAATGTTGGGGATATCGAGAGATATCTTGACAGGCG GAAGGAATACTTTATATTCGCAACGTATCGGGTGTTTGCCNNANGTTTTTAGGTTTTTATCAAATTTCAAA AGGAAGCC... (SEQIDNO:43) #6:...CGTCTGAGTCCCCGAGTTTCAGACAGCATATTCACAAAGGCGCACCAGCCGGAGGAGGGAGAGG AAAGGATTGTTGGAGGCGGCGCAGTATTTAGCAGAAATAAAAAACCTTATCCGACAGCGACATGACGAATT TCCCCAAAAAAATCCCGCTGAAAGCATTGACCGTTTTTCCCTGTGGGCGTATAGTTCGGTTCTTCGCTGCT GCAGAAGTGGCGGACGAACTGAAAAGTATAGCACAGAATGTTGGGGATATCGAGAGATATCTTGACAGGCG GAAGGAATACTTTTAATTCGCACGTATCGGGTGTTTGCCCGATGTTTTTAGGTTTTTATTAAATTTACAAA AGGAAGCCCATANGAATCGAACTGC...

(25) Any of these longer sequences can be used with the invention, although modifications as discussed herein may, of course, be made.

(26) A fHbp gene under the control of a variant promoter was stably inserted into the chromosome of a meningococcus (strain NZ98/254) in place of the endogenous lpxL1 and/or synX gene(s). Slightly higher expression levels were seen at the synX locus, and expression for the strain with both insertions (lpxL1synX double knockout) was the sum of the expression from the individual loci (FIG. 3).

(27) Strains were also made in which two different fHbp variants (1 & 2) were expressed under the control of a modified PorA promoter. The co-expression of both variants has no significant negative effect on the expression from each distinct locus, and instead resulted in an additive effect (FIG. 5).

(28) Knockout of the endogenous mltA (GNA33) gene in the lpxL1synX double knockout further increased expression levels, and had no negative impact on the localisation of fHbp protein to the strain's vesicles. FIG. 4 shows fHbp levels in vesicles isolated from these strains, showing (A) the yield of protein (mg) relative to the culture's optical density (OD), and (B) an anti-fHbp western blot against of 0.5 g of the vesicles. SDS-PAGE shows that the fHbp band in the triple knockout strain was one of the most abundant proteins in the vesicles, along with PorA and PorB (FIG. 6).

(29) It will be understood that the invention is described above by way of example only and modifications may be made whilst remaining within the scope and spirit of the invention.

REFERENCES

(30) [1] Koeberling et al. (2007) Vaccine 25:1912-20. [2] Koeberling et al. (2008) J Infect Dis 198:262-70. [3] Hou et al. (2005) J Infect Dis 192:580-90. [4] WO2009/038889. [5] Bonvehi et al. (2010) Clin Vacc Immunol 17:1460-6. [6] Keiser et al. (2011) Vaccine 29:1413-20. [7] Pinto et al. (2011) Vaccine 29:7752-8. [8] WO01/09350. [9] WO2004/015099. [10] van der Ende et al. (1995) J Bacteriol 177:2475-80. [11] Gourse et al. (1986) Cell 44:197-205. [12] Hirvonene et al. (2001) J. Bacteriol. 183:6305-14. [13] Deghmane et al. (2003) Infect Immun 71:2897-901. [14] WO02/09643. [15] Katial et al. (2002) Infect. Immun. 70:702-707. [16] U.S. Pat. No. 6,180,111. [17] WO01/34642. [18] WO2006/046143. [19] WO2004/019977. [20] European patent 0011243. [21] Fredriksen et al. (1991) NIPH Ann. 14 (2):67-80. [22] WO01/91788. [23] WO2005/004908. [24] WO2011/036562. [25] WO00/26384. [26] U.S. Pat. No. 6,531,131 [27] U.S. Pat. No. 6,645,503 [28] Claassene et al. (1996) Vaccine 14:1001-8. [29] de Kleijne et al. (2000) Vaccine 18:1456-66. [30] WO03/105890. [31] WO2006/024946 [32] WO2006/081259. [33] Schielke et al. (2009) Mol Microbiol 72:1054-67. [34] WO2004/014418. [35] WO00/25811. [36] WO2010/070453. [37] WO02/09746. [38] Oriente et al. (2010) J Bacteriol 192:691-701. [39] U.S. provisional patent application 61/247,428. [40] Giuliani et al. (2006) Proc Natl Acad Sci USA 103 (29): 10834-9. [41] Donnelly et al. (2010) PNAS USA 107:19490-5. [42] Kimura et al. (2010) Clin Vaccine Immunol. 2010 PMID: 21177912. [43] Zollinger et al. (2010) Vaccine 28:5057-67. [44] WO99/10497. [45] Steeghs et al. (2001) The EMBO Journal 20:6937-6945. [46] Maiden et al. (1998) PNAS USA 95:3140-3145. [47] WO02/062378. [48] WO2004/014417. [49] WO00/66741. [50] WO99/57280 [51] Serruto et al. (2010) PNAS USA 107:3770-5. [52] U.S. Pat. No. 5,698,438. [53] Perkins-Balding et al. (2003) Microbiology 149:3423-35. [54] Masignani et al. (2003) J Exp Med 197:789-799. [55] Welsch et al. (2004) J Immunol 172:5605-15. [56] Hou et al. (2005) J Infect Dis 192(4):580-90. [57] WO03/063766. [58] Fletcher et al. (2004) Infect Immun 72:2088-2100. [59] Zhu et al. (2005) Infect Immun 73(10):6838-45. [60] Cantini et al. (2006) J. Biol. Chem. 281:7220-7227 [61] WO2004/048404 [62] WO2009/104097. [63] Schneider et al. (2009) Nature 458:890-3. [64] WO2010/046715. [65] Pajon et al. (2012) Infect Immun 80:2667-77. [66] WO2011/126863. [67] Martin et al. (1997) J Exp Med 185(7): 1173-83. [68] WO96/29412. [69] WO01/55182. [70] WO01/38350. [71] WO00/23595. [72] Gennaro (2000) Remington: The Science and Practice of Pharmacy. 20th edition, ISBN: 0683306472. [73] RIVM report 124001 004. [74] RIVM report 000012 003. [75] Vaccine Design . . . (1995) eds. Powell & Newman. ISBN: 030644867X. Plenum. [76] WO01/30390. [77] http://neisseria.org/nm/typing/mlst/ [78] Tettelin et al. (2000) Science 287:1809-1815. [79] Pettersson et al. (1994) Microb Pathog 17 (6):395-408. [80] Welsch et al. (2002) Thirteenth International Pathogenic Neisseria Conference, Norwegian Institute of Public Health, Oslo, Norway; Sep. 1-6, 2002. Genome-derived antigen (GNA) 2132 elicits protective serum antibodies to groups B and C Neisseria meningitidis strains. [81] Santos et al. (2002) Thirteenth International Pathogenic Neisseria Conference, Norwegian Institute of Public Health, Oslo, Norway; Sep. 1-6, 2002. Serum bactericidal responses in rhesus macaques immunized with novel vaccines containing recombinant proteins derived from the genome of N. meningitidis. [82] WO2007/000327. [83] WO2007/071707 [84] Methods In Enzymology (S. Colowick and N. Kaplan, eds., Academic Press, Inc.) [85] Handbook of Experimental Immunology, Vols. I-IV (D. M. Weir and C. C. Blackwell, eds, 1986, Blackwell Scientific Publications) [86] Sambrook et al. (2001) Molecular Cloning: A Laboratory Manual, 3rd edition (Cold Spring Harbor Laboratory Press). [87] Handbook of Surface and Colloidal Chemistry (Birdi, K. S. ed., CRC Press, 1997) [88] Ausubel et al. (eds) (2002) Short protocols in molecular biology, 5th edition (Current Protocols). [89] Molecular Biology Techniques: An Intensive Laboratory Course, (Ream et al, eds., 1998, Academic Press) [90] PCR (Introduction to Biotechniques Series), 2nd ed. (Newton & Graham eds., 1997, Springer Verlag) [91] Geysen et al. (1984) PNAS USA 81:3998-4002. [92] Carter (1994) Methods Mol Biol 36:207-23. [93] Jameson, B A et al. 1988, CABIOS 4 (1): 181-186. [94] Raddrizzani & Hammer (2000) Brief Bioinform 1 (2): 179-89. [95] Bublil et al. (2007) Proteins 68 (1):294-304. [96] De Lalla et al. (1999) J. Immunol. 163:1725-29. [97] Kwok et al. (2001) Trends Immunol 22:583-88. [98] Brusic et al. (1998) Bioinformatics 14 (2):121-30 [99] Meister et al. (1995) Vaccine 13 (6):581-91. [100] Roberts et al. (1996) AIDS Res Hum Retroviruses 12 (7):593-610. [101] Maksyutov & Zagrebelnaya (1993) Comput Appl Biosci 9 (3):291-7. [102] Feller & de la Cruz (1991) Nature 349 (6311):720-1. [103] Hopp (1993) Peptide Research 6:183-190. [104] Welling et al. (1985) FEBS Lett. 188:215-218. [105] Davenport et al. (1995) Immunogenetics 42:392-297. [106] Tsurui & Takahashi (2007) J Pharmacol Sci. 105 (4):299-316. [107] Tong et al. (2007) Brief Bioinform. 8 (2):96-108. [108] Schirle et al. (2001) J Immunol Methods. 257 (1-2): 1-16. [109] Chen et al. (2007) Amino Acids 33 (3):423-8. [110] Current Protocols in Molecular Biology (F. M. Ausubel et al., eds., 1987) Supplement 30 [111] Smith & Waterman (1981) Adv. Appl. Math. 2: 482-489. [112] Koeberling et al. (2009) Clin Vaccin Immunol 16:156-62. [113] Koeberling et al. (2011) Vaccine 29:4728-34.