Replication competent pseudo-type retrovirus vector system

Abstract

The present invention provides a vector system in which a MuLV-Gag gene, a MuLV-Pol gene, and a GaLV-Env gene are expressed in two separate vectors. The vector system is capable of inserting a therapeutic gene to these two separate vectors, and in this raged, the size of an inserted gene is not limited and a variety of foreign therapeutic genes may be inserted to the vectors. Accordingly, the foreign therapeutic gene may be delivered in a safe and efficient manner to desired tissue of cells of aberrant proliferation. Therefore, the vector system is applicable in a composition for delivering a gene targeting the aberrantly dividing cells of aberrant proliferation, wherein the composition includes a retrovirus produced by cell line transfection. The vector system is also applicable in a composition for preventing or treating a disease caused by cells of aberrant proliferation of, such as cancer cells.

Claims

1. A composition for delivering a gene targeting cells of aberrant proliferation, comprising: a retrovirus obtained by transfecting a cell line with a pseudotyped replication-competent retrovirus two-vector system having two separate vectors, said two separate vectors comprise, a first recombinant expression vector carrying a murine leukemia virus (MuLV)-Gag gene and a MuLV-Pol gene, the first recombinant expression vector comprising a first vector having a first plasmid map of FIG. 1, and a second recombinant expression vector carrying a gibbon ape leukemia virus (GaLV)-Env gene, the second recombinant expression vector comprising a second vector having a second plasmid map of FIG. 2.

2. The composition of claim 1, wherein the cells of aberrant proliferation comprise cancer cells.

3. The composition of claim 2, wherein the cancer cells are derived from myxoid and round cell carcinomas, locally advanced tumors, metastatic cancer, Ewing's sarcoma, cancer metastasis, lymphatic metastasis, squamous epithelial cell carcinoma, esophagus squamous epithelial cell carcinoma, oral carcinoma, multiple myeloma, acute lymphocytic leukemia, acute non-lymphocytic leukemia, chronic lymphocytic leukemia, chronic myelocytic leukemia, hairy cell leukemia, effusion lymphoma (body cavity based lymphoma), thymic lymphoma lung cancer, small cell carcinoma of the lung, cutaneous T-cell lymphoma, Hodgkin's lymphoma, non-Hodgkin's lymphoma, cancer of the adrenal cortex, ACTH-producing tumor, non-small cell carcinoma of the lung, breast cancer, small cell carcinoma, ductal carcinoma, stomach cancer, colon cancer, colorectal cancer, polyp associated with colorectal neoplasia, pancreatic cancer, liver cancer, bladder cancer, primary superficial bladder tumor, invasive transitional cell carcinomas of the bladder, muscle-invasive bladder cancer, prostate cancer, renal cell carcinoma, esophagus cancer, ovarian carcinoma, uterine cervical cancer, endometrial cancer, choriocarcinoma, ovarian cancer, primary peritoneal epithelial neoplasm, cervical carcinomas, vaginal cancer, cancer of the vulva, uterine cancer, solid tumor in the ovarian follicle, testicular cancer, penile cancer, renal cell carcinoma, brain cancer, head and neck cancer, neuroblastoma, asfrocytic brain tumor, glioma, metastatic tumor cell invasion in the central nervous system, osteoma, osteosarcoma, malignant melanoma, tumor progression of human skin keratinocyte, thyroid cancer, retinoblastoma, neuroblastoma, mesothelioma, Wilms's tumor, gall bladder cancer, trophoblastic neoplasm, hemangiopericytoma, or Kaposi's sarcoma.

4. The composition of claim 1, wherein the cells of aberrant proliferation are non-cancerous cells of aberrant proliferation derived from an inflammatory disease or a hyperproliferative vascular disorder.

5. The composition of claim 4, wherein the non-cancerous cells derived from inflammatory disease are derived from inflammatory-induced bone disease, degenerative arthritis, diabetes, autoimmune myositis, atherosclerosis, stroke, liver cirrhosis, meningitis, inflammatory gastric ulcer, gallbladder stone, kidney stone, paranasal sinusitis, rhinitis, conjunctivitis, asthma, dermatitis, inflammatory bowel disease, inflammatory collagen vascular disease, glomerulonephritis, inflammatory skin disease, rheumatoid arthritis, systemic lupus erythematosus, ankylosing spondylitis, Behcet's disease, ulcerative colitis, Crohn disease, psoriasis, atopic dermatitis, contact dermatitis, moist dermatitis, seborrheic dermatitis, lichen planus, lichen simplex chronicus, pemphigus, bellous pemphigus, epidermolysis bullosa, urticaria, angioedema, vasculitis, erythema, eosinophilia, nummular dermatitis, generalized exfoliative dermatitis, stasis dermatitis, disease of sebaceous gland, perioral dermatitis, pseudofolliculitus barbae, drug rash, erythema multiforme, erythema nodosum, granuloma annulare, or pelvic inflammatory disease (PID).

6. The composition of claim 4, wherein the non-cancerous cells of aberrant proliferation derived from hyperproliferative vascular disorder are derived from vascular sclerosis, atherosclerosis, restenosis and stenosis, vascular malformation, vascular access stenosis associated with blood dialysis, transplant arteriopathy, vasculitis, vascular inflammatory disease, Digeorge syndrome, hereditary hemorrhagic telangeiectasia (HHT), keloid scar, blister disease, hyperproliferative vitreous syndrome, retinopathy of prematurity, myopic choroidal neovascularization, macular degeneration, diabetic retinopathy, neovascularization, primary pulmonary hypertension, asthma, nasal polyps, inflammatory bowel and periodontal disease, endometriosis, ovarian cysts, ovarian hyperstimulation syndrome, arthritis, rheumatoid arthritis, chronic articular rheumatism, synovitis, osteoarthritis, osteomyelitis, osteophytosis, septicemia, or vascular leak syndrome.

7. The composition of claim 1, wherein the first recombinant expression vector and the second recombinant expression vector comprises a foreign-gene-inserted therapeutic gene for treating cancer by killing the cells of aberrant proliferation.

8. The composition of claim 7, wherein, the cells of aberrant proliferation comprise cancer cells, and the therapeutic gene comprises at least one selected from an apoptosis-related gene, an apoptosis-inducing gene, an immune gene, an angiogenesis inhibitor gene, and a sequence that expresses shRNA, miRNA, or siRNA that induces gene silencing (RNAi) capable of killing the cancer cells.

9. The composition of claim 8, wherein the apoptosis-related gene activates a prodrug.

10. The composition of claim 9, wherein the apoptosis-related gene comprises thymidine kinase of herpes simplex virus that activates a prodrug, GCV (Ganciclovir).

11. A method of manufacturing a pseudotyped replication-competent retrovirus vector system, the method comprising: preparing a first recombinant expression vector carrying a MuLV-Gag gene and a MuLV-Pol gene; and preparing a second recombinant expression vector carrying a GaLV-Env gene.

Description

DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 is a plasmid map of a first recombinant expression vector carrying a gag gene and a pol gene;

(2) FIG. 2 is a plasmid map of a second recombinant expression vector carrying a GaLV-Env gene;

(3) FIG. 3 depicts the second recombinant expression vector to which a therapeutic gene is added;

(4) FIGS. 4 and 5 depict subcloning of a sRCRgp-RFP vector, wherein

(5) FIG. 4 depicts that a pRCR(FvGEL199) vector is cut by ScaI and PmeI to remove a FvGEL199Env sequence and is self-ligated by a T4 DNA polymerase, and

(6) FIG. 5 depicts that an sRCRgp plasmid is cut by EcoRI to insert a marker gene, RFP, and is ligated with a fragment of mCMV promoter-RFP amplified by PCR from a pLentiM1.4-monomerRFP vector;

(7) FIG. 6 depicts subcloning of a spRCRe(GaLV-Env)GFP vector, wherein FIG. 6A depicts that a pMFG-eGFP-Puro vector is cut by XhoI and ClaI to insert an mCMV promoter and a GFP sequence and is ligated with a fragment of mCMV promoter-RFP amplified by PCR from a pLenti-M1.4-eGFP vector, and FIG. 6B depicts that a GaLV-Env sequence of a pMYK-ef1-GaLV-Env vector is amplified and inserted to a site that is cut by PmeI of the pMFG-mCMV-GFP2 vector (see FIG. 6A);

(8) FIG. 7 depicts subcloning of a spRCRe(GaIV-Env)TK vector, wherein FIG. 7A depicts that, to perform subcloning of a spRCR (GaLV-Env)MCS vector, a spRCRe(GaLV-Env)-GFP vector is cut by a restriction enzyme to remove eGFP and is self-ligated and a multi-cloning site is inserted to the spRCR(GaLV-Env)MCS vector by PCR amplification. The spRCR(GaLV-Env)MCS vector is cut by PmeI to insert a TK sequence. FIG. 7B depicts that the TK fragment cut by PmeI from a pSXLC-TK vector is inserted to the spRCR(GaLV-Env)MCS vector;

(9) FIG. 8 depicts a structure of a semi-pseudotyped replication-competent retrovirus (spRCR) vector that allows expression of a fluorescent marker protein, wherein FIG. 8A depicts the sRCRgp-RFP vector including two terminal LTRs, a structure for the Gag-Pol gene expression, and the RFP sequence, and the sRCRe(MuLV-Env)-GFP vector including an expression marker, a structure for the MuLV-Env gene expression, and the GFP sequence, and FIG. 8B depicts that the MuLV-Env gene of the sRCRe(MuLV-Env)-GFP vector is replaced by the GaLV-Env gene;

(10) FIGS. 9 and 10 show replication kinetics of the sRCR(MuLV-Env)-FL and spRCR(GaLV-Env)-FL vectors with high titer, wherein

(11) FIGS. 9A and 9B show the results of measuring fluorescence by flow cytometry to determine percentages of cells that express a GFP gene or a RFP gene based on the observation of the cells under a fluorescence microscope at various time points after the cells were infected by 2.510.sup.7 genomic copies of Human glioma cells (U-87 MG) with the sRCR-FL vector or the spRCR-FL vector;

(12) FIG. 10 shows percentages of cells that express a GFP gene or a RFP gene measured by flow cytometry.

(13) FIGS. 11 and 12 show replication kinetics of the sRCR(MuLV-Env)-FL and spRCR(GaLV-Env)-FL vectors with high titer, wherein

(14) FIGS. 11A and 11B show percentages of a GFP gene or a RFP gene expressed by an Env vector or a Gag-Pol vector, and FIG. 12 depicts a comparison between replication kinetics of a spRCRe(GaLV-Env)-GFP vector and that of a sRCRe(MuLV-Env)-GFP vector;

(15) FIGS. 13 and 14 show replication kinetics of the sRCR(MuLV-Env)-FL and spRCR(GaLV-Env)-FL vectors with low titer, wherein

(16) FIGS. 13A and 13B show the results of measuring fluorescence by flow cytometry to determine percentages of cells that express a GFP gene or a RFP gene based on the observation of the cells under a fluorescence microscope at various time points after the cells were infected by 1.510.sup.6 genomic copies of Human glioma cells (U-87 MG) with the sRCR-FL vector or the spRCR-FL vector;

(17) FIGS. 15 and 16 show replication kinetics of the sRCR(MuLV-Env)-FL and spRCR(GaLV-Env)-FL vectors with low titer, wherein

(18) FIG. 15 shows percentages of a GFP gene or a RFP gene expressed by a Env vector and a Gag-Pol vector, and FIG. 16 depicts a comparison between replication kinetics of a spRCRe(GaLV-Env)-GFP vector and that of a sRCRe(MuLV-Env)-GFP vector;

(19) FIG. 17 depicts a structure of a spRCR vector that allows gene expression, wherein FIGS. 17A and 17B each depicts a structure of an Env vector in which a GFP gene is replaced by herpes simplex virus type I thymidine kinase (TK) gene;

(20) FIG. 18 depicts the expression of the TK gene of the spRCR vector that allows expression of the TK gene, based on the observation of the HSV-TK expression in A549 cells by a western blotting, wherein Lane 1 denotes untreated A549 cells, Lane 2 denotes A549 cells infected with a spRCR(GaLV-Env)-TK virus, and Lane 3 denotes A549 cells infected with a sRCR(MuLV-Env)-TK virus, and Lane 4 denotes gp293 cells transfected with a spRCR(GaLV-Env)-TK plasmid;

(21) FIGS. 19 and 20 depict cytotoxicity of a semi-RCR-TK/GCV vector in U-87 MG cells, wherein

(22) FIG. 19 depicts the results of the cell viability measured by MTT analysis by which spRCR(GaLV-Env)-TK transduced U-87 MG are treated with GCV in various concentrations from 0 to 70 g/ml beginning at 0 day;

(23) FIG. 20 depicts the results of the cell viability measured by MTT analysis by which spRCR(GaLV-Env)-FL, sRCR(MuLV-Env)-TK, and spRCR(GaLV-Env)-TK transduced U-87 MG cells are treated with GCV in a concentration of 10 g/ml;

(24) FIG. 21 depicts dispersion of a semi-RCR virus in human gliomas, wherein FIG. 21A depicts that human glioma (U-87 MG) are infected with a striatum of a nude mouse to form cancer cells, and after 7 days of the infection, 1.510.sup.7 genomic copies (10.sup.4 TU) of a semi-RCR-FL vector are injected to the heterotransplanted cancer cells, and after 18 days of the viral infection, the cancer cells are subjected to cryosection. FIGS. 21B and 21C are integrated images showing the expression of the GFP gene or the RFP gene by the dispersion of the sRCR(MuLV-Env)-FL vector (FIG. 21B) or the spRCR(GaLV-Env)-FL vector (FIG. 21C);

(25) FIG. 22 depicts the results of the survival period obtained after infecting the brain tumor transplanted nude mouse with spRCR-TK vector;

(26) FIG. 23 depicts PCR results obtained by adding a certain number of gene copies to 100 ng of nude mouse genomic DNA to draw a standard curve of the qPCR, and shows data including standard deviation calculated by repeating the experiments 3 times;

(27) FIG. 24 is a graph showing CT values obtained by performing intratumoral injection of a spRCR-GFP vector into the brain tumor transplanted nude mouse and by performing qPCR using 100 ng of each organ's DNA as a sample. The graph also shows data including standard deviation calculated by repeating the experiments 3 times;

(28) FIG. 25 is an image that confirms the presence of spRCR-GFP genome in 100 ng of the nude mouse genomic DNA by using PCR. The image also shows the results of electrophoresis obtained after performing intratumoral injection of the spRCR-GFP vector into the brain tumor transplanted nude mouse and performing PCR using 100 ng of each organ's DNA as a sample; and

(29) FIG. 26 is PET-CT images showing virus dispersion in cancerous tissues through proliferation of the virus after infecting the brain tumor transplanted nude mouse with the spRCR-TK vector.

BEST MODE

(30) The present invention provides including a first recombinant expression vector carrying a MuLV-Gag gene and a MuLV-Pol gene; and a second recombinant expression vector carrying a GaLV-Env gene.

(31) The first recombinant expression vector may include a vector having a plasmid map of FIG. 1.

(32) The second recombinant expression vector may include a vector having a plasmid map of FIG. 2.

(33) The first recombinant expression vector of the second recombinant expression vector may include a therapeutic gene for cells of aberrant proliferation.

(34) The second recombinant expression vector may include a vector having a plasmid map of FIG. 3.

(35) The present invention provides a retrovirus produced by transfecting a cell strain with the vector system.

(36) The present invention provides a composition including the retrovirus for delivering genes targeting cells of aberrant proliferation.

(37) The cells of aberrant proliferation may be cancer cells.

(38) The cancer cells may include cells derived from myxoid and round cell carcinomas, locally advanced tumors, metastatic cancer, Ewing's sarcoma, cancer metastasis, lymphatic metastasis, squamous epithelial cell carcinoma, esophagus squamous epithelial cell carcinoma, oral carcinoma, multiple myeloma, acute lymphocytic leukemia, acute non-lymphocytic leukemia, chronic lymphocytic leukemia, chronic myelocytic leukemia, hairy cell leukemia, effusion lymphoma (body cavity based lymphoma), thymic lymphoma lung cancer, small cell carcinoma of the lung, cutaneous T-cell lymphoma, Hodgkin's lymphoma, non-Hodgkin's lymphoma, cancer of the adrenal cortex, ACTH-producing tumor, non-small cell carcinoma of the lung, breast cancer, small cell carcinoma, ductal carcinoma, stomach cancer, colon cancer, colorectal cancer, polyp associated with colorectal neoplasia, pancreatic cancer, liver cancer, bladder cancer, primary superficial bladder tumor, invasive transitional cell carcinomas of the bladder, muscle-invasive bladder cancer, prostate cancer, renal cell carcinoma, esophagus cancer, ovarian carcinoma, uterine cervical cancer, endometrial cancer, choriocarcinoma, ovarian cancer, primary peritoneal epithelial neoplasm, cervical carcinomas, vaginal cancer, cancer of the vulva, uterine cancer, solid tumor in the ovarian follicle, testicular cancer, penile cancer, renal cell carcinoma, brain cancer, head and neck cancer, neuroblastoma, asfrocytic brain tumor, glioma, metastatic tumor cell invasion in the central nervous system, osteoma, osteosarcoma, malignant melanoma, tumor progression of human skin keratinocyte, thyroid cancer, retinoblastoma, neuroblastoma, mesothelioma, Wilms's tumor, gall bladder cancer, trophoblastic neoplasm, hemangiopericytoma, or Kaposi's sarcoma.

(39) The cells of aberrant proliferation may be non-cancer cells derived from inflammatory disease or hyperproliferative vascular disorder.

(40) The non-cancerous cells of aberrant proliferation derived from the inflammatory disease may include cells derived from inflammatory-induced bone disease, degenerative arthritis, diabetes, autoimmune myositis, atherosclerosis, stroke, liver cirrhosis, meningitis, inflammatory gastric ulcer, gallbladder stone, kidney stone, paranasal sinusitis, rhinitis, conjunctivitis, asthma, dermatitis, inflammatory bowel disease, inflammatory collagen vascular disease, glomerulonephritis, inflammatory skin disease, rheumatoid arthritis, systemic lupus erythematosus, ankylosing spondylitis, Behcet's disease, ulcerative colitis, Crohn disease, psoriasi, atopic dermatitis, contact dermatitis, moist dermatitis, seborrheic dermatitis, lichen planus, lichen simplex chronicus, pemphigus, bellous pemphigus, epidermolysis bullosa, urticaria, angioedema, vasculitis, erythema, eosinophilia, nummular dermatitis, generalized exfoliative dermatitis, stasis dermatitis, disease of sebaceous gland, perioral dermatitis, pseudofolliculitus barbae, drug rash, erythema multiforme, erythema nodosum, granuloma annulare, or pelvic inflammatory disease (PID).

(41) The non-cancerous cells of aberrant proliferation derived from the hyperproliferative vascular disorder may include cells derived from vascular sclerosis, atherosclerosis, restenosis and stenosis, vascular malformation, vascular access stenosis associated with blood dialysis, transplant arteriopathy, vasculitis, vascular inflammatory disease, Digeorge syndrome, hereditary hemorrhagic telangeiectasia (HHT), keloid scar, blister disease, hyperproliferative vitreous syndrome, retinopathy of prematurity, myopic choroidal neovascularization, macular degeneration, diabetic retinopathy, neovascularization, primary pulmonary hypertension, asthma, nasal polyps, inflammatory bowel and periodontal disease, endometriosis, ovarian cysts, ovarian hyperstimulation syndrome, arthritis, rheumatoid arthritis, chronic articular rheumatism, synovitis, osteoarthritis, osteomyelitis, osteophytosis, septicemia, or vascular leak syndrome.

(42) The present invention provides a composition including a retrovirus for preventing or treating a disease causing aberrant proliferation of cells, wherein the retrovirus is produced by transfecting a cell strain.

(43) The therapeutic gene for cancer may include at least one selected from the group consisting of an apoptosis-related gene, an apoptosis-inducing gene, an immune gene, an angiogenesis inhibitor gene, and a sequence that expresses shRNA, miRNA, or siRNA that induces gene silencing (RNAi) capable of killing cancer cells.

(44) The apoptosis-related gene may activate a prodrug.

(45) The apoptosis-related genes may include herpes simplex virus thymidine kinase (HSV-TK), which may activate prodrug, GCV (Ganciclovir).

(46) The present invention provides a method of manufacturing a pseudo-type replication-competent retrovirus vector system, the method including: preparing a first recombinant expression vector carrying the MuLV-Gag gene and the MuLV-Pol gene; and preparing a second recombinant expression vector carrying the GaLV-Env gene.

MODE OF THE INVENTION

(47) The present invention provides a vector system in which a MuLV-Gag gene, a MuLV-Pol gene, and a GaLV-Env gene are expressed in two separate vectors, a retrovirus produced by transfecting a cell strain with the vector system, a composition including the retrovirus for delivering genes targeting cells of aberrant proliferation, a composition for preventing and treating cancer, and a method of manufacturing the vector system in which the MuLV-Gag gene, the MuLV-Pol gene, and the GaLV-Env gene are expressed in two separate vectors. The present invention will now be described in greater detail with reference to the following examples. In this regard, the present Examples are merely described to explain aspects of the present description and should not be construed as being limited to the descriptions set forth herein.

EXAMPLE

Example 1

Cell Culture

(48) 293T (human embryonic kidney) cells and U-87 MG (human glioma) cells were cultured in Dulbecco's Minimal Essential Medium (DMEM, Thermo Hyclone) to which 10% fetal bovine serum (Invitrogen) and antibiotics (Invitrogen) were added. In all experiments, cells were cultured in a cell culture vessel (e.g., a 100 mm dish and a 6-well plate) in a 5% CO.sub.2 incubator, and then, were subjected to subcloning at a ratio of 1:5 when the frequency of the cultured cells reached 70% to 80%.

Example 2

Manufacture of Vector

(49) In order to manufacture a sRCRgp-RFP vector carrying a marker gene, RFP (see FIGS. 4 and 5), a FvGeI199Env gene of a pRCR (FvGEL199Env) vector was cut and removed by Sca I and Pme I. Genes from an mCMV promoter to a RFP gene of a pLenti M1.4-momomerRFP vector were cut by PpuM I and Not I, thereby connecting the genes to the pRCR (FvGEL199Env) vector by blunt end ligation.

(50) In order to manufacture a spRCRe (GaLV-Env)-GFP vector carrying a marker gene, GFP (see FIG. 6), an Xho I site in downstream of a gag gene and a Cla I site in upstream of 3LTR of a MFG-eGFP-Puro vector were cut and removed. Genes from an mCMV gene to an eGFP gene, which were cut from a pLenti M1.4-eGFP vector, were amplified by PCR for ligation, thereby manufacturing a MFG-mCMV-GFP2 vector (Forward: Sal I-Pme I-mCMV, Reverse: Cla I-GFP). In order to insert a GaLV-Env sequence to a site between the Gag gene and the mCMV gene of the MFG-mCMV-GFP2 vector, PCR was performed by using a MYK-ef1-GaLV-Env vector as a template and a primer set each including a Pme I site. Then, the previously manufactured vector was cut by Pme I to ligate with an insert.

(51) In order to insert a therapeutic gene instead of a marker gene, an eGFP gene was cut by BamH I and Cla I, and then, inserted to a multi cloning site, thereby manufacturing a spRCR (GaLV-Env)-MCS vector.

(52) In order to insert a TK gene to the spRCR (GaLV-Env)-MCS vector (see FIG. 7), a pSXLC-TK vector was cut by Nco I and Xho I and was resulted in blunt ends by a T4 DNA polymerase (TAKARA). Afterwards, the spRCR(GaLV-Env)-MCS vector was cut by Pme I, followed by being treated with CIAP and ligated with an insert.

(53) In order to manufacture a sRCRe (MuLV-Env) vector, a site in upstream of the mCMV was cut by Pme I from the previously manufactured MFG-mCMV-GFP2 vector. In order to prepare an Amphotropic MuLV-Env insert, a MuLV-Env gene of an EQPAM-Am vector was subjected to PCR for ligation using a primer set each including a Pml I location in forward and reverse sites.

(54) In order to insert a TK gene to the sRCR (MuLV-Env)-RFP vector, both ends of a RFP gene were cut by Hpa I from the sRCR (MuLV-Env)-RFP vector, and the TK gene was cut by Hpa I and Cla I from a spRCR (GaLV-Env)-TK vector and was resulted in blunt end ligation.

(55) TABLE-US-00001 TABLE 1 Vector Fragment Ligation step sRCRgp-RFP Vector pRCR(FvGEL199Env).fwdarw. Sca I, Pme I .fwdarw. self ligation (sRCRgp) .fwdarw. EcoR I .fwdarw. T4DNAPol .fwdarw. CIAP Insert pLentiM1.4-monomerRFP .fwdarw. PpuM I, Not I.fwdarw. T4DNAPol Ligation Blunt end ligation

(56) TABLE-US-00002 TABLE2 Vector Fragment Ligationstep spRCRe Vector1 MFG-eGFP-Puro.fwdarw. Xho|,Cla| .fwdarw. T4DNA (GaLV-Env)-GFP Pol.fwdarw. CIAP Insert1 M1.4-eGFP.fwdarw. PCR Forward(SalI-PmeI-mCMV): CCGTCGACGTTTAAAC AACAGGAAAGTTCCATTG Reverse(ClaI-GFP): CCATCGATTTACTTGTACAGCTCGTCCA Ligation1 Bluntendligation(MFG-mCMV-GFP2) Vector2 MFG-mCMV-GFP2.fwdarw. PmeI.fwdarw. CIAP Insert2 MYK-ef1-GaLVEnV.fwdarw. PCR Forward(PmlI-GaLV-Env): CGGCACGTGATGGTATTGCTGCCTGGG Reverse(GaLV-PmlI-R): GCCCACGTGTTAAAGGTTACCTTCGTT.fwdarw. PmlIcut Ligation2 Stickyendligation spRCR(GaLV- Vector1 spRCR(GaLV-Env)-GFP.fwdarw. BamHI,ClaI.fwdarw. Env)-TK cuttingout Insert1 PCR(Multicloningsite) Forward(BamHI,HpaI,NotI, PmeI,SalI,ClaI): CGGGATCCGCGTTAACATTT GCGGCCGCTTTAGTTTAAACGCGTCGAC CCATCGATGG Reverse(BamHI,HpaI,NotI, PmeI,SalI,ClaI): CCATCGATGGGTCGACGCGTTTAAAC TAAAGCGGCCGCAAATGTTAACGC GGATCCCG.fwdarw. BamHI,ClaIcut Ligation1 Stickyendligation Vector2 spRCRe(GaLV-Evn)-MCS.fwdarw. PmeIcut Insert2 pSXLC-TK.fwdarw. NcoI,XhoI.fwdarw. T4DNAPol Ligation2 Bluntendligation

(57) TABLE-US-00003 TABLE3 Vector Fragments Ligationstep sRCR(MuLV-Env)-GFP Vector MFG-mCMV-GFP2.fwdarw. PmlI,PmeI.fwdarw. CIAP Insert EQPAM-Am(AF010170).fwdarw. PCR Forward(PmlI-MuLV-Env): CGGCACGTG ATGGCGCGTTCAACGCTCTCA Reverse(PmlI-MuLV-Env): GCCCACGTG CTATGGCTCGTACTCTATAGG.fwdarw. PmlIcut Ligation Bluntendligation sRCR(MuLV-Env)-TK Vector1 MFG-mCMV-GFP2.fwdarw. BamHI,ClaI Insert1 shLenti2.4R.fwdarw. PCR Forward(BamHI-HpaI-RFP): CGGGATCC GTTAACATGGCCTCCTCCGAGAACGTC Reverse(HpaI-ClaI-RFP): CCATCGATGTTAAC CTACAGGAACAGGTGGTGGCG.fwdarw. BamHI,ClaIcut Ligation1 Stickyendligation(MFG-mCMV-RFP) Vector2 MFG-mCMV-RFP.fwdarw. PmlI.fwdarw. CIAP Insert2 pGEM-T-EQPAMEnv#2.fwdarw. PmlI Ligation2 Bluntendligation(sRCR(MuLV-Env)-RFP) Vector3 sRCR(MuLV-Env)-RFP.fwdarw. HpaIcuttingout.fwdarw. CIAP Insert3 spRCR(GaLV-Env)-TK.fwdarw. HpaI,ClaIcut.fwdarw. T4DNAPol Ligation3 Bluntendligation

Example 3

Virus Production

(58) One day before performing transfection, 293T cells were inoculated with a growth medium at 610.sup.5 cells/well in a 6-well plate. Next day, 1 ml of the growth medium was replaced by an FBS-free DMEM medium. The 6-well plate was placed again in an incubator, and 100 l/well of a DMEM medium was added to two separate 1.5 ml tubes. DNA (total 1 g) of Tables above and PLUS reagent (Invitrogen) (5 l/well) were added to one tube while lipopectamine reagent (Invitrogen) (3 l/well) was added to another tube, and each of which tubes was vortexed for 10 seconds. After culturing at room temperature for 15 minutes, a solution from the lipopectamine-containing tube was added to the PLUS-containing tube, and then, the PLUS-containing tube was vortexed again for 10 seconds. After culturing at room temperature for 20 minutes, the plate where the cells underlay at the bottom of the plate was taken out from the incubator, and 208 l/well of the cells was added dropwise without losing the cells to the tube. After placing the tube back to the incubator, the cell medium was removed in 4 hours and a DMEM media containing 3% FBS were added carefully thereto. Here, viruses to be used in animal experiments did not contain FBS. 48 hours later, the cell medium was harvested and collected in a tube. For the concentration and purification of the cells, the viruses were added to Amicon 100K (Millipore) and centrifuged at a temperature of 4 C. at 3,000 rpm until the number of the viruses reached 10 greater. The resultant included in the 1.5 ml tube was labeled with a date that the tube was prepared, and was divided by 100 l and stored at a temperature of 80 C.

(59) In order to quantitate the virus, a Retrovirus Titer Set for Realtime PCR (TaKaRa) was used. The kit includes a primer that recognizes a packaging signal region of MuLV, and a marker probe, SYBR Green I. An excess of DNA was used during the virus transfection. Thus, in order to remove such an excess of DNA, DNase I process [25 l in total (Virus Supernatant 12.5 l, 10DNase Buffer 2.5 l, DNase(5 U/l) 2.0 l RNase Inhibitor (40 l) 0.5 l, RNase-Free Water 7.5 l); 37 C., 30 min/70 C., 1 minute] was performed thereafter.

(60) A standard sample was prepared by serial dilution with RNA control template included in the Kit. The real time PCR was performed as follows (103, 104, 105, 106, 107, 108 copies/l) [25 l in total (2 One Step SYBR RT-PCR Buffer III 12.5 l, TaKara Ex Taq HS (5 u/l) 0.5 l, PrimeScript RT Enzyme Mix II 0.5 l, Forwaard Titer Primer FRT-1 (10 pmol/l) 0.5 l, Reverse Titer Primer FRT-1 (10 pmol/l) 0.5 l, 2 l of a virus supernatant or a standard sample, 8.5 l of RNase-Free Water; Reverse transcription, 42 C., 5 minutes/95 C., 10 seconds; PCR, 40 cycles, 95 C., 5 seconds/60 C. 30 seconds; Dissociation, 95 C., 15 seconds/60 C., 30 seconds/95 C., 15 seconds].

(61) A standard curve was drawn and a sample value was calculated therefrom.

(62) TABLE-US-00004 TABLE 4 Transfer gene Vector Vector used in virus production Reporter gene sRCR-FL sRCRgp-RFP + sRCRe(MuLV-env)-GFP spRCR-FL sRCRgp-RFP + spRCRe(GaLV-env)-GFP Therapeutic gene sRCR-TK sRCRgp-RFP + sRCRe(MuLV-env)-TK spRCR-TK sRCRgp-RFP + spRCRe(GaLV-env)-TK

Example 4

Replication Patterns According to Times Required for spRCR Vector In Vitro

(63) A conventional RCR vector associated with MuLV virus allowed expression of Gag-Pol, MuLV-Env, and a reporter gene (or a therapeutic gene) in one vector. However, the semi-pseudotyped replication-competent retrovirus (spRCR) vector as used herein allowed expression of Gag-Pol, GaLV-Env, and a reporter gene (or a therapeutic gene) in two separate vectors. Thus, a sRCRgp vector allowed expression of Gag-Pol, and its intracellular expression may be confirmed by RFP. The sRCRe(MuLV-Env) and the spRCRe(GaLV-Env) vectors each allowed the expression of MuLV-Env and GaLV-Env, which may be confirmed by GFP (FIG. 8).

(64) The virus was produced through a top agar medium by transient transfection of the 293T cells with the two separate vectors. The same virus was subjected to quantitative real time PCR to calculate the number of genomic copies. 2.510.sup.7 and 1.510.sup.6 genome copies (gc) (0.01MOI, 0.0005MOI) of spRCR-FL and sRCR-FL were each infected with U-87 MG cells, and every 2 to 3 days, a fluorescence image of the cells was obtained before carrying out the subcloning. The cells remained after the subculturing were then subjected to FACS analysis. According to FACS data, in the case of the cell infection with high titer (genome copy, gc), the infection rate or fluorescence intensity of the spRCR(GaLV-Env) was relatively higher than that of the sRCR(MuLV-Env). After 12 days of the infection, the sRCR(MuLV-Env) vector was remained at 80% infection yet while the spRCR(GaLV-Env) vector was close to 100% infection (see FIGS. 9 to 12). Alternatively, in the case of the cell infection with low titer, the spRCR(GaLV-Env) and sRCR(MuLV-Env) vectors had a more obvious difference in infection rates therebetween. These two vectors had slow infection rates at the beginning of the infection in the case of the cell infection with low titer, but 20 days after the cell infection, the sRCR(MuLV-Env) vector was resulted in only 2% infection while the spRCR(GaLV-Env) vector was resulted in 94% infection (see FIGS. 13 to 16).

Example 5

Confirmation of Thymidine Kinase Protein Expressed in spRCR-TK

(65) A GFP gene was deleted from an Env vector that allows expression of a reporter gene, and then, a therapeutic gene, thymidine kinase (TK) was cloned thereto (see FIG. 17). In order to confirm whether the TK protein is actually expressed in the spRCR-TK vector, a western blotting was performed.

(66) As shown in FIG. 18, it was confirmed that no band appeared in untreated A549 cells while bands appeared in cells that were infected or transduced with spRCR-TK, sRCR-TK, and pRCR-TK, which allow expression of the TK gene.

Example 6

Sensitivity of Cells Infected with spRCR-TK Vector According to GCV Concentrations

(67) In order to measure a degree of cytotoxicity of the cells infected with the spRCR-TK vector when treated with GCV in vitro, MTT assay was carried out. First, a vector carrying a therapeutic gene, TK, instead of a GFP gene of the Env vector was prepared. Then, the 293T cells were transfected with the prepared vector and a Gag-pol vector, so as to manufacture the spRCR-TK vector. Then, the U-87 MG cells were infected with the virus of the spRCR-TK vector, and maintained for 14 days. Afterwards, the infected cells and non-infected cells were inoculated into a 96-well plate. Next day after the inoculation, the concentration of GCV was gradually increased to 0, 10, 20, 30, 40, 50, 60, and 70 g/ml for the treatment. The GCV treatment period was divided as the 1.sup.st, 2.sup.nd, 3.sup.rd, and 4.sup.th day, to perform MTT assay.

(68) In the 1.sup.st day of the treatment with 10 g/ml of GCV, the number of the cells infected with the sRCR-TK vector was decreased by 40% one day after the GCV treatment, and the number of the cells infected with the spRCR-TK vector was decreased by 60%. Meanwhile, normal cells showed their cytoxicity in concentration starting from GCV 70 g/ml (see FIGS. 19 and 20).

Example 7

Spread Pattern of spRCR-FL and sRCR-FL Vectors in Xenografted Tumor Tissues

(69) In order to figure out spread pattern of the spRCR-FL and sRCR-FL vectors in xenografted tumor tissue of a nude mouse, a brain striatum of the nude mouse was transplanted with 310.sup.5 of the U-87 MG cells. After 7 days of the cancer transplantation, 1.510.sup.7 gc (10.sup.4 TU)/10 l of a viral vector was injected to the tumor tissue. After 18 days of the viral injection, the tumor tissue was examined by using a fluorescent microscope.

(70) Fluorescence was observed only in cancer cells. That is, the virus was not infected anywhere in the normal brain. The cancer cells infected with the sRCR-FL vector showed very weak fluorescence and were topically infected with the virus, whereas the tumor tissue infected with the spRCR-FL vector showed clearly and entirely expression of fluorescence gene (see FIG. 21).

Example 8

Survival Period of Brain Tumor-Transplanted Nude Mouse Upon spRCR-TK Infection (+GCV Injection)

(71) In the same manner as in described above, a brain striatum of a nude mouse was transplanted with the U-87 MG cells. After 1 week of the tumor transplantation, 1.510.sup.7 gc (10.sup.4 TU)/10 l of the cancer cells infected with the spRCR-TK vector and 10 l of PBS (control) were used for intratumoral injection. Then, PBS or GCV (100 mg/kg) was injected intraperitoneally thereto after 21 to 51 days of the tumor transplantation.

(72) Regarding mice in a control group (N=13), all the mice died around 40 days after the tumor transplantation. Regarding mice in a test group (N=21), 100 mg/kg of GCV was injected to the mice every day, and all the mice survived up to 70 days after the tumor transplantation upon the completion of the observation. Meanwhile, all the mice in the test group maintained their normal body weights (see FIG. 22).

Example 9

Safety of spRCR Vector

(73) A brain striatum of a female, nude mouse aged 6 weeks was transplanted with 310.sup.5 of the U-87MG cells. After 7 days of the transplantation, the 10.sup.7 gc spRCR-FL vector was injected intratumorally. After 7 days of the injection, the mouse was subjected to perfusion, and the skin was ripped off in sterile conditions from the normal brain next to tumor, tumor, heart, lung, liver, kidney, spleen, intestine, ovary, bone marrow, and a surgical site. Here, a genome DNA was prepared by using the Tissue prep kit (GeneAII).

(74) To perform quantitative PCR, a primer was designed as shown in Table 5 below.

(75) TABLE-US-00005 TABLE5 ForwardPrimer 5-TCCAGGTAAACTGACAGC-3 ReversePrimer 5-CGCCTTTCTAGCCTCTAA-3 FAMprobe 5-TGTTCTCATCACCCATCAGCCCAC-3

(76) Compositions for the PCR reaction include 10 l of 2IQ Supermix (2), 0.4 l (10 pmol/l) of sense primer, 0.4 l (10 pmol/l) of anti-sense primer, 2 l (50 ng/l) of gDNA, 0.03 l (100 pmol/l) of FAM probe, and 7.2 l of sterilized water, resulting in a total volume of 20.03 l.

(77) In CFX real time PCR C1000 Thermo (Bio-Rad), the PCR was repeating 40 cycles, each of which cycles was performed at a temperature of 95 C. for 30 minutes, at a temperature of 95 C. for 20 seconds, and at a temperature of 58 C. for 60 seconds. Data obtained therefrom were analyzed after the completion of the PCR reaction.

(78) In order to perform a general PCR in the same tissue, 0.5 g of sample DNA, 0.5 M of each primer), and 20 l of 5 units TaKaRa Ex Taq polymerase were prepared and subjected to the PCR by repeating 30 cycles, each of which cycles was performed at a temperature of 94 C. for 1 minute, at a temperature of 60 C. for 30 seconds, and at a temperature of 72 C. for 1 minutes. Here, a primer that recognizes pol and GFP genes of the vector was used. The production was obtained in a size of 3.5 kb, and a sequence of the primer is shown in Table 6 below.

(79) TABLE-US-00006 TABLE6 Forwardprimer 5-GGAAAGGACCTTACACAGTC-3 (pol) Reverseprimer 5-CGGGTTAACTTACTTGTACAGCTCGTCC-3 (GFP)

(80) The PCR product was subjected to electrolysis for 40 minutes in 1% agarose gel at a voltage of 100 V.

(81) The genomic DNA was extracted from the normal brain, tumor tissue, heart, lung, liver, kidney, spleen, intestine, ovary, bone marrow, and a surgical site, or the like, was subjected to qPCR and PCR analysis. As a result, it was confirmed that the GFP sequence was found only in tumor tissues while the GFP sequence was not found in any other tissues (FIGS. 23 to 25).

Example 10

PET-CT Scanning on Mice with HSV-TK Expression in Brain Tumor

(82) In the same manner as in described above, a brain striatum of the nude mouse was transplanted with the U-87 MG cells (n=6). After 7 days of the tumor transplantation, 1.510.sup.7 gc (10.sup.4 TU)/10 l of the comparative spRCRe-TK vector (replication-defective) or the replication-competent spRCR-TK viral vector was injected intratumorally. After the viral injection, PET-CT scanning was performed on the 3.sup.rd, 7.sup.th, 10.sup.th, 14.sup.th and 17.sup.th day of the viral injection. 500 Ci/50 l of [.sup.18F]FHBG was injected intravenously (i.v.) to each of the mice, and 1 hour later, the mice were subjected to animal PET-CT (eXplore VISTA CT, GE) scanning. The CT scanning was performed under conditions of 250 A and 40 KA. The PET scanning was completed by obtaining images for 5 minutes and performing 2D OSEM reconstruction. The images obtained therefrom were then analyzed and implemented by using the Osirix imaging software (The Osirix Foundation, Geneva, Switzerland) (see FIG. 26).

(83) As shown in FIG. 26, it was found that the replication-defective virus barely spread in the cancerous tissues while the replication-competent spRCR-TK virus spread in the tumor tissues in a significantly efficient manner.