Interaction of moraxella catarrhalis with epithelial cells, extracellular matrix proteins and the complement system
09657067 ยท 2017-05-23
Assignee
Inventors
Cpc classification
C07K19/00
CHEMISTRY; METALLURGY
C07K14/78
CHEMISTRY; METALLURGY
C07K14/212
CHEMISTRY; METALLURGY
C12N15/101
CHEMISTRY; METALLURGY
International classification
Abstract
The present disclosure relates to surface proteins of Moraxella catarrhalis and their ability to interact with epithelial cells via cell-associated fibronectin and laminin, and also to their ability to inhibit the complement system. These surface proteins are useful in the preparation of vaccines. The present disclosure also provides peptides interacting with fibronectin, laminin and the complement system.
Claims
1. A cDNA encoding a polypeptide consisting of an amino acid sequence selected from SEQ ID NOs 6, 7, and 8.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
MATERIALS AND METHODS
(23) Interaction Between M. catarrhalis and Fibronectin Bacterial Strains and Culture Conditions
(24) The sources of the clinical M. catarrhalis strains are listed in table 7. M. catarrhalis BBH18 and RH4 mutants were constructed as previously described. [23, 58] The M. catarrhalis strains were routinely cultured in brain heart infusion (BHI) liquid broth or on BHI agar plates at 37 C. The UspA1-deficient mutants were cultured in BHI supplemented with 1.5 g/ml chloramphenicol (Sigma, St. Louis, Mo.), and UspA2-deficient mutants were incubated with 7 g/ml zeocin (Invitrogen, Carlsbad, Calif.). Both chloramphenicol and zeocin were used for growth of the double mutants.
(25) TABLE-US-00014 TABLE 7 Clinical strains of M. catarrhalis used in the present study Strain Clinical Source Reference BBH18 Sputum [53] D1 Sputum [53] Ri49 Sputum [53] C10 Sputum [10] F16 Sputum [10] Bro2 Respiratory tract [53] Z14 Pharynx [10] S6-688 Nasopharynx [23] Bc5 Nasopharynx [20] RH4 Blood [53] RH6 Blood [53] R14 Unknown [10] R4 Unknown [10] S-1914 Tympanic cavity aspirate [23] Note: The strains C10, R4 did not have the uspA1 gene, whereas F16, R14, Z14 lacked the uspA2 gene.[10] The remaining strains contained both uspA1 and A2 genes (data not shown).
DNA Method
(26) To detect the presence uspA1, A2, and A2H genes in those strains which this was unknown, primers and PCR conditions as described by Meier et al. was used. [50] Partial sequencing was also carried out with the UspA1.sup.299-452 and UspA2.sup.165-318 5 and 3 primers of the respective uspA1 and uspA2 gene of RH4 and BBH18. Confirmation of the presence of the amino acid residues DQKADIDNNINNIYELAQQQDQHSSDIKTLK (SEQ ID NO: 1) was also performed by PCR with a primer (5-CAAAGCTGACATCCAAGCACTTG-3) (SEQ ID NO: 54) designed from the 5 end of this sequence and 3 primers for uspA1 and A2 as described by Meier at al. [50]
(27) Recombinant Proteins Construction and Expression
(28) Recombinant UspA1.sup.50-770 and UspA.sup.230-539, which are devoid of their hydrophobic C-termini, has recently been described. [58] The genomic DNA was extracted from M. catarrhalis Bc5 using a DNeasy tissue kit (Qiagen, Hilden, Germany). In addition, recombinant proteins corresponding to multiple regions spanning UspA1.sup.50-770 and UspA2.sup.30-539 were also constructed by the same method. The primers used are listed in table 8. All constructs were sequenced according to standard methods. Expression and purification of the recombinant proteins were done as described previously. [59] Proteins were purified using columns containing a nickel resin (Novagen) according to the manufacturer's instructions for native conditions. The recombinant proteins were analyzed on SDS-PAGE as described. [21] Table 8. Primers used in this present study (5 primers are disclosed as SEQ ID NOS 55-69, respectively, in order of appearance; 3 primers are disclosed as SEQ ID NOS 70-84, respectively, in order of appearance)
(29) TABLE-US-00015 Protein 5 primer 3 primer UspA1.sup.50-770 gcgtctgcggatccagtag ccctgaagctttagtgcata gcaaggcaacc acctaattg UspA1.sup.50-491 gcgtctgcggatccagtag ttgagcaagcttagcttggt gcaaggcaacc ttttagcg UspA1.sup.50-197 gcgtctgcggatccagtag acctgtggcaagcttcttcc gcaaggcaacc tgcc UspA1.sup.50-321 gcgtctgcggatccagtag ggtgtcactaagcttacctg gcaaggcaacc caccaacatgaac UspA1.sup.299-452 ggatttgcaggtgcatcgg gtcttttgtaagatcaagct atcctggtaatggtact tttgatcaat UspA1.sup.433-580 catagctctgatatggatc catgctgagaagcttaccta cacttaaaaac gattgg UspA1.sup.557-704 gccaaagcacaagcggatc ggtcttattggtagtaagct caaataaagac tagcttggg UspA1.sup.680-770 gttgagcaaaaggatccca ccctgaagctttagtgcata tcaatcaagag acctaattg UspA2.sup.30-539 cgaatgcggatcctaaaaa cattaagcttggtgtctaat tgatataactttagagg gcagttac UspA2.sup.30-177 cgaatgcggatcctaaaaa ctcatgaccaaaatcaagct tgatataactttagagg tatcttcgatagactc UspA2.sup.101-240 gatattgcggatccggaag gatcaataagcttaccgctt atgatgttgaaac agattgaatagttcttc UspA2.sup.101-318 gatattgcggatccggaag gtcaatcgcttcaagcttct atgatgttgaaac tttgagcatactg UspA2.sup.165-318 gagattgagaaggatccag gtcaatcgcttcaagcttct atgctattgct tttgagcatactg UspA2.sup.302-458 gctcaaaaccaagcggatc ggtgagcgtttcaagctttg cccaagatctg catcagcatcggc UspA2.sup.446-539 gcaagtgctgcggatcctg cattaagcttggtgtctaat atcgtattgct gcagttac
Antibodies
(30) Rabbit anti-UspA1/A2 polyclonal antibodies (pAb) were recently described in detail. [58] The other antibodies used were rabbit anti-human fibronectin pAb, swine FITC-conjugated anti-rabbit pAb, swine horseradish peroxidase (HRP) conjugated anti-rabbit pAb and finally a mouse anti-human CD54 (ICAM1) monoclonal antibody (mAb). Antibodies were from Dakopatts (Glostrup, Denmark).
(31) Flow Cytometry Analysis
(32) The UspA1/A2-protein expression and the capacity of M. catarrhalis to bind fibronectin were analyzed by flow cytometry. M. catarrhalis wild type strains and UspA1/A2-deficient mutants were grown overnight and washed twice in phosphate buffered saline containing 3% fish gelatin (PBS-gelatin). The bacteria (10.sup.8) were then incubated with the anti-UspA1/A2 antiserum or 5 g fibronectin (Sigma, St Louis, Mo.). They were then washed and incubated for 30 min at room temperature (RT) with FITC-conjugated anti-rabbit pAb (diluted according to the manufacturer's instructions) or with 1/100 dilution of rabbit anti-human fibronectin pAb (if fibronectin was first added) for 30 min at RT before incubation with the FITC-conjugated anti-rabbit pAb. After three additional washes, the bacteria were analyzed by flow cytometry (EPICS, XL-MCL, Coulter, Hialeah, Fla.). All incubations were kept in a final volume of 100 l PBS-gelatin and the washings were done with the same buffer. Anti-fibronectin pAb and FITC-conjugated anti-rabbit pAb were added separately as a negative control for each strain analyzed. Fibronectin inhibition studies were carried out by pre-incubating 0.25 moles of UspA fragments for 1 h with 2 g of fibronectin before incubation with M. catarrhalis bacteria (10.sup.8). The residual free amount of fibronectin that bound to M. catarrhalis was determined by flow cytometry as outlined above.
(33) Binding of M. catarrhalis to Immobilized Fibronectin
(34) Glass slides were coated with 30 l aliquots of fibronectin (1 mg/ml) and air dried at RT. After washing once with PBS, the slides were incubated in Petri dishes with pre-chilled bacteria at late exponential phase (optical density (OD) at 600 nm=0.9). After 2 h at RT, glass slides were washed once with PBS followed by Gram staining.
Protein Labeling and Radio Immunoassay (RIA)
(35) Fibronectin was .sup.125Iodine labeled (Amersham, Buckinghamshire, England) to a high specific activity (0.05 mol iodine per mol protein) with the Chloramine T method. [21] M. catarrhalis strains BBH18 and RH4 together with their corresponding mutants were grown overnight on solid medium and were washed in PBS with 2% bovine serum albumin (BSA). Bacteria (10.sup.8) were incubated for 1 h at 37 C. with .sup.125I-labeled fibronectin (1600 kcpm/sample) in PBS containing 2% BSA. After three washings with PBS 2% BSA, .sup.125I-labeled fibronectin bound to bacteria was measured in a gamma counter (Wallac, Espoo, Finland).
(36) Enzyme-Linked Immunosorbent Assay (ELISA)
(37) Microtiter plates (Nunc-Immuno Module; Roskilde, Denmark) were coated with 40 nM of purified recombinant UspA1.sup.50-770 and UspA2.sup.30-539 proteins in 75 mM sodium carbonate, pH 9.6 at 4 C. overnight. Plates were washed four times with washing buffer (50 mM Tris-HCl, 0.15 M NaCl, and 0.1% Tween 20, pH 7.5) and blocked for 2 h at RT with washing buffer containing 3% fish gelatin. After four additional washings, the wells were incubated for 1 h at RT with fibronectin (120 g/ml) diluted in three-fold step in 1.5% fish gelatin (in wash buffer). Thereafter, the plates were washed and incubated with rabbit anti-human fibronectin pAb for 1 h. After additional washings, HRP-conjugated anti-rabbit pAb was added and incubated for 1 h at RT. Both the antihuman fibronectin and HRP-conjugated anti-rabbit pAb were diluted 1:1,000 in washing buffer containing 1.5% fish gelatin. The wells were washed four times and the plates were developed and measured at OD.sub.450. ELISAs with truncated proteins spanning UspA1.sup.50-770 and UspA2.sup.30-539 were performed with fixed doses of fibronectin at 80 g/ml and 120 g/ml, respectively.
(38) Cell Line Adherence Inhibition Assay
(39) Chang conjunctival cells (ATCC CCL 20.2) were cultured in RPMI 1640 medium (Gibco BRL, Life Technologies, Paisley, Scotland) supplemented with 10% fetal calf serum, 2 mM L-glutamine, and 12 g of gentamicin/ml. On the day before adherence inhibition experiments, cells were harvested, washed twice in gentamicin-free RPMI 1640, and added to 96 well tissue culture plates (Nunc) at a final concentration of 10.sup.4 cells/well in 200 l of gentamicin-free culture medium. Thereafter, cells were incubated overnight at 37 C. in a humidified atmosphere of 5% CO.sub.2 and 95% air. On the day of experiments, inhibition of M. catarrhalis adhesion was carried out by pre-incubating increasing concentration of recombinant UspA1/A2 truncated proteins containing the fibronectin binding domains (UspA1.sup.299-452 and UspA2.sup.165-318) or rabbit anti-human fibronectin pAb (diluted 1:50) for 1 h. Nonfibronectin binding recombinant proteins (UspA1.sup.433-580 and UspA2.sup.30-177) were used as controls. Chang epithelial cells are known to express ICAM1. [18] Hence an anti-ICAM1 antibody was used to differentiate if the inhibitory effect of the anti-fibronectin antibody was secondary to steric hindrance. Subsequently, M. catarrhalis RH4 (10.sup.6) in PBS-gelatin was inoculated onto the confluent monolayers. In all experiments, tissue culture plates were centrifuged at 3,000g for 5 min and incubated at 37 C. in 5% CO.sub.2. After 30 min, infected monolayers were rinsed several times with PBS-gelatin to remove non-adherent bacteria and were then treated with trypsin-EDTA (0.05% trypsin and 0.5 mM EDTA) to release the Chang cells from the plastic support. Thereafter, the resulting cell/bacterium suspension was seeded in dilution onto agar plates containing BHI and incubated overnight at 37 C. in 5% CO.sub.2.
(40) Determination of Fibronectin Expression in Chang Conjunctival Epithelial Cells
(41) Chang conjunctival epithelial cells were harvested by scraping followed by re-suspension in PBS-gelatin. Cells (110.sup.6/ml) were labeled with rabbit anti-human fibronectin pAb followed by washing and incubation with a FITC-conjugated anti-rabbit pAb. After three additional washes, the cells were analyzed by flow cytometry as outlined above.
(42) Interaction Between M. catarrhalis and Laminin Bacterial Strains and Culture Conditions
(43) The clinical M. catarrhalis strains BBH18 and RH4 and their corresponding mutants were previously described. [58] Both strains have a relatively higher expression of UspA2 compared to UspA1. [58] The mutants expressed equal amount of M. catarrhalis immunoglobulin D-binding protein (MID) when compared to wild type strains. Bacteria were routinely cultured in brain heart infusion (BHI) broth or on BHI agar plates at 37 C. The UspA1-deficient, UspA2-deficient and double mutants were cultured in BHI supplemented with antibiotics as described. [58]
(44) Recombinant Protein Construction and Expression Recombinant
(45) UspA1.sup.50-770 and UspA2.sup.30-539, which are devoid of their hydrophobic C-termini, were manufactured. [58] In addition, recombinant proteins corresponding to multiple regions spanning UspA1.sup.50-770 and UspA2.sup.30-539 were used. [78]
(46) Antibodies
(47) Rabbit anti-UspA1/A2 and anti-MID polyclonal antibodies (pAb) were used. [22, 58] Rabbit anti-laminin pAb was from Sigma (St Louis, Mo., USA). Swine horseradish peroxidase (HRP)-conjugated anti-rabbit pAb was from Dakopatts (Glostrup, Denmark).
(48) Binding of M. catarrhalis to Immobilized Laminin
(49) Microtiter plates (Nunc-Immuno Module; Roskilde, Denmark) were coated with Engelbreth-Holm-Swarm mouse sarcoma laminin (Sigma, Saint Louis, USA) or bovine serum albumin (BSA) (30 g/ml) in Tris-HCL, pH 9.0 at 4 C. overnight. The plates were washed with phosphate buffered saline and 0.05% Tween 20, pH 7.2 (PBS-Tween) and subsequently blocked with 2% BSA in PBS+0.1% Tween 20, pH 7.2. M. catarrhalis RH4 and BBH18 (10.sup.8) in 100 l were then added followed by incubation for 1 h. Unbound bacteria were removed by washing 3 times with PBS-Tween. Residual bound bacteria were detected by means of an anti-MID pAb, followed by detection with HRP-conjugated anti-rabbit pAb. The plates were developed and measured at OD.sub.450 according to a standard protocol.
(50) Enzyme-Linked Immunosorbent Assay (ELISA)
(51) Microtiter plates (Nunc-Immuno Module) were coated with 40 nM of purified recombinant UspA1.sup.50-770 and UspA2.sup.30-539 proteins in 75 mM sodium carbonate, pH 9.6 at 4 C. Plates were washed four times with washing buffer (50 mM Tris-HCl, 0.15 M NaCl, and 0.1% Tween 20, pH 7.5) and blocked at RT with washing buffer containing 3% fish gelatin. After additional washings, the wells were incubated for 1 h at RT with laminin at different dilutions as indicated in 1.5% fish gelatin (in wash buffer). Thereafter, the plates were washed and incubated with rabbit anti-laminin pAb. After additional washings, HRP-conjugated anti-rabbit pAb was added and incubated at RT. Both the anti-laminin and HRP-conjugated anti-rabbit pAb were diluted 1:1,000 in washing buffer containing 1.5% fish gelatin. The wells were washed and the plates were developed and measured at OD.sub.450. Uncoated wells incubated with identical dilutions of laminin were used as background controls. ELISAs with truncated proteins spanning UspA1.sup.50-770 and UspA2.sup.30-539 were performed with fixed doses of laminin (20 g/ml).
(52) Interaction Between M. catarrhalis and C3 and C3met Bacterial Strains and Culture Conditions
(53) The clinical M. catarrhalis isolates and related subspecies have recently been described in detail. [21, 53] Type strains were from the Culture Collection, University of Gothenburg (CCUG; Department of Clinical Bacteriology, Sahlgrenska Hospital, Gothenburg, Sweden), or the American Type Culture Collection (ATCC; Manassas, Va.); Neisseria gonorrheae CCUG 15821, Streptococcus pyogenes CCUG 25570 and 25571, Streptococcus agalactiae CCUG 4208, Streptococcus pneumoniae ATCC 49619, Legionella pneumophila ATCC 33152, Pseudomonas aeruginosa ATCC 10145, Staphylococcus aureus ATCC 29213, and finally Staphylococcus aureus ATCC 25923. The remaining strains in Table 9 were clinical isolates from Medical Microbiology, Department of Laboratory Medicine, Malm University Hospital, Lund University, Sweden.
(54) TABLE-US-00016 TABLE 9 M. catarrhalis is a unique C3/C3met binding bacterium. Related moraxella subspecies and other common human pathogens do not bind C3/C3met (mfi <2.0). After incubation with EDTA-treated NHS or C3met, bacteria were analysed by flow cytometry using a rabbit anti-C3d pAb and a FITC-conjugated goat anti-rabbit pAb. Species NHS-EDTA (mfi) C3met (mfi) Moraxella catarrhalis RH4 8.7 22.1 M. osloensis <2.0 <2.0 M. bovis <2.0 <2.0 M. caniculi <2.0 <2.0 M. nonliquefacie <2.0 <2.0 N. pharyngis <2.0 <2.0 N. sicca <2.0 <2.0 N. flava <2.0 <2.0 N. subflava <2.0 <2.0 Oligella ureolytica (n = 2) <2.0 <2.0 Haemophilus influenzae (n = 7) <2.0 <2.0 Streptococcus pneumoniae (n = 11) <2.0 <2.0 Legionella pneumophila (n = 2) <2.0 <2.0 Pseudomonas aeruginosa (n = 2) <2.0 <2.0 Listeria monocytogenes <2.0 <2.0 Yersinia entercolitica <2.0 <2.0 Staphylococcus aureus (n = 3) <2.0 <2.0 Streptococcus pyogenes (n = 2) <2.0 <2.0 Streptococcus agalactia <2.0 <2.0 Enterococcus faecalis <2.0 <2.0 Helicobacter pylori <2.0 <2.0 Escherichia coli (n = 2) <2.0 <2.0 M. ovis <2.0 <2.0 M. caviae <2.0 <2.0 Neisseria gonorrheae <2.0 <2.0 N. meningtidis <2.0 <2.0 N. mucosa <2.0 <2.0
(55) The different non-moraxella species were grown on appropriate standard culture media. M. catarrhalis strains were routinely cultured in brain heart infusion (BHI) liquid broth or on BHI agar plates at 37 C. M. catarrhalis BBH18 and RH4 mutants were manufactured as previously described. [22, 23, 58] The MID-deficient mutants were grown in BHI containing 50 g/ml kanamycin. The UspA1-deficient mutants were cultured in BHI supplemented with 1.5 g/ml chloramphenicol (Sigma, St. Louis, Mo.), and UspA2-deficient mutants were incubated with 7 g/ml zeocin (Invitrogen, Carlsbad, Calif.). Both chloramphenicol and zeocin were used for growth of the UspA1/A2 double mutants.
(56) Antibodies
(57) Rabbits were immunized intramuscularly with 200 g recombinant full-length UspA1 emulsified in complete Freunds adjuvant (Difco, Becton Dickinson, Heidelberg, Germany), and boosted on days 18 and 36 with the same dose of protein in incomplete Freunds adjuvant. [22] Blood was drawn 3 weeks later. To increase the specificity, the anti-UspA1 antiserum was affinity-purified with Sepharose-conjugated recombinant UspA1.sup.50-770. [58] The antiserum bound equally to UspA1 and UspA2 and was thus designated anti-UspA1/A2 pAb. The rabbit anti-human C3d pAb and the FITC-conjugated swine anti-rabbit pAb were purchased from Dakopatts (Glostrup, Denmark), and the goat anti-human C3 were from Advanced Research Technologies (San Diego, Calif.). The horseradish peroxidase (HRP)-conjugated donkey anti-goat pAb was obtained from Serotec (Oxford, UK).
(58) Proteins and Iodine Labelling
(59) The manufacture of recombinant UspA1.sup.50-770 and UspA2.sup.30-539, which are devoid of their hydrophobic C-termini, has recently been described. [23] The truncated UspA1 and UspA2 proteins were manufactured as described in detail by Tan et al. [78] C3b was purchased from Advanced Research Technologies. C3(H.sub.2O) was obtained by freezing and thawing of purified C3. The C3b-like molecule (C3met) was made by incubation of purified C3 with 100 mM methylamine (pH 8.0) for 2 h at 37 C., and subsequent dialysis against 100 mM Tris-HCl (pH 7.5), 150 mM NaCl. For binding studies, C3met was labelled with 0.05 mol .sup.125I (Amersham, Buckinghamshire, England) per mol protein, using the Chloramine T method. [25]
(60) Flow Cytometry Analysis
(61) Binding of C3 to M. catarrhalis and other species was analyzed by flow cytometry. Bacteria were grown on solid medium overnight and washed twice in PBS containing 2% BSA (Sigma) (PBS-BSA). Thereafter, bacteria (10.sup.8 colony forming units; cfu) were incubated with C3met, C3b, C3(H.sub.2O), or 10% NHS with or without 10 mM EDTA or 4 mM MgCl.sub.2 and 10 mM EGTA (Mg-EGTA) in PBS-BSA for 30 min at 37 C. After washings, the bacteria were incubated with anti-human C3d pAb for 30 min on ice, followed by washings and incubation for another 30 min on ice with FITC-conjugated goat anti-rabbit pAb. After three additional washes, bacteria were analyzed by flow cytometry (EPICS, XL-MCL, Coulter, Hialeah, Fla.). All incubations were kept in a final volume of 100 l PBS-BSA and the washings were done with the same buffer. The anti-human C3d pAb and FITC-conjugated anti-rabbit pAb were added separately as a negative control for each strain analyzed. In the inhibition studies, serum was preincubated with 100 nM of the recombinant UspA1.sup.50-770 and UspA2.sup.30-539 proteins for 30 min at 37 C. To analyze the characteristics of the M. catarrhalis and C3 interaction, increasing concentrations of NaCl (0-1.0 M) was added to bacteria and C3met. To analyze UspA1/A2 expression, bacteria (10.sup.8 cfu) were incubated with the anti-UspA1/A2 pAb and washed as described above. A FITC-conjugated goat anti-rabbit pAb diluted according to the manufacturers instructions was used for detection. To assure that EDTA did not disrupt the outer membrane proteins UspA1 and UspA2, M. catarrhalis was incubated with or without EDTA followed by detection of UspA1/A2 expression. EDTA, at the concentrations used in the NHS-EDTA experiments, did not change the density of UspA1/A2.
(62) Serum and Serum Bactericidal Assay
(63) Normal human serum (NHS) was obtained from five healthy volunteers. The blood was allowed to clot for 30 min at room temperature and thereafter incubated on ice for 60 min. After centrifugation, sera were pooled, aliquoted and stored at 70 C. To inactivate both the classical and alternative pathways, 10 mM EDTA was added. In contrast, Mg-EGTA was included to inactivate the classical pathway. Human serum deficient in the C4BP was prepared by passing fresh serum through a HiTrap column (Amersham Biosciences) coupled with mAb 104, a mouse mAb directed against CCP1 of the -chain of C4BP. [41] The flow through was collected and the depleted serum was stored in aliquots at 70 C. Serum depleted of C1q was obtained via the first step of C1q purification [79] using Biorex 70 ion exchange chromatography (Bio-Rad, Hercules, Calif.). The resulting sera displayed normal haemolytic activity. The factor D and properdin deficient serum was kindly provided by Dr. Anders Sjholm (Department of Medical Microbiology, Lund University, Lund, Sweden). M. catarrhalis strains were diluted in 2.5 mM Veronal buffer, pH 7.3 containing 0.1% (wt/vol) gelatin, 1 mM MgCl.sub.2, 0.15 mM CaCl.sub.2, and 2.5% dextrose (DGVB.sup.++). Bacteria (10.sup.3 cfu) were incubated together with 10% NHS and EDTA or Mg-EGTA in a final volume of 100 l. The bacteria/NHS was incubated at 37 C. and at various time points, 10 l aliquots were removed and spread onto BHI agar plates. In inhibition studies, 10% serum was incubated with 100 nM of the recombinant UspA1.sup.50-770 and UspA2.sup.30-539 proteins for 30 min at 37 C. before bacteria were added.
(64) Dot Blot Assays
(65) Purified recombinant UspA1.sup.50-770 and UspA2.sup.30-539 diluted in three-fold steps (1.9-150 nM) in 100 l of 0.1 M Tris-HCl, pH 9.0 were applied to nitrocellulose membranes (Schleicher & Schull, Dassel, Germany) using a dot blot device. After saturation, the membranes were incubated for 2 h with PBS-Tween containing 5% milk powder at room temperature and washed four times with PBS-Tween. Thereafter, 5 kcpm [.sup.125I]-labelled C3met in PBS-Tween with 2% milk powder was added overnight at 4 C. The bound protein was visualized with a Personal FX (Bio-Rad) using intensifying screens.
(66) Surface Plasmon Resonance (Biacore)
(67) The interaction between UspA1.sup.50-770 or UspA2.sup.30-539 and C3 was further analysed using surface plasmon resonance (Biacore 2000; Biacore, Uppsala, Sweden) as recently described for the UspA1/2-C4BP interaction. [58] The K.sub.D (the equilibrium dissociation constant) was calculated from a binding curve showing response at equilibrium plotted against the concentration using steady state affinity model supplied by Biaevaluation software (Biacore).
(68) Enzyme-Linked Immunosorbent Assay (ELISA)
(69) Microtiter plates (Nunc-Immuno Module; Roskilde, Denmark) were coated with triplets of purified recombinant UspA1.sup.50-770, UspA2.sup.30-539, or the truncated UspA1 and UspA2 fragments (40 nM in 75 mM sodium carbonate, pH 9.6) at 4 C. overnight. Plates were washed four times with washing buffer (PBS with 0.1% Tween 20, pH 7.2) and blocked for 2 hrs at room temperature with washing buffer supplied with 1.5% ovalbumin (blocking buffer). After washings, the wells were incubated overnight at 4 C. with 0.25 g C3met in blocking buffer. Thereafter, the plates were washed and incubated with goat anti-human C3 in blocking buffer for 1 h at RT. After additional washings, HRP-conjugated donkey anti-goat pAbs was added for another 1 h at RT. The wells were washed four times and the plates were developed and measured at OD.sub.450.
(70) Haemolytic Assay
(71) Rabbit erythrocytes were washed three times with ice-cold 2.5 mM Veronal buffer, pH 7.3 containing 0.1% (wt/vol) gelatin, 7 mM MgCl.sub.2, 10 mM EGTA, and 2.5% dextrose (Mg.sup.++EGTA), and resuspended at a concentration of 0.510.sup.9 cells/ml. Erythrocytes were incubated with various concentrations (0 to 4%) of serum diluted in Mg.sup.++EGTA. After 1 h at 37 C., erythrocytes were centrifuged and the amount of lysed erythrocytes was determined by spectrophotometric measurement of released hemoglobin at 405 nm. For inhibition with UspA1 and UspA2, 10% serum was preincubated with 100 nM of recombinant UspA1.sup.50-770 and/or UspA2.sup.30-539 proteins for 30 min at 37 C., and thereafter added to the erythrocytes at 0 to 4%.
(72) Isolation of Polymorphonuclear Leukocytes and Phagocytosis
(73) Human polymorphonuclear leukocytes (PMN) were isolated from fresh blood of healthy volunteers using macrodex (Pharmalink AB, Upplands Vasby, Sweden). The PMN were centrifuged for 10 min at 300 g, washed in PBS and resuspended in RPMI 1640 medium (Life Technologies, Paisley, Scotland). The bacterial suspension (0.510.sup.8) was opsonized with 3% of either NHS or NHS-EDTA, or 20 g of purified C3met for 15 min at 37 C. After washes, bacteria were mixed with PMN (110.sup.7 cells/ml) at a bacteria/PMN ratio of 10:1 followed by incubation at 37 C. with end-over-end rotation. Surviving bacteria after 0, 30, 60, and 120 min of incubation was determined by viable counts. The number of engulfed NHS-treated bacteria was compared with bacteria phagocytosed in the absence of NHS. S. aureus opsonized with NHS was used as positive control.
(74) Examples And Results
(75) Interaction Between M. catarrhalis and Fibronectin M. catarrhalis Devoid of UspA1 and A2 does not Bind Soluble or Immobilized Fibronectin.
(76) We selected a random series of M. catarrhalis clinical strains (n=13) (table 7) and tested them for fibronectin binding in relation to their UspA1/A2 expression by flow cytometry analysis. High UspA1/A2 expression as determined by high mean fluorescence intensity (MFI) was correlated to UspA1/A2 expression (Pearson correlation coefficient 0.77, P<0.05) (
(77) Two M. catarrhalis isolates (BBH18 and RH4) and their specific mutants lacking UspA1, UspA2 or both proteins were also analyzed by flow cytometry. M. catarrhalis BBH18 strongly bound fibronectin with a mean fluorescence intensity (MFI) of 96.1 (uspA1/A2 revealed an MFI of only 10.7 and 11.5, respectively (
(78) To further analyze the interaction between fibronectin and M. catarrhalis, .sup.125I-labeled fibronectin was incubated with two clinical M. catarrhalis isolates (BBH18 and RH4) and their respective mutants. The wild type M. catarrhalis RH4 strongly bound .sup.125I-fibronectin while the corresponding uspA1 mutant showed 80% binding of the wild type. In contrast, the
uspA2 and double mutant bound .sup.125I-fibronectin at 14% and 12%, respectively, which was just above the background levels (5.0 to 10%) (
(79) To investigate the bacterial attachment to immobilized fibronectin, M. catarrhalis RH4 and its corresponding uspA1/A2 mutants were applied onto fibronectin coated glass slides. After 2 h of incubation, slides were washed, and subsequently Gram stained. M. catarrhalis wild type and the
uspA1 mutant were found to strongly adhere to the fibronectin coated glass slides (
uspA2 and
uspA1/A2 double mutants weakly adhered to the fibronectin coated glass slide with only a few bacteria left after washing (
(80) The Fibronectin Binding Domains Include Amino Acid Residues Located Between 299 and 452 of UspA1 and Between 165 and 318 of UspA2
(81) To further analyze the interactions of UspA1 and A2 with fibronectin, truncated UspA1.sup.50-770 and UspA2.sup.30-539 were recombinantly produced in E. coli, coated on microtiter plates and incubated with increasing concentrations of fibronectin. Bound fibronectin was detected with an anti-human fibronectin pAb followed by incubation with a horseradish peroxidase conjugated anti-rabbit pAb. Both recombinant UspA1.sup.50-770 and UspA2.sup.30-539 bound soluble fibronectin and the interactions were dose-dependent (
(82) To define the fibronectin-binding domain of UspA1, recombinant proteins spanning the entire molecule of UspA1.sup.50-770 were manufactured. Fibronectin was incubated with the immobilized UspA1 proteins fragments and the interactions were quantified by ELISA. UspA1.sup.50-491 bound fibronectin almost as efficiently as UspA1.sup.50-770 suggesting that the binding domain was within this part of the protein. Among the other truncated fragments, UspA1.sup.299-452 efficiently bound fibronectin (
(83) UspA1.sup.50-491 and UspA1.sup.299-452 Fragments Competitively Inhibit M. catarrhalis Fibronectin Binding
(84) To further validate our findings on the UspA1/A2 fibronectin binding domains, recombinant truncated UspA1 proteins were tested for their capacity to block fibronectin binding to M. catarrhalis. Fibronectin (2 g) was pre-incubated with 0.25 moles of recombinant UspA1 fragments and subsequently incubated with M. catarrhalis. Finally, M. catarrhalis UspA-dependent fibronectin binding was measured by flow cytometry. Pre-incubation with UspA1.sup.50-491 and UspA1.sup.299-432 resulted in decreased fibronectin binding with a 95% reduction for UspA1.sup.30-491 and a 63% reduction for UspA1.sup.299-452 (
(85) Thus, the fibronectin binding domains of UspA1 and A2 block the interactions between fibronectin and M. catarrhalis.
(86) UspA1.sup.299-452 and UspA2.sup.165-318 Inhibit M. catarrhalis Adherence to Chang Epithelial Cells
(87) Epithelial cells are known to express fibronectin and many bacteria attach to epithelial cells via cell-associated fibronectin. [46, 54, 69, 77] Previous studies have shown that M. catarrhalis adhere to epithelial cells. [43, 49] We analyzed Chan conjunctival cells, which have frequently been used in adhesion experiments with respiratory pathogens. Chang cells strongly expressed fibronectin as revealed by flow cytometry analysis (
(88) To analyze whether the UspA-dependent fibronectin binding was important for bacterial adhesion, Chang epithelial cells were pre-incubated with anti-human fibronectin pAb, or the recombinant proteins UspA1.sup.299-452 and UspA2.sup.165-318. Thereafter, M. catarrhalis RH4 was added and bacterial adhesion analyzed. The relative adherence (measured by the number of colony forming units) after pre-incubation with 0.4 moles per 200 l of UspA1.sup.299-452, UspA2.sup.165-318, or an anti-human fibronectin pAb were 36%, 35% and 32%, respectively. Higher concentrations of recombinant peptides did not result in further inhibition. In contrast, the non-fibronectin binding fragments UspA1.sup.433-580 and UspA2.sup.30-177 did not inhibit the interactions between M. catarrhalis and the Chang epithelial cells (
(89) Interaction Between M. catarrhalis and Laminin M. catarrhalis Binds Laminin Through UspA1 and A2
(90) Two clinical M. catarrhalis isolates (BBH18 and RH4) and their specific mutants lacking UspA1, UspA2 or both proteins were analyzed by a whole-cell ELISA. M. catarrhalis RH4 strongly bound to immobilized laminin. (
(91) To further analyze the binding between UspA1/A2 and laminin, truncated UspA1.sup.50-770 and UspA2.sup.30-539 were produced in E. coli. Recombinant proteins were coated on microtiter plates and incubated with increasing concentrations of laminin. Bound laminin was detected with a rabbit anti-laminin pAb followed by incubation with an HRP-conjugated anti-rabbit pAb. Both recombinant UspA1.sup.50-770 and UspA2.sup.30-539 strongly bound soluble laminin and the binding was dose-dependent and saturable (
(92) To define the laminin binding domains, recombinant UspA1 and A2 spanning the entire molecules were manufactured. Laminin was incubated with immobilized truncated UspA1 and A2 fragments and followed by quantification by ELISA. UspA1.sup.50-491 bound to laminin almost as efficiently as UspA1.sup.50-770 suggesting that the binding domain was within this part of the protein. However, among the other truncated fragments spanning this region, no other fragment appeared to bind laminin. The N-terminal part, UspA2.sup.30-351, was able to retain 44.7% binding capacity as compared to the full length protein. The shorter protein UspA2.sup.30-177 showed a 43.7% binding capacity. (
(93) Interaction Between M. catarrhalis and C3 and C3met M. catarrhalis Outer Membrane Proteins UspA1 and UspA2 Inhibit Both the Classical and the Alternative Pathway of the Complement Cascade
(94) UspA2 surface expression is crucial for M. catarrhalis survival in normal human serum (NHS) [1, 58], i.e., moraxella UspA2 deficient mutants are rapidly killed when exposed to NHS. We have recently shown that both UspA1 and A2 bind C4BP and thus might inhibit the classical pathway of complement activation [58]. To further shed light on M. catarrhalis interactions with the complement system, survival of UspA1/A2 double mutants was studied in serum treated with either EGTA with addition of MgCl.sub.2 (Mg-EGTA) or EDTA. Mg-EGTA inhibits the classical and lectin pathways and thus allows separate analysis of the alternative pathway. In contrast, EDTA inhibits all complement pathways by absorbing divalent cations (Mg.sup.2+ and Ca.sup.2+). The M. catarrhalis RH4 wild type survived after 30 min of incubation, whereas RH4uspA1/A2 double mutant was killed by intact NHS after 10 min (
(95) M. catarrhalis Absorbs C3 from EDTA-Inactivated Serum
(96) C3b covalently binds to the surface of a microbe and hence induces the alternative pathway (
(97) Binding of C3met to M. catarrhalis is Dose-Dependent and Non-Covalent
(98) Our experiments implied that C3 bound to the surface of M. catarrhalis irrespectively of complement activation. Therefore, we analyzed whether converted C3, which is non-functional, could bind to the bacteria. Native C3 was purified from human serum and treated with methylamine, which converts C3 to a C3met molecule equivalent to C3b without the capacity to covalently bind to microbes (
(99) To determine whether the binding of C3 is a general feature of all M. catarrhalis strains, we selected a random series of clinical isolates (n=13) and analyzed their capacity to bind C3met. All M. catarrhalis strains bound C3met as revealed by a flow cytometry analysis with an anti-C3d pAb. The mfi values varied from 4 to 39. However, S. pneumoniae and E. coli that were included for comparison did not bind C3met.
(100) M. catarrhalis is a Unique C3 and C3met Binding Bacterium
(101) To extend our analysis of bacterial C3 absorption from NHS, related moraxella subspecies (n=13) as well as common human pathogens (n=13) were incubated in the presence of NHS-EDTA. Interestingly, among all the bacterial species tested, M. catarrhalis was the only bacterium binding C3 in complement-inactivated serum (Table 9). All related moraxella strains as well as the other human pathogens were also analyzed for binding of C3met. In parallel with the C3 binding, M. catarrhalis was the only species that bound C3met. Taken together, M. catarrhalis has a unique feature to strongly bind C3 and C3met in a non-covalent manner.
(102) M. catarrhalis Binds C3met Via the Outer Membrane Proteins UspA1 and UspA2
(103) To determine the M. catarrhalis protein responsible for the C3 binding, we tested a series of bacterial mutants devoid of the outer membrane proteins MID, UspA1 and/or UspA2 [22, 58]. Interestingly, the binding of C3met was significantly correlated with Usp expression (BBH18 isolate and the corresponding BBH18 mutants.
(104) To further analyze the interaction between C3 and UspA1/A2, UspA1.sup.50-770 and UspA2.sup.30-539 were produced in E. coli and purified. The recombinant proteins were dot blotted onto a nitrocellulose membrane followed by incubation with iodine-labelled C3met. Recombinant MID.sup.962-1200, which is derived from the M. catarrhalis outer membrane protein MID [59], was included as a negative control. A weak binding to UspA1.sup.50-770 was detected, whereas [.sup.125I]-C3met strongly bound to UspA2.sup.30-539 (
(105) A C3 Binding Domain is Located Between Amino Acid Residues 200 and 458 of UspA2.
(106) To define the C3 binding domain of UspA2, recombinant proteins spanning the entire UspA2.sup.30-539 molecule were manufactured. C3met was incubated with the immobilized full length UspA1.sup.50-770, UspA2.sup.30-539 and a series of truncated UspA2 proteins. Thereafter, the interactions were quantified by ELISA. In agreement with the dot blot experiments (FIG. 16A), UspA1.sup.50-770 bound C3met to a much lower extent compared to UspA2.sup.30-539 in the ELISA (
(107) Recombinant UspA1/A2 Neutralizes C3 Activity
(108) In order to in detail examine the role of UspA1/A2-dependent inhibition of the alternative pathway, a series of flow cytometry experiments was performed with bacteria incubated with 10% NHS or serum that had been preincubated with 100 nM recombinant UspA1.sup.50-770 and UspA2.sup.30-539. Interestingly, a significantly decreased C3 deposition/binding at the surface of M. catarrhalis RH4uspA1/A2 was observed when NHS was pretreated with UspA1.sup.50-770 and UspA2.sup.30-539 (
(109) To determine whether absorption of C3 by recombinant UspA1.sup.50-770 and UspA2.sup.30-539 increased bacterial survival, the double mutant M. catarrhalis RH4uspA1/A2 was incubated with serum supplemented with UspA1.sup.50-770 and UspA2.sup.30-539 followed by determination of the number of surviving bacteria. Mg-EGTA was included in the reactions in order to inhibit the classical pathway. Interestingly, addition of recombinant UspA1.sup.50-770 and UspA2.sup.30-539 to NHS prevented killing of the UspA1/A2 deficient M. catarrhalis (
(110) We also included an alternative pathway haemolytic assay consisting of rabbit erythrocytes and NHS in order to establish the role of UspA1 and A2 as inhibitors of the alternative pathway. NHS was preincubated with recombinant UspA1.sup.50-770 UspA2.sup.30-539, or both proteins together followed by addition to the erythrocytes. After 1 h incubation, the amount of erythrocyte lysis was determined. Interestingly, a significantly decreased haemolysis was observed when NHS was preincubated with UspA1.sup.50-770 or UspA2.sup.30-539 as compared to untreated NHS (
(111) In addition of being a key molecule in the complement cascade, deposited C3b and iC3b (inactivated C3b) target microbes for removal in the process of opsonophagocytosis. To investigate whether C3 or C3met that was non-covalently bound at the surface of M. catarrhalis could still function as an opsonin, a series of phagocytosis experiments was performed. M. catarrhalis was preincubated with C3met, NHS or NHS treated with EDTA followed by addition of polymorphonuclear leukocytes. Interestingly, M. catarrhalis was not engulfed in the presence of C3met, whereas NHS strongly promoted phagocytosis (data not shown). However, when NHS was pretreated with EDTA, M. catarrhalis was not phagocytosed by polymorphonuclear leukocytes. Thus, C3/C3met was inactive at the M. catarrhalis cell surface and did not function as an opsonin.
(112) Discussion
(113) Interaction Between M. catarrhalis and Fibronectin
(114) UspA1.sup.299-452 and UspA2.sup.165-318 from the clinical M. catarrhalis strain Bc5 were the shortest fragments that still bound fibronectin. Interestingly, longer fragments encompassing the amino acid sequence found within UspA1.sup.299-452 and UspA2.sup.165-318 displayed a more efficient binding to fibronectin (
(115) In our last set of experiments, we tested whether the adherence of M. catarrhalis to Chang conjunctival cells could be inhibited by the fibronectin binding fragments (UspA1.sup.299-452 and UspA2.sup.165-318) (
(116) In conclusion, we have shown that UspA1/A2 of M. catarrhalis BBH18, RH4 and Bc5 are crucial FnBP. Both recombinant UspA1 and A2 derived from Bc5 bind fibronectin with a binding domain sharing identical amino acid residues including the conserved NNINNIY (SEQ ID NO: 86) sequence. Furthermore, an interaction of M. catarrhalis UspA1/A2 with epithelial cells is via cell-associated fibronectin. The definition of these fibronectin binding domains is therefore an important step forward in the development of a vaccine against M. catarrhalis.
(117) Interaction Between M. catarrhalis and Laminin
(118) M. catarrhalis is a common cause of infectious exacerbations in patients with COPD. The success of this species in patients with COPD is probably related in part to its large repertoire of adhesins. In addition, there are pathological changes such as loss of epithelial integrity with exposure of basement membrane where the laminin layer itself is thickened in smokers. [4] Some pathogens have been shown to be able to bind to laminin and thus may contribute to their ability to adhere to such damaged and denuded mucosal surfaces. These include pathogens known to cause significant disease in the airways such as S. aureus and P. aeruginosa amongst others. [7, 63]
(119) We recently showed that both UspA1 and A2 bind fibronectin. [78] The fibronectin binding domains were located within UspA1.sup.299-452 and UspA2.sup.165-318. In this study, the N-terminal halves UspA1.sup.50-491 and UspA2.sup.30-351 (containing the fibronectin domains) also bound laminin. However, the smallest fragments that bound fibronectin, UspA1.sup.299-452 and UspA2.sup.165-318 did not bind laminin to any appreciable extent. In fact, fragments smaller than the N-terminal half of UspA1 (UspA1.sup.50-491) losses all its laminin binding ability whereas with UspA2, only UspA2.sup.30-170 bound laminin albeit at a lower level then the whole recombinant protein (UspA2.sup.30-539). These findings suggest that perhaps different parts of the molecules might have different functional roles.
(120) Comparing the smallest laminin binding regions of UspA1 and A2, we find that there is, however, little similarity by way of amino acid homology between UspA2.sup.30-170 and UspA1.sup.50-491 (data not shown). This is not surprising as it is a known fact that both proteins have a lollipop-shaped globular head structure despite having only 22% identity in both N-terminal halves. [2, 32] We postulate that a tertiary structure is likely responsible for the interactions with laminin in the head region in vivo. The localization of the binding domains at the N-terminal end would be logical as this would be most exposed and in contact with the human basement membrane in vivo.
(121) Bacterial factors mediating adherence to tissue and extracellular matrix (ECM) components are grouped together in a single family named microbial surface components recognizing adhesive matrix molecules (MSCRAMMS). Since UspA1/A2 bind both fibronectin and laminin, these proteins can be designated MSCRAMMS. Our results suggest that UspA1 and A2 are multifunctional adhesins with different domains interacting with different ligands in the respiratory tract. Similar broad-spectrum binding profiles have been reported for other bacterial proteins such as YadA of Yersinia enterocolitica for which UspA1 and A2 bear a structural relationship. [45, 70] YadA too binds both fibronectin and laminin. [32]
(122) In summary we have shown that UspA1/A2 are crucial to M. catarrhalis interaction with the basement membrane glycoprotein laminin and this will play an important role in the pathogenesis of infections in patients with COPD. [74]
(123) Interaction Between M. catarrhalis and C3 and C3met
(124) Complement resistance is one of the most important bacterial virulence factors. [66] The majority (89%) of M. catarrhalis isolates from patients with lower respiratory tract infections are resistant to complement-mediated killing. [34] M. catarrhalis UspA1 and A2 are crucial for bacterial survival in human serum in vivo [1, 15], and we have shown that these two outer membrane proteins bind to the complement fluid phase regulator of the classical pathway, C4BP. [58] In the present study, we demonstrate that M. catarrhalis can inhibit the alternative pathway by non-covalently binding of C3 (
(125) M. catarrhalis is equally resistant to both the classical and alternative pathways (
(126) The importance of the complement system as a primary defence mechanism is mirrored by the fact that microbes have developed various strategies to interfere with and/or neutralize components of the complement system. [42, 35, 88] In addition to M. catarrhalis, S. pyogenes, Bordetella pertussis, E. coli K1, Candida albicans, and N. gonorrhoeae express specific surface molecules that bind C4BP and as a consequence protect the bacteria against the classical complement pathway. [8, 9, 52, 58, 64, 65, 80] In addition to inhibition of the classical pathway, several bacteria (e.g., C. albicans, N. meningitides, S. pyogenes, and S. pneumoniae; for reviews see [68, 89] bind factor H and factor H-like molecule and hence are partially protected against the alternative complement pathway.
(127) UspA1 and A2 absorb C3 from serum and hereby most likely inhibit the complement activation. Similarly, the Pneumococcal Surface Protein A (PspA) appears to inhibit the alternative pathway both in vitro and in vivo. PspA is an important virulence factor for S. pneumoniae. PspA-deficient pneumococcal strains are readily cleared from the blood, whereas the PspA-expressing strains survive. [82] Furthermore, in a murine model of bacteremia, PspA-deficient pneumococci have a significantly reduced virulence compared with pneumococci that express PspA. [11] It has been demonstrated that more C3b is deposited on PspA-negative pneumococci than on PspA-positive. [67, 82] Thus, expression of PspA reduces the complement-mediated clearance and phagocytosis of S. pneumoniae by limiting opsonization by C3b. [12, 67] PspA-deficient pneumococci that are not virulent in normal mice become virulent in C3-deficient and factor B-deficient mice. [82]
(128) To our knowledge, there are only two examples of bacterial proteins that non-covalently bind C3 and thereby interfere with complement function. The first one is the extracellular fibrinogen-binding protein (Efb) of Staphylococcus aureus, which was found to bind C3b. [44] Efb inhibits both the classical and alternative pathways independently of the thioester conformation, i.e., the binding to C3b is non-covalent. The second example is the pneumococcal choline-binding protein (CbpA), which has been shown to bind methylamine-treated C3, suggesting a non-covalent interaction that is not dependent on complement activation. [16] CbpA is a component of the pneumococcal cell wall, but may only bind C3 when the CbpA is secreted. In order to test this hypothesis, which is not firmly established in the literature, we analyzed eleven different pneumococcal isolates for C3 binding (methylamine-treated C3 or NHS-EDTA) by flow cytometry (
(129) The yeast Candida albicans has been shown to bind C3b, iC3b and C3d. However, C3b is bound at a considerably lower affinity than iC3b and C3d. [29] We found a large difference between C3 binding to M. catarrhalis and C. albicans (not shown); despite that candida bound C3met (56% positive cells), the mean fluorescence intensity (mfi) was only <2.0 as compared to mfi 36.9 for M. catarrhalis. Furthermore, no detectable binding was seen when C. albicans was incubated with EDTA-treated serum. Two C3d-binding proteins have been isolated from C. albicans and the most characterized protein is a 60 kDa mannoprotein that initially was recognized by an antibody directed against human complement receptor 2 (CD21). [13] However, M. catarrhalis UspA1 and A2 were not recognized by a polyclonal antibody directed against CD21 (not shown). In parallel with staphylococci and pneumococci [52, 64], a secreted C3d-binding protein from C. albicans also exists. [72] Finally, a C. albicans iC3b receptor has been isolated and is structurally similar to human CR3 (CD11b). [3] The mechanisms by which these receptors may participate in pathogenesis are not fully known.
(130) The above examples of C3 binding pathogens are notably different from M. catarrhalis in that these species often are blood stream isolates. M. catarrhalis is mucosal pathogen with rare instances of bacteremic infections. Hence, the binding and inactivating C3 most likely occur at the mucosal surface. This is supported by the fact that there is strong ongoing complement activation and consequent inflammation in disease state such as acute otitis media. [57] The complement proteins are believed to be transported to the mucosal surface due to exudation of plasma. [26, 62] In middle-ear effusions (MEEs) from children for example, strongly elevated concentrations of C3 products can also be found. [51] In addition, complement factors in MEEs fluid have been shown to be important in the bactericidal activity against other mucosal agents such as non-typable H. influenzae. [75] M. catarrhalis is a strict human pathogen. It does not cause diseases such as otitis media or pneumonia in animals. A mouse pulmonary clearance model and an otitis media model with chinchilla has been used at several occasions. However, neither otitis media nor pneumonia develops and bacteria are rapidly cleared. [19, 83] It is thus difficult to test the biological significance of bacterial C3 binding in vivo. Since UspA1 and A2 are multifunctional proteins [1, 15, 31, 43, 58, 78], it would be impossible to relate any differences in the clearance of M. catarrhalis to C3 binding. In particular the fact that UspA1 is an important adhesin of M. catarrhalis and binds both CEACAM1 and fibronectin [31, 78] would most likely affect the clearance. Nevertheless, due to the strong complement activation in disease states such as otitis media, moraxella-dependent binding of C3 may represent an important way of combating the mucosal defense.
(131) The fact that M. catarrhalis hampers the human immune system in several ways might explain why M. catarrhalis is such a common inhabitant of the respiratory tract [73]. In conclusion, M. catarrhalis has developed sophisticated ways of combating both the humoral and innate immune systems. The present data show that M. catarrhalis has a unique C3-binding capacity at the bacterial cell surface that cannot be found in other bacterial species.
(132) References
(133) 1. Aebi C, Lafontaine E R, Cope L D, et al. Phenotypic effect of isogenic uspA1 and uspA2 mutations on Moraxella catarrhalis O35E. Infect Immun 1998; 66:3113-9. 2. Aebi C, Maciver I, Latimer J L, et al. A protective epitope of Moraxella catarrhalis is encoded by two different genes. Infect Immun 1997; 65:4367-77. 3. Alaei, S., C. Larcher, C. Ebenbichler, W. M. Prodinger, J. Janatova, and M. P. Dierich. 1993. Isolation and biochemical characterization of the iC3b receptor of Candida albicans. Infect. Immun. 61:1395-1399. 4. Amin K, Ekberg-Jansson A, Lofdahl C G and Venge P. Relationship between inflammatory cells and structural changes in the lungs of asymptomatic and never smokers: a biopsy study. Thorax 2003; 58:135-42. 5. Attia A S, Lafontaine E R, Latimer J L, Aebi C, Syrogiannopoulos G A and Hansen E J. The UspA2 protein of Moraxella catarrhalis is directly involved in the expression of serum resistance. Infect Immun 2005; 73:2400-10. 6. Bartos L C, Murphy T F. Comparison of the outer membrane proteins of 50 strains of Branhamella catarrhalis. J Infect Dis 1988; 158:761-5. 7. de Bentzmann S, Tristan A, Etienne J, Brousse N, Vandenesch F and Lina G. Staphylococcus aureus isolates associated with necrotizing pneumonia bind to basement membrane type I and IV collagens and laminin. J Infect Dis 2004; 190:1506-15. 8. Berggrd, K., E. Johnsson, F. R. Mooi, and G. Lindahl. 1997. Bordetella pertussis binds the human complement regulator C4B P: role of filamentous hemagglutinin. Infect. Immun. 65:3638-3643. 9. Blom, A. M., A. Rytkonen, P. Vasquez, G. Lindahl, B. Dahlback, and A. B. Jonsson. 2001. A novel interaction between type IV pili of Neisseria gonorrhoeae and the human complement regulator C4B-binding protein. J. Immunol. 166:6764-6770. 10. Bootsma H J, van der Heide H G, van de Pas S, Schouls L M and Mooi F R. Analysis of Moraxella catarrhalis by DNA typing: evidence for a distinct subpopulation associated with virulence traits. J Infect Dis 2000; 181:1376-87. 11. Briles, D. E., J. Yother, L. S. McDaniel. 1988. Role of pneumococcal surface protein A in the virulence of Streptococcus pneumoniae. Rev. Infect. Dis. 10:(Suppl. 2):S372. 12. Briles, D. E., S. K. Hollingshead, E. Swiatlo, A. Brooks-Walter, A. Szalai, A. Virolainen, L. S. McDaniel, K. A. Benton, P. White, K. Prellner, A. Hermansson, P. C. Aerts, H. Van Dijk, and M. J. Crain. 1997. PspA and PspC: their potential for use as pneumococcal vaccines. Microb. Drug Resist. 3:401-408. 13. Calderone, R. A., L. Linehan, E. Wadsworth, and A. L. Sandberg. 1988. Identification of C3d receptors on Candida albicans. Infect. Immun. 56:252-258. 14. Catlin B W. Branhamella catarrhalis: an organism gaining respect as a pathogen. Clin Microbiol Rev 1990; 3:293-320. 15. Chen D, Barniak V, VanDerMeid K R and McMichael J C. The levels and bactericidal capacity of antibodies directed against the UspA1 and UspA2 outer membrane proteins of Moraxella (Branhamella) catarrhalis in adults and children. Infect Immun 1999; 67:1310-6. 16. Cheng, Q., D. Finkel, and M. K. Hostetter. 2000. Novel purification scheme and functions for a C3-binding protein from Streptococcus pneumoniae. Biochem. 39:5450-5457. 17. Cope L D, Lafontaine E R, Slaughter C A, et al. Characterization of the Moraxella catarrhalis uspA1 and uspA2 genes and their encoded products. J Bacteriol 1999; 181:4026-34. 18. De Saint Jean M, Baudouin C, Di Nolfo M, et al. Comparison of morphological and functional characteristics of primary-cultured human conjunctival epithelium and of Wong-Kilbourne derivative of Chang conjunctival cell line. Exp Eye Res 2004; 78:257-74. 19. Fulghum, R. S., and H. G. Marrow. 1996. Experimental otitis media with Moraxella (Branhamella) catarrhalis. Ann. Otol. Rhinol. Laryngol. 105:234-241. 20. Forsgren, A., and A. Grubb. 1979. Many bacterial species bind human IgD. J. Immunol 122:1468-1472. 21. Forsgren A, Brant M, Mollenkvist A, et al. Isolation and characterization of a novel IgD-binding protein from Moraxella catarrhalis. J Immunol 2001; 167:2112-20. 22. Forsgren A, Brant M, Karamehmedovic M and Riesbeck K. The immunoglobulin D-binding protein MID from Moraxella catarrhalis is also an adhesin. Infect Immun 2003; 71:3302-9. 23. Forsgren A, Brant M and Riesbeck K. Immunization with the truncated adhesion moraxella catarrhalis immunoglobulin D-binding protein (MID764-913) is protective against M. catarrhalis in a mouse model of pulmonary clearance. J Infect Dis 2004; 190:352-5. 24. Gjrloff-Wingren, A., R. Hadzic, A. Forsgren, and K. Riesbeck. 2002. A novel IgD-binding bacterial protein from Moraxella catarrhalis induces human B lymphocyte activation and isotype switching in the presence of Th2 cytokines. J. Immunol. 168:5582-5588. 25. Greenwood F C, Hunter W M and Glover J S. The Preparation of I-131-Labelled Human Growth Hormone of High Specific Radioactivity. Biochem J 1963; 89:114-23. 26. Greiff, D., I. Erjefalt, C. Svensson, P. Wollmer, U. Alkner, M. Andersson, and C. G. Persson. 1993. Plasma exudation and solute absorbtion across the airway mucosa. Clin. Physiol. 13: 219-233. 27. Hanski E, Caparon M. Protein F, a fibronectin-binding protein, is an adhesin of the group A streptococcus Streptococcus pyogenes. Proc Natl Acad Sci USA 1992; 89:6172-6. 28. Hays J P, van der Schee C, Loogman A, et al. Total genome polymorphism and low frequency of intra-genomic variation in the uspA1 and uspA2 genes of Moraxella catarrhalis in otitis prone and non-prone children up to 2 years of age. Consequences for vaccine design? Vaccine 2003; 21:1118-24. 29. Heidenreich, F., and M. P. Dierich. 1985. Candida albicans and Candida stellatoidea, in contrast to other Candida species, bind iC3b and C3d but not C3b. Infect. Immun. 50:598-600. 30. Helminen M E, Maciver I, Latimer J L, et al. A large, antigenically conserved protein on the surface of Moraxella catarrhalis is a target for protective antibodies. J Infect Dis 1994; 170:867-72. 31. Hill D J, Virji M. A novel cell-binding mechanism of Moraxella catarrhalis ubiquitous surface protein UspA: specific targeting of the N-domain of carcinoembryonic antigen-related cell adhesion molecules by UspA1. Mol Microbiol 2003; 48:117-29. 32. Hoiczyk E, Roggenkamp A, Reichenbecher M, Lupas A and Heesemann J. Structure and sequence analysis of Yersinia YadA and Moraxella UspAs reveal a novel class of adhesins. EMBO J 2000; 19:5989-99. 33. Holm M M, Vanlerberg S L, Foley I M, Sledjeski D D and Lafontaine E R. The Moraxella catarrhalis porin-like outer membrane protein C D is an adhesin for human lung cells. Infect Immun 2004; 72:1906-13. 34. Hol, C., C. M. Verduin, E. E. Van Dijke, J. Verhoef, A. Fleer, H. van Dijk. 1995. Complement resistance is a virulence factor of Branhamella (Moraxella) catarrhalis. FEMS Immunol. Med. Microbiol. 11:207-211. 35. Hornef, M. W., M. J. Wick, M. Rhen, and S. Normark. 2002. Bacterial strategies for overcoming host innate and adaptive immune responses. Nat. Immunol. 3:1033-1040. 36. Hostetter, M. K., M. L. Thomas, F. S. Rosen, and B. F. Tack. 1982. Binding of C3b proceeds by a transesterification reaction at the thiolester site. Nature 298:72-75. 37. Hostetter, M. K., R. A. Krueger, and D. J. Schmeling. 1984. The biochemistry of opsonization: central role of the reactive thiolester of the third component of complement. J. Infect. Dis. 150:653-661. 38. Joh D, Wann E R, Kreikemeyer B, Speziale P and Hook M. Role of fibronectinbinding MSCRAMMs in bacterial adherence and entry into mammalian cells. Matrix Biol 1999; 18:211-23. 39. Joh H J, House-Pompeo K, Patti J M, Gurusiddappa S and Hook M. Fibronectin receptors from gram-positive bacteria: comparison of active sites. Biochemistry 1994; 33:6086-92. 40. Karalus R, Campagnari A. Moraxella catarrhalis: a review of an important human mucosal pathogen. Microbes Infect 2000; 2:547-59. 41. Kask, L., L. A. Trouw, B. Dahlback, and A. M. Blom. 2004. The C4b-binding protein-protein S complex inhibits the phagocytosis of apoptotic cells. J. Biol. Chem. 279:23869-23873. 42. Lachmann, P. J. 2002. Microbial subversion of the immune response. Proc. Natl. Acad. Sci. U.S.A 99:8461-8462. 43. Lafontaine E R, Cope L D, Aebi C, Latimer J L, McCracken G H, Jr. and Hansen E J. The UspA1 protein and a second type of UspA2 protein mediate adherence of Moraxella catarrhalis to human epithelial cells in vitro. J Bacteriol 2000; 182:1364-73. 44. Lee, L. Y. L., M. Hk, D. Haviland, R. A. Wetsel, E. O. Yonter, P. Syribeys, J. Vernachio, and E. L. Brown. 2004. Inhibition of complement activation by secreted Staphylococcus aureus protein. J. Infect. Dis. 190:571-579. 45. Mack D, Heesemann J and Laufs R. Characterization of different oligomeric species of the Yersinia enterocolitica outer membrane protein YadA. Med Microbiol Immunol (Berl) 1994; 183:217-27. 46. Maheshwari R K, Kedar V P, Bhartiya D, Coon H C and Kang Y H. Interferon enhances fibronectin expression in various cell types. J Biol Regul Homeost Agents 1990; 4:117-24. 47. McGavin M J, Gurusiddappa S, Lindgren P E, Lindberg M, Raucci G and Hook M. Fibronectin receptors from Streptococcus dysgalactiae and Staphylococcus aureus. Involvement of conserved residues in ligand binding. J Biol Chem 1993; 268:23946-53. 48. McMichael J C. Vaccines for Moraxella catarrhalis. Vaccine 2000; 19 Suppl 1:S101-7. 49. McMichael J C, Fiske M J, Fredenburg R A, et al. Isolation and characterization of two proteins from Moraxella catarrhalis that bear a common epitope. Infect Immun 1998; 66:4374-81. 50. Meier P S, Troller R, Grivea I N, Syrogiannopoulos G A and Aebi C. The outer membrane proteins UspA1 and UspA2 of Moraxella catarrhalis are highly conserved in nasopharyngeal isolates from young children. Vaccine 2002; 20:1754-60. 51. Meri, S., T. Lehtinen, and T. Palva. 1984. Complement in chronic secretory otitis media. C3 breakdown and C3 splitting activity. Arch. Otolaryngol. 110:774-778. 52. Meri, T., A. M. Blom, A. Hartmann, D. Lenk, S. Meri, P. F. Zipfel. 2004. The hyphal and yeast forms of Candida albicans bind the complement regulator C4b-binding protein. Infect. Immun. 72:6633-6641. 53. Mollenkvist A, Nordstrom T, Hallden C, Christensen J J, Forsgren A and Riesbeck K. The Moraxella catarrhalis immunoglobulin D-binding protein MID has conserved sequences and is regulated by a mechanism corresponding to phase variation. J Bacteriol 2003; 185:2285-95. 54. Mongodin E, Bajolet O, Cutrona J, et al. Fibronectin-binding proteins of Staphylococcus aureus are involved in adherence to human airway epithelium. Infect Immun 2002; 70:620-30. 55. Murphy T F. Branhamella catarrhalis: epidemiology, surface antigenic structure, and immune response. Microbiol Rev 1996; 60:267-79. 56. Murphy T F, Brauer A L, Aebi C and Sethi S. Identification of surface antigens of Moraxella catarrhalis as targets of human serum antibody responses in chronic obstructive pulmonary disease. Infect Immun 2005; 73:3471-8. 57. Nrki-Mkel, M., J. Jero, and S. Meri 1999. Complement activation and expression of membrane regulators in the middle ear mucosa in otitis media with effusion. Clin. Exp. Immunol. 116:401-409. 58. Nordstrom T, Blom A M, Forsgren A and Riesbeck K. The emerging pathogen Moraxella catarrhalis Interacts with complement inhibitor C4b binding protein through ubiquitous surface proteins A1 and A2. J Immunol 2004; 173:4598-606. 59. Nordstrom T, Forsgren A and Riesbeck K. The immunoglobulin D-binding part of the outer membrane protein MID from Moraxella catarrhalis comprises 238 amino acids and a tetrameric structure. J Biol Chem 2002; 277:34692-9. 60. Nordstrom T, Blom A M, Tan T T, Forsgren A and Riesbeck K. Ionic binding of C3 to the human pathogen Moraxella catarrhalis is a unique mechanism for combating innate immunity. J Immunol 2005; MS#05-2213, in press. 61. Pearson M M, Lafontaine E R, Wagner N J, St Geme J W, 3rd and Hansen E J. A hag mutant of Moraxella catarrhalis strain O35E is deficient in hemagglutination, autoagglutination, and immunoglobulin D-binding activities. Infect Immun 2002; 70:4523-33. 62. Persson, C. G., I. Erjeflt, U. Alkner, C. Baumgarten, L. Greiff, B. Gustafsson, A. Luts, U. Pipkorn, F. Sundler, C. Svensson et al. 1991. Plasma exudation as a first line respiratory mucosal defence. Clin. Exp. Allergy 21: 17-24. 63. Plotkowski M C, Tournier J M and Puchelle E. Pseudomonas aeruginosa strains possess specific adhesins for laminin. Infect Immun 1996; 64:600-5. 64. Prasadarao, N. V., A. M. Blom, B. O. Villoutreix, and L. C. Linsangan. 2002. A novel interaction of outer membrane protein A with C4b binding protein mediates serum resistance of Escherichia coli K1. J. Immunol. 169:6352-6360. 65. Ram, S., M. Cullinane, A. M. Blom, S. Gulati, D. P. McQuillen, B. G. Monks, C. O'Connell, R. Boden, C. Elkins, M. K. Pangburn, B. Dahlback, and P. A. Rice. 2001. Binding of C4b-binding protein to porin: a molecular mechanism of serum resistance of Neisseria gonorrhoeae. J. Exp. Med. 193:281-296. 66. Rautemaa, R., and S. Meri. 1999. Complement-resistance mechanisms of bacteria. Microbes Infect. 1:785-94. 67. Ren, B., A. J. Szalai, S. K. Hollingshead, D. E. Briles. 2004. Effects of PspA and antibodies to PspA on activation and deposition of complement on the pneumococcal surface. Infect. Immun. 72:114-122. 68. Rodrguez de Crdoba, S., J. Esparza-Gordillo, E. Goicoechea de Jorge, M. Lopez-Trascasa, and P. Snchez-Corral. 2004. The human complement factor H: functional roles, genetic variations and disease associations. Mol. Immunol. 41:355-367. 69. Roger P, Puchelle E, Bajolet-Laudinat 0, et al. Fibronectin and alpha5beta1 integrin mediate binding of Pseudomonas aeruginosa to repairing airway epithelium. Eur Respir J 1999; 13:1301-9. 70. Roggenkamp A, Ackermann N, Jacobi C A, Truelzsch K, Hoffmann H and Heesemann J. Molecular analysis of transport and oligomerization of the Yersinia enterocolitica adhesin YadA. J Bacteriol 2003; 185:3735-44. 71. Rozalska B, Wadstrom T. Protective opsonic activity of antibodies against fibronectin-binding proteins (FnBPs) of Staphylococcus aureus. Scand J Immunol 1993; 37:575-80 72. Saxena, A., and R. Calderone. 1990. Purification and characterization of the extracellular C3d-binding protein of Candida albicans. Infect. Immun. 58:309-314. 73. Schwarz-Linek U, Werner J M, Pickford A R, et al. Pathogenic bacteria attach to human fibronectin through a tandem beta-zipper. Nature 2003; 423:177-81. 74. Sethi, S., and T. F. Murphy. 2001. Bacterial infection in chronic obstructive pulmonary disease in 2000: a state-of-the-art review. Clin. Microbiol. Rev. 14:336-363. 75. Shimizu, T., T. Harada, Y. Majima, and Y. Sakakura. 1988. Bactericidal activity of middle ear effusion on a single isolate of non-typable Haemophilus influenzae. Int. J. Pediatr. Otorhinolaryngol. 16:211-217. 76. Tack, B. F., R. A. Harrison, J. Janatova, M. L. Thomas, and J. W. Prahl. 1980. Evidence for presence of an internal thiolester bond in third component of human complement. Proc. Natl. Acad. Sci. U.S.A. 77: 5764-5768. 77. Talay S R, Valentin-Weigand P, Jerlstrom P G, Timmis K N and Chhatwal G S. Fibronectin-binding protein of Streptococcus pyogenes: sequence of the binding domain involved in adherence of streptococci to epithelial cells. Infect Immun 1992; 60:3837-44. 78. Tan, T. T., T. Nordstrom, A. Forsgren, and K. Riesbeck. 2005. The Respiratory Pathogen Moraxella catarrhalis Adheres to Epithelial Cells by Interacting with Fibronectin through Ubiquitous Surface Proteins A1 and A2. J. Infect. Dis., MS#33893, in press. 79. Tenner, A. J., P. H. Lesavre, and N. R. Cooper. 1981. Purification and radiolabeling of human C1q. J. Immunol. 127:648-653. 80. Thern, A., L. Stenberg, B. Dahlbck, and G. Lindahl. 1995. Ig-binding surface proteins of Streptococcus pyogenes also bind human C4b-binding protein (C4B P), a regulatory component of the complement system. J. Immunol. 154:375-386. 81. Timpe J M, Holm M M, Vanlerberg S L, Basrur V and Lafontaine E R. Identification of a Moraxella catarrhalis outer membrane protein exhibiting both adhesin and lipolytic activities. Infect Immun 2003; 71:4341-50. 82. Tu, A. H., R. L. Fulgham, M. A. McCrory, D. E. Briles, A. J. Szalai. 1999. Pneumococcal surface protein A inhibits complement activation by Streptococcus pneumoniae. Infect. Immun. 67:4720. 83. Unhanand, M., I. Maciver, O. Ramilo, O. Arencibia-Mireles, J. C. Argyle, G. H. McCracken Jr, and E. J. Hansen. 1992. Pulmonary clearance of Moraxella catarrhalis in an animal model. J. Infect. Dis. 165:644-650. 84. Verduin C M, Hol C, Fleer A, van Dijk H and van Belkum A. Moraxella catarrhalis: from emerging to established pathogen. Clin Microbiol Rev 2002; 15:125-44. 85. Walport, M. J. 2001. Complement. First of two parts. N. Engl. J. Med. 344:1058-1066. 86. Walport, M. J. 2001. Complement. Second of two parts. N. Engl. J. Med. 344:1140-1144. 87. Wang H, Liu X, Umino T, et al. Effect of cigarette smoke on fibroblast-mediated gel contraction is dependent on cell density. Am J Physiol Lung Cell Mol Physiol 2003; 284:L205-13. 88. Wurzner, R. 1999. Evasion of pathogens by avoiding recognition or eradication by complement, in part via molecular mimicry. Mol. Immunol. 36:249-260. 89. Zipfel, P. F., C. Skerka, J. Hellwage, S. T. Jokiranta, S. Meri, V. Brade, P. Kraiczy, M. Noris, and G. Remuzzi. 2001. Factor H family proteins: on complement, microbes and human diseases. Biochem. Soc. Trans. 30:971-978.