Porcine circovirus type-2 (PCV2) subunit vaccine
09657063 ยท 2017-05-23
Assignee
Inventors
- Tsun-Yung Kuo (I-Lan, TW)
- Hsu-Chung Gabriel Chen (Taipei, TW)
- Shu-Hsiang Yang (New Taipei, TW)
- Yu-San Chen (Taichung, TW)
Cpc classification
C12N7/00
CHEMISTRY; METALLURGY
C07K5/101
CHEMISTRY; METALLURGY
C07K2319/55
CHEMISTRY; METALLURGY
A61K2039/6037
HUMAN NECESSITIES
C12N2750/10022
CHEMISTRY; METALLURGY
C12N2750/10034
CHEMISTRY; METALLURGY
International classification
C12N7/00
CHEMISTRY; METALLURGY
Abstract
A porcine circovirus type-2 (PCV2) immunogenic composition includes an antigenic peptide. The antigenic peptide is a non-arginine-rich peptide of a PCV2 open reading frame 2 (ORF2) and/or a recombinant fusion protein having the non-arginine-rich peptide of the PCV2 ORF2, a PE peptide, and a KDEL signal peptide. The number of arginines of the non-arginine-rich peptide of the PCV2 ORF2 is not greater than half of the number of arginines of the arginine-rich domain of the N terminal of the PCV2 ORF2.
Claims
1. A porcine circovirus type 2 (PCV2) immunogenic composition, comprising an antigenic peptide, wherein the antigenic peptide consists of at least one of: (a) at least one recombinant peptide fragment of a PCV2 open reading frame 2 (ORF2) selected from the group consisting of a recombinant peptide consisting of amino acids 79-156 at the N-terminus of a PCV2 ORF2 of SEQ ID NO: 2, a recombinant peptide consisting of amino acids 157-233 at the N-terminus of the PCV2 ORF2 of SEQ ID NO: 2, a recombinant peptide consisting of amino acids 117-233 at the N-terminus of the PCV2 ORF2 of SEQ ID NO: 2, a recombinant peptide consisting of amino acids 79-233 at the N-terminus of the PCV2 ORF2 of SEQ ID NO: 2, a recombinant peptide consisting of amino acids 79-156 at the N-terminus of a PCV2 ORF2 of SEQ ID NO: 16, a recombinant peptide consisting of amino acids 157-233 at the N-terminus of the PCV2 ORF2 of SEQ ID NO: 16, a recombinant peptide consisting of amino acids 117-233 at the N-terminus of the PCV2 ORF2 of SEQ ID NO: 16, a recombinant peptide consisting of amino acids 79-233 at the N-terminus of the PCV2 ORF2 of SEQ ID NO: 16, a recombinant peptide consisting of amino acids 79-156 at the N-terminus of a PCV2 ORF2 of SEQ ID NO: 20, a recombinant peptide consisting of amino acids 157-233 at the N-terminus of the PCV2 ORF2 of SEQ ID NO: 20, a recombinant peptide consisting of amino acids 117-233 at the N-terminus of the PCV2 ORF2 of SEQ ID NO: 20, a recombinant peptide consisting of amino acids 79-233 at the N-terminus of the PCV2 ORF2 of SEQ ID NO: 20, a recombinant peptide consisting of amino acids 79-156 at the N-terminus of a PCV2 ORF2 of SEQ ID NO: 51, a recombinant peptide consisting of amino acids 157-233 at the N-terminus of the PCV2 ORF2 of SEQ ID NO: 51, a recombinant peptide consisting of amino acids 117-233 at the N-terminus of the PCV2 ORF2 of SEQ ID NO: 51, a recombinant peptide consisting of amino acids 79-233 at the N-terminus of the PCV2 ORF2 of SEQ ID NO: 51, a recombinant peptide consisting of amino acids 79-156 at the N-terminus of a PCV2 ORF2 of SEQ ID NO: 53, a recombinant peptide consisting of amino acids 157-233 at the N-terminus of the PCV2 ORF2 of SEQ ID NO: 53, a recombinant peptide consisting of amino acids 117-233 at the N-terminus of the PCV2 ORF2 of SEQ ID NO: 53, and a recombinant peptide consisting of amino acids 79-233 at the N-terminus of the PCV2 ORF2 of SEQ ID NO: 53; and (b) a recombinant fusion protein comprising, from the amino-terminus to the carboxyl-terminus of the recombinant fusion protein: a Pseudomonas aeruginosa exotoxin A (PE) peptide having the sequence of SEQ ID NO: 35; a PCV2 ORF2 protein sequence consisting of at least one of the recombinant peptide fragments of the PCV2 ORF2 of (a); and a KDEL signal peptide having the sequence of SEQ ID NO: 31; and wherein the immunogenic composition does not include a peptide fragment consisting of amino acids 1-78 at the N-terminus of the PCV2 ORF2.
2. The PCV2 immunogenic composition of claim 1, further comprising open reading frames (ORFs) other than ORF 2 of the PCV2, wherein the ORFs other than ORF2 comprise ORF1 and ORF3.
3. The PCV2 immunogenic composition of claim 1, further comprising at least one pathogen antigen selected from the group consisting of an antigen of swine influenza virus (SIV), an antigen of porcine reproductive and respiratory syndrome virus (PRRSV), an antigen of mycoplasma, antigen of porcine parvovirus (PPV), an antigen of erysipelas, and an antigen of pseudorabies virus.
4. The PCV2 immunogenic composition of claim 1, wherein the peptide fragment of the PCV2 ORF2 of (a) is selected from the group consisting of SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 18, SEQ ID NO: 22, SEQ ID NO: 55, and SEQ ID NO: 57.
5. The PCV2 immunogenic composition of claim 1, further comprising at least one agent selected from the group consisting of vehicles, solvent, emulsifier, suspending agents, decomposer, binding agents, excipient, stabilizing agents, chelating agents, diluent, gelling agents, preservatives, lubricant, surfactant, adjuvant, and biological carriers.
6. The PCV2 immunogenic composition of claim 1, wherein the recombinant fusion protein of (b) is selected from the group consisting of SEQ ID NO: 41, SEQ ID NO: 45, and SEQ ID NO: 49.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT
Example 1
Construction and Determination of Antigenic Peptides of PCV2 Subunit Vaccine
(8) Due to the fact that protein expression level of full-length PCV2 ORF2 protein in biological expression systems is quite low, DNA sequences that encode full-length PCV2 ORF2 proteins are cut into fragments of different sizes, and the DNA fragments are inserted into expression vectors and then expressed in hosts. The levels of the expressed proteins are evaluated to determine which DNA fragments can produce high levels of proteins in protein expression systems.
(9) A commonly used prokaryotic expression system (Escherichia coli) is used in the following examples for analysis and illustration.
(10) 1. Amplification of PCV2 ORF2 Gene Fragments of Different Sizes
(11) The full-length PCV2 ORF2 gene used in this example has a sequence of SEQ ID NO: 1. PCV2 ORF2 gene sequences provided by Wang et al. (Wang et al., Virus Research 2009, Genetic variation analysis of Chinese strains of porcine circovirus type 2.) are used as standard sequences for phylogenetic analysis of SEQ ID NO: 1. The result shows that the PCV2 ORF2 sequence (SEQ ID NO: 1) belongs to PCV2 2a subgroup (as shown in
(12) As shown in
(13) TABLE-US-00001 TABLE1 Sequencelistingofprimersforamplicationof differentsizesoffragmentsofPCV2ORF2gene Frag- ment Primer Sequence.sup.Note ORF2 pF1 Forward CCCAAGCTTGCATGACGT SEQID primer ATCCAAGGAGGCG NO:23 pR1 Reverse CCG GGGTTT SEQID primer AAGTGGGGGGTCTTTA NO:24 F1 pF1 Forward CCCAAGCTTGCATGACGT SEQID primer ATCCAAGGAGGCG NO:23 pR3 Reverse CCG
GTCGTT SEQID primer AATATTAAATCTCATC NO:28 F2 pF2 Forward CCCAAGCTTGCTTTGTTC SEQID primer CCCCGGGAGGGGG NO:25 pR2 Reverse CCG
GTAGGA SEQID primer GAAGGGTTGGGGGATT NO:26 F3 pF3 Forward CCCAAGCTTGCCACTCCC SEQID primer GGTACTTTACCCC NO:27 pR1 Reverse CCG
GGGTTT SEQID primer AAGTGGGGGGTCTTTA NO:24 F4 pF4 Forward CCCAAGCTTGCGGAGTGG SEQID primer GCTCCACTGCTGT NO:29 pR1 Reverse CCG
GGGTTT SEQID primer AAGTGGGGGGTCTTTA NO:24 F5 pF2 Forward CCCAAGCTTGCTTTGTTC SEQID primer CCCCGGGAGGGGG NO:25 pR1 Reverse CCG
GGGTTT SEQID primer AAGTGGGGGGTCTTTA NO:24 F6 pF1 Forward CCCAAGCTTGCATGACGT SEQID primer ATCCAAGGAGGCG NO:23 pR2 Reverse CCG
GTAGGA SEQID primer GAAGGGTTGGGGGATT NO:26 Note: Sequences marked with ____ underneath are the sequences of Hind III restriction site (AAGCTT), and sequences marked with
underneath are the sequences of Xho I restriction site (CTCGAG).
(14) Conditions for PCR reaction comprises: 95 C. for 5 minutes, 25 cycles of 95 C. for 30 seconds, 55 C. for 30 seconds, and 72 C. for 30 seconds, and 72 C. for 5 minutes for elongation. Sizes of the PCR products 2a-ORF2, 2a-F1, 2a-F2, 2a-F3, 2a-F4, 2a-F5, and 2a-F6 are 699 bp, 234 bp, 234 bp, 231 bp, 351 bp, 465 bp, and 468 bp, respectively, and confirmed by 2% agarose electrophoresis. After confirmation, the PCR products were purified with PCR-M purification kit (Viogene).
(15) 2. Construction of pET24a Plasmids Containing Different Sizes of Fragments of PCV2 ORF2
(16) One (1) g of the purified PCR products and 1 g of pET24a expression vector (Novagen) were digested with two restriction enzymes (New England Biolabs), 1 l of Hind III and 1 l of Xho I, respectively, for 8 hours at 37 C. After restriction enzyme cleavage reaction, the digested PCR products and pET24a expression vector were purified with PCR-M Clean up System (Viogene) respectively. The purified PCR products were ligated with the purified pET24a expression vector to form plasmids pET24a-2a-F1, pET24a-2a-F2, pET24a-2a-F3, pET24a-2a-F4, pET24a-2a-F5, pET24a-2a-F6, and pET24a-2a-ORF2, and then the plasmids were transformed into host cells (E. coli). Transformants containing the PCR products were selected, and DNA sequences were confirmed by DNA sequencing. Bacteria containing the plasmids above were then obtained.
(17) 3. Protein Expression and Confirmation of Different Sizes of Fragments of PCV2 ORF2
(18) Bacteria containing the plasmids above were incubated in 2 ml of LB medium at 37 C. for 16-18 hours and then inoculated at a ratio of 1:50 in LB medium containing 25 g/ml kanamycin to be further incubated in a 37 C., 200 rpm incubator until the O.D. 600 nm is 0.6. After that, -D-thiogalactoside (IPTG) was added to a final concentration of 1 mM, and the E. coli host cells were incubated in a 37 C., 200 rpm incubator for 6 more hours. Then, 1 ml of the E. coli host cells was centrifuged at 10,000g, and the pellet was treated with B-PE Bacterial Protein Extraction (purchased from PIERCE) to check whether the recombinant proteins are soluble proteins or in inclusion bodies by the following steps. The pellet was added in 40 l of reagent, mixed with a vortex shaker for 1 minute, and centrifuged at 10,000g to separate soluble proteins (upper part) from insoluble inclusion bodies (lower part). The soluble proteins were dissolved in 1SDS-PAGE sample buffer, and the pellet was added in 2SDS-PAGE sample buffer. The samples were placed in a heat block at 100 C. for 20 minutes and then centrifuged. The supernatant was analyzed by 15% SDS-PAGE to measure the expression of the recombinant proteins.
(19) The recombinant proteins were produced by inducing bacterial culture with IPTG. The 2a-ORF2 recombinant protein has the amino acid sequence of SEQ ID NO: 2. The 2a-F1 recombinant protein has the amino acid sequence of SEQ ID NO: 4. The 2a-F2 recombinant protein has the amino acid sequence of SEQ ID NO: 6. The 2a-F3 recombinant protein has the amino acid sequence of SEQ ID NO: 8. The 2a-F4 recombinant protein has the amino acid sequence of SEQ ID NO: 10. The 2a-F5 recombinant protein has the amino acid sequence of SEQ ID NO: 12. The 2a-F6 recombinant protein has the amino acid sequence of SEQ ID NO: 14.
(20) Expression of the recombinant proteins was analyzed by SDS-PAGE, and the results are shown in
(21) Next, western blotting was deployed to check whether the expressed recombinant proteins are PCV2 2a-ORF2 fragments. Following electrophoresis, the SDS-PAGE was transferred onto a PVDF Nylon membrane. The resulting membrane was blocked with blocking buffer, which is TBST (10 mM Tris-HCl, pH 8.0, 150 mM NaCl, 0.1% Tween 20) containing 5% skim milk, for 1 h at room temperature to prevent non-specific binding of proteins. After that, the proteins were identified using alkaline phosphatase (AP)-conjugated mouse anti-6his monoclonal antibodies against the 6his-tag fusion proteins for 1 hour at room temperature, followed by 6 times of wash with TBST, 5 minutes for each. After wash, NBT/BCIP substrate (Bio-Rad) was added. After 10 minutes, the reaction was stopped by adding water.
(22) The results of western blot are shown in
(23) TABLE-US-00002 TABLE 2 Analysis of Arginine Numbers of the PCV2 2a-ORF2 Amino Acid Sequence 2a-F1 2a-F2 + 2a-F3 Codon Amino Acid Amount Codon Amino Acid Amount AGA Arginine 5 AGA Arginine 3 AGG Arginine 3 AGG Arginine 3 CGA Arginine 1 CGC Arginine 1 CGC Arginine 10 CGG Arginine 1 CGT Arginine 2 CGT Arginine 1 Total 21 Total 9
Example 2
Immunogenicity Analysis of Antigenic Peptides of PCV2 Subunit Vaccine
(24) 1. Immunization of Rats
(25) PCV2 subunit vaccine was made with the 2a-F2, 2a-F3, 2a-F4, and 2a-F5 recombinant proteins prepared in Example 1, respectively, and Freund's complete adjuvant. Rats were vaccinated with the PCV2 subunit vaccine to analyze immunogenicity of the antigenic peptides of the PCV2 subunit vaccine.
(26) Five- to six-week-old healthy specific-pathogen-free (SPF) rats were randomly divided into 5 groups of 3 rats each. Enzyme-linked immunosorbent assay (ELISA) showed that all the 15 rats were negative for anti-PCV2 antibodies. Each rat in the 4 vaccine groups (Groups 1 to 4) was injected subcutaneously with 200 g of recombinant protein, and the total volume of each injection was 300 L with 1:1 (v/v) ratio of protein to adjuvant formulation. Rats in Group 5 were injected with 300 L PBS and served as negative control. Two weeks after primary immunization (p.i.), the rats in the 4 vaccine groups were boosted with the same dose of the 4 different recombinant proteins, respectively. Serum samples were collected at weeks 0, 2, 4, and 8 post-primary immunization. All the serum samples were tested by ELISA to measure the titer of anti-PCV2 antibodies.
(27) 2. Detection of Anti-PCV2 Antibodies by ELISA
(28) Ninety-six well plates containing PCV2 pathogen antigen (300 ng/well) were used as the ELISA plates in this example. The ELISA plates were washed 3 times with 50 mmol/L PBS (pH 7.2) containing 500 l/L Tween-20 (i.e. PBST) for 3 to 5 minutes each time. To block the ELISA plates, 2004 of 0.15% BSA blocking solution was added to each well of the ELISA plates, and then the ELISA plates were incubated for 2 hours at 37 C. After that, the ELISA plates were washed with PBS. Rat serum samples were diluted fifty-fold (1:50) with PBS and then diluted two-fold serially. Each sample had 8 repeats. Diluted serum samples were added to the wells of the ELISA plates (100 l/well), and the plates were incubated for 1 hour at 37 C. After incubation, the plates were washed with PBS. Anti-rat IgG antibody conjugated with alkaline phosphatase (AP) was then added to the wells. After incubating for 1 hour at 37 C., the plates were washed with PBS. For visualization of results, para-Nitrophenylphosphate (pNPP) was added to the wells. Following incubation, the reaction was stopped by adding 1M NaOH. The optical density of each well was read using optical density at 405 nm. Each sample was analyzed in duplicate, and the O.D. values of duplicates were averaged.
(29) ELISA results are shown in
(30) Furthermore, pigs were vaccinated with the 2a-F2, 2a-F3, 2a-F4, and 2a-F5 recombinant proteins, respectively, and all the recombinant proteins were able to induce serum antibodies against PCV2 in pigs. In addition, the vaccinated pigs were challenged with PCV2 virus to evaluate the efficacy of the recombinant proteins. First, the recombinant proteins were formulated as subunit vaccine and injected into pigs. Then, the pigs were challenged with PCV2 virus. The results show that the protection rates of immunization groups are higher then that of the negative control (no vaccination). The protection rates used herein include a decrease in viremia and alleviation of PCV2 symptoms. Therefore, the results show that the PCV2 subunit vaccine prepared with the recombinant proteins can effectively induce immunity in animals and increase survival rate of the animals.
Example 3
Construction and Expression of Antigenic Peptides of PCV2 2a Subunit Vaccine
(31) The results in Example 2 show that among the recombinant proteins, the F2 peptide of PCV2 ORF2 induces the highest level of serum antibody against PCV2. In order to enhance the immunogenicity of PCV2 subunit vaccine, receptor binding domain I and transmembrane targeting domain II of Pseudomonas aeruginosa exotoxin A (i.e. PE protein) and ER retention signalKDEL signal peptide were fused with the 2a-F2 peptide prepared in Example 1 at the N and C terminuses, respectively, to produce a fusion protein (PE-2a-F2-KDEL) to induce sufficient immunity against PCV2 infection in animals.
(32) The recombinant protein (PE-2a-F2-KDEL) was prepared by genetic engineering in this Example. DNA sequences encoding the proteins of interest were cloned into an expression vector to construct pET24a-PE-2a-F2-KDEL plasmid. The plasmid was induced to express PE-2a-F2-KDEL recombinant protein. First, DNA sequence (SEQ ID NO: 30) encoding KDEL signal peptide was cloned into pET24a vector to form pET24a-KDEL plasmid. After that, DNA sequence (SEQ ID NO: 5) of the 2a-F2 fragment obtained in Example 1 was cloned into pET24a-KDEL plasmid to form pET24a-2a-F2-KDEL plasmid. Finally, DNA sequence (SEQ ID NO: 34) encoding PE protein was cloned into pET24a-2a-F2-KDEL plasmid to form pET24a-PE-2a-F2-KDEL plasmid.
(33) 1. Construction of pET24a-KEDL
(34) The DNA sequence encoding KDEL signal peptide (SEQ ID NO: 31) is shown as SEQ ID NO: 30. The DNA sequence was amplified by PCR. The sequences of KEDL specificity primers are shown as follows.
(35) TABLE-US-00003 Forwardprimer(withaHindIIIrestrictionsite): (SEQIDNO:32) 5-CCC CTCAAAAAAGACGAACTGAGAGATG AACTGAAAGA-3 HindIII Reverseprimer(withaXhoIrestrictionsite) (SEQIDNO:33) 5-GTG
CAGTTCGTCTTTCAGTTCATCT-3 XhoI
Conditions for PCR reaction comprises: 94 C. for 3 minutes, 5 cycles of 95 C. for 1 minute, 55 C. for 1 minute, and 72 C. for 20 seconds, and 72 C. for 1 minutes for elongation. PCR product and pET24a vector were subjected to double restriction enzymes digestion with Hind III and Xho I. Thereafter, the digested PCR products and pET24a vector were purified, respectively, followed by ligation to clone the PCR product into pET24a to form pET24a-KDEL. Then, the construct pET24a-KEDL was transformed into host cells (E. coli) to carry out mass replication. The replicate PCR products were further confirmed by sequencing.
2. Construction of pET24a-2a-F2-KDEL
(36) The 2a-F2 DNA sequence (SEQ ID NO: 5) obtained in Example 1 was amplified by PCR. The PCR primers are shown as follows.
(37) TABLE-US-00004 ForwardprimerpF2-1 (withaSacIrestrictionsite): (SEQIDNO:38) 5-C TTTGTTCCCCCGGGAGGGGGG-3 SacI ReverseprimerpR2-1 (withaHindIIIrestrictionsite): (SEQIDNO:39) 5-CCC
GTAGGAGAAGGGTTGGGGGATT-3 HindIII
Conditions for PCR reaction comprises: 95 C. for 5 minutes, 25 cycles of 95 C. for 30 seconds, 55 C. for 30 seconds, and 72 C. for 30 seconds, and 72 C. for 5 minutes for elongation. PCR product and pET24a-KDEL plasmid were subjected to double restriction enzymes digestion with Sac I and Hind III. Thereafter, the digested PCR products and pET24a-KDEL plasmid were purified, respectively, followed by ligation to clone the PCR product into pET24a-KDEL to form pET24a-2a-F2-KDEL. Then, the construct was transformed into host cells (E. coli) to carry out mass replication. The replicate PCR products were further confirmed by sequencing.
3. Construction of pET24a-PE-2a-F2-KDEL
(38) The DNA sequence encoding PE protein (SEQ ID NO: 35) is shown as SEQ ID NO: 34. The DNA sequence was amplified by PCR. The sequences of PE specificity primers are shown as follows.
(39) TABLE-US-00005 Forwardprimer(withaBamHIrestrictionsite): (SEQIDNO:36) 5-CG GAAGAAGCGTTCGAC-3 BamHI Reverseprimer (withaEcoRIandaSacIrestrictionsites) (SEQIDNO:37) 5-CGGAATTC
GCAGGTCAGGCTCACCAC-3 EcoRISacI
Conditions for PCR reaction comprises: 94 C. for 5 minutes, 30 cycles of 95 C. for 1 minute, 55 C. for 1 minute, and 72 C. for 1.5 minutes, and 72 C. for 7 minutes for elongation. PCR product and pET24a-2a-F2-KDEL plasmid were subjected to double restriction enzymes digestion with BamH I and Sac I. Thereafter, the digested PCR products and pET24a-2a-F2-KDEL plasmid were purified, respectively, followed by ligation to clone the PCR product into pET24a-2a-F2-KDEL to form pET24a-PE-2a-F2-KDEL. Then, the construct pET24a-PE-2a-F2-KDEL was transformed into host cells (E. coli) to carry out mass replication. The replicate PCR products were further confirmed by sequencing. The antigenic fusion protein PE-2a-F2-KDEL has amino acid sequence of SEQ ID NO: 41, and the DNA sequence encoding the fusion protein is SEQ ID NO: 40.
4. PE-2a-F2-KDEL Protein Expression
(40) E. coli containing pET24a-PE-2a-F2-KEDL plasmid was incubated in LB medium. The bacterial culture was induced by addition of IPTG to express the antigenic fusion protein PE-2a-F2-KEDL (SEQ ID NO: 41). Methods for protein expression and extraction are described in Example 1.
Example 4
Analysis of PCV2 ORF2 Sequences of Different Subgroups
(41) In addition to subgroup 2a, there are other subgroups of PCV2 virus. Analyses of arginine numbers of amino acid sequences encoded by nucleotides 1-234 at the 5 end of PCV2 ORF2 and amino acid sequences encoded by the DNA sequences from nucleotide 235 to the last nucleotide of PCV2 ORF2 of PCV2 subgroups 2b, 2c, 2d, and 2e are shown as follows, respectively.
(42) PCV2 ORF2 gene sequences provided by Wang et al. (Wang et al., Virus Research 2009, Genetic variation analysis of Chinese strains of porcine circovirus type 2.) are used as standard sequences for phylogenetic analysis of SEQ ID NO: 15 and SEQ ID NO: 19. The result shows that PCV2 ORF2 sequences SEQ ID NO: 15 and SEQ ID NO: 19 belong to PCV2 2b subgroup and PCV2 2d subgroup, respectively (as shown in
(43) Results of sequence analysis of PCV2 2b subgroup are shown in Table 3. The ORF2 fragment of PCV2 2b subgroup (2b-ORF2) has the nucleotide sequence of SEQ ID NO: 15 and the amino acid sequence of SEQ ID NO: 16. There are 21 arginine residues in the amino acid sequences encoded by nucleotides 1-234 at the 5 end of 2b-ORF2, whereas there are 10 arginine residues in the amino acid sequences (SEQ ID NO: 18) encoded by nucleotides 235-699 (without the stop codon, SEQ ID NO: 17) of 2b-ORF2. Results of sequence analysis of PCV2 2b subgroup are consistent with that of PCV2 2a subgroup. The arginine numbers at the N terminus of both ORF2 proteins are two times or more than the arginine numbers of the rest part of the ORF2 proteins (as shown in Tables 2 and 3).
(44) TABLE-US-00006 TABLE 3 Analysis of Arginine Numbers of the PCV2 2b-ORF2 Amino Acid Sequence Subgroup PCV2-2b - Subgroup PCV2-2b - nucleotides 1-234 nucleotides 235-699 Codon Amino Acid Amount Codon Amino Acid Amount AGA Arginine 5 AGA Arginine 5 AGG Arginine 3 AGG Arginine 1 CGA Arginine 1 CGA Arginine 0 CGC Arginine 9 CGC Arginine 3 CGG Arginine 1 CGG Arginine 0 CGT Arginine 2 CGT Arginine 1 Total 21 Total 10
(45) Results of sequence analysis of PCV2 2c subgroup are shown in Table 4. The ORF2 fragment of PCV2 2c subgroup (2c-ORF2) has the nucleotide sequence of SEQ ID NO: 50 and the amino acid sequence of SEQ ID NO: 51. There are 20 arginine residues in the amino acid sequences encoded by nucleotides 1-234 at the 5 end of 2c-ORF2, whereas there are 10 arginine residues in the amino acid sequences (SEQ ID NO: 55) encoded by nucleotides 235-702 (SEQ ID NO: 54) of 2c-ORF2. Results of sequence analysis of PCV2 2c subgroup are consistent with that of PCV2 2a subgroup and PCV2 2b subgroup. The arginine numbers at the N terminus of all the three ORF2 proteins are two times or more than the arginine numbers of the rest part of the ORF2 proteins (as shown in Tables 2, 3 and 4).
(46) TABLE-US-00007 TABLE 4 Analysis of Arginine Numbers of the PCV2 2c-ORF2 Amino Acid Sequence Subgroup PCV2-2c - Subgroup PCV2-2c - nucleotides 1-234 nucleotides 235-702 Codon Amino Acid Amount Codon Amino Acid Amount AGA Arginine 5 AGA Arginine 6 AGG Arginine 3 AGG Arginine 1 CGA Arginine 0 CGA Arginine 0 CGC Arginine 9 CGC Arginine 2 CGG Arginine 1 CGG Arginine 0 CGT Arginine 2 CGT Arginine 1 Total 20 Total 10
(47) Results of sequence analysis of PCV2 2d subgroup are shown in Table 5. The ORF2 fragment of PCV2 2d subgroup (2d-ORF2) has the nucleotide sequence of SEQ ID NO: 19 and the amino acid sequence of SEQ ID NO: 20. There are 21 arginine residues in the amino acid sequences encoded by nucleotides 1-234 at the 5 end of 2d-ORF2, whereas there are 10 arginine residues in the amino acid sequences (SEQ ID NO: 21) encoded by nucleotides 235-702 (without the stop codon, SEQ ID NO: 22) of 2d-ORF2. Results of sequence analysis of PCV2 2d subgroup are consistent with that of PCV2 2a subgroup, PCV2 2b subgroup, and PCV2 2c subgroup. The arginine numbers at the N terminus of all the four ORF2 proteins are two times or more than the arginine numbers of the rest part of the ORF2 proteins (as shown in Tables 2, 3, 4, and 5).
(48) TABLE-US-00008 TABLE 5 Analysis of Arginine Numbers of the PCV2 2d-ORF2 Amino Acid Sequence Subgroup PCV2-2d - Subgroup PCV2-2d - nucleotides 1-234 nucleotides 235-702 Codon Amino Acid Amount Codon Amino Acid Amount AGA Arginine 5 AGA Arginine 4 AGG Arginine 3 AGG Arginine 3 CGA Arginine 1 CGA Arginine 0 CGC Arginine 10 CGC Arginine 1 CGG Arginine 0 CGG Arginine 1 CGT Arginine 2 CGT Arginine 1 Total 21 Total 10
(49) Results of sequence analysis of PCV2 2e subgroup are shown in Table 6. The ORF2 fragment of PCV2 2e subgroup (2e-ORF2) has the nucleotide sequence of SEQ ID NO: 52 and the amino acid sequence of SEQ ID NO: 53. There are 20 arginine residues in the amino acid sequences encoded by nucleotides 1-234 at the 5 end of 2e-ORF2, whereas there are 9 arginine residues in the amino acid sequences (SEQ ID NO: 57) encoded by nucleotides 235-699 (without the stop codon, SEQ ID NO: 56) of 2e-ORF2. Results of sequence analysis of PCV2 2e subgroup are consistent with that of PCV2 2a subgroup, PCV2 2b subgroup, PCV2 2c subgroup, and PCV2 2d subgroup. The arginine numbers at the N terminus of all the five ORF2 proteins are two times or more than the arginine numbers of the rest part of the ORF2 proteins (as shown in Tables 2, 3, 4, 5, and 6).
(50) TABLE-US-00009 TABLE 6 Analysis of Arginine Numbers of the PCV2 2e-ORF2 Amino Acid Sequence Subgroup PCV2-2e - Subgroup PCV2-2e - nucleotides 1-234 nucleotides 235-699 Codon Amino Acid Amount Codon Amino Acid Amount AGA Arginine 5 AGA Arginine 4 AGG Arginine 3 AGG Arginine 2 CGA Arginine 0 CGA Arginine 0 CGC Arginine 9 CGC Arginine 2 CGG Arginine 1 CGG Arginine 0 CGT Arginine 2 CGT Arginine 1 Total 20 Total 9
(51) Protein expression levels of the arginine-rich domains and the non-arginine-rich domains of PCV2 2b subgroup, PCV2 2c subgroup, PCV2 2d subgroup, and PCV2 2e subgroup are also analyzed by the method described in Example 1. The results are consistent with the results in Example 1. Protein expression level of the arginine-rich domains at N terminus is low, whereas protein expression level of the non-arginine-rich domain is high. Furthermore, analysis of addition or deletion of the arginine shows that deletion of the excessive arginine can increase protein expression of PCV2 ORF2, which is also consistent with the results of PCV2 2a subgroup.
(52) The arginine-rich domain has an amino acid sequence of about residues 1-78 at the N terminus of the full-length peptide of PCV2 ORF2, and the non-arginine-rich domain has an amino acid sequence about from residue 79 to the last residue at C terminus.
Example 5
Construction and Expression of Antigenic Peptides of PCV2 2b Subunit Vaccine
(53) 1. Construction and Expression of pET24a-2b-F2
(54) In this example, ORF2 gene of PCV2 2b subgroup in Example 4 was used in construction of the antigenic peptide of PCV2 subunit vaccine. As described in Examples 1 and 3, F2 fragment (nucleotides 235-468 at the 5 end of the full-length DNA sequence of PCV2 2b ORF2 gene, 2b-F2 fragment) is cloned into expression vector. The 2b-F2 fragment of PCV2 2b subgroup has the nucleotide sequence of SEQ ID NO: 17 and the amino acid sequence of SEQ ID NO: 18. The nucleotide sequence of the 2b-F2 fragment was amplified by PCR. The PCR primers are shown as follows.
(55) TABLE-US-00010 ForwardprimerpF-2b (withaSacIrestrictionsite): (SEQIDNO:42) 5-C TTTCTTCCCCCAGGAGGGGGC-3 SacI ReverseprimerpR-2b (withaHindIIIrestrictionsite): (SEQIDNO:43) 5-CCC
GTAGGAGAAGGGCTGGGTTAT-3 HindIII
Conditions for PCR reaction comprises: 95 C. for 5 minutes, 25 cycles of 95 C. for 30 seconds, 55 C. for 30 seconds, and 72 C. for 30 seconds, and 72 C. for 5 minutes for elongation. PCR product and pET24a expression vector (Novagen) were subjected to double restriction enzymes digestion with Sac I and Hind III. Thereafter, the digested PCR products and pET24a expression vector were purified, respectively, followed by ligation to clone the PCR product into pET24a expression vector to form pET24a-2b-F2 plasmid. Then, the construct was transformed into host cells (E. coli) to carry out mass replication. The replicate PCR products were further confirmed by sequencing. E. coli containing pET24a-2b-F2 lasmid was incubated in LB medium. The bacterial culture was induced by addition of IPTG to express the antigenic protein 2b-F2 (SEQ ID NO: 18). Methods for protein expression and extraction are described in Example 1.
2. Construction and Expression of pET24a-PE-2b-F2-KDEL
(56) In addition to using 2b-F2 peptide as the antigenic peptide of PCV2 subunit vaccine, in this Example, PE protein and KDEL signal peptide were fused with the 2b-F2 peptide at the N and C terminuses, respectively, to produce PE-2b-F2-KDEL recombinant fusion protein to induce sufficient immunity against PCV2 infection in animals.
(57) PE-2b-F2-KDEL recombinant fusion protein has a DNA sequence of SEQ ID NO: 44 and an amino acid sequence of SEQ ID NO: 45. The strategy for construction of plasmid expressing PE-2b-F2-KDEL recombinant fusion protein (pET24a-PE-2b-F2-KDEL) is the same as the strategy described in Example 3. First, DNA sequence (SEQ ID NO: 30) encoding KDEL signal peptide was cloned into pET24a vector to form pET24a-KDEL plasmid. Method for construction of pET24a-KDEL plasmid is described in Example 3. After that, DNA sequence (SEQ ID NO: 17) of the 2b-F2 fragment was cloned into pET24a-KDEL plasmid to form pET24a-2b-F2-KDEL plasmid. Finally, DNA sequence (SEQ ID NO: 34) encoding PE protein was cloned into pET24a-2b-F2-KDEL plasmid to form pET24a-PE-2b-F2-KDEL plasmid. Method for construction of pET24a-PE-2b-F2-KDEL plasmid is described in Example 3. Then, E. coli containing pET24a-PE-2b-F2-KDEL plasmid was incubated in LB medium. The bacterial culture was induced by addition of IPTG to express PE-2b-F2-KDEL recombinant protein (SEQ ID NO: 45). Methods for protein expression and extraction are described in Example 1.
Example 6
Construction and Expression of Antigenic Peptides of PCV2 2d Subunit Vaccine
(58) 1. Construction and Expression of pET24a-2d-F2
(59) In this example, ORF2 gene of PCV2 2d subgroup in Example 4 was used in construction of the antigenic peptide of PCV2 subunit vaccine. As described in Examples 1 and 3, F2 fragment (nucleotides 235-468 at the 5 end of the full-length DNA sequence of PCV2 2d ORF2 gene, 2d-F2 fragment) is cloned into expression vector. The 2d-F2 fragment of PCV2 2d subgroup has the nucleotide sequence of SEQ ID NO: 21 and the amino acid sequence of SEQ ID NO: 22. The nucleotide sequence of the 2d-F2 fragment was amplified by PCR. The PCR primers are shown as follows.
(60) TABLE-US-00011 ForwardprimerpF-2d (withaSacIrestrictionsite): (SEQIDNO:46) 5-C TTTCTTCCCCCAGGAGGGGGC-3 SacI ReverseprimerpR-2d (withaHindIIIrestrictionsite): (SEQIDNO:47) 5-CCC
GTAGGAGAAGGGCTGGGTTAT-3 HindIII
Conditions for PCR reaction comprises: 95 C. for 5 minutes, 25 cycles of 95 C. for 30 seconds, 55 C. for 30 seconds, and 72 C. for 30 seconds, and 72 C. for 5 minutes for elongation. PCR product and pET24a expression vector (Novagen) were subjected to double restriction enzymes digestion with Sac I and Hind III. Thereafter, the digested PCR products and pET24a expression vector were purified, respectively, followed by ligation to clone the PCR product into pET24a expression vector to form pET24a-2d-F2 plasmid. Then, the construct was transformed into host cells (E. coli) to carry out mass replication. The replicate PCR products were further confirmed by sequencing. E. coli containing pET24a-2d-F2 lasmid was incubated in LB medium. The bacterial culture was induced by addition of IPTG to express the antigenic protein 2d-F2 (SEQ ID NO: 22). Methods for protein expression and extraction are described in Example 1.
2. Construction and Expression of pET24a-PE-2d-F2-KDEL
(61) In addition to using 2d-F2 peptide as the antigenic peptide of PCV2 subunit vaccine, in this Example, PE protein and KDEL signal peptide were fused with the 2d-F2 peptide at the N and C terminuses, respectively, to produce PE-2d-F2-KDEL recombinant fusion protein to induce sufficient immunity against PCV2 infection in animals.
(62) PE-2d-F2-KDEL recombinant fusion protein has a DNA sequence of SEQ ID NO: 48 and an amino acid sequence of SEQ ID NO: 49. The strategy for construction of plasmid expressing PE-2d-F2-KDEL recombinant fusion protein (pET24a-PE-2d-F2-KDEL) is the same as the strategy described in Example 3. First, DNA sequence (SEQ ID NO: 30) encoding KDEL signal peptide was cloned into pET24a vector to form pET24a-KDEL plasmid. Method for construction of pET24a-KDEL plasmid is described in Example 3. After that, DNA sequence (SEQ ID NO: 21) of the 2d-F2 fragment was cloned into pET24a-KDEL plasmid to form pET24a-2d-F2-KDEL plasmid. Finally, DNA sequence (SEQ ID NO: 34) encoding PE protein was cloned into pET24a-2d-F2-KDEL plasmid to form pET24a-PE-2d-F2-KDEL plasmid. Method for construction of pET24a-PE-2d-F2-KDEL plasmid is described in Example 3. Then, E. coli containing pET24a-PE-2d-F2-KDEL plasmid was incubated in LB medium. The bacterial culture was induced by addition of IPTG to express PE-2d-F2-KDEL recombinant protein (SEQ ID NO: 49). Methods for protein expression and extraction are described in Example 1.
Example 7
Immunogenicity Analysis of Antigenic Peptides of PCV2 Subunit Vaccine-1
(63) 1. Immunization of Mice
(64) PCV2 subunit vaccine was made with the 2a-F2 recombinant protein (SEQ ID NO: 6) prepared in Example 1 and the PE-2a-F2-KDEL recombinant protein (SEQ ID NO: 41) prepared in Example 3, respectively, and Freund's complete adjuvant. Mice were vaccinated with the PCV2 subunit vaccine to analyze immunogenicity of the antigenic peptides of the PCV2 subunit vaccine.
(65) Five- to six-week-old healthy SPF mice were randomly divided into 3 groups of 3 mice each. Enzyme-linked immunosorbent assay (ELISA) showed that all the 9 mice were negative for anti-PCV2 antibodies. Each mouse in the 2 vaccine groups (Groups 1 and 2) was injected intraperitoneally with 100 g of recombinant protein. Mice in Group 3 were injected with PBS and served as negative control. Two weeks after primary immunization (p.i.), the mice in the 2 vaccine groups were boosted with the same dose of the 2 different recombinant proteins, respectively. Serum samples were collected at weeks 2, 4, 5, and 8 post-primary immunization. All the serum samples were tested by ELISA to measure the titer of anti-PCV2 antibodies.
(66) 2. Detection of Anti-PCV2 Antibodies by ELISA
(67) Ninety-six well plates containing PCV2 pathogen antigen (300 ng/well) were used as the ELISA plates in this example. The ELISA plates were washed 3 times with 50 mmol/L PBS (pH 7.2) containing 500 l/L Tween-20 (i.e. PBST) for 3 to 5 minutes each time. To block the ELISA plates, 2004 of 0.15% BSA blocking solution was added to each well of the ELISA plates, and then the ELISA plates were incubated for 2 hours at 37 C. After that, the ELISA plates were washed with PBS. Mice serum samples were diluted fifty-fold (1:50) with PBS and then diluted two-fold serially. Each sample had 8 repeats. Diluted serum samples were added to the wells of the ELISA plates (100 l/well), and the plates were incubated for 1 hour at 37 C. After incubation, the plates were washed with PBS. Anti-mouse IgG antibody conjugated with alkaline phosphatase (AP) was then added to the wells. After incubating for 1 hour at 37 C., the plates were washed with PBS. For visualization of results, para-Nitrophenylphosphate (pNPP) was added to the wells. Following incubation, the reaction was stopped by adding 1M NaOH. The optical density of each well was read using optical density at 405 nm. Each sample was analyzed in duplicate, and the O.D. values of duplicates were averaged.
(68) ELISA results are shown in
Example 8
Immunogenicity Analysis of Antigenic Peptides of PCV2 Subunit Vaccine-2
(69) 1. Immunization of Mice
(70) In this Example, immunogenicity of PE-2a-F2-KDEL recombinant protein disclosed herein in tested animals is compared with immunogenicity of PCV2 whole virus in tested animals.
(71) PCV2 subunit vaccine was made with the PE-2a-F2-KDEL recombinant protein (SEQ ID NO: 41) prepared in Example 3 and oil adjuvant Montanide ISA 206 (Seppic, France). In addition, PCV2 whole virus vaccine was made with in activated PCV2 whole virus (10.sup.6 TCID.sub.50/ml) and oil adjuvant Montanide ISA 206 (Seppic, France). There are 100 l inactivated PCV2 whole virus and 250 l adjuvant in a single dose of PCV2 whole virus vaccine. The two vaccines were used to vaccinate mice.
(72) Five- to six-week-old healthy SPF mice were randomly divided into 3 groups of 5 mice each. Enzyme-linked immunosorbent assay (ELISA) showed that all the 15 mice were negative for anti-PCV2 antibodies. Each mouse in Groups 1 was injected intraperitoneally with 100 g of recombinant protein. Each mouse in Groups 2 was injected intraperitoneally with a single dose of PCV2 whole virus vaccine. Mice in Group 3 were injected with oil adjuvant Montanide ISA 206 and served as negative control. Three weeks after primary immunization (p.i.), the mice in the 2 vaccine groups were boosted with the same dose of the 2 different vaccines, respectively. Serum samples were collected at weeks 0, 1, 2, 3, 4, and 5 post-primary immunization. All the serum samples were tested by ELISA to measure the titer of anti-PCV2 antibodies.
(73) 2. Detection of Anti-PCV2 Antibodies by ELISA
(74) ELISA method for detection of anti-PCV2 antibodies is described in Example 7. ELISA results are shown in
(75) Furthermore, pigs were vaccinated with the 2a-F2 and PE-2a-F2-KDEL recombinant proteins, respectively, and both of the recombinant proteins were able to induce serum antibodies against PCV2 in pigs. In addition, the vaccinated pigs were challenged with PCV2 virus to evaluate the efficacy of the recombinant proteins. First, the recombinant proteins were formulated as subunit vaccine and injected into pigs. Then, the pigs were challenged with PCV2 virus. The results show that the protection rates of immunization groups are higher then that of the negative control (no vaccination). The protection rates used herein include a decrease in viremia and alleviation of PCV2 symptoms. Therefore, the results show that the PCV2 subunit vaccine prepared with the recombinant proteins can effectively induce immunity in animals and increase survival rate of the animals.
(76) Additionally, ORF2 proteins or fragments thereof of PCV2 2b subgroup, PCV2 2c subgroup, PCV2 2d subgroup, and PCV2 2e subgroup were prepared by the methods described in Examples 1-3, respectively, and immunogenicity of the ORF2 proteins or fragments thereof were analyzed by the methods described in Examples 7 and 8. The results show that the ORF2 fragments of these PCV2 subgroups (for example, F2 fragment) and recombinant fusion proteins thereof (for example, PE-F2-KDEL) can induce immunity in animals (such as pigs) and prevent the animals from PCV2 infection.
(77) The PCV2 subunit vaccine provided in the disclosure has the following advantages comparing with other conventional techniques.
(78) The PCV2 subunit vaccine provided in the disclosure is prepared by genetic engineering, in which PCV2 ORF2 protein fragments that can be highly expressed in biological expression systems are cloned and used as antigenic peptides of the subunit vaccine. The subunit vaccine can induce sufficient immunity against PCV2 infection in animals, and the PCV2 ORF2 protein fragments can be mass-produced by genetic engineering to reduce cost of manufacturing the vaccine.
(79) Another PCV2 subunit vaccine provided in the disclosure contains a PE-F2-KDEL antigenic fusion protein, which is a recombinant protein of F2 peptide of PCV2 ORF2, PE protein, and KDEL signal peptide. Animal trials show that this PCV2 subunit vaccine can efficiently induce higher immunity against PCV2 infection in animals.
(80) The subunit vaccine provided in the disclosure is developed by genetic engineering, and the vaccine has the advantages of simple production process, low cost, high purity, high yield, and good safety.
(81) Many changes and modifications in the above-described embodiment of the invention can, of course, be carried out without departing from the scope thereof. Accordingly, to promote the progress in science and the useful arts, the invention is disclosed and is intended to be limited only by the scope of the appended claims.