Composition comprising a purified extract isolated from Pseudolysimachion rotundum var. subintegrum containing abundant amount of active ingredient or the compounds isolated therefrom, as an active ingredient for treating a chronic obstructive pulmonary disease and the use thereof

Abstract

A composition comprising a purified extract isolated from Pseudolysimachion rotundum var. subintegrum containing abundant amount of active ingredient or the compounds isolated therefrom as an active ingredient for treating a chronic obstructive pulmonary disease and the use thereof. Inventive purified extract and compounds showed potent anti-COPD activity without beta-2-receptor agonistic response through various in vivo tests as well as in vitro test. Therefore, it can be used as the therapeutics or functional health food for treating and preventing chronic obstructive pulmonary disease (COPD).

Claims

1. A method of treating chronic obstructive pulmonary disease (COPD) in mammals, wherein the method comprises administering a therapeutically effective amount of the purified extract with the secondary fractionation (ATC2) containing 30-60% (w/w) verproside, 0.5-10% (w/w) veratric acid, 2-20% (w/w) catalposide, 1- 10% (w/w) picroside II, 1-10% (w/w) isovanilloyl catalpol and 2-20% (w/w) 6-O-veratroyl catalpol based on the weight of total extract (100%) of Pseudolysimachion rotundum var subintegrum into the mammal suffering from chronic obstructive pulmonary disease (COPD).

2. A method of treating chronic obstructive pulmonary disease (COPD) in mammals, wherein the method comprises administering a composition comprising therapeutically effective amount of the purified extract with the secondary fractionation (ATC2) containing 30-60% (w/w) verproside, 0.5-10% (w/w) veratric acid, 2-20% (w/w) catalposide, 1-10% (w/w) picroside II, 1-10% (w/w) isovanilloyl catalpol and 2-20% (w/w) 6-O-veratroyl catalpol based on the weight of total extract (100%) of Pseudolysimachion rotundum var subintegrum and the pharmaceutically acceptable carriers or excipients, into the mammal suffering from chronic obstructive pulmonary disease (COPD).

3. A method of treating chronic obstructive pulmonary disease (COPD) in mammals, wherein the method comprises administering a therapeutically effective amount of the combined compounds contained in Pseudolysimachion rotundum var subintegrum with mixed weight ratio of 45%-90% verproside, 1.0%-7.0% veratric acid, 3.0%-15% catalposide, 2.0%-10% picroside II, 2.0%-10% isovanilloyl catalpol and 2.0-15% 6-O-veratroyl catalpol into the mammal suffering from chronic obstructive pulmonary disease (COPD).

4. A method of treating chronic obstructive pulmonary disease (COPD) in mammals, wherein the method comprises administering a composition comprising a therapeutically effective amount of the combined compounds contained in Pseudolysimachion rotundum var subintegrum with mixed weight ratio of 45%-90% verproside, 1.0%-7.0% veratric acid, 3.0%-15% catalposide, 2.0%-10% picroside II, 2.0%-10% isovanilloyl catalpol and 2.0-15% 6-O-veratroyl catalpol, and the pharmaceutically acceptable carriers or excipients, into the mammal suffering from chronic obstructive pulmonary disease (COPD).

Description

DESCRIPTION OF DRAWINGS

Best Mode

(1) The above and other objects, features and other advantages of the present invention will more clearly understood from the following detailed description taken in conjunction with the accompanying drawings, in which;

(2) FIG. 1 shows HPLC analysis of the crude extract of Pseudolysimachion rotundum var subintegrum prepared in comparative Example 1;

(3) FIG. 2 shows HPLC analysis of the inventive purified extract (ATC1) of Pseudolysimachion rotundum var subintegrum prepared in Example 1;

(4) FIG. 3 shows HPLC analysis of the inventive purified extract (ATC2) of Pseudolysimachion rotundum var subintegrum prepared in Example 2;

(5) FIG. 4 shows the schematic procedure to establish ADRB2 GPCR-expressing cell line model;

(6) FIG. 5 shows the spot formation in U2OS cell treated with already known ADRB agonist;

(7) FIG. 6 shows the spot formation in U2OS cell treated with the inventive purified extract and compounds;

(8) FIG. 7 shows the digitalized result of the expression of MUC5AC using by HSC;

(9) FIG. 8 represents the change of MUC5AC expression in A549 cell treated with TO Fb1;

(10) FIG. 9 represents the change of MUC5AC expression in A549 cell which was pre-treated with the inventive purified extract or compounds and then treated with TNF-;

(11) FIG. 10 represents the change of MUC5AC expression in A549 cell treated with acrolein, the inventive purified extract or compounds;

(12) FIG. 11 presents the effect of the inventive purified extract or compounds on the induction of Th2 differentiation from Naive CD4.sup.+ T cells (CD4.sup.+CD62L+);

(13) FIG. 12 presents the effect of the inventive purified extract or compounds on the differentiation of Mouse Th2;

(14) FIG. 13 presents the effect of the inventive purified extract or compounds on the IL-4 expression, a differentiation marker of mouse Th2 cell;

(15) FIG. 14 presents the effect of the inventive purified extract or compounds on the number of total immunocytes, neutrophils and the level of T lymphocyte after the LPS inhalation (i.t) to Balb/c mice and challenge of cigarette smoke;

(16) FIG. 15 presents the effect of the inventive purified extract or compounds on the number of CD4.sup.+& CD8.sup.+ T cells in BALF (A: total cell number (10.sup.5)/BALF (ml); B: number of neutrophils (10.sup.4)/BALF (ml); C: absolute number of CD4.sup.+ & CD8.sup.+ T cell (10.sup.4)/BALF (ml), data was expressed as mean cell numberSEM (P<0.05, P<0.01, P<0.001 versus LPS+CS; n=10);

(17) FIG. 16 presents the effect of the inventive purified extract or compounds on the level of CXCL-1, TNF-, and MIP-2 after the LPS inhalation (i.t) to Balb/c mice and challenge of cigarette smoke;

(18) FIG. 17 presents the effect of the inventive purified extract or compounds on the number of inflammatory cells;

(19) FIG. 18 presents the effect of the inventive purified extract or compounds on the total cell number in BALF;

(20) FIG. 19 presents the effect of the inventive purified extract or compounds on the MMP-9 activity in lung tissue;

(21) FIG. 20 presents the effect of the inventive purified extract or compounds on the expression of proinflammatory proteins in lung tissue;

(22) FIG. 21 represents the inhibitory effect of the inventive purified extract on the inflammatory response in lung tissue cell using by the histological examination of bronchoalveolar lavage;

BEST MODE FOR CARRYING OUT THE INVENTION

(23) It will be apparent to those skilled in the art that various modifications and variations can be made in the compositions, use and preparations of the present invention without departing from the spirit or scope of the invention.

(24) The present invention is more specifically explained by the following examples. However, it should be understood that the present invention is not limited to these examples in any manner.

EXAMPLES

(25) The following Reference Example, Examples and Experimental Examples are intended to further illustrate the present invention without limiting its scope.

Comparative Example 1

Preparation of the Crude Extract of Pseudolysimachion rotundum Var Subintegrum

(26) 1-1. Preparation of Crude Extract (ATE)

(27) 1 kg of dried Pseudolysimachion rotundum var subintegrum (cultivated at 244, Soi-myeon Eumseong-gun Chungcheongbuk-do in Korea according to GAP) cut into small pieces and mixed with 10 L of 40% ethanol. The mixture was stirred at room temperature for 24 hours and extracted with reflux extraction at 78 C. for 12 hours to collect the filtrate, three times. The extract was filtered with filter paper to remove the debris. The collected filtrate was concentrated by rotary evaporator (EYELA, N-2100, Japan) at 5565 C. under reduced pressure and dried with freezing dryer to obtain 202 g of dried crude extract (designated as ACE hereinafter) for used as a comparative example.

(28) 1-2. Component Analysis

(29) The component analysis was performed using by HPLC (Agilent 1260 model, USA) according to the condition in Table 1 and the result was shown in FIG. 1.

(30) As can be seem in FIG. 1, it has been confirmed that each ingredient was detected at 9.548 mins (Verproside), 10.817 mins (Veratric acid), 16.728 mins (Catalposide), 20.346 min (Picroside II), 21.853 mins (Isovanilloyl catalpol), and 30.462 mins (6-O-veratrolyl catalpol) respectively.

(31) The content of each ingredient (%) in the sample was calculated based on the HPLC pattern (retention time) according to math formulae 1.
content of each ingredient=conc. of standard (mg/ml)/conc. of test sample (mg/ml)At/Aspurity of standard (%)[Math formulae 1]

(32) wherein At denotes the ingredient area in test sample and As denotes that in standard provided that the sampled volume of test sample and standard is identical to each other.

(33) TABLE-US-00001 TABLE 1 HPLC condition HPLC condition Pump Agilent 1260 Series, 1260 quart pump Detector Agilent 1260 Series, 1260 DAD Column Agilent Eclipse XOB C18, 4.6 50 cm, 5 m Flow rate 1.5 ml/min UV Absorbance 266 nm Mobile phase Mobile phase A: phosphate buffer (pH = 3.5) Mobile phase B: methanol Mobile phase A Mobile phase B Time (%) (%) 0~5 80 20 5~20 75 25 20~25 75 25 25~30 55 45 30~35 55 45 35~36 80 20 36~40 80 20 Injection volume 10 l

(34) At the result, it has been confirmed that the crude extract of Pseudolysimachion rotundum var subintegrum contains only 8.49% (w/w) catalposide derivatives, i.e., 5.9% (w/w) verproside, 0.21% (w/w) veratric acid, 0.82% (w/w) catalposide, 0.40% (w/w) picroside II, 0.42% (w/w) isovanillyl catalpol, and 0.74% (w/w) 6-O-veratroyl catalpol, respectively, as can be seen in Table 2.

(35) TABLE-US-00002 TABLE 2 HPLC result (crude extract: ACE) Comparative Example 1 Active ingredient Retention Time (mins) Content (w/w %) Verproside 9.548 5.90 Veratric acid 10.817 0.21 Catalposide 16.728 0.82 Picroside II 20.346 0.40 Isovanilloyl catalpol 21.853 0.42 6-O-veratroyl catalpol 30.462 0.74 Total 8.49

Example 1

Preparation of the Purified Extract (ATC1) of Pseudolysimachion rotundum Var Subintegrum

(36) The crude extract (ACE) of Pseudolysimachion rotundum var subintegrum prepared by the conventional method according to Comparative Example 1, was suspended in 2 L of distilled water and the suspension was added with 2 L of butanol to fractionate into butanol-soluble fraction and water-soluble fraction. The butanol soluble fraction was collected, concentrated under reduced pressure and dried to afford 82 g of the inventive purified extract fractionated with butanol (ATC1) used as a test example.

(37) The component analysis was performed using by HPLC (Agilent 1260 model, USA) according to the condition in Table 1 and the result was shown in FIG. 2.

(38) As can be seem in FIG. 2, it has been confirmed that each ingredient was detected at 9.545 mins (Verproside), 10.821 mins (Veratric acid), 16.727 mins (Catalposide), 20.345 min (Picroside II), 21.853 mins (Isovanilloyl catalpol), and 30.462 mins (6-O-veratroyl catalpol) respectively.

(39) The content of each ingredient (%) in the sample was calculated based on the HPLC pattern (retention time) according to math formulae 1.

(40) At the result, it has been confirmed that the inventive purified extract fractionated with butanol (ATC1) of Pseudolysimachion rotundum var subintegrum contains 25.64% (w/w) catalposide derivatives, i.e., 17.60% (w/w) verproside, 0.72% (w/w) veratric acid, 2.62% (w/w) catalposide, 1.08% (w/w) picroside II, 1.26% (w/w) isovanillyl catalpol, and 2.36% (w/w) 6-O-veratroyl catalpol, respectively, as can be seen in Table 3.

(41) TABLE-US-00003 TABLE 3 HPLC result (purified extract: ATC1) Example 1 Active ingredient Retention Time (mins) Content (w/w %) Verproside 9.545 17.60 Veratric acid 10.821 0.72 Catalposide 16.727 2.62 Picroside II 20.345 1.08 Isovanilloyl catalpol 21.853 1.26 6-O-veratroyl catalpol 30.462 2.36 Total 25.64

Example 2

Preparation of the Purified Extract (ATC2) of Pseudolysimachion rotundum var subintegrum

(42) The inventive purified extract fractionated with butanol (ATC1) of Pseudolysimachion rotundum var subintegrum according to Example 1, was dissolved in 75 ml of mixed solvent (distilled water:methaol=1:0.003) and 75 g of the solution was loaded on reverse phase column chromatography (C18 (IV)-D-75-120 nm, AGC Si-Tech Co. Ltd., Japan, 450 g) with eluting the suspension using by eluting solvent (distilled water:methanol=90:10.fwdarw.60:40). 8.4 L of the eluted solution running at the initial eluting solvent system (distilled water:methanol=90:10) was collected and concentrated under reduced pressure. 5.6 L of the eluted solution running at the late eluting solvent system (distilled water:methanol=60:40) was collected, concentrated under reduced pressure and dried to afford 33 g of the inventive purified extract with the secondary fractionation (ATC2) used as a test example.

(43) The component analysis was performed using by HPLC (Agilent 1260 model, USA) according to the condition in Table 1 and the result was shown in FIG. 3.

(44) As can be seem in FIG. 3, it has been confirmed that each ingredient was detected at 9.525 mins (Verproside), 10.818 mins (Veratric acid), 16.721 mins (Catalposide), 20.346 min (Picroside II), 21.857 mins (Isovanilloyl catalpol), and 30.462 mins (6-O-veratroyl catalpol) respectively.

(45) The content of each ingredient (%) in the sample was calculated based on the HPLC pattern (retention time) according to math formulae 1.

(46) At the result, it has been confirmed that the inventive purified extract with the secondary fractionation (ATC2) of Pseudolysimachion rotundum var subintegrum contains 65.63% (w/w) catalpol derivatives, i.e., 43.83% (w/w) verproside, 1.80% (w/w) veratric acid, 7.07% (w/w) catalposide, 2.93% (w/w) picroside II, 3.85% (w/w) isovanillyl catalpol, and 6.15% (w/w) 6-O-veratroyl catalpol, respectively, as can be seen in Table 4.

(47) TABLE-US-00004 TABLE 4 HPLC result (purified extract: ATC2) Example 2 Active ingredient Retention Time (mins) Content (w/w %) Verproside 9.524 43.83 Veratric acid 10.818 1.80 Catalposide 16.721 7.07 Picroside II 20.346 2.93 Isovanilloyl catalpol 21.857 3.85 6-O-veratroyl catalpol 30.462 6.15 Total 65.63

Example 3

Preparation of Inventive Compounds from Pseudolysimachion rotundum Var Subintegrum

(48) The inventive compounds, i.e., verproside, veratric acid, catalposide, picroside II, isovanilloyl catalpol, and 6-O-veratroyl catalpol having following physico-chemical properties, were purified from the extract of Pseudolysimachion rotundum var subintegrum according to isolating method disclosed in Korean Patent Publication No. 10-2006-125499, and the physico-chemical properties of each compound were compared with those in the already published literatures for the identification of each chemical structure.

1. Verproside (=6-O-(3,4-dihydroxybenzoyl)catalpol)

(49) .sup.1H NMR (400 MHz, DMSO-d.sub.6) : 2.47 (1H, dd, J=8.0, 9.2 Hz, H-9), 2.59 (1H, dddd, J=1.6, 4.0, 8.0, 8.0, H-5), 3.00 (1H, m, H-G4), 3.05 (1H, m, H-G2), 3.14 (1H, m, H-G5), 3.18 (1H, m, H-G3), 3.42, 3.71 (2H, m, H-G6). 3.67 (1H, s, H-7), 3.71, 3.91 (2H, d, J=13.2 Hz, each, H-10), 4.61 (1H, d, J=7.6 Hz, H-G1), 4.94 (1H, dd, J=4.0, 6.0 Hz, H-4), 5.03 (1H, d, J=8.0 Hz, H-6), 5.09 (1H, d, J=9.2 Hz, H-1), 6.41 (1H, dd, J=1.6. 6.0 Hz, H-3), 6.82 (1H, d, J=8.0 Hz, H-5), 7.35 (1H, dd, J=2.0, 8.0 Hz, H-6), 7.39 (1H, d, J=2.0 Hz, H-2).

(50) .sup.13C-NMR (100 MHz, DMSO-d.sub.6) : 93.0 (C1), 141.1 (C-3), 101.8 (C-4), 35.2 (C-5), 79.5 (C-6), 58.2 (C-7), 65.8 (C-8), 41.8 (C-9), 120.0 (C-1), 116.4 (C-2), 145.1 (C-3), 150.8 (C-4), 115.4 (C-5), 122.6 (C-6), 165.6 (C-7), 97.9 (C-G1), 73.4 (C-G2), 76.4 (C-G3), 70.3 (C-G4), 77.5 (C-G5), 61.4 (C-G6).

2. Picroside II (=6-O-(4-hydroxy-3-methoxybenzoly)catalpol)

(51) .sup.1H-NMR (400 MHz, DMSO-d.sub.6) : 2.47 (1H, dd, J=8.0, 9.6 Hz, H-9), 2.58 (1H, dddd, J=1.2, 6.0, 8.0, 8.4 Hz, H-5), 3.00 (1H, m, H-G4), 3.05 (1H, m, H-G2), 3.14 (1H, m, H-G5), 3.18 (1H, m, H-G3), 3.42, 3.71 (2H, m, H-G6), 3.67 (1H, br s, H-7), 3.72, 3.92 (2H, d, J=13.2, each, H-10), 4.62 (1H, d, J=7.6 Hz, H-G1), 4.99 (1H, dd, J=4.4, 6.0 Hz, H-4), 5.06 (1H, d, J=8.4 Hz, H-6), 5.11 (1H, d, J=9.6 Hz, H-1), 6.42 (1H, dd, J=1.2. 6.0 Hz, H-3), 6.89 (1H, d, J=8.4 Hz, H-5), 7.46 (1H, d, J=2.0 Hz, H-2.sup.1), 7.52 (1H, dd, J=2.0, 8.4 Hz, H-6), 3.83 (3H, s, 3-OCH3).

(52) .sup.13C-NMR (100 MHz, DMSO-d.sub.6) : 93.0 (C1), 141.1 (C-3), 101.8 (C-4), 35.2 (C-5), 79.7 (C-6), 58.2 (C-7), 65.8 (C-8), 41.8 (C-9), 58.5 (C-10), 120.0 (C-1), 112.7 (C-2), 147.5 (C-3), 152.0 (C-4), 115.3 (C-5), 123.8 (C-6), 165.6 (C-7), 97.9 (C-G1), 73.4 (C-G2), 76.4 (C-G3), 70.3 (C-G4), 77.5 (C-G5), 61.4 (C-G6), 55.7 (3-OCH3).

3. Catalposide (=6-O-(4-hydroxybenzolyl)catalpol)

(53) .sub.1H-NMR (400 MHz, DMSO-d.sub.6) : 2.47 (1H, dd, J=8.0, 9.6 Hz, H-9), 2.56 (1H, dddd, J=1.2, 4.0, 8.0, 8.0 Hz, H-5), 3.00 (1H, m, H-G4), 3.05 (1H, m, H-G2), 3.14 (1H, m, H-G5), 3.18 (1H, m, H-G3), 3.43, 3.72 (2H, m, H-G6), 3.69 (1H, br s, H-7), 3.72, 3.92 (2H, d, J=13.2 Hz, each, H-10), 4.62 (1H, d, J=8.0 Hz, H-G1), 4.96 (1H, dd, J=4.0, 6.0 Hz, H-4), 5.05 (1H, dd, J=1, 2, 8.0 Hz, H-6), 5.11 (1H, d, J=9.6 Hz, H-1), 6.42 (1H, dd, J=1.2. 6.0 Hz, H-3), 6.86 (2H, d, J=8.0 Hz, H-3, -5), 7.85 (2H, d, J=2.0 Hz, H-2, -6).

(54) .sup.13C-NMR (100 MHz, DMSO-d.sub.6) : 92.9 (C1), 141.1 (C-3), 101.8 (C-4), 35.1 (C-5), 79.6 (C-6), 58.2 (C-7), 65.8 (C-8), 41.8 (C-9), 119.6 (C-1), 131.7 (C-2, 6), 115.5 (C-3, 5), 162.6 (C-4), 165.5 (C-7), 97.8 (C-G1), 73.4 (C-G2), 76.4 (C-G3), 70.3 (C-G4), 77.5 (C-G5), 61.4 (C-G6).

4. Isovanilloyl catalpol (=6-O-(3-hydroxy-4-methoxybenzoyl)catalpol)

(55) .sup.1H-NMR (400 MHz, DMSO-d.sub.6) : 2.47 (1H, m, H-9), 2.55 (1H, m H-5), 3.00 (1H, m, H-G4), 3.05 (1H, m, H-G2), 3.14 (1H, m, H-G5), 3.18 (1H, m, H-G3), 3.43, 3.70 (2H, m, H-G6), 3.70 (1H, br s, H-7), 3.72, 3.92 (2H, d, J=13.2, each, H-10), 4.62 (1H, d, J=8.0 Hz, H-G1), 4.95 (1H, dd, J=4.4, 6.0 Hz, H-4), 5.06 (1H, d, J=8.0 Hz, H-6), 5.11 (1H, d, J=9.2 Hz, H-1), 6.42 (1H, d, J=6.0 Hz, H-3), 7.04 (1H, d, J=8.4 Hz, H-5), 7.42 (1H, br s, H-2), 7.48 (1H, d, J=8.4 Hz, H-6), 3.84 (3H, s, 4-OCH3).

(56) .sup.13C-NMR (100 MHz, DMSO-d.sub.6) : 93.0 (C1), 141.0 (C-3), 101.6 (C-4), 35.2 (C-5), 79.7 (C-6), 58.2 (C-7), 65.8 (C-8), 41.8 (C-9), 58.4 (C-10), 121.7 (C-1), 115.7 (C-2), 146.3 (C-3), 152.1 (C-4), 111.4 (C-5), 121.3 (C-6), 165.3 (C-7), 97.8 (C-G1), 73.4 (C-G2), 76.4 (C-G3), 70.3 (C-G4), 77.4 (C-G5), 61.4 (C-G6), 55.7 (4-OCH3).

5. 6-O-veratroyl catalpol (=6-O-(3,4-di methoxybenzoly)catalpol)

(57) .sup.1H-NMR (400 MHz, DMSO-d.sub.6) : 2.47 (1H, dd, J=8.0, 9.6 Hz, H-9), 2.59 (1H, dddd, J=1.6, 4.8, 8.0, 8.0 Hz, H-5), 3.00 (1H, m, H-G4), 3.05 (1H, m, H-G2), 3.14 (1H, m, H-G5), 3.18 (1H, m, H-G3), 3.42, 3.71 (2H, m, H-G6), 3.70 (1H, br s, H-7), 3.72, 3.90 (2H, d, J=13.2 Hz, each, H-10), 4.61 (1H, d, J=7.6 Hz, H-G1), 4.97 (1H, dd, J=4.8, 6.0 Hz, H-4), 5.08 (1H, d, J=8.8 Hz, H-6), 5.10 (1H, d, J=9.6 Hz, H-1), 6.42 (1H, dd, J=1.6. 6.0 Hz, H-3), 7.09 (1H, d, J=8.4 Hz, H-5), 7.46 (1H, d, J=2.0 Hz, H-2), 7.64 (1H, dd, J=2.0, 8.4 Hz, H-6), 3.81, 3.84 (6H, s each, 3, 4-OCH3).

(58) .sup.13C-NMR (100 MHz, DMSO-d.sub.6) : 92.9 (C1), 141.1 (C-3), 101.8 (C-4), 35.2 (C-5), 79.9 (C-6), 58.2 (C-7), 65.9 (C-8), 41.8 (C-9), 58.4 (C-10), 121.3 (C-1), 111.8 (C-2), 148.5 (C-3), 153.2 (C-4), 111.2 (C-5), 123.5 (C-6), 165.5 (C-7), 97.8 (C-G1), 73.4 (C-G2), 76.4 (C-G3), 70.3 (C-G4), 77.5 (C-G5), 61.4 (C-G6), 55.6, 55.7 (3, 4-OCH.sub.3).

Experimental Example 1

Establishment of ADBR2 GPCR-Targeting Cell-Based Assay System

(59) In order to develop ADBR2 GPCR-targeting cell-based assay system, following test was performed.

(60) 1-1. Development of ADBR2 GPCR Expressing Cell Line

(61) ADBR2 (beta-2 adrenergic receptor) GPCR (G-protein coupled receptor, Sinco Biological Inc., HF10378-M) was cloned to pIRESpuro vector (Clontech, Mountain View, Calif.), transformed into U2OS (ATCC, HTB-96, human osteosarcoma cell line) and treated with growth medium supplemented with DEME (HyClone), 10% FBS (HyClone, SH30071.03) and 1% antibiotic (Gibco, 15140) to select single colony.

(62) The selected stable colonies were inoculated into 96 well-plates and test samples, i.e., Indacaterol (positive control, Zhiyu biotechnology, China) and 24 hrs after the inoculation, ATC2 extract prepared in Example were treated thereto. The cell was fixed with formalin solution for 5 mins, washed with a sterilized water and confirm the spot formation using by spot detector software (ThermoFisher, U.S.A) as depicted in FIG. 4.

(63) 1-2. Evaluation on the Efficacy of Positive Control

(64) 10 micromole already well-known ADBR2 agonists, i.e., isopreterenol, salmeterol, formoterol, salbutamol and indacaterol (Zhiyu biotechnology, China) were treated to the selected U2OS cells stably expressing ADBR2 GPCR and the spot formation by the treatment was determined by using spot detector software in Cellomics apparatus (ThermoFisher, U.S.A).

(65) As can be seen in FIG. 5, it has confirmed that all the groups treated with already well-known ADBR2 agonists (isopreterenol, salmeterol, formoterol, salbutamol and indacaterol), especially, indacaterol, showed apparent spot formation and the beta 2-agonist such as indacaterol form apparant spot by acting as a ADRB2 agonist (beta 2-receptor) whereas ATC2 at 40 mg/ml did not form spot formation.

(66) 1-3. Evaluation on the Efficacy of Test Samples

(67) 40 g/ml of ATC2 as well as the inventive compounds, i.e., 20 micromole verproside, veratric acid, catalposide, picroside II, isovanilloyl catalpol, and 6-O-veratroyl catalpol, respectively, were treated to the selected U2OS cells stably expressing ADBR2 GPCR and the spot formation by the treatment was determined by using spot detector software in Cellomics apparatus (ThermoFisher, U.S.A).

(68) As can be seen in FIG. 6, it has confirmed that all the groups treated with ATC2 as well as the inventive compounds, I.e., 20 micromole verproside, veratric acid, catalposide, picroside II, isovanilloyl catalpol, and 6-O-veratroyl catalpol, did not show spot formation, which means the presence of ADRB2-GFP on the receptor. According to the result, it has been confirmed that ATC extract and the inventive compounds did not act as a ADBR2 agonist.

(69) Accordingly, it has also confirmed that inventive extract and inventive compounds directly targeting MUC5AC, a main therapeutic target, and preventing from MUC5AC expression, could solve the existing problems of conventional treatment such as the treatment by beta 2 agonist, for example, adrenergic reaction to beta 2 receptor such as hypokalemia, cramp, anxiety, tachycardia, ventricular premature beats etc and the adverse response in case of oral administration such as arrhythmia, epilepsy etc caused by irregular change in blood drug concentration.

Experimental Example 2

Establishment of Mucin 5AC-Targeting Cell-Based Assay System

(70) There have been reported that Mucin5A/C is an important taget to develop COPD treating agent (Busse P J, Zhang T F, Srivastava K, Schofield B, Li X M. 2007. Effect of ageing on pulmonary inflammation, airway hyperresponsiveness and T and B cell responses in antigen-sensitized and -challenged mice. Clinical & Experimental Allergy. 37(9):1392-403, Smirnova M G, Birchall J P, Pearson J P. 2000. TNF-alpha in the regulation of MUC5AC secretion: some aspects of cytokine-induced mucin hypersecretion on the in vitro model. Cytokine, 12:1732-6).

(71) Accordingly, the present inventors developed novel high throughput screening test by introducing high content screening system which can quantitatively determine the expression of target protein in animal cell level and in order to screening the inhibiting agent of Mucin 5AC expression, following test was performed by modifying the target activator method published on Cellomics BioApplication.

(72) 2-1. Digitization of Mucin 5A/C Expression Using by HSC

(73) A549 cell line (ATCC, CCL-185), a epithelial cell line isolated from human lung cancer tissue was seeded on 96 well plates (5,000 cells/well) and 24 hrs after the seeding, 20 ng/ml of bFGF, 100 ng/ml of EGF, 20 micromole IGF, 5 ng/ml of TGF-beta1, 30 nanomole acrolein, 5 nanomole PMA, 1 microgram/ml, LPS and 20 ng/ml of IL-1 beta were treated therewith. The expression of Mucin 5A/C was digitized by target activator program in Cellomics apparatus.

(74) As can be seen in FIG. 7, it has been confirmed that all the tested substances excepting TGF-beta1 increased the expression of MUC5A/C.

(75) 2-2. Digitization of Inhibiting Effect of TGF-Beta1 on Mucin 5A/C Expression

(76) Various concentrations of TGF-beta 1 (PeproTech, #100-21), i.e., 1, 5 and 10 ng/ml TGF-beta 1 were treated with A549 cell line (ATCC, CCL-185), and the expression of Mucin 5A/C was digitized by target activator program in Cellomics apparatus.

(77) As can be seen in FIG. 8, it has been confirmed that TGF-beta1 more inhibited the expression of MUC5A/C than control medium (GM, DMEM, 10% FBS, 1% antibiotics).

(78) 2-3. Digitization of Inhibiting Effect of TNF-Alpha on Mucin 5A/C Expression

(79) Various concentrations of ATC2 extract were treated with A549 cell line for 2 hours and then 20 g/ml TNF-alpha (Sigma, H8916) was treated therewith for 24 hours. The expression of Mucin 5A/C was digitized by target activator program in Cellomics apparatus.

(80) As can be seen in FIG. 9, it has been confirmed that the expression of MUC5A/C was effectively inhibited with the treatment of TNF-alpha which increases MUC5AC expression in a dose dependent manner in case that ATC2 was pre-treated.

(81) 2-4. Inhibiting Effect of Inventive Test Samples on Mucin 5A/C Expression

(82) The diluted A549 cell line (ATCC, CCL-185) with DMEM medium supplemented with 5% phenol red and FBS (Fetal Bovine Serum) was seeded in 6 well plates (410.sup.5 cells/well) to adhere thereto for a night, and 20 and 40 microgram/ml of ATC2 extract were treated with A549 cell line for 1 hours. 30 nM acrolein was treated therewith to induce Mucin 5A/C expression. The medium was removed the cell, washed with PBS solution and homogenized with Trizol (Invitrogen, CA, USA) for the isolation of ribonucleic acids from the cells for 5 mins. the cells were collected, transferred to centrifugal separator, completely mixed with chloroform for 15 seconds, left alone for 3 mins and centrifuged for 15 mins at the speed of 14,000 rpm. The supernatant containing ribonucleic acid was transferred to new tube and mixed with isopropylalcohol for 10 mins. The solution was centrifuged to discard the supernatant and 75% ethanol was added to the precipitate. The precipitate was centrifuged for 5 mins at the speed of 10,000 rpm and the supernatant was discarded. The precipitated ribonucleic acid was dried at room temperature for 20 mins. The dried ribonucleic acid was suspended in distilled water treated with DEPC (Diethylpyrocarbonate, W2004, www.biosesang.com, Korea). After the quantification of ribonucleic acid, the complementary DNA was synthesized using by 1 microgram of RNA and RT-kit (Omniscript RT kit, Qiagen, USA) and the synthetic cDNA was used as a template. Mucin5A/C primer (Forward; 5-CGA CAA CTA CTT CTG CGG TGC-3, Reverse: 5-GCA CTC ATC CTT CCT GTC GTT-3) was mixed therewith, denatured for 5 mins at 94 C. using by PCR mix (DreamTaq PCR Master Mix, Fermentas, USA), reacted for 40 cycles, i.e., 30 seconds at 94 C., 30 seconds at 58 C., 45 seconds at 72 C. and performed to PCR for 5 mins at 72 C. in order to enzyme inactivation. GAPDH (Glyceraldehyde-3-phosphate dehydrogenase, Bioneer Corporation, www.bioneer.co.kr, Korea) was used as an internal standard.

(83) As can be seen in FIG. 10, it has been confirmed that the expression of MUC5A/C was increased by acrolein treatment while it was inhibited with the treatment of inventive extract (ARC2) or inventive compounds such as verproside or 6-O-veratroyl catalpol in a dose dependent manner.

Experimental Example 3

Inhibition Effect on Mouse Th2 Cell Differentiation

(84) 3-1. Establishment of Mouse Th2 Cell Differentiation

(85) aCD4.sup.+ T cells (CD4.sup.+CD62L.sup.+) was isolated from the lymph nodes and spleens of C57BL6 mice using by MACS (Miltenyi Biotec, Order no. 130-090-976) and the collected CD4.sup.+ T cells were cultured on the coated plates with anti-CD3 (1 g/ml, BD pharmingen) and anti-CD28 (0.5 g/ml, BD pharmingen).

(86) The differentiation of TH2 cells were induced by RPMI medium supplemented with anti-IFN-gamma and rmIL-4 (Hyclone) and the degree of differentiation was determined by FACS (Flow cytometry, Becton-Dickinson, FACSCalibur).

(87) As can be seen in FIG. 11, it has been confirmed that the established condition of test was utilized since the degree of differentiation of this condition was determined as 29.6%, similarly to that of conventionally available condition using by the marketed medium for inducing the differentiation of TH2 cells (38%, Merck Milipore, FCIM025162) and the differentiation of TH2 cells was induced at 3rd days after the induction of differentiation by reconfirming the induction of marker expression through RT-PCR (S1000 Thermal cycler, Bio-Rad) experiment using by Th2 differentiation markers (IL-4 and GATA3) to determine their mRNA expression.

(88) 3-2. Effect on Mouse Th2 Cell Differentiation

(89) Naive CD4.sup.+ T cells (CD4.sup.+CD62L.sup.+Miltenyi Biotec, 130-093-227) was isolated from the lymph nodes and spleens of C57BL6 mice using by MACS (Miltenyi Biotec, Order no. 130-090-976) and 5, 10, 20 and 40 microgram/ml of ATC2 were treated therewith when the cell was induced to be differentiated into Th2 cell. The degree of Th2 differentiation was determined by the expression of IL-4 differentiation maker.

(90) As can be seen in FIG. 12, it has been confirmed that the degree of Th2 differentiation in the test group treated with various concentrations of ATC2 has been reduced in a dose dependant manner, 19.2% in case of 5 microgram/ml of ATC2 while that in the control group was 29.6%. However the total number of cells in the test group treated with 20 and 40 microgram/ml of ATC2 were reduced and therefore it has been actually confirmed that less than 10 microgram/ml of ATC2 showed effective inhibitory concentration from Th2 differentiation without affecting on the total number of cells.

(91) Accordingly, it has been confirmed that less than 10 microgram/ml of ATC2 is suitable concentration in the test.

(92) 3-3. Effect on the Spectral Change in the Molecular Expression Involved in Th2 Cell Differentiation

(93) Naive CD4.sup.+ T cells (CD4.sup.+CD62L.sup.+Miltenyi Biotec, 130-093-227) was isolated from the lymph nodes and spleens of C57BL6 mice using by MACS (Miltenyi Biotec, Order no. 130-090-976) and 2.5, 5, and 10 microgram/ml of ATC2 were treated therewith when the cell was induced to be differentiated into Th2 cell. The degree of Th2 differentiation was determined by the expression of IL-4 differentiation maker.

(94) As can be seen in FIG. 13, it has been confirmed that II-4 expression was induced in only Th2 cell comparing with naive cell and the expression of IL-4 differentiation maker were sharply reduced to about 60% in the group treated with 2.5 microgram/ml of ATC2, about 30% in the group treated with 5 microgram/ml of ATC2, and about 5% in the group treated with 10 microgram/ml of ATC2.

(95) Oxidative stress caused by cigarette smoking or air pollution, give rises to destroying an alveolar maintenance, increasing apoptosis and inflammatory response, inducing the unbalance of protease/anti-protease, and intensifying the inflammation through aging and autoimmune response, thereby resulting in the occurrence of COPD disease after a lapse of 30-50 years. COPD showed particular characteristics for, example, obstruction of air-trapping and emphysema or specific inflammation in lung such as the increased level of macrophage, neutrophil, T-lymphocyte, CD 8 cell, chemokines etc.

(96) The present test analyzed the effective concentration of test samples (ATC2, Verproside, Roflumilast) in COPD induced mice by the intratracheal instillation (i.t.) of LPS and CS.

(97) At the result, it has been confirmed that more than 15 mg/kg of ATC2, 15 mg/kg of verproside and 15 mg/kg of Roflumilast, showed similar inhibition on the number of total immunocyte, neutrophil, and T lymphocyte etc in BALF. More than 15 mg/kg of ATC2, 15 mg/kg of verproside and Roflumilast 15 mg/kg of Roflumilast, showed similar inhibition on the reproduced level of TNF-a, KC/CXCL-1, and MIP-2, a mediator destroying lung alveoli.

(98) Through those result, it has been confirmed that more than 15 mg/kg of ATC2, 15 mg/kg of verproside and 15 mg/kg of Roflumilast, showed potent anti-COPD activity by way of inhibiting the proliferation and activation of neutrophils recruiting to lung caused by the occurrence of COPD.

Experimental Example 4

Animal Model Test (Mice)

(99) In order to determine the anti-COPD effect of inventive extract or compounds on the number of total immunocyte, neutrophil, and T lymphocyte etc in BALF, and the reproduced level of TNF-a, KC/CXCL-1, and MIP-2, following test was performed by using COPD induced mice.

(100) 4-1. Experiment Animal

(101) Specific pathogen-free male BALB/c mice (about 18-20 g), aged 8 weeks, which were routinely screened serologically for relevant respiratory pathogens, were purchased from ORIENT Co. (www.orient.co.kr, Seoul, Korea) and bred allowing to access freely to feed and water in breeding room controlling the temperature of 222 C., and humidity of 5515% at the light-dark cycle for 12 hours and acclimated with the experimental environment for 1 week.

(102) 4-2. Drug and Administration

(103) (1) Test Sample

(104) 4 kinds of test samples, i.e., ATC2 (30 mg/kg), Verproside (30 mg/kg), Indacaterol (30 mg/kg), Roflumilast (30 mg/kg) were dissolved in 0.5% CMC (carboxmethylcellulose sodium) and uses as test samples.

(105) (2) Administration

(106) 30 mg/kg of each ATC2, Verproside, Indacaterol, and Roflumilast were mixed with 100 l of the LPS+CS mixture {LPS (100 g/ml)+standard cigarette extract (Cigarette smoking (CS), 4 mg/ml)=1:1} and orally administrated to the mice, 1 hour before prior the intratracheal instillation (i.t.).

(107) (3) Preparation of Standard Cigarette Extract (Cigarette Smoking; CS)

(108) test material: 60 pieces of standard cigarette CM7 (Coresta Monitering Cigarette 7, Heinr Borgwaldt, Germany) and isopropanol, ethanol (Merck, Germany), n-heptadecane (Sigma-Aldrich, USA) were used as test materials and Automatic smoking machine (ISO 3308 standardized product, automatic smoking machine, model No.: RM20, Heinr Borgwaldt) were used in the experiment.
4-3. Collection of Mainstream Smoke
(1) Collection of Mainstream Smoke

(109) Mainstream smoke of standard cigarette CM7 (Coresta Monitering Cigarette 7, Heinr Borgwaldt, Germany) was collected according to the procedure disclosed in KS H ISO (International Organization for Standardization) 3402 standard (Tobacco and tobacco productsAtmosphere for conditioning and testing) and Korean guideline (Determination guideline for the harmful component in Cigarette type smoking desire suppressor, October, 2012, KFDA) and performed in smoking room (temp.: 222 C., relative humidity: 605%).

(110) The cigarette was combusted according to the smoking procedure ISO standard, i.e., smoked volume (35.00.3 ml), smoking interval (600.5 sec), smoking time (2.000.02 sec) and length of cigarette butt (tipping paper+3 mm, overwrap+3 mm) using by Automatic smoking machine (ISO 3308 standardized product, automatic smoking machine, model No.: RM20/CS, Heinr Borgwaldt, Germany) pursuant to ISO3308 standard (Routine analytical cigaretteSmoking machineDefinition and standard conditions) and TPM (Total Particulate Matter) of cigarette was collected using by 92 mm cambridge filter (ISO3308 standardized product, RM20, Heinr Borgwaldt, Germany) pursuant to ISO3308 standard (KS H ISO3308, 2000).

(111) (2) Weight of Total Particulate Matter (TPM)

(112) The weight of cigarette holder containing pre-combusted cambridge filter was determined according to ISO4387 standard and then the weight of cigarette holder (RM20/CS, Heinr Borgwaldt, Germany) containing cigarette smoke collected by cambridge filter (RM20, Heinr Borgwaldt, Germany) after combustion to calculate TPM content (KS H ISO 4387, 2000; CigarettesDetermination of total and nicotine-free dry particulate matter using a routine analytical smoking machine) and the Korean guideline (Determination guideline for the harmful component in Cigarette type smoking desire suppressor, October, 2012, KFDA).

(113) At the result, it has been confirmed that the content of TPM in case that standard cigarette has been combusted three times, was determined as 16.0621 mg (19 pieces), 15.9135 mg (20 pieces), 15.5380 mg/cig (20 pieces) respectively. The tested total number of standard cigarette was 59 pieces and TPM was 47.5136 mg.

(114) (3) Extraction of Cigarette TPM

(115) The cambridge filter containing RPM was isolated from cigarette holder and poured to 100 ml erlenmeyer flask. 50 ml of isopropanol 50 ml was added thereto, mixed thoroughly, left alone at room temperature for over 8 hours to extract. After extraction, the solution was filtered, concentrated under vaccuo and transferred to scintillation vial (WHEATON, 03-340-25N, USA) to concentrate under nitrogen gas.

(116) The content of cigarette TPM in mainstream smoke was calculated according to following empirical formulae 1.

(117) calculation of TPM content Empirical formulae 1 TPM ( mg / cig ) = W FHA - W FHB N

(118) wherein TPM denotes Total Particulate Matter;

(119) W.sub.FHA denotes the weight of Filter Holder after smoking;

(120) W.sub.FHB denotes the weight of Filter Holder before smoking;

(121) N denotes the number of smoked cigarette (vig.)/Trap.

(122) 4-4. Test Procedure

(123) (1) COPD Animal Model

(124) 8 weeks aged BALB/c male mice was anaesthetized with 7% chloral hydrate and 100 l of LPS+CS mixture {LPS (100 g/ml)+standard cigarette extract (Cigarette smoking (CS), 4 mg/ml)=1:1} was inhaled to mice (i.t.) for three weeks once a week to prepare COPD animal model. Briefly, 100 l of LPS+CS mixture was evenly inhaled to nose and mouth of fastened mice (i.t). The tested groups were divided into six groups, i.e., (i) normal group with no treatment (Intact), (ii) control group treated with LPS+CS mixture (COP D-control), (iii) test sample group treated with ATC2 (30 mg/kg, p.o) 1 hr prior to LPS+CS treatment (COP D-ATC2), (iv) test sample group treated with Verproside (30 mg/kg, p.o) 1 hr prior to LPS+CS treatment (COPD-Verproside), (v) test sample group treated with Indacaterol (30 mg/kg, p.o) 1 hr prior to LPS+CS treatment (COPD-Indacaterol), and (vi) test sample group treated with Roflumilast (30 mg/kg, p.o) 1 hr prior to LPS+CS treatment (COP D-Roflumilast). After the end of experiment, the blood, BALF, and pneumonocyte of each mice were isolated and collected to test.

(125) (2) Isolation of PBMCs from Blood and Determination of Cell Number

(126) After the end of experiment, 8001000 l of blood was collected from the mice injected with 40 l of 30 I.U heparin (APU8AF, JW Pharmaceutical, Korea) and then anaesthetized with ethyl ether according to cardiac puncture. 500 l of collected blood was added to 9.5 ml of ACK solution (A1049201. Invitrogen, USA) and left alone for 5 mins to dissolve erythrocyte. The blood was centrifuged for 5 mins at the speed of 1200 rpm to isolate PBMCs (Peripheral Blood Mononuclear Cell) and stained with 0.04% trypan blue (15250061, Invitrogen, USA) to count the total cell number/ml.

(127) (3) Isolation of BALF (BAL Fluid) and Determination of Total Cell Number

(128) After blood collection, 1 ml of FBS-free/DMEM medium contained in injector was injected to the trachea of autopsied mice, and the mice was fixed with string to circulate the blood three times and isolate the cell from BALF. The blood was isolated, treated with AK solution at 37 C., for 5 mins to dissolve erythrocyte, washed with FBS-free/DMEM medium and stained with 0.04% trypan blue to count total cell number.

(129) (4) Isolation of Lung Cell (Pneumocyte) and Determination of Total Cell Number

(130) Lung was delivered from the mice of which BALF was not isolated and the lung tissue was cut into slices. The slices were added to 3 ml of DMEM medium (LM001-05, Welgene, KOREA) without fetal bovine serum (FBS) and 1 mg/ml of collagenase IV (C5138, Sigma-Aldrich, USA) was added to the medium. The medium was incubated with shaking incubator (KMC480S, VISION SCI, Korea) at 37 C., for 30 mins and the tissue was digested more than four times to isolate pneumocyte. The isolated pneumocyte was washed with medium and allowed to pass through cell strainer (352350, FALCON, USA) to remove the undigested tissues other than cells or impurities. The cell was treated with ACK solution at 37 C., for 5 mins to dissolve erythrocyte, washed again with the medium, and stained with 0.04% trypan blue (15250061, Invitrogen, USA) to count total cell number.

(131) (5) FACS Analysis

(132) The isolated PBMCs, BAL (Bronchoalveolar lavage), and pneumocyte were adjusted to 510.sup.5 cells and performed to immunofluorescence staining at 4 C. PE-anti-CD3e (553064, BD Pharmingen, USA), FITC-anti-CD8 (553031, BD Pharmingen, USA), PE-anti-CD4 (553047, BD Pharmingen, USA), PE-anti-Gr-1 (553128, BD Pharmingen, USA), and FITC-anti-neutrophil (ab55453, Abcam, UK) were added thereto, respectively, and reacted for 30 mins in ice. After the reaction, the cells were washed with phosphate buffered physiological saline solution more than three times and the cell frequency (%) of CD3.sup.+CD4.sup.+ & CD3.sup.+CD8.sup.+, and Gr-1.sup.+Neutrophil.sup.+ was determined using by Cell Quest program (643274, BD Biosciences, USA) of the flow cytometer (FACSCalibur, Becton, Dickinson, USA) and the absolute total number in each tissue was calculated by applying total cells.

(133) (6) ELISA Analysis

(134) The level of IL-1, IL-6, TNF-a, IL-17, MCP-1, and GRO-a (BioSource, USA) in BALF isolated from mice was determined by enzyme-linked immuno-sorbent assay. Respective antibodies against L-1, IL-6, TNF-a, IL-17, MCP-1, and GRO-a were diluted with a coating buffer solution (291195, R&D System, USA), coated on a microwell and left alone for overnight at 4 C. Each well was washed three times with washing buffer solution and 100 l of 10-fold diluted serum was added thereto. The solution was left alone at room temperature for 1 hour, washed twice with washing buffer solution (Tween-20, Sigma-Aldrich, USA), added with 100 l of antibody Avidin-HRP conjugated (DY998, R&D System, USA), left alone for 1 hour at room temperature and washed again. 100 l of TMB substrate (555214, BD, USA) was added thereto. The solution was left alone for 30 mins in shadow and added with 50 l of stop solution (DY994, R&D system, USA) to determine the absorbance using by ELISA leader at 450 nm (340PC384, Molecular Devices, USA).

(135) (7) Determination of mRNA Gene Expression in Lung Tissue

(136) (7-1) RNA Isolation from Lung Tissue

(137) The lung tissue of mice was delivered and crushed into pieces to be dissolved solved by adding 500 ml of RNAzol.sup.B (CS-105B, Tel-Test, USA). 50 ml of chloroform (CHCl.sub.3) was added the mixed floating solution and mixed again for 15 seconds. The solution was left alone for 15 mins in ice, centrifuged at 13,000 rpm to recover about 200 ml of the supernatant and 200 ml of 2-propanol 200 ml was added to equal volume of the supernatant. The mixture was left alone for 15 mins in ice, centrifuged again at 13,000 rpm, washed with 80% EtOH, and dried for 3 mins with vacuum pump (ULVAC, USA) to extract RNA. The extracted RNA was dissolved in 20 ml of distilled water treated with diethyl pyrocarbonate (DEPC, IBS-BW1004, Intron, Korea), and inactivated with heating block (2050, Lab-Line, India) at 75 C. to use in the synthesis of first strand cDNA.

(138) (7-2) Reverse Transcription-Polymerase Chain Reaction

(139) Reverse transcription reaction was performed by the procedure as follows: 2 g of prepared total RNA in heating block was reacted at 37 C. for 30 mins by adding DNase I (10 U/ml) 2 U/tube, denatured at 75 C. for 10 mins, added with 2.5 ml of 10 mM dNTPs mix (4026, 4027, 4028, 4029, TaKaRA, Japan), 1 ml of random sequence hexanucleotides (25 pmole/25 ml (11034731001, Roche, Germany), 1 ml of RNase inhibitor (2313A, TaKaRa, Japan, 20 U/ml) as RNA inhibitor, 1 ml of 100 mM DTT (P1171, Progmega, USA), 4.5 ml of 5RT buffer (M531A, Promega, USA), and 250 mM Tris-HCl (pH 8.3, 375 mM KCl, 15 mM MgCl.sub.2), added again with 1 ml of M-MLV RT (200 U/ml, M1705, Promega, USA) and the final volume of solution was adjusted to 20 ml by adding distilled water treated with DEPC (diethyl pyrocarbonate). 20 ml of the reaction mixture was mixed thoroughly, centrifuged at 2,000 rpm for 5 second, reacted at 37 C. for 60 mins in heating block to synthesize first-strand cDNA, left alone at 95 C. for 5 mins to inactivate M-MLV RT and the synthesized cDNA was used in polymerase chain reaction (PCR).

(140) (7-3) Real Time Quantitative RT-PCR

(141) The synthesized cDNA was used in Real time quantitative PCR (Galli S J. Allergy, Curr. Biol., 10:R93-95, 2006) using by Applied Biosystems 7500 Real-Time PCR system (Applied Biosystems, USA). CATGTTCCAGTATGACTCCACTCACG (VIC, product provided with Applied Biosystems Co. Ltd.) was used as the probe for TGF-1, MUC5AC, and mouse glyceraldehyde-3-phosphate dehydrogenase (G3PDH), and Sper-Taqman PCR Master mix (4369016, ABI) was used in the experiment to react to the extent that the final concentration had reached to 200 nM. Real time quantitative PCR was performed as follows: pre-denaturation: at 50 C. for 2 min, at 94 C. for 10 min, and 40 cycles at 95 C. for 0.15 min, at 60 C. for 1 min. G3PDH (4351309, ABI, USA) was used as an internal standard in RME treatment group and control group and RQ (relative quantitative) was calculated according to following empirical formulae 2. (See Table 5)
target group Quantitative PCRy=x(1+e)nEmpirical formulae 2

(142) x=starting quantity, y=yield, n=number of cycles, e=efficiency

(143) TABLE-US-00005 TABLE5 NucleotidesequenceofMouse real-timePCROligonucleotide Gene Primer Sequence TGF-1 Forward 5 tggagcaacatgtggaactc3 Reverse 5 ctgccgtacaactccagtga3 MUC5AC Forward 5 AGAATATCTTTCAGGACCCCTGCT3 Reverse 5 ACACCAGTGCTGAGCATACTTTT3
(8) Histopathological Examination

(144) Delivered lung was promptly fixed with 10% formaldehyde solution (F0161, SAMCHUN, Korea), and cut into slices. The slices were washed with running water for 8 hrs, embedded with epoxy, cut into slices with microtome (SM2000R, LEICA, Germany), stained with Hematoxylin & Eosin, and Masson-Trichrome stain for collagen deposition staining. To observe the goblet cells, the cells were stained with PAS (Periodic Acid-Schiff) staining to observe by 400 optical microscope (333246, NIKON, Japan).

(145) 4-5. Statistics

(146) All the result obtained from various experiments was recorded as meanstandard error, and the verification of significance was determined using by b Student's T-test. The above data was analyzed according to one-way ANOVA test to determine the statistically significant variance between respective group for each determined final point and the statistic significance between each group was determined according to nonparametric Mann-Whitney test and Dunnett's multiple comparison test (IBM SPSS statistics version 19.0 statistic software, Inc, IBM, USA). The difference between each control (COPD-control) was obvious and therefore, it is not shown in figures and tables. The results (presented as meanstandard error of mean) was expressed as P values: <0.05 (*), <0.01 (**), or <0.001 (***) as statistically significant.

(147) 4-6. Test Result

(148) (1) Effect on the Number of Total Immunocyte, Neutrophils, and T-Lymphocyte in BALF

(149) The cell number of total immunocyte, the total absolute cell number of Nerutrophils.sup.+Gr-1.sup.+ cell, and the total absolute cell number of CD4.sup.+& CD8.sup.+ T cell in control group (COPD-control) were sharply increased compared with those in normal group (Balb/c normal group). The number of total immunocyte in the test group treated with more than 15 mg/kg of ATC2 (5, 10, 15, 30 mg/kg) was reduced compared with control group and those in the test group treated with verproside (15 mg/kg) and Roflumilast (15 mg/kg) (p<0.05) was sharply reduced compared with control group (FIG. 14). The total absolute cell number of Nerutrophils.sup.+Gr-1.sup.+ cell (total absolute No.) in the test group treated with more than 15 mg/kg (p<0.001) and 30 mg/kg (p<0.001) of ATC2 (5, 10, 15, 30 mg/kg) was reduced by more than 73.2% and 81.9% respectively compared with control group and those in the test group treated with verproside (15 mg/kg) (p<0.001) and Roflumilast (15 mg/kg) (p<0.001) was reduced by more than 93.9% and 97.5%, respectively, compared with control group (FIG. 14). The total absolute cell number of CD4.sup.+ T cell (total absolute No.) in the test group treated with 15 mg/kg (p<0.01) and 30 mg/kg (p<0.001) of ATC2 (5, 10, 15, 30 mg/kg) was reduced by more than 47.7% and 19.7% respectively, compared with control group and those in the test group treated with verproside (15 mg/kg) and Roflumilast (15 mg/kg) (p<0.001) was reduced by more than 32.9% and 73.2%, respectively, compared with control group (FIG. 14c). The total absolute cell number of CD8.sup.+ T cell (total absolute No.) in the test group treated with ATC2 (5, 10, 15, 30 mg/kg) and verproside (15 mg/kg) was not significantly different comparing with that in control group while that in the test group treated with Roflumilast (15 mg/kg) (p<0.001) was reduced by more than 67.2% comparing with that in control group (FIG. 14).

(150) At the result, it has been confirmed that the groups treated with more than 15 mg/kg of ATC2 (5, 10, 15, 30 mg/kg), Verproside (15 mg/kg), and Roflumilast (15 mg/kg) showed potent inhibitory effect on the proliferation and activation of inflammatory immunocytes and neutrophils recruiting to lung, resulting in potent anti-COPD activity.

(151) (2) Effect on the Number of Neutrophils in BALF

(152) The number of Diff-Qick stained neutrophils in the control group (COPD-control) using by cytospin in mice BALF was sharply increased by about 184 folds compared with that in normal group (Balb/c normal group) (FIG. 15). As can be seen in FIG. 15, The number of neutrophils in the groups treated with 15 mg/kg (p<0.001) and 30 mg/kg (p<0.001) of ATC2 (5, 10, 15, 30 mg/kg), were reduced by more than 89.1% and 72.4%, respectively, compared with control group and those in the groups treated with verproside (15 mg/kg)(p<0.001) and Roflumilast (15 mg/kg) (p<0.001) were reduced by more than 94.2% and 99.0%, respectively, compared with control group.

(153) At the result, it has been confirmed that the groups treated with more than 15 mg/kg of ATC2 (5, 10, 15, 30 mg/kg), Verproside (15 mg/kg), and Roflumilast (15 mg/kg) showed potent inhibitory effect on the proliferation of neutrophils recruiting to lung, resulting in potent anti-COPD activity.

(154) (3) Effect on the Reproduction of CXCL-1, TNF-, and MIP-2 in BALF

(155) Various chemokines MIP-2/CXCL-2, TNF- and protease etc released from produced from the inflammatory macrophage in lung tissue destroy an alveolar layer, and KC/CXCL-1 (Chemokines Gro-) and CXCL-8 stimulate neutrophil, release protease and thereby destroy alveolae again, resulting in COPD (Blidberg K, Palmberg L, Dahlen B, Lantz A S, Larsson K. 2012. Chemokine release by neutrophils in chronic obstructive pulmonary disease. Innate Immun. 18: 503-510).

(156) As can be seen in FIG. 16A showing the reproduction of chemokine KC/CXCL-1 (Chemokines Gro-) of BALF in mice determined by ELISA method, the reproduction of chemokine KC/CXCL-1 (Chemokines Gro-) in the control group has been sharply increased by about 5.9 folds compared with that in the control group (Balb/c normal group). The reproduction of chemokine KC/CXCL-1 (Chemokines Gro-) in the group groups treated with 15 mg/kg and 30 mg/kg (p<0.01) of ATC2 (5, 10, 15, 30 mg/kg), were reduced by more than 46.8% and 83.9%, respectively, compared with control group and those in the group treated with verproside (15 mg/kg)(p<0.05) and Roflumilast (15 mg/kg) (p<0.01) were reduced by more than 57.4% and 82.7%, respectively, compared with control group. As can be seen in FIG. 16B showing the reproduction of TNF- of BALF in mice determined by ELISA method, the reproduction of TNF- in the control group has been sharply increased by about 2.8 folds compared with that in the control group (Balb/c normal group). The reproduction of TNF- in the group groups treated with 15 mg/kg (p<0.05) and 30 mg/kg (p<0.01) of ATC2 (5, 10, 15, 30 mg/kg), were reduced by more than 45.5% and 63.4%, respectively, compared with control group and those in the group treated with verproside (15 mg/kg)(p<0.05) and Roflumilast (15 mg/kg) (p<0.01) were reduced by more than 42.2% and 65.0%, respectively, compared with control group. oup. As can be seen in FIG. 16C showing the reproduction of chemokines MIP-2/CXCL-2 of BALF in mice determined by ELISA method, the reproduction of chemokines MIP-2/CXCL-2 in the control group has been sharply increased by about 5.2 folds compared with that in the control group (Balb/c normal group). The reproduction of chemokines MIP-2/CXCL-2 in the group groups treated with 15 mg/kg (p<0.05) and 30 mg/kg (p<0.001) of ATC2 (5, 10, 15, 30 mg/kg), were reduced by more than 48.4% and 86.4%, respectively, compared with control group and those in the group treated with verproside (15 mg/kg)(p<0.01) and Roflumilast (15 mg/kg) (p<0.001) were reduced by more than 63.0% and 81.9%, respectively, compared with control group.

(157) At the result, it has been confirmed that the groups treated with more than 15 mg/kg of ATC2 (5, 10, 15, 30 mg/kg), Verproside (15 mg/kg), and Roflumilast (15 mg/kg) showed potent inhibitory effect on the reproduction of chemokines MIP-2/CXCL-2, TNF-, KC/CXCL-1 (Chemokines Gro-) and CXCL-8 etc involved in the destruction of lung cell, resulting in potent anti-COPD activity.

Experimental Example 5

Animal Model Test (Rat)

(158) In order to determine the anti-COPD effect of inventive extract or compounds on the number of total immunocyte, neutrophil, etc in BALF, the reproduced level of cytokines such as IL-1 beta, IL-6, TNF-a, the activation of MMP-9, the expression of proinflammatory proteins such as MMP-9, NF-kB, and the inflammatory response in lung tissue, following test was performed by using COPD induced mice.

(159) 5-1. Experiment Animal

(160) Specific pathogen-free male Sprague-Dawley eat (about 180-200 g), aged 6 weeks, which were routinely screened serologically for relevant respiratory pathogens, were purchased from ORIENT Co. (www.orient.co.kr, Seoul, Korea) and bred allowing to access freely to feed (antibiotic free, Samyang Oil & Feed Corp., Korea) and water in breeding room controlling the temperature of 222 C., and humidity of 5515% at the light-dark cycle for 12 hours and acclimated with the experimental environment for 1 week.

(161) 5-2. Drug and Administration

(162) (1) Test Sample

(163) 3 kinds of test samples, i.e., ATC2 (30 mg/kg), Verproside (30 mg/kg), Daxas (main ingredient: Roflumilast, 1 mg/kg) were dissolved in PBS and uses as test samples.

(164) (2) Administration

(165) ATC2, Verproside, Daxas were orally administrated to the mice at the dose of 4 mg/kg, 1 hour before prior the intratracheal instillation (i.t.).

(166) 5-3. Preparation of COPD Rat Model

(167) (1) Standard Cigarette

(168) 3R4F Kentucky Reference Cigarettes (University of California, USA) was used as a standard cigarette for generating a cigarette smoke. The cigarette containing 9.4 mg of tar, 11 mg of TPM (total particle matter) and 12 mg of carbon monooxide per piece, was used after harmonizing with the temperature of 221 C. and humidity of 602% after opening for 4872 hrs.

(169) (2) Procedure

(170) The exposure of cigarette smoke was performed by using a cigarette smoke generator (CH Technology Corp. USA). In a detail, 1 hour after the orally administration of test samples using by Head/nose-only exposure unit (TSE System, German) according to nose-only method, the cigarette smoke was exposed by inhalation for 3 days every hour. 8 puffs (volume 35 ml, duration 2 sec, interval 1 time/min) per one piece of standard cigarette was performed in the experiment. The tested groups were divided into five groups, i.e., (i) normal group with no treatment (normal control, NC), (ii) control group exposed with cigarette smoke (COPD), (iii) test sample group treated with Daxas (1 mg/kg, p.o) 1 hr prior to cigarette smoke exposure (DA), (iv) test sample group treated with ATC2 (30 mg/ml, p.o) 1 hr prior to cigarette smoke exposure (YPL), and (v) test sample group treated with Verproside (30 mg/ml, p.o) 1 hr prior to cigarette smoke exposure (Ver). After the end of experiment, the blood, BALF, and pneumonocyte of each rat were isolated and collected to test.

(171) 5-4. BALF Isolation and Determination of the Number of Immunocytes

(172) After finishing the experiment, rats were anesthetized with Zoletil50 (3VX9, Virbac, France, p.o) and the blood was delivered through caudal veins. In order to isolate BALF from lung, the bronchus of right lung was ligated with suture and then performed to tracheotomy. IV-use catheter (16 GA, 3S-Cath, Dukwoo, Korea) was put into the bronchus, and both of bronchus and catheter (16 GA, 3S-Cath, Dukwoo, Korea) were fixed with suture. The injector containing 5 ml of DPBS (Dubecco's phosphate-buffered saline, 14190-250, Invitrogen, USA) was connected thereto and DPBS was forced to circulate three times to isolate BALF. The light lung ligated with suture was isolated, fixed with 10% neutral formalin solution, and the remaining lung tissue was reserved in refrigerator at 70 C. The isolated BALF was centrifuged for 15 mins at 1500 rpm to prepare cell pellet and the supernatant was reserved in refrigerator at 70 C. for cytokine analysis. The cell pellet was suspended in DPBS, and the cell was attached to a slide glass using by cytospin centrifuge (CS03270047, Hanil, Korea). Diff-Quik staining (ZS1003, Sysmex, Japan) was performed and the cell was observed by optical microscopy (DM1000, Leica, German) to count the number of immunocyte in each test sample.

(173) 5-5. Cytokine Analysis in BALF

(174) The level of IL-1, IL-6, and TNF-a (R&D System, USA) in BALF isolated from the rat was determined by enzyme-linked immuno-sorbent assay (ELISA). The analysis of each cytokine was performed according to the manufacturer's manual, and the absorbance was determined at 450 nm by ELISA leader (340PC384, Molecular Devices, USA).

(175) 5-6. The Determination of the Expression of Immunocytes

(176) (1) Gelatin Zymography

(177) The lung tissue of rat was homogenized with Tissue lysis buffer (C3228, Sigma-Aldrich, USA) treated with a protease inhibitor (11836153001, Roche, Germany) and the homogenized lung tissue was centrifuged at 12000 rpm for 10 mins to isolate the supernatant. The protein assay reagent (500-0006, Bio-Rad, USA) was used to quantification. To determine the activity of MMP-9, sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) containing 1% gelatin (G9382, Sigma-Aldrich, USA) was used in the experiment. The protein was performed to electrophoresis with the dose of 60 g/lane. Zymogram gel was washed with 2.5% Triton X-100 (0694, Amresco, USA), and reacted for 16 hrs at 37 C. using by developing buffer (1M Tris-HCl, pH 7.5 with CaCl.sub.2, T1503, Sigma-Aldrich, USA). After finishing the reaction, zymogram gel was stained using by Coomassie brilliant blue (0472, Amresco, USA) and washed with a destaining buffer {500 ml of Methanol (M1447, Samchun, Korea)+1400 ml of D.W+160 ml of acetic acid (9151, J. T. Baker)}. The density of MMP-9 band was determined using by Chemi-doc (170-8070, Bio-Rad, USA) to determine the activity of MMP-9.

(178) (2) Western Blotting

(179) The protein obtained from homogenization was performed to electrophoresis at the dose of 30 g/lane and transferred using by polyvinylidene difluoride (PVDF) membrane (IPVH00010, Millipore, USA). The membrane (IPVH00010, Millipore, USA) was blocked with 5% skim milk and then reacted with anti-MMP-9 (ab38898, Abcam, UK), anti-p65 (sc-372, Santa Cruz, USA) and anti-p-p65 (sc-33039, Santa Cruz, USA) antibodies. After finishing the reaction, the membrane was washed with TBST (Tris-buffered saline containing 0.05% Tween-20, HT2008, Biosesang, Korea) and reacted with suitable secondary antibody (sc-358914, Santa Cruz, USA) at room temperature for 1 hour. The membrane was washed again with TBST and the band was confirmed by using chemiluminescence kit (34095, Thermo, USA).

(180) 5-7. Histopathological Examination

(181) Delivered lung was promptly fixed with 10% formaldehyde solution (F0161, SAMCHUN, Korea), and cut into slices. The slices were washed with running water for 8 hrs, embedded with epoxy, cut into slices with microtome (CUT4050, MicroTec, Germany) and stained with Hematoxylin (MHS-16, Sigma-Aldrich, USA) & Eosin (HT110-1-32, Sigma-Aldrich, USA). To observe the Histopathological change in lung tissue, the cells were observed by 400 optical microscope (DM1000, Leica, Germany).

(182) 5-8. Statistics

(183) All the result obtained from various experiments was determined using by one-way ANOVA test and the statistical significance between respective group was verified according to Dunnett's multiple comparison test for post hoc comparison result.

(184) 5-9. Test Result

(185) (1) Effect on the Number of Total Immunocyte in BALF

(186) The characteristic increased level of neutrophils was observed in COPD induced group. The drug control group treated with Daxas showed reduced level of neutrophils however it is not remarkable compared with COPD induced group. In a while, the groups treated with ATC2 and verproside showed remarkably reduced level of neutrophils and total immunocytes compared with COPD induced group (FIG. 17A). The reduction was observed in the ratio between the level of neutrophils and total immunocytes. The positive control group treated with Daxas showed similar ratio of the number of neutrophils to that of immunocytes in case of counting 300 immnocytes to COPD induced group whereas the groups treated with ATC2 and verproside showed remarkably reduced ratio of the number of neutrophils (FIG. 17B).

(187) (2) Effect on the Cytokine Release in BALF

(188) In COPD induced group, the level of IL-1, IL-6, and TNF- were sharply increased in BALF. The drug control group treated with Daxas did not show significant reduction in the level of cytokines compared with COPD induced group. In a while, the groups treated with ATC2 and verproside showed significantly reduced level of cytokines compared with COPD induced group, of which level was sharply reduced compared with drug control group treated with Daxas (FIG. 18).

(189) (3) Effect on the Activity of MMP-9 in Lung Tissue

(190) In COPD induced group, the activity of MMP-9, an important mediator involved in inflammation and the degradation of extracellular matrix, was remarkably increased. In a while, the groups treated with ATC2 and verproside showed remarkably reduced activity of MMP-9, of which level was similar to the drug control group treated with Daxas (FIG. 19).

(191) (4) Effect on the Expression of Proinflammatory Protein in Lung Tissue

(192) In COPD induced group, the activity of proinflammatory proteins such as MMP-9 and NF-B, was remarkably increased. However, such increased expression of proinflammatory protein in COPD induced group, was significant decreased in the groups treated with ATC2 and verproside, similarly to the drug control group treated with Daxas (FIG. 20).

(193) (5) Effect on the Inflammation in Lung Tissue

(194) In COPD induced group, there showed the infiltration of many inflammatory cells within bronchus, perivascular tissue and interstitial tissue etc. However, such increased inflammation in COPD induced group, was significant decreased in the groups treated with ATC2 and verproside as well as the drug control group treated with Daxas, the inhibitory effect on inflammation in the groups treated with ATC2 and verproside was more potent than that in the drug control group treated with Daxas (FIG. 21).

(195) At the result, it has been confirmed that ATC2 and the compounds isolated therefrom, verproside etc, have potent treating effect on COPD by way of inhibiting the release of IL-1, IL-6, or TNF-, the activation of NF-B, and the expression of MMP-9, a main cause of COPD. Those treating activity of inventive extract or compounds are confirmed to be similar or more potent than conventionally available COPD treating agent (Daxas).

Experimental Example 6

Acute Toxicity Test of Oral Administration in Rat

(196) The acute toxicity test was performed by administrating inventive extract and compounds to 6-weeks aged SPF Sprague-Dawley rats.

(197) 250 mg/kg, 500 mg/kg, 1000 mg/kg, 5000 mg/kg of inventive extract and compounds was orally administrated to each group consisting of 2 rats and the symptoms of rats were observed for 14 days. After administrating the extract or compounds, all the clinical changes i.e., mortality, clinical signs, body weight changes was observed and blood test such as haematological test and hematological biochemistry test was performed. The abnormal changes of abdominal organ and thoracic organ were observed after autopsy.

(198) There did not show any changes in mortality, clinical signs, body weight changes and gross findings in any group or either gender. Furthermore, there showed any toxicity in test group treated with 5000 mg/kg of inventive extract or compounds.

(199) Accordingly, it has been confirmed that the inventive extract and compounds prepared in the present invention was potent and safe substance showing LD.sub.50 (more than 5000 mg/kg) in oral administration.

MODE FOR INVENTION

(200) Hereinafter, the formulating methods and kinds of excipients will be described, but the present invention is not limited to them. The representative preparation examples were described as follows.

(201) Preparation of Injection

(202) TABLE-US-00006 ATC1 extract 100 mg Sodium metabisulfite 3.0 mg Methyl paraben 0.8 mg Propyl paraben 0.1 mg Distilled water for injection optimum amount

(203) Injection preparation was prepared by dissolving active component, controlling pH to about 7.5 and then filling all the components in 2 ml ample and sterilizing by conventional injection preparation method.

(204) Preparation of Powder

(205) TABLE-US-00007 ATC2 extract 500 mg Corn Starch 100 mg Lactose 100 mg Talc 10 mg

(206) Powder preparation was prepared by mixing above components and filling sealed package.

(207) Preparation of Tablet

(208) TABLE-US-00008 verproside 200 mg Corn Starch 100 mg Lactose 100 mg Magnesium stearate optimum amount

(209) Tablet preparation was prepared by mixing above components and entabletting.

(210) Preparation of Capsule

(211) TABLE-US-00009 veratric acid 100 mg Lactose 50 mg Corn starch 50 mg Talc 2 mg Magnesium stearate optimum amount

(212) Tablet preparation was prepared by mixing above components and filling gelatin capsule by conventional gelatin preparation method.

(213) Preparation of Liquid

(214) TABLE-US-00010 catalposide 1000 mg Sugar 20 g Polysaccharide 20 g Lemon flavor 20 g

(215) Liquid preparation was prepared by dissolving active component, and then filling all the components in 1000 Ml ample and sterilizing by conventional liquid preparation method.

(216) Preparation of Health Food

(217) TABLE-US-00011 ATC2 extract 1000 mg Vitamin mixture optimum amount Vitamin A acetate 70 g Vitamin E 1.0 mg Vitamin B.sub.10. 13 mg Vitamin B.sub.2 0.15 mg Vitamin B6 0.5 mg Vitamin B1 20.2 g Vitamin C 10 mg Biotin 10 g Amide nicotinic acid 1.7 mg Folic acid 50 g Calcium pantothenic acid 0.5 mg Mineral mixture optimum amount Ferrous sulfate 1.75 mg Zinc oxide 0.82 mg Magnesium carbonate 25.3 mg Monopotassium phosphate 15 mg Dicalcium phosphate 55 mg Potassium citrate 90 mg Calcium carbonate 100 mg Magnesium chloride 24.8 mg

(218) The above mentioned vitamin and mineral mixture may be varied in many ways. Such variations are not to be regarded as a departure from the spirit and scope of the present invention.

(219) Preparation of Health Beverage

(220) TABLE-US-00012 6-O-veratroyl catalpol 1000 mg Citric acid 1000 mg Oligosaccharide 100 g Apricot concentration 2 g Taurine 1 g Distilled water 900 ml

(221) Health beverage preparation was prepared by dissolving active component, mixing, stirred at 85 C. for 1 hour, filtered and then filling all the components in 1000 ml ample and sterilizing by conventional health beverage preparation method.

(222) The invention being thus described, it will be obvious that the same may be varied in many ways. Such variations are not to be regarded as a departure from the spirit and scope of the present invention, and all such modifications as would be obvious to one skilled in the art are intended to be included within the scope of the following claims.

INDUSTRIAL APPLICABILITY

(223) As described in the present invention, inventive purified extract containing abundant active ingredients such as catalpol derivatives from the extract of Pseudolysimachion rotundum var subintegrum or at least one compounds selected from the group consisting of veratric acid, verproside, catalposide, picroside II, isovanilloyl catalpol and 6-O-veratroyl catalpol showed potent anti-COPD activity without beta-2-receptor agonistic response through various in vivo tests using by BALB/c male mice, for example, an inhibition test on the proliferation and activity of inflammatory immunocytes and neutrophils recruiting to lung caused by COPD occurrence; an inhibition test on the reproduction of chemokines involved in the destruction of pneumocyte, such as MIP-2/CXCL-2, TNF-alpha, KC/CXCL-1 (Chemokines Gro-alpha) and CXCL-8 etc; the reducing effect on the release of IL-1beta, IL-6, TNF-alpha and MMP-9 expression by decreasing NF-kappaB activation in animal test using by SPF (specific pathogen-free) Sprague-Dawley rat, as well as in vitro test, for example, an inhibition test on the expression of MUC5AC (oligomeric muscus/gel-forming), inducing effect on the IL-4-expression of Th2 cell in molecular expression profiling change test etc. Therefore, it can be used as the therapeutics or functional health food for treating and preventing chronic obstructive pulmonary disease (COPD). preventing chronic obstructive pulmonary disease (COPD).